Use of a ZmAAP33 gene in regulating starch content in corn seeds

Abstract

This invention belongs to the field of maize molecular breeding technology and discloses a method for increasing the starch content of maize kernels and the application of the ZmAAP33 gene in regulating maize kernel starch content. The method obtains maize plants with reduced or absent ZmAAP33 function by reducing the expression level of the ZmAAP33 gene in maize and / or weakening or destroying the activity of the ZmAAP33 protein. The ZmAAP33 gene is edited using CRISPR / Cas gene editing technology to induce frameshift mutations and premature termination of translation. ZmAAP33 participates in the input of amino acids and nitrogen during maize kernel development. By reducing or destroying the function of ZmAAP33, the input of amino acids and nitrogen into developing kernels can be reduced, regulating the carbon-nitrogen distribution and the balance of protein and starch accumulation in the kernels, thereby increasing the starch content of mature maize kernels.

Description

Technical Field

[0001] This invention belongs to the field of maize molecular breeding technology, specifically involving the application of the ZmAAP33 gene in regulating the starch content of maize kernels. Background Technology

[0002] Corn kernel starch is the main storage substance in corn kernels, primarily composed of amylose and amylopectin. Its content is closely related to the feed value, starch processing performance, and fermentation utilization value of corn. High-starch-content corn can serve as an important raw material for starch deep processing, energy feed, and bio-fermentation. Therefore, increasing the starch content of corn kernels is an important direction for improving corn quality. Existing high-starch corn materials are typically obtained through screening of high-starch germplasm resources, hybridization and multi-generation selection, molecular marker-assisted selection, and genetic modification of starch synthesis-related genes.

[0003] With the deepening research on the metabolic pathways of corn starch synthesis, key enzymes involved in starch synthesis, such as ADP-glucose pyrophosphorylase, grain-bound starch synthase, soluble starch synthase, starch branching enzyme, and starch debranching enzyme, and their encoding genes have been extensively studied. The starch content and composition of grains can be regulated by changing the expression or function of related genes.

[0004] Currently, various molecular targets for improving maize starch quality have been identified by screening for quantitative trait loci related to starch content, superior allelic variations, or directly regulating genes related to starch synthesis. For example, genome-wide association analysis and genetic linkage analysis can screen for genetic loci significantly associated with grain starch content, and related molecular markers can be used for assisted selection. On the other hand, grain starch content can also be regulated by overexpressing or editing the activity of functional genes related to starch synthesis. These technologies can improve the targeting of starch trait selection, but their regulatory targets mainly focus on the starch biosynthesis pathway itself or genetic variations related to starch content, with less attention paid to the regulatory relationship between nutrient input, especially amino acid and nitrogen input, and starch accumulation in developing grains. Summary of the Invention

[0005] The purpose of this invention is to provide a method for increasing the starch content of maize kernels by reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein, thereby regulating the input of amino acids and nitrogen and the carbon-nitrogen distribution in maize kernels and promoting starch accumulation in maize kernels.

[0006] The purpose of this invention is to provide an application of the ZmAAP33 gene in regulating the starch content of maize kernels, providing a new molecular target for the creation of maize materials with high starch content and for molecular breeding.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] This invention provides an application of the ZmAAP33 gene in regulating the starch content of maize seeds. By reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein, the starch content of maize kernels is increased. The nucleotide sequence of the coding region of the ZmAAP33 gene is shown in SEQ ID NO:1, and the amino acid sequence of the ZmAAP33 protein is shown in SEQ ID NO:2.

[0009] By editing the ZmAAP33 gene, one or more nucleotides are substituted, deleted, and / or inserted, thereby reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein.

[0010] The gene editing occurred in the coding region, promoter, enhancer, 5′ untranslated region, 3′ untranslated region and / or splicing regulatory region of the ZmAAP33 gene.

[0011] The gene editing causes frameshift mutations, premature termination mutations, amino acid substitution mutations that reduce or eliminate the activity of ZmAAP33 protein, transmembrane domain deletion mutations, and / or splicing abnormal mutations in the ZmAAP33 gene to obtain mutants with reduced or lost ZmAAP33 function.

[0012] The gene editing was performed using a CRISPR / Cas system; wherein the CRISPR / Cas system is a CRISPR / Cas9 system, and the first sgRNA targeting sequence is shown in SEQ ID NO:3, and the second sgRNA targeting sequence is shown in SEQ ID NO:4.

[0013] The ZmAAP33 reduced or lost function mutants include Zmaap33-1 and / or Zmaap33-2;

[0014] Specifically, Zmaap33-1 involves a 40 bp nucleotide deletion between the first sgRNA target site and the second sgRNA target site, causing a frameshift in the open reading frame of the ZmAAP33 gene and generating an early stop codon. The nucleotide sequence of the edited region of Zmaap33-1 is shown in SEQ ID NO:5.

[0015] The Zmaap33-2 gene undergoes a 2 bp nucleotide deletion at the first sgRNA target site and a 1 bp nucleotide insertion at the second sgRNA target site, resulting in a net deletion of 1 bp. This causes a frameshift in the open reading frame of the ZmAAP33 gene and generates an early stop codon. The nucleotide sequence of the edited region of the Zmaap33-2 gene is shown in SEQ ID NO:6.

[0016] This invention provides a method for increasing the starch content of maize kernels, comprising reducing the expression level of the ZmAAP33 gene in maize and / or weakening or destroying the activity of the ZmAAP33 protein, obtaining maize plants with reduced or absent ZmAAP33 function, and causing the maize plants to produce kernels.

[0017] The reduction in the expression level of the ZmAAP33 gene and / or the weakening or disruption of the activity of the ZmAAP33 protein are achieved through at least one of the following methods:

[0018] Gene editing was performed on the coding region of the ZmAAP33 gene to induce a decrease or loss of function in the ZmAAP33 gene;

[0019] Gene editing was performed on the promoter, enhancer, 5′ untranslated region, 3′ untranslated region and / or splicing regulatory region of the ZmAAP33 gene to reduce the expression level of the ZmAAP33 gene;

[0020] And / or use RNA interference, antisense inhibition, artificial microRNA and / or CRISPR interference to reduce the transcriptional and / or translational levels of the ZmAAP33 gene.

[0021] The maize plants with reduced or absent ZmAAP33 function were obtained through screening or breeding. The screening or breeding included detecting the ZmAAP33 gene in the maize material to be screened and selecting maize materials with allelic variants of reduced or absent ZmAAP33 function. The reduced or absent ZmAAP33 allelic variants reduced the expression level of the ZmAAP33 gene and / or reduced or eliminated the activity of the ZmAAP33 protein.

[0022] This invention provides a corn material with high starch content obtained by the above method.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] 1. This invention uses ZmAAP33 as a molecular breeding target to regulate starch content in maize kernels. By reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein, it provides a new technical approach for improving high-starch maize, which is different from directly regulating genes related to starch synthesis.

[0025] 2. This invention reduces the input of amino acids and nitrogen into developing kernels by decreasing the function of ZmAAP33, thereby regulating the carbon-nitrogen distribution and protein-starch accumulation balance in kernels. This results in a decrease in nitrogen content, protein and amino acid accumulation in mature kernels, while increasing starch content in maize kernels, thus achieving targeted regulation of high starch traits.

[0026] 3. This invention can obtain maize materials with reduced or absent ZmAAP33 function through gene editing and other methods, providing clear genetic materials and molecular targets for the creation of high-starch maize germplasm and molecular breeding. Attached Figure Description

[0027] Figure 1 A schematic diagram of the ZmAAP33 gene structure and the mutation sites of the Zmaap33 gene editing mutant;

[0028] Figure 2 This is a comparison of the plant and seed phenotypes of wild-type and Zmaap33 mutant plants. Figure 2 A shows a comparison of the phenotypes of wild-type and Zmaap33 mutant plants. Figure 2 B shows a comparison of the female ear and grain phenotypes between the wild type and the Zmaap33 mutant. Figure 2 C represents a comparison of grain length between the wild type and the Zmaap33 mutant. Figure 2 D represents a comparison of grain width between the wild type and the Zmaap33 mutant. Figure 2 E represents the comparison of the weight of 100 grains between the wild type and the Zmaap33 mutant. Figure 2 F represents a comparison of grain hardness between the wild type and the Zmaap33 mutant;

[0029] Figure 3 The figure shows the results of the detection of the effect of ZmAAP33 function loss on the accumulation of storage substances in mature maize kernels. Figure 3 A shows the SDS-PAGE results of prolysin and non-prolysin in mature seeds of wild type and Zmaap33 mutant. Figure 3 B represents the ImageJ quantification results of the protein bands. Figure 3 C represents the protein content determined by the BCA method. Figure 3 D represents the results of the carbon, hydrogen, and nitrogen content of the grains determined by the combustion method. Figure 3 E represents the results of starch and protein content in grains determined by near-infrared spectroscopy. Figure 3 F represents the result of the grain amino acid content test. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0032] The present invention will be further described below with reference to specific embodiments. It should be noted that the following embodiments are used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention. Without departing from the concept of the present invention, those skilled in the art can adjust or substitute the specific embodiments according to actual needs.

[0033] The ZmAAP33 gene described in this invention is a maize endogenous amino acid transport-related gene, with gene number LOC103654612. Its coding region nucleotide sequence is shown in SEQ ID NO:1, and the amino acid sequence of the ZmAAP33 protein it encodes is shown in SEQ ID NO:2.

[0034] Example 1

[0035] Obtaining and molecularly identifying the Zmaap33 gene-editing mutant

[0036] The ZmAAP33 gene was edited using CRISPR / Cas9 gene editing technology to obtain a maize mutant with loss of ZmAAP33 function.

[0037] Based on the ZmAAP33 gene coding sequence as shown in SEQ ID NO:1, two specific sgRNA targets were designed. The first sgRNA targets GTTCGACGAGGTGTCCTCGG, as shown in SEQ ID NO:3, with a corresponding PAM sequence of TGG. The second sgRNA targets GGGGCCGCCGACGACGACGG, as shown in SEQ ID NO:4, with a corresponding PAM sequence of CGG. Figure 1 The ZmAAP33 gene structure and target locations are shown. The editing location of the first sgRNA target is marked as +23 bp, and the editing location of the second sgRNA target is marked as +61 bp. The two targets are separated by an interval of 18 bp.

[0038] The target sequences corresponding to the two sgRNAs mentioned above were ligated into plant CRISPR / Cas9 binary expression vectors to construct the ZmAAP33 gene editing vector. The specific method is as follows: Ma X, Liu YG. CRISPR / Cas9-Based MultiplexGenome Editing in Monocot and Dicot Plants. Curr Protoc Mol Biol. 2016 Jul 1;115:31.6.1-31.6.21. doi: 10.1002 / cpmb.10. PMID: 27366892.

[0039] The constructed recombinant vector was transformed into competent Agrobacterium tumefaciens cells EHA105. After KanaR resistance selection, the correct construction of the recombinant vector was confirmed by colony PCR and / or sequencing, and Agrobacterium tumefaciens cells carrying the ZmAAP33 gene editing vector were obtained.

[0040] The immature embryos of maize inbred line B104 were selected as genetic transformation materials, and transformation was carried out using Agrobacterium-mediated genetic transformation.

[0041] After infection, the maize embryos were subjected to callus induction, Basta resistance screening, plant regeneration and rooting culture in sequence. After obtaining regenerated plants, they were hardened off and transplanted to a greenhouse for cultivation to obtain T0 generation transgenic plants.

[0042] Genomic DNA was extracted from leaves of T0 generation plants. Primers were designed to identify the ZmAAP33 gene fragment containing the two editing target sites, with the upstream primer sequence being AGGGCTAGCCGATCAACAAC and the downstream primer sequence being TGACGGCCGTGATAATGTGG. PCR amplification was performed on the ZmAAP33 gene fragment containing both editing target sites. The PCR products were sequenced using Sanger sequencing and compared with the wild-type ZmAAP33 gene sequence to determine the specific editing type.

[0043] Two independent ZmAAP33 gene editing events were identified, named Zmaap33-1 and Zmaap33-2, respectively. Their mutation locations are as follows: Figure 1 As shown.

[0044] Specifically, Zmaap33-1 involves a 40 bp deletion between the first and second sgRNA target sites. This deletion spans the downstream region of the first sgRNA target site, the spacer region between the two targets, and the upstream region of the second sgRNA target site. This causes a frameshift in the open reading frame of the ZmAAP33 gene, resulting in an early stop codon and thus premature termination of ZmAAP33 protein translation. The deleted 40 bp nucleotide sequence is CTCGGTGGAGGCGGGGGCCTACGGGGGCCGCGACGACGAC, representing a deletion from positions 39 to 78 of the ZmAAP33 coding region nucleotide sequence shown in SEQ ID NO:1. The nucleotide sequence of the edited region after the Zmaap33-1 mutation is shown in SEQ ID NO:5.

[0045] Zmaap33-2 undergoes a 2 bp deletion at the first sgRNA target site and a 1 bp insertion at the second sgRNA target site, resulting in a net deletion of 1 bp. The 2 bp deleted at the first sgRNA target site is TC, and the 1 bp inserted at the second sgRNA target site is T. This editing causes a frameshift in the open reading frame of the ZmAAP33 gene and generates an early stop codon, leading to premature termination of ZmAAP33 protein translation. The specific positions of the 2 bp deletion and 1 bp insertion relative to the nucleotide sequence of the ZmAAP33 coding region shown in SEQ ID NO:1 are 40 bp and 78 bp, respectively; the nucleotide sequence of the edited region after the Zmaap33-2 mutation is shown in SEQ ID NO:6.

[0046] T0 generation plants with independent editing events of Zmaap33-1 and Zmaap33-2 were self-crossed for three generations. Genotyping of the offspring was performed using the above-mentioned PCR amplification combined with Sanger sequencing method. Homozygous mutants of Zmaap33-1 and Zmaap33-2 that can be stably inherited were screened.

[0047] Subsequent analyses of grain phenotype, grain quality, and function were performed using the stable, homozygous Zmaap33-1 and Zmaap33-2 mutants.

[0048] Figure 1 The structure of the ZmAAP33 gene and the editing locations and mutation types of two independent gene editing mutants, Zmaap33-1 and Zmaap33-2, are shown. Both mutation types cause frameshifts in the open reading frame of ZmAAP33, leading to premature termination of translation. The scale bar in the figure is 100 bp.

[0049] Example 2

[0050] Phenotypic analysis of Zmaap33 mutant plants and grains

[0051] To evaluate the effects of ZmAAP33 loss of function on maize plant growth and grain traits, homozygous Zmaap33-1 and Zmaap33-2 mutants obtained in Example 1 were planted concurrently and their phenotypes were compared with wild-type maize materials with the same genetic background.

[0052] The wild-type materials were B104, Zmaap33-1, Zmaap33-2, and wild-type materials planted at a Sanya, Hainan plantation in the winter of 2025, using the same planting density, water and fertilizer management, and pest and disease control conditions.

[0053] The overall growth phenotype of wild-type, Zmaap33-1, and Zmaap33-2 plants was observed and recorded when the plants reached the pollen shedding stage. Results are as follows: Figure 2 As shown in Figure A, no significant differences were observed in the overall growth phenotype of the Zmaap33-1 and Zmaap33-2 mutant plants compared with the wild type.

[0054] After the maize kernels matured, mature female ears and kernels from wild-type, Zmaap33-1, and Zmaap33-2 plants were harvested and uniformly dried to constant weight. The kernel phenotypes were then compared under identical conditions. Results are as follows: Figure 2 As shown in B, no significant differences were observed in the overall phenotype of the female ears of the two Zmaap33 mutants compared with the wild type, and there was no significant difference in the translucency of the kernels. However, the overall kernel size of the Zmaap33 mutants was slightly smaller than that of the wild type.

[0055] Mature grains of each genotype were randomly selected, and grain length and width were measured using a Hangzhou Wanshen seed copying instrument. Results are as follows: Figure 2 C and Figure 2 As shown in D, compared with the wild type, the seed length and seed width of the Zmaap33-1 and Zmaap33-2 mutants were significantly reduced, with a sample size of n = 200.

[0056] Mature seeds of each genotype were randomly selected, with 100 seeds per group, and the weight of 100 seeds was measured. Results are as follows: Figure 2 As shown in E, the 100-grain weight of the wild type was higher than that of the Zmaap33 mutant. The 100-grain weight of both the Zmaap33-1 and Zmaap33-2 mutants was significantly lower than that of the wild type. The sample size was n = 10.

[0057] The hardness of mature wild-type, Zmaap33-1, and Zmaap33-2 kernels was tested using the puncture method with a Baosheng Technology TA.GEL hardness tester. Results are as follows: Figure 2As shown in Figure F, the grain hardness of the Zmaap33-1 and Zmaap33-2 mutants was not significantly different from that of the wild type. The sample sizes n were 23, 24, and 18, respectively.

[0058] The above results indicate that the loss of ZmAAP33 function did not significantly affect the overall growth of maize plants or kernel firmness, but it did reduce kernel length, kernel width, and 100-kernel weight. Therefore, the Zmaap33-deficient material obtained in this embodiment exhibited certain variations in kernel size and weight.

[0059] Figure 2 Data distribution was visualized using box plots and violin plots generated by GraphPad Prism v10.1.2. For the box plots, the upper whiskers, upper boundary of the box, middle line, lower boundary of the box, and lower whiskers, from top to bottom, represent the maximum, third quartile, median, first quartile, and minimum, respectively. In the violin plots, the width of the violin represents the data density, the middle horizontal line represents the median, and the upper and lower dashed lines represent the third quartile and first quartile, respectively. According to Tukey's multiple comparison test and one-way ANOVA, different lowercase letters indicated significant differences (P < 0.05).

[0060] Example 3

[0061] Effects of Zmaap33 function loss on protein, nitrogen, amino acid and starch accumulation in mature grains

[0062] To further determine the effect of ZmAAP33 loss of function on the accumulation of storage substances in maize kernels, mature kernels of the homozygous Zmaap33-1 and Zmaap33-2 mutants obtained in Example 1 and wild-type kernels with the same genetic background were used as materials to determine the contents of kernel storage protein, carbon, hydrogen and nitrogen elements, starch, protein and amino acids.

[0063] First, the prolysin and non-prolysin were extracted from the mature seeds. Mature seeds of wild type, Zmaap33-1 and Zmaap33-2 were dried at 55 degrees Celsius to constant weight, ground into powder in a grinder at 60 Hz for 120 seconds, and then passed through an 80-mesh sieve for later use.

[0064] 100 mg of seed powder was added to 1 mL of alcohol-soluble protein extraction buffer, which consisted of 70% (v / v) ethanol, 2% (v / v) β-mercaptoethanol, 3.75 mM sodium borate (pH 10.0), and 0.3% SDS. The mixture was vortexed and incubated overnight at room temperature. The extract was then centrifuged at 12000 rcf for 20 min at room temperature, and the supernatant was collected as the alcohol-soluble protein fraction. This alcohol-soluble protein extraction step was repeated three times, and the supernatants from each extraction were combined. After removing the residual extract from the precipitate after the last extraction, further extraction buffer was added, consisting of 12.5 mM sodium borate, 5% SDS, and 2% β-mercaptoethanol. The mixture was vortexed thoroughly and incubated at room temperature for 2 h. The extract was then centrifuged at 12000 rcf for 20 min at room temperature, and the supernatant was collected as the non-alcohol-soluble protein fraction.

[0065] Equal masses of alcohol-soluble and non-alcohol-soluble protein samples were subjected to SDS-PAGE gel electrophoresis. The results are as follows: Figure 3 As shown in Figure A, compared with the wild type, both prolysin and non-prolysin in the Zmaap33-1 and Zmaap33-2 mutants were reduced overall. Among them, the bands with more significant reductions in prolysin mainly corresponded to α-zein proteins with molecular weights of approximately 19 kDa and 22 kDa.

[0066] ImageJ software was used to quantify the grayscale values ​​of protein bands in SDS-PAGE gels. The integrated grayscale value of each target protein band was measured, and after subtracting the corresponding background signal, the grayscale values ​​of the corresponding protein bands of each sample were directly compared.

[0067] The results are as follows Figure 3 As shown in B, compared with the wild type, the quantitative values ​​of the prolysin bands of Zmaap33-1 and Zmaap33-2 mutants decreased by 12.9% and 12.6%, respectively, and the quantitative values ​​of the non-prolysin bands decreased by 9.7% and 5.9%, respectively.

[0068] The contents of the above-mentioned alcohol-soluble and non-alcohol-soluble proteins were further determined using the BCA protein quantification method. An appropriate amount of protein extract was taken and analyzed using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the kit instructions. A standard curve was plotted using bovine serum albumin (BSA) as a standard, and the absorbance was measured at 562 nm. The protein concentration of the sample was calculated based on the standard curve.

[0069] The results are as follows Figure 3As shown in C, compared with the wild type, the content of prolysin in Zmaap33-1 and Zmaap33-2 mutants was reduced by 22% and 18%, respectively, and the content of non-prolysin was reduced by 11% and 3%, respectively.

[0070] Subsequently, the carbon, hydrogen, and nitrogen content in mature kernels was determined using a combustion method. Mature kernels of wild type, Zmaap33-1, and Zmaap33-2 were ground into a uniform powder, and 3 mg of each powder was weighed out. Carbon, hydrogen, and nitrogen content were analyzed using an elemental analyzer at 950 degrees Celsius according to the combustion method.

[0071] The results are as follows Figure 3 As shown in Figure D, the carbon and hydrogen contents in mature grains of the Zmaap33-1 and Zmaap33-2 mutants were not significantly different from those of the wild type, but the nitrogen content was significantly reduced. Specifically, compared with the wild type, the total nitrogen content in mature grains of Zmaap33-1 and Zmaap33-2 decreased by 18.2% and 12.9%, respectively.

[0072] The starch and protein content of mature kernels were further determined using near-infrared spectroscopy. Powders of mature wild-type, Zmaap33-1, and Zmaap33-2 kernels were ground and analyzed using a near-infrared spectrometer to determine the starch and protein content, respectively.

[0073] The results are as follows Figure 3 As shown in E, compared with the wild type, the starch content in the mature grains of the Zmaap33-1 and Zmaap33-2 mutants was significantly increased, with relative increases of 2.0% and 2.1%, respectively; at the same time, the protein content in the grains of both mutants was significantly decreased, with relative decreases of 10.6% and 8.4%, respectively.

[0074] The amino acid content of mature seeds from wild-type and Zmaap33 mutant strains was further determined, with Zmaap33-1 as a representative. A suitable amount of mature seed powder was taken, and the sample was treated with acid hydrolysis. The content of each amino acid was then determined using high-performance liquid chromatography-tandem mass spectrometry.

[0075] The results are as follows Figure 3 As shown in F, compared with the wild type, the total amino acid content of mature seeds of the Zmaap33 mutant is reduced, with non-essential amino acids decreasing by about 6% and essential amino acids decreasing by about 7%.

[0076] The results indicate that in two independent ZmAAP33 gene editing events, loss of ZmAAP33 function led to decreased nitrogen content, protein content, and amino acid accumulation in mature kernels, while increasing starch content. The two independent mutants exhibited consistent trends, suggesting that ZmAAP33 is related to nitrogen input and the protein-starch accumulation balance in maize kernels, and that reducing or disrupting ZmAAP33 function can promote the relative accumulation of starch in mature maize kernels. Therefore, ZmAAP33 can serve as a molecular breeding target for increasing starch content in maize kernels.

[0077] It should be noted that the above embodiments are merely some preferred embodiments of the present invention, and not all embodiments. Obviously, based on the above embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0078] The above description of the embodiments is intended to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. An application of the ZmAAP33 gene in regulating starch content in maize seeds, characterized in that, By reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein, the starch content of corn kernels is increased; wherein, the nucleotide sequence of the coding region of the ZmAAP33 gene is shown in SEQ ID NO:1, and the amino acid sequence of the ZmAAP33 protein is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, By editing the ZmAAP33 gene, one or more nucleotides are substituted, deleted, and / or inserted, thereby reducing the expression level of the ZmAAP33 gene and / or weakening or destroying the activity of the ZmAAP33 protein.

3. The application according to claim 2, characterized in that, The gene editing occurred in the coding region, promoter, enhancer, 5′ untranslated region, 3′ untranslated region and / or splicing regulatory region of the ZmAAP33 gene.

4. The application according to claim 2 or 3, characterized in that, The gene editing causes frameshift mutations, premature termination mutations, amino acid substitution mutations that reduce or eliminate the activity of ZmAAP33 protein, transmembrane domain deletion mutations, and / or splicing abnormal mutations in the ZmAAP33 gene to obtain mutants with reduced or lost ZmAAP33 function.

5. The application according to any one of claims 2 to 4, characterized in that, The gene editing was performed using a CRISPR / Cas system; wherein the CRISPR / Cas system is a CRISPR / Cas9 system, and the first sgRNA targeting sequence is shown in SEQ ID NO:3, and the second sgRNA targeting sequence is shown in SEQ ID NO:

4.

6. The application according to any one of claims 1 to 5, characterized in that, The ZmAAP33 reduced or lost function mutants include Zmaap33-1 and / or Zmaap33-2; Specifically, Zmaap33-1 involves a 40 bp nucleotide deletion between the first sgRNA target site and the second sgRNA target site, causing a frameshift in the open reading frame of the ZmAAP33 gene and generating an early stop codon. The nucleotide sequence of the edited region of Zmaap33-1 is shown in SEQ ID NO:

5. The Zmaap33-2 gene undergoes a 2 bp nucleotide deletion at the first sgRNA target site and a 1 bp nucleotide insertion at the second sgRNA target site, resulting in a net deletion of 1 bp. This causes a frameshift in the open reading frame of the ZmAAP33 gene and generates an early stop codon. The nucleotide sequence of the edited region of the Zmaap33-2 gene is shown in SEQ ID NO:

6.

7. A method for increasing the starch content of corn kernels, characterized in that, This includes reducing the expression level of the ZmAAP33 gene in maize and / or weakening or destroying the activity of the ZmAAP33 protein, obtaining maize plants with reduced or absent ZmAAP33 function, and enabling the maize plants to produce kernels.

8. The method according to claim 7, characterized in that, The reduction in the expression level of the ZmAAP33 gene and / or the weakening or disruption of the activity of the ZmAAP33 protein are achieved through at least one of the following methods: Gene editing was performed on the coding region of the ZmAAP33 gene to induce a decrease or loss of function in the ZmAAP33 gene; Gene editing was performed on the promoter, enhancer, 5′ untranslated region, 3′ untranslated region, and / or splicing regulatory region of the ZmAAP33 gene to reduce the expression level of the ZmAAP33 gene; and / or RNA interference, antisense inhibition, artificial microRNA and / or CRISPR interference were used to reduce the transcriptional and / or translational levels of the ZmAAP33 gene.

9. The method according to claim 7, characterized in that, The maize plants with reduced or absent ZmAAP33 function were obtained through screening or breeding. The screening or breeding included detecting the ZmAAP33 gene in the maize material to be screened and selecting maize materials with allelic variants of reduced or absent ZmAAP33 function. The reduced or absent ZmAAP33 allelic variants reduced the expression level of the ZmAAP33 gene and / or reduced or eliminated the activity of the ZmAAP33 protein.

10. A corn material with high starch content obtained by the method as described in claim 7.

Images