Application of cszat10 protein and its coding gene in regulating endogenous abscisic acid and sugar content in citrus plants

Abstract

The application provides application of CsZAT10 protein and a coding gene thereof in regulation of endogenous abscisic acid and sugar content of citrus plants, and belongs to the technical field of plant genetic engineering. The amino acid sequence of the CsZAT10 protein is shown as SEQ ID No. 4. Through gene cloning, subcellular localization, transient transformation and stable transformation experiments, it is found that up-regulation of the content of CsZAT10 protein in the citrus plants can increase the endogenous abscisic acid and sugar content of the citrus plants; and reduction of the content of CsZAT10 protein in the citrus plants can reduce the endogenous abscisic acid and sugar content of the citrus plants. The CsZAT10 protein has the function of regulating the endogenous abscisic acid and sugar content of the citrus plants, and provides more choices for breeding and large-scale production of citrus crops.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the CsZAT10 protein and its encoding gene in regulating the endogenous abscisic acid and sugar content in citrus plants. Background Technology

[0002] Abscisic acid (ABA) is a sesquiterpene endogenous plant hormone that plays a crucial role in regulating plant growth and development (such as seed dormancy and germination, and stomatal closure regulation) and in responding to biotic and abiotic stresses. Optimal ABA levels within plants are essential for their physiological processes: moderately elevated ABA levels promote fruit ripening and coloring, induce seed dormancy, enhance stomatal closure to reduce water transpiration, and significantly improve plant tolerance to adverse conditions such as drought, low temperature, high salinity, and pathogen infection. Conversely, excessively low ABA levels may lead to delayed fruit ripening, poor coloring, premature seed germination (spike germination), and sluggish stomatal response to drought signals, thus significantly reducing the plant's resistance to drought, chilling injury, and other stresses, making it more susceptible to disease. Therefore, the level of endogenous ABA not only directly affects the initiation of fruit ripening, the coloring process, and postharvest storage performance, but is also closely related to the plant's ability to cope with adverse stresses such as drought and low temperature.

[0003] Currently, regulating plant ABA levels in agricultural production mainly relies on exogenous application of abscisic acid-based plant growth regulators. However, exogenous application of plant hormones has drawbacks, including high cost, effectiveness limited by environmental conditions (such as rainfall and temperature), susceptibility to photodegradation or metabolic inactivation, and potential residue risks. Therefore, in the long run, utilizing genetic engineering technology to regulate the plant's own ABA biosynthesis through endogenous pathways, achieving molecular-level regulation of endogenous ABA content, has significant scientific and practical value for improving crop agronomic traits, enhancing fruit quality, and strengthening stress resistance. It represents a more efficient, stable, and environmentally friendly alternative strategy.

[0004] Citrus fruits are typical non-climacteric fruits, and ABA is considered one of the most important plant hormones regulating their ripening. As the fruit develops and ripens, the amount of free ABA in the peel and pulp of citrus fruits continuously increases. ABA also participates in regulating abiotic stress responses in citrus fruits, such as salt tolerance, heat tolerance, cold tolerance, drought tolerance, and waterlogging tolerance, as well as biotic stress responses to fungi such as Penicillium finger-like mold, citrus canker fungus, Phytophthora parasitica, Huanglongbing fungus, and its vector, the citrus psyllid. However, major cultivated citrus varieties still generally suffer from concentrated ripening periods and unstable endogenous hormone levels. Therefore, discovering functional genes that regulate ABA content from the genetic resources of Citrus plants themselves not only helps to deepen the understanding of the molecular basis of citrus fruit development but also provides valuable genetic resources for molecular design breeding of Citrus and closely related species. Summary of the Invention

[0005] To address the aforementioned issues, this invention provides an application of the CsZAT10 protein and its encoding gene in regulating the endogenous abscisic acid and sugar content in citrus plants. By regulating the content of the CsZAT10 protein in citrus plants, the aim of regulating the endogenous abscisic acid and sugar content in citrus plants can be achieved.

[0006] Specifically, the first objective of this invention is to provide the application of CsZAT10 protein in regulating the content of endogenous abscisic acid and sugar in citrus plants. This application is achieved by upregulating the content of CsZAT10 protein in citrus plants, thereby increasing the content of endogenous abscisic acid and sugar; or by downregulating the content of CsZAT10 protein in citrus plants, thereby decreasing the content of endogenous abscisic acid and sugar. The amino acid sequence of the CsZAT10 protein is shown in SEQ ID No. 4.

[0007] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0008] A second objective of this invention is to provide the application of a gene encoding the CsZAT10 protein in regulating the endogenous abscisic acid and sugar content in citrus plants. This application involves increasing the endogenous abscisic acid and sugar content in citrus plants by overexpressing the gene encoding the CsZAT10 protein; or decreasing the endogenous abscisic acid and sugar content in citrus plants by interfering with the expression of the gene encoding the CsZAT10 protein. The amino acid sequence of the CsZAT10 protein encoded by the gene encoding the CsZAT10 protein is shown in SEQ ID No. 4.

[0009] In a preferred embodiment, the nucleotide sequence of the gene encoding the CsZAT10 protein is shown in SEQ ID No. 3.

[0010] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0011] A third objective of this invention is to provide the application of biomaterials that enhance gene expression in promoting the accumulation of endogenous abscisic acid and sugars in citrus plants. This application involves overexpressing the gene encoding the CsZAT10 protein in citrus plants using the biomaterials, thereby increasing the content of endogenous abscisic acid and sugars in citrus plants. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 4. The biomaterials are at least one of the following: (1) A nucleic acid molecule, wherein the amino acid sequence of the protein encoded by the nucleic acid molecule is shown in SEQ ID No. 4; (2) An expression cassette containing the nucleic acid molecule described in (1) and subjecting the nucleic acid molecule to overexpression; (3) an overexpression vector containing the nucleic acid molecule described in (1) and / or the expression cassette described in (2); (4) A host cell containing the expression cassette or the overexpression vector, or the host cell having the nucleic acid molecule described in (1) integrated into its genome; (5) A transgenic plant cell line containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (6) A transgenic plant tissue, wherein the transgenic plant tissue contains the nucleic acid molecule described in (1) or the expression cassette described in (2); (7) A transgenic plant organ containing the nucleic acid molecule described in (1) or the expression cassette described in (2).

[0012] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0013] A fourth objective of this invention is to provide the application of a biomaterial that reduces gene expression levels in reducing the content of endogenous abscisic acid and sugars in citrus plants. This application is achieved by interfering with the expression of the gene encoding the CsZAT10 protein, thereby reducing the content of endogenous abscisic acid and sugars in citrus plants. The amino acid sequence of the CsZAT10 protein is shown in SEQ ID No. 4. The biomaterial is at least one of the following materials: (a) An RNA interference molecule that targets the gene encoding the protein with the amino acid sequence shown in SEQ ID No. 4, thereby silencing the gene encoding the CsZAT10 protein; (b) An expression cassette containing the RNA interference molecule described in (a); (c) A recombinant vector containing the RNA interference molecule described in (a) or the expression cassette described in (b); (d) A recombinant microorganism containing the RNA interference molecule described in (a), the expression cassette described in (b), or the recombinant vector described in (c); (e) A transgenic plant cell line containing the RNA interference molecule described in (a) or the expression cassette described in (b); (f) Transgenic plant tissue containing the RNA interference molecule described in (a) or the expression cassette described in (b); (g) A transgenic plant organ containing the RNA interference molecule described in (a) or the expression cassette described in (b).

[0014] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0015] The fifth objective of this invention is to provide a method for promoting the accumulation of endogenous abscisic acid and sugars in citrus plants, comprising the following steps: constructing an overexpression vector, and introducing the overexpression vector into citrus plants using Agrobacterium-mediated transformation; wherein the overexpression vector contains a gene encoding the CsZAT10 protein, and the amino acid sequence of the CsZAT10 protein is shown in SEQ ID No. 4.

[0016] In a preferred embodiment, the Agrobacterium is GV3101 or EHA105.

[0017] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0018] The sixth objective of this invention is to provide a method for reducing the endogenous abscisic acid and sugar content in citrus plants, comprising the following steps: constructing a recombinant vector and introducing the recombinant vector into citrus plants using Agrobacterium-mediated transformation; wherein the recombinant vector contains the RNA interference molecule described in the fourth objective.

[0019] In a preferred embodiment, the Agrobacterium is GV3101 or EHA105.

[0020] In a preferred embodiment, the citrus plant is kumquat or / and mandarin orange.

[0021] A seventh objective of the present invention is to provide a transgenic citrus plant that overexpresses the gene encoding the CsZAT10 protein; or the gene encoding the CsZAT10 protein in the transgenic citrus plant is silenced; the amino acid sequence of the CsZAT10 protein encoded by the gene encoding the CsZAT10 protein is shown in SEQ ID No. 4.

[0022] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention cloned the CsZAT10 gene from the citrus fruit *Citrus aurantium*. Genetic transformation experiments confirmed that overexpression of this gene significantly increased the accumulation of endogenous abscisic acid (ABA) and sugars in citrus plants, while RNAi-mediated silencing of the gene significantly reduced the content of ABA and sugars. This function of the CsZAT10 gene was repeatedly verified across different citrus materials and species, effectively eliminating interference from non-specific effects and ensuring the determinacy and reliability of gene function. Therefore, the technical solution of this invention provides more gene options for the endogenous regulation of hormone levels in citrus plants and for crop breeding. Attached Figure Description

[0023] Figure 1 The CsZAT10 protein in Example 2 of this invention is from tobacco (Nicotiana spp.) Nicotiana benthamianaFigure 1 shows the results of subcellular localization analysis in the leaf. Figure 2 Figure 3 shows the results of measuring the ZAT10 gene expression level (Figure (a)), ABA content (Figure (b)), and sugar content (Figures (c) to (e)) of kumquat fruits in the transient transformation of the present invention. Figure 3 The figures show the results of measuring the ZAT10 gene expression level (Figure (a) and (d), ABA content (Figure (b) and (e)) and sugar content (Figure (c) and (f)) of the stably transformed citrus callus in Example 4 of this invention. Figure 4 The vector spectrum of the pRI101-YFP vector used in Example 2 of this invention; Figure 5 The vector spectrum of the pENTR1A-3xflag vector used in Example 3 of this invention; Figure 6 The vector spectrum of the pK7WG2D vector used in Embodiment 3 of the present invention; Figure 7 The vector spectrum of the pDONR221 vector used in Embodiment 3 of the present invention; Figure 8 This is the carrier spectrum of pK7GWIWG2D(II) used in Example 3 of the present invention. Detailed Implementation

[0024] The following description, in conjunction with embodiments, clearly and completely describes the technical solutions of this application, so that those skilled in the art can fully understand this application. Obviously, the described embodiments are merely some preferred embodiments of this application, and not all embodiments. Any equivalent modifications or substitutions made by those skilled in the art to the following embodiments without creative effort are within the protection scope of this application.

[0025] Example 1: Isolation, cloning, amplification, and sequence analysis of the CsZAT10 gene In this embodiment, the full-length coding sequence of the CsZAT10 gene was successfully cloned by PCR amplification using cDNA from Qingjia navel orange pulp as a template. The CDS sequence of this gene contains 735 base pairs and encodes a protein composed of 244 amino acid residues. The specific operational steps are as follows: (1) Using the pulp tissue of Qingjia navel oranges 150 days after flowering as material, total RNA was extracted from all samples using the EASYspin Plus RNA Extraction Kit (Aidlab Biotech, Beijing). After removing genomic DNA, cDNA was synthesized using the EasyScriptOne-Step gDNA Removal Kit and cDNA Synthesis SuperMix (Beijing TransGen Biotechnology Co., Ltd.); the reagents provided with the kit were used and the operation was carried out according to the kit instructions.

[0026] (2) Based on the sequence information in the Citrus Genome Database (CPBD: http: / / citrus.hzau.edu.cn / seqFetch / query.php), specific amplification primers were designed. The forward primer sequence (SEQ ID No.1) was 5'-atggcactggaagctctcaact-3', and the reverse primer sequence (SEQ ID No.2) was 5'-ttaaacttcgattttggggggca-3'.

[0027] (3) Using cDNA as a template, PCR amplification was performed using high-fidelity DNA polymerase. The PCR reaction system (total volume 20 μL) consisted of: 200 μmol / L cDNA 2 μL, 10 μmol / L forward primer 1 μL, 10 μmol / L reverse primer 1 μL, 2×PhantaUltraMaster Mix (Novizan) 10 μL, and ddH2O 6 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0028] (4) After the PCR amplification products were detected by 1% agarose gel electrophoresis, the gel was cut and recovered, and the target band was purified using a DNA gel rapid purification kit (Beijing TransGen Biotech Co., Ltd.).

[0029] (5) Connect the purified product to pEASY ® -Blunt cloning vector (Beijing TransGen Biotech Co., Ltd.), ligation reaction system: 4 μL of PCR purified product, pEASY ® Add 1 μL of Blunt cloning vector to sterile water to a final volume of 10 μL (or follow the kit's recommended ratio), and mix gently. Incubate at 25°C for 15 min (or 5-30 min at 25°C according to the kit instructions). After the reaction, place the centrifuge tube on ice for subsequent transformation.

[0030] (6) The ligation product was transformed into E. coli DH5α competent cells by chemical transformation. The specific operation was as follows: 30 μL of DH5α competent cells were added to the ligation product and placed on ice for 30 min, heat-shocked at 42℃ for 30 s, and then placed on ice for 2 min. The bacterial culture was evenly spread on LB medium containing 100 mg / L kanamycin (the main components are as follows: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L, agar 15 g / L), and cultured at 37℃ until colonies grew. Positive single colonies were selected for PCR identification. The PCR amplification primers, reaction system, reaction conditions, and product detection were the same as in steps (2) to (4). Positive clones with correct PCR product gel electrophoresis bands were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared and analyzed by SnapGene software, and the full-length coding sequence of the CsZAT10 gene was confirmed. The nucleotide sequence of the gene is shown in SEQ ID No. 3, and the amino acid sequence it encodes is shown in SEQ ID No. 4.

[0031] Nucleotide sequence of CsZAT10 gene (SEQ ID No.3): atggcactggaagctctcaactctccaactacttcgacgccgccgtttcacttcgaagaagctaatcttcactgccttgagccatggaccaaacgcaagcgctcaaagcgtccacacaatcctccaactgaagaagagtatctcgcgctctgcctcgtcatgcttgcacgtggcacaacctccaccgccgtcttaactaactgcaacacgaccaccgccgcctcacagcgacagaagtctcctgctctatctactgctgcaacgacgtcgtcctctgaccagaagcttctcttcaagtgcagcgtgtgcgacaaggcgttttcttcttaccaagccttgggtggtcacaaggccagccaccgtaagggatctgggggcggcgatgaacactccgcatccactaccaccaacaccaacgcaaccgccacgaccaccggcgtaccgaacgccactggtaggacccacgagtgttccatctgtcacaagtccttccccactggccaagccttgggcggacacaaacgttgtcactacgatggcggcgagaagagcggagtgacgtcatccggatccagtagcactcacagccaagtcagccaccgtgactttgacctcaacctccctgtcttaccggagctctcccctgctttcttcgtctccggtgatgacgaggtggagagtccactgccggcgaagaagccccgtcttttcttgccccccaaaatcgaagtttaa.

[0032] The amino acid sequence of the protein encoded by the CsZAT10 gene (SEQ ID No. 4): MALEALNSPTTSTPPFHFEEANLHCLEPWTKRKRSKRPHNPPTEEEYLALCLVMLARGTTSTAVLTNCNTTTAASQRQKSPALSTAATTSSSDQKLLFKCSVCDKAFSSYQALGGHKASHRKGSGGGDEHSASTTTNTNATATTTGVPNATGRTHECSICHKSFPTGQALGGHKRCHYDGGEKSGVTSSGSSSTHSQVSHRDFDLNLPVLPELSPAFFVSGDDEVESPLPAKKPRLFLPPKIEV.

[0033] Example 2: Subcellular localization analysis of CsZAT10 protein This embodiment constructs a fusion expression vector encoding the CsZAT10 gene and the yellow fluorescent protein gene to analyze the subcellular localization of the CsZAT10 protein as a transcription factor. The specific procedures are as follows: (1) Based on the nucleotide sequence of the CsZAT10 gene and the vector map of the pRI101-YFP vector (see... Figure 4 The stop codon of the CsZAT10 gene was removed, and EcoRI and BamHI restriction sites were added to both ends of the gene, respectively. Specific primers without the stop codon were designed. PCR amplification was performed using the CsZAT10 gene without the stop codon as a template. The PCR reaction system was as follows: 200 μmol / L cDNA 2 μL, 10 μmol / L forward primer 1 μL, 10 μmol / L reverse primer 1 μL, 2×PhantaUltraMaster Mix 10 μL (Novizan), ddH2O 6 μL. The PCR reaction conditions were as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles; final extension at 72℃ for 5 minutes. The specific primer sequence (SEQ ID No. 5) without a stop codon is as follows: 5'-atgggatctactagtgaattcATGGCACTGGAAGCTCTCAACT-3'; the reverse primer sequence (SEQ ID No. 6) is as follows: 5'-gggggtaccgtcgacggatccAACTTCGATTTTGGGGGGCAAG-3'.

[0034] (2) After recovering the amplification product, insert it between the EcoRI and BamHI restriction sites of the pRI101-YFP vector using the homologous recombination kit C117 (Novizan), so that the 3' end of the CsZAT10 gene nucleotide sequence is fused with the 5' end of the pRI101-YFP vector nucleotide sequence. The expression of the fusion gene is driven by the CaMV35S promoter, and the recombinant plasmid 35S::CsZAT10-YFP is constructed.

[0035] (3) Using the empty vector 35S::YFP without the CsZAT10 gene as a control, and preparing the nuclear localization marker plasmid mCherry-VirD2NLS (https: / / abrc.osu.edu / stocks / number / CD3-1106), the recombinant plasmid 35S::CsZAT10-YFP, the empty vector 35S::YFP, and the nuclear localization marker plasmid mCherry-VirD2NLS were transformed into Agrobacterium GV3101 competent cells, respectively. The specific operation was as follows: 3 μL of the recombinant plasmid was added to 10 μL of GV3101 competent cells, placed on ice for 10 min, placed in liquid nitrogen for 2 min, incubated at 37℃ for 3 min, and then placed on ice for 2 min. The bacterial culture was then evenly spread on LB medium containing 100 mg / L kanamycin. The culture was continued until the bacterial culture reached OD. 600nm It is 0.5.

[0036] (4) An equal volume of bacterial suspension containing recombinant plasmid 35S::CsZAT10-YFP and bacterial suspension containing nuclear localization marker plasmid mCherry-VirD2NLS was mixed and injected into the lower epidermis of Nicotiana benthamiana leaves. Forty-eight hours after injection, the lower epidermis of the leaves was peeled off and slides were prepared. The distribution of fluorescence signals was observed under a laser confocal microscope. The results are as follows: Figure 1 As shown. Figure 1The image above shows the empty vector (EV) of the control group, CsZAT10 representing transient expression of the CsZAT10-YFP fusion protein in tobacco leaf epidermal cells, mCherry-VirD2NLS representing the nuclear colocalization marker used to indicate the cell nucleus, Bright representing the bright-field image, and Merged representing the fusion image of YFP, mCherry-VirD2NLS, and Bright. As can be seen from the image, the yellow fluorescence of the control group empty vector 35S::YFP is diffusely distributed throughout the entire cell, including the cytoplasm and nucleus; while the yellow fluorescence of the experimental group recombinant plasmid 35S::CsZAT10-YFP is concentrated only in the nuclear region, completely overlapping with the red fluorescence of the nuclear colocalization marker plasmid mCherry-VirD2NLS, showing a yellow colocalization signal. This result clearly confirms that the CsZAT10 protein is located in the cell nucleus, which is completely consistent with its functional location as a transcriptional regulator.

[0037] Example 3: Transient transformation of ABA and sugar content in kumquat fruit verification To investigate the function of the CsZAT10 gene in regulating abscisic acid (ABA) and sugar accumulation, this example uses kumquat (Fortunella crassifolia Swingle) fruit as material for a transient transformation experiment.

[0038] 3.1 Construction of CsZAT10 gene overexpression vector and CsZAT10 gene silencing vector 3.1.1 Using the cDNA of "Qingjia" navel orange (extracted according to step (1) of Example 1) as a template, the CDS sequence of CsZAT10 was obtained by PCR amplification (according to steps (2) to (4) of Example 1).

[0039] 3.1.2 Construction of overexpression vector: The CDS sequence of CsZAT10 obtained in 3.1.1 was cloned into pENTR1A-3xflag digested with SalI / KpnI (vector map shown). Figure 5 In the cloning primer sequence (SEQ ID No. 7), the forward primer sequence (5'-aaaggaaccaattcagtcgacATGGCACTGGAAGCTCTCAACT-3' and the reverse primer sequence (SEQ ID No. 8) are as follows: 5'-tggaaaagggaattcggtaccAACTTCGATTTTGGGGGGCAAG-3'. Then, using LRClonase™ enzyme (ThermoFisher, catalog number 11791043, USA), the target fragment was introduced into the pK7WG2D vector via Gateway recombination reaction (vector map shown in [link]). Figure 6), thus obtaining the overexpression vector OE.

[0040] 3.1.3 Construction of RNA interference (RNAi) vector: Using the cDNA obtained in 3.1.1 as a template, a fragment of the CDS sequence of the CsZAT10 gene was amplified using specific primers with attB adapters. The forward primer sequence (SEQ ID No. 9) with attB adapters is as follows: 5'-ggggacaagtttgtacaaaaaagcaggcttcATGGCACTGGAAGCTCTCAACT-3', and the reverse primer sequence (SEQ ID No. 10) is as follows: 5'-ggggaccactttgtacaagaaagctgggtcGGATTGTGTGGACGCTTTGAGC-3'. The lowercase letters are the attB1 and attB2 recombinant adapter sequences, and the uppercase letters are the CsZAT10 specific sequences. The PCR reaction system and reaction conditions were carried out according to step (3) of Example 1. The amplified product was detected by 1% agarose gel electrophoresis and then purified by gel extraction (operation is the same as step (4) of Example 1).

[0041] The purified interference fragment with the attB linker was combined with the pDONR221 donor vector and subjected to a BP recombination reaction using BP Clonase™ II enzyme (ThermoFisher, catalog number 11789021, USA) according to the kit instructions (incubation at 25°C for 5 h). The interference fragment was directionally inserted into the pDONR221 vector via attB×attP recombination (vector pattern shown in [link]). Figure 7 Transformed into Escherichia coli DH5α, screened for kanamycin resistance, and verified by colony PCR and sequencing to obtain an entry clone containing the CsZAT10 interference fragment.

[0042] The above introductory clone was then combined with the hairpin RNAi target vector pK7GWIWG2D(II) (vector map shown). Figure 8 The LR Clonase™ II enzyme (ThermoFisher, catalog number 11791043, USA) was used to perform the LR recombination reaction according to the kit instructions (incubated at 25°C for 5 h). After attL×attR recombination, the interference fragment was inserted into two recombination sites separated by introns in pK7GWIWG2D(II) in both the forward and reverse directions, and transcribed into hairpin double-stranded RNA under the drive of the CaMV 35S promoter. After transformation into E. coli, the RNA interference vector of CsZAT10 was selected with spectinomycin resistance and confirmed to be correct by enzyme digestion and sequencing (denoted as 35S::CsZAT10-RNAi).

[0043] 3.2 Transformation of the vector into Agrobacterium The constructed vectors (overexpression vector OE, RNAi vector, and empty vector) were transformed into Agrobacterium tumefaciens strain EHA105 (Shanghai Weidi Biotechnology Co., Ltd.). The specific procedures were as follows: 3 μL of recombinant plasmid was added to 10 μL of EHA105 competent cells, placed on ice for 10 min, incubated in liquid nitrogen for 2 min, at 37°C for 3 min, and then placed on ice for 2 min. The bacterial culture was then evenly spread on LB medium containing 100 mg / L spectinomycin. The culture was continued until the bacterial culture reached OD500. 600nm It is 0.5.

[0044] 3.3 Infection of kumquat fruit When used for transient infection of fruits, the transformed Agrobacterium EHA105 is cultured to OD600. nm =0.8, then resuspended to OD using infection buffer (0.05M 2-morpholinoethanesulfonic acid (MES) buffer, 2 mM Na3PO4, 0.5% D-glucose, 0.1 mM acetylsuccinone). 600nm =0.4, and then injected into the opposite sides of the equatorial part of the kumquat fruit (30 fruits per group).

[0045] 3.4. Detection of CsZAT10 gene expression level, abscisic acid content, and sugar content. 3.4.1 Detection of CsZAT10 gene expression level After 5 days of dark incubation, total RNA was extracted from all samples using a kit (Adley Biotech, Beijing, China). Genomic DNA was removed and cDNA was synthesized using a reverse transcription kit (TransGen Biotech, Beijing, China). The cDNA obtained from reverse transcription was diluted 1:6 by volume and qRT-PCR was performed using 2×ChamQ Universal SYBR qPCR Master Mix (Novizan Biotechnology Co., Ltd., Nanjing), with four replicates per sample. The nucleotide sequence (SEQ ID No. 11) of the forward primer qRT-PCR-F for PCR amplification is: ccaactgaagaagagtatctcgc; the nucleotide sequence (SEQ ID No. 12) of the reverse primer qRT-PCR-R is: gaagagaagcttctggtcagag. The PCR reaction mixture consisted of: 5 μL of 2×ChamQ UniversalSYBR qPCR Master Mix, 0.5 μL of 10 μmol / L forward primer, 0.5 μL of 10 μmol / L reverse primer, 1 μL of cDNA, and 3 μL of ddH2O. Real-time quantitative PCR (RT-qPCR) was performed on a Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The PCR amplification program was: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 30 s, for 40 cycles. The melting curve analysis program was: 95℃ for 15 s, 60℃ for 1 min, and 95℃ for 15 s. 2 -ΔΔCT Method (Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔCT The relative expression levels of gene transcription were calculated using the method (DOI: https: / / doi.org / 10.1006 / meth.2001.1262). The citrus Actin gene was used as an internal control.

[0046] 3.4.2 ABA Content Analysis The abscisic acid content in kumquat fruit was determined by LC-MS (liquid chromatography-mass spectrometry). The specific procedure was as follows: 0.5 g of frozen kumquat juice sac powder was mixed with 1.5 mL of 80% methanol containing 1 mmol / L BHT (2,6-di-tert-butyl-p-cresol), sonicated for 20 minutes, incubated overnight at -20°C, and then centrifuged at 4°C. The supernatant was dried under vacuum (400 Pa, 24°C) for 2.5 hours, redissolved in 700 µL of phosphate buffer (0.4 M, pH 8.0), and washed three times with petroleum ether. The aqueous phase was treated with 20 µL of 2 M NaOH and 80 mg of PVP-P (cross-linked polyvinylpyrrolidone), vortexed, and centrifuged. The pH was adjusted to 2.0–3.0 with formic acid, and then extracted three times with 700 µL of ethyl acetate. The organic phases were combined and evaporated to dryness, and the residue was redissolved in 0.5 mL of methanol. ABA content was determined using an HPLC-MS / MS system (Shimadzu20ADXR-8040) equipped with a C18 column. Mobile phase A was an aqueous solution containing 5 mmol / L ammonium formate and 0.05% (v / v) formic acid, and mobile phase B was methanol. Gradient elution was used, and the elution program is shown in Table 1. The chromatographic column was a Shim-pack XR-ODS II, 2.0 × 100 mm, 2.2 μm; the column temperature was 50 °C, the injection volume was 10 µL, and the flow rate was 0.3 mL / min. Detection was performed in negative ion multiple reaction monitoring mode. The ion source was ESI (electrospray ionization); the ion source interface voltage was -3.5 kV; m / z 153.20 (quantitative), m / z 219.25 (qualitative); the nebulizing gas was nitrogen, 3.0 L / min; the drying gas was nitrogen, 15 L / min; the collision gas was argon; the desolvation tube temperature was 300℃, the heating module temperature was 500℃, the residence time was 20 ms, and the delay time was 3 ms. A five-point standard curve (400 ng / mL, 100 ng / mL, 25 ng / mL, 6.25 ng / mL, 1.5625 ng / mL) was established using ABA standard (Beijing Solarbio Science & Technology Co., Ltd.) for quantification. Three biological replicates and three technical replicates were set up for each sample.

[0047] Table 1. Mobile phase elution procedure for abscisic acid content determination

[0048] 3.4.3 Sugar content analysis The sugar content in kumquat fruit was determined using a gas chromatography method. The specific procedure was as follows: A frozen sample (0.2 g) ground in liquid nitrogen was mixed with 1.4 mL of 75% (v / v) methanol and 100 µL of ribitol (1.2 mg / mL). The mixture was incubated at 70 °C with shaking for 30 min, followed by centrifugation at 12000 rpm for 10 min. 750 µL of the supernatant was collected, and 750 µL of water and 400 µL of chloroform were added. After mixing, the mixture was centrifuged at 6000 rpm for 5 min. The upper aqueous phase (200 µL) was collected and concentrated by rotary evaporation under vacuum. The residue was redissolved in 40 µL of a pyridine solution containing 20 mg / mL methoxyamine hydrochloride and incubated at 37 °C for 2 h. Then, 60 µL of MSTFA (N-methyl-N-(trimethylsilane)trifluoroacetamide) was added, and the mixture was incubated at 37 °C for another 30 min. Quantification was performed using a gas chromatograph (GC9720Plus, Fuli Instruments, Zhejiang, China). Three biological replicates (independent plant samples) were set up, and each biological replicate contained three technical replicates.

[0049] 3.5 Analysis of Experimental Results Results of gene expression levels, abscisic acid content, and sugar content detection are shown below. Figure 2 . Figure 2 EV indicates an empty vector, and the gray bars in the figure represent the results of empty vectors; OE indicates overexpression; Ri indicates RNA interference; the suffixes "-1" and "-2" represent two independent strains. This indicates that P < 0.05. This indicates that P < 0.01; P < 0.001. The results showed that the ABA content in the juice vesicles of kumquats overexpressing the CsZAT10 gene was 1.3–1.4 times higher than the control group, and the sugar content was also significantly increased. Conversely, the ABA content in the juice vesicles of kumquats treated with RNAi silencing was 30%–40% lower than the control group, and the overall sugar content also decreased accordingly. These results indicate that overexpression of the CsZAT10 gene in plants promotes ABA and sugar accumulation, while silencing the CsZAT10 gene in plants reduces abscisic acid and sugar content. Therefore, the CsZAT10 gene has great potential as a Citrus gene resource for regulating endogenous ABA levels and thus increasing sugar content.

[0050] Example 4: Verification of Stable Genetic Transformation of Citrus Callus and Changes in ABA and Sugar Content To further investigate the function of the CsZAT10 gene and obtain transgenic material that can be preserved for a long time, this embodiment utilizes a citrus callus system for stable genetic transformation. Embryogenic callus from the "Guoqing No. 1" citrus variety used for genetic transformation was inoculated onto MT medium and cultured in the dark at 24°C for three weeks.

[0051] 4.1. Infecting citrus callus tissue with bacterial solution and conducting resistance screening. The transformed recombinant Agrobacterium was obtained using the same method as in steps 3.1 and 3.2 of Example 3. The Agrobacterium was then cultured at 28°C until OD... 600nm The bacterial concentration was 0.8. After centrifugation at 3000g, the bacterial suspension was resuspended in MT liquid medium containing 50 μM acetylsyleugenol (main components: MT medium (Murashige and Tucker Medium) 4.43 g / L, sucrose 40 g / L). The resuspended Agrobacterium suspension was mixed with the callus and vacuum infiltrated for 15 minutes, followed by shaking incubation at 28°C for 10 minutes. The infiltrated callus was co-cultured with Agrobacterium for 2 days, and then washed three times with sterile water. The callus samples were transferred to MT medium supplemented with 40 g / L sucrose, 300 mg / L timentin, and 50 mg / L kanamycin, and cultured for 4–8 weeks until positive callus growth and stability. These positive transgenic callus lines were then used in subsequent experiments. The positive callus was subcultured into multiple lines, each line divided into three culture flasks as three technical replicates.

[0052] 4.2 RT-qPCR was used to detect the expression level of the target gene and to determine the endogenous ABA and sugar content. The expression level of the target gene was detected by RT-qPCR (the measurement method is the same as in step 3.4.1 of Example 3), and the endogenous ABA and sugar content were measured (the measurement method is the same as in step 3.4.2 of Example 3).

[0053] The measurement results are as follows Figure 3 As shown. Figure 3 EV indicates an empty vector; Z10 is short for ZAT10; OE indicates overexpression; Ri indicates RNA interference; the suffix numbers "1" and "2" represent two independent strains. This indicates that P < 0.01; P < 0.001. The results showed that the endogenous ABA content in callus lines overexpressing the CsZAT10 gene increased by 2.2–2.7 times, and the sugar content was significantly increased. In contrast, the endogenous ABA content in lines silenced by RNAi interference decreased by approximately 40%, and the sugar content was significantly reduced. The stable transformation results of the callus tissue were completely consistent with the transient transformation results of kumquat, further confirming that CsZAT10 gene overexpression can promote the accumulation of endogenous ABA and sugar in plants.

[0054] In summary, this application systematically and rigorously demonstrates, from four aspects—gene cloning, subcellular localization, transient transformation to stable transformation—that the CsZAT10 gene overexpression has the biological function of promoting the accumulation of endogenous ABA and increasing sugar content in plants. This lays a solid theoretical foundation and provides sufficient technical support for its practical application in crop hormone metabolism regulation and genetic improvement.

[0055] The embodiments described above are merely preferred embodiments of this application and are not intended to limit the scope of protection of this application. Various modifications and variations can be made to this application by anyone skilled in the art. Any simple equivalent changes and modifications made based on the scope of protection claimed in this application and the content of the specification should be included within the scope of protection of this application.

Claims

1. The application of CsZAT10 protein in regulating endogenous abscisic acid and sugar content in citrus plants, characterized by, The content of CsZAT10 protein in citrus plants is increased, and the content of endogenous abscisic acid and sugar in citrus plants is increased; or the content of CsZAT10 protein in citrus plants is decreased, and the content of endogenous abscisic acid and sugar in citrus plants is decreased; the amino acid sequence of the CsZAT10 protein is shown in SEQ ID No.

4.

2. The application of the gene encoding the CsZAT10 protein in regulating the endogenous abscisic acid and sugar content in citrus plants, characterized by, Overexpression of the gene encoding the CsZAT10 protein in citrus plants increases the content of endogenous abscisic acid and sugars in citrus plants; or interference with the expression of the gene encoding the CsZAT10 protein in citrus plants decreases the content of endogenous abscisic acid and sugars in citrus plants; the amino acid sequence of the CsZAT10 protein encoded by the gene encoding the CsZAT10 protein is shown in SEQ ID No.

4.

3. The application according to claim 2, characterized in that, The nucleotide sequence of the gene encoding the CsZAT10 protein is shown in SEQ ID No.

3.

4. The application of biomaterials that enhance gene expression in promoting the accumulation of endogenous abscisic acid and sugars in citrus plants, characterized in that, The gene is the encoding gene for the CsZAT10 protein, and the amino acid sequence of the CsZAT10 protein is shown in SEQ ID No. 4; the biomaterial is at least one of the following materials: (1) A nucleic acid molecule, wherein the amino acid sequence of the protein encoded by the nucleic acid molecule is shown in SEQ ID No. 4; (2) An expression cassette containing the nucleic acid molecule described in (1) and subjecting the nucleic acid molecule to overexpression; (3) An overexpression vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (4) A host cell containing the expression cassette or the overexpression vector, or the host cell having the nucleic acid molecule described in (1) integrated into its genome; (5) A transgenic plant cell line containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (6) A transgenic plant tissue, wherein the transgenic plant tissue contains the nucleic acid molecule described in (1) or the expression cassette described in (2); (7) A transgenic plant organ containing the nucleic acid molecule described in (1) or the expression cassette described in (2).

5. The application of biomaterials that reduce gene expression levels in reducing endogenous abscisic acid and sugar content in citrus plants, characterized in that, The gene encodes the CsZAT10 protein with the amino acid sequence shown in SEQ ID No. 4; the biomaterial is at least one of the following materials: (a) An RNA interference molecule that targets the gene encoding the protein with the amino acid sequence shown in SEQ ID No. 4, thereby silencing the gene encoding the CsZAT10 protein; (b) An expression cassette containing the RNA interference molecule described in (a); (c) A recombinant vector containing the RNA interference molecule described in (a) or the expression cassette described in (b); (d) A recombinant microorganism containing the RNA interference molecule described in (a), the expression cassette described in (b), or the recombinant vector described in (c); (e) A transgenic plant cell line containing the RNA interference molecule described in (a) or the expression cassette described in (b); (f) Transgenic plant tissue containing the RNA interference molecule described in (a) or the expression cassette described in (b); (g) A transgenic plant organ containing the RNA interference molecule described in (a) or the expression cassette described in (b).

6. A method for promoting the accumulation of endogenous abscisic acid and sugars in citrus plants, characterized in that, The process includes the following steps: constructing the overexpression vector as described in claim 4, and introducing the overexpression vector into a citrus plant using Agrobacterium-mediated transformation.

7. The method according to claim 6, characterized in that, The Agrobacterium is GV3101 or EHA105.

8. A method for reducing the content of endogenous abscisic acid and sugar in citrus plants, characterized in that, Includes the following steps: The recombinant vector as described in claim 5 was constructed, and the recombinant vector was introduced into a citrus plant using Agrobacterium-mediated transformation.

9. The method according to claim 8, characterized in that, The Agrobacterium is GV3101 or EHA105.

10. A transgenic citrus plant, characterized in that, The transgenic citrus plant overexpresses the gene encoding the CsZAT10 protein; or the transgenic citrus plant silences the gene encoding the CsZAT10 protein; the amino acid sequence of the CsZAT10 protein encoded by the gene encoding the CsZAT10 protein is shown in SEQ ID No. 4.

Images