Application of cucumber CsLTPG1 gene in regulating cucumber fruit peel brightness

Abstract

The application belongs to the technical field of plant molecular biology and crop genetic breeding, and particularly relates to a cucumber CsLTPG1 Gene in regulating cucumber peel brightness, the gene serves as a rate-limiting bottleneck for output of cuticle and wax components, regulates formation of cutin ridge and wax crystal, and further regulates cucumber peel brightness. The application knocks out or silences the gene by using CRISPR-Cas9 and other technologies CsLTPG1 Gene, successfully decouples glossiness and thorn / nodular body traits, obtains high-gloss fruit while maintaining normal commercial quality, and overcomes the pleiotropic defects of CsDULL knockout. Ideal targets are provided for precise breeding of high-value cucumber varieties.

Description

Technical Field

[0001] This invention belongs to the fields of plant molecular biology and crop genetics and breeding technology, and specifically relates to a cucumber. CsLTPG1 Application of genes in regulating cucumber peel brightness. Background Technology

[0002] Cucumber (Cucumis sativus L.) is one of the world's most important vegetable crops, and the appearance quality of its fruit directly affects its commercial value. The gloss of the cucumber peel is an important trait for evaluating fruit appearance quality, and varieties with high-gloss peels are more favored by consumers in the market. Peel gloss is mainly determined by the structure and composition of the epidermal cuticle, including the content and distribution of cutin and epipicuticular waxes. The morphology and arrangement of cuticular ridges and wax crystals directly affect the light reflection characteristics of the peel surface.

[0003] GPI-anchored non-specific lipid transfer proteins (LTPGs) are a class of lipid-binding proteins located in the plasma membrane (PM), playing a crucial role in the transmembrane transport of lipids in the plant cuticle. Studies have shown that LTPG proteins act as a rate-limiting transport bottleneck for the export of cuticle and wax components, regulating the formation of cuticle ridges and wax crystals. However, in cucumbers, CsLTPG1 The molecular mechanisms by which genes regulate fruit peel brightness and their application in breeding have not yet been reported.

[0004] The transcription factor CsDULL (C2H2-type zinc finger protein) has been shown to directly target the AAGCCAC motif in the CsLTPG1 promoter, activating its expression. While CsDULL knockout increases pericarp gloss, it also leads to abnormal spine and tubercles morphology, affecting the commercial quality of cucumbers to some extent. Therefore, finding precise breeding targets that can decouple gloss from spine / tubercles traits is of great significance for cultivating high-value cucumber varieties. Summary of the Invention

[0005] To address the shortcomings of existing technologies in the background section, this invention proposes a cucumber... CsLTPG1The application of genes in regulating cucumber peel brightness solves the pleiotropic defect problem caused by existing CsDULL knockout, achieving improved peel gloss while maintaining the normal commercial quality morphology of spines and nodules.

[0006] The technical solution adopted in this invention: This invention discloses a cucumber CsLTPG1 Application of genes in regulating cucumber peel brightness, the cucumber CsLTPG1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Furthermore, the cucumber CsLTPG1 The gene encodes a GPI-anchored nonspecific lipid transfer protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Furthermore, the application involves using genetic engineering techniques to reduce the cucumber's... CsLTPG1 The expression level of the gene regulates the brightness of the cucumber peel without affecting the morphology of the cucumber's spines and nodules.

[0009] This invention discloses a method for constructing a high-gloss cucumber peel material, wherein the method uses genetic engineering techniques to knock out, silence, or inhibit cucumber... CsLTPG1 Gene expression was used to obtain cucumber materials with high pericarp gloss.

[0010] Preferably, the knockout, silencing, or inhibition is performed using CRISPR-Cas9 or RNAi.

[0011] Furthermore, the CRISPR-Cas9 knockout method includes the following steps: (1) Design of targeted cucumber CsLTPG1 sgRNA sequences in the gene coding region; (2) Construct an expression vector containing the Cas9 nuclease and the sgRNA; (3) The expression vector was transformed into cucumber plants using Agrobacterium-mediated transformation; (4) Select cucumbers CsLTPG1 Homozygous mutant lines with gene knockout.

[0012] The targeted cucumber CsLTPG1 The nucleotide sequences of the sgRNA target site sequences in the gene coding region are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0013] This invention discloses a method for breeding cucumbers with high gloss peel. The method described in claims 4-7 is used to obtain cucumber plants as parents, and cucumbers with high gloss peel are obtained through transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

[0014] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention discloses for the first time the properties of cucumber. CsLTPG1 Genes, acting as bottlenecks limiting the output rate of cuticle and wax components, play a crucial role in regulating fruit peel brightness.

[0015] 2. This invention uses knockout or silencing. CsLTPG1 Genetic modification successfully yielded cucumber material with high-gloss peel, significantly improving the gloss of the peel.

[0016] 3. The key innovation of this invention is that CsLTPG1 knockout successfully decouples gloss and spine / tumor traits, obtaining high-gloss fruit while maintaining normal commercial quality, overcoming the pleiotropic defects of CsDULL knockout.

[0017] 4. CsLTPG1 is an ideal target for precision breeding of high-value cucumber varieties and has important application value. Attached Figure Description

[0018] Figure 1 Fruit phenotype, SEM and TEM analysis for CsLTPG1 overexpression and RNAi lines.

[0019] (ab) Quantitative analysis of fruit phenotype and gloss (Gs value) of CsLTPG1 overexpression lines (OE#4, OE#5) and control 2073-2; scale bar: 2 cm (a).

[0020] (cd) SEM (scanning electron microscope) and TEM (transmission electron microscope) images of the pericarp of CsLTPG1 overexpressing lines. Arrows indicate cuticular ridges and wax crystals. Scale bar: 10 μm (c); 2 μm (d).

[0021] (ef) Quantitative analysis of fruit phenotype and gloss of CsLTPG1-RNAi lines (RNAi#7, RNAi#9) and control 3630; scale bar: 2 cm (e).

[0022] SEM and TEM images of the pericarp of the (gh)CsLTPG1-RNAi strain, showing reduced cuticle ridges and elimination of wax crystals. Scale bar: 10 μm (g); 2 μm (h).

[0023] In (c, g): green arrows indicate cuticle ridges; yellow arrows indicate epidermal wax. In (d, h): red dashed lines indicate the epidermal outline of the pericarp at the cellular level, and red arrows mark the physical location of cuticle ridges or corresponding depressions. In (b, f): the bar chart represents the mean ± standard deviation (…). N = 9 fruits); different letters indicate significant differences ( p < 0.05, one-way ANOVA combined with Tukey's multiple comparison test).

[0024] Figure 2 Subcellular localization and tissue expression analysis of CsLTPG1; (a) Relative expression levels of CsLTPG1 in different tissues (roots, stems, leaves, tendrils, male flowers, pericarps, and pulp); (b) Expression patterns of CsLTPG1 at different fruit development stages; (S1–S11 represent: 7 days, 5 days, and 3 days before pollination, and 0 days, 3 days, 6 days, 10 days, 15 days, 20 days, 25 days, and 30 days after pollination, respectively) (cd) In situ hybridization expression pattern of CsLTPG1 RNA in pericarp; Figure c is the negative control. Scale bar: 200 μm (ef) Subcellular localization of the CsLTPG1-GFP fusion protein in tobacco leaves, and co-localization analysis with CD3-1007 (plasma membrane marker). Scale bar: 25 μm In (ab): all samples are from 2073-1; the bar chart represents the mean ± standard deviation. N =3 independent biological replicates).

[0025] Figure 3 Cuticle staining and TEM analysis of CsLTPG1 transgenic plants.

[0026] (a) Sudan IV cuticle staining of the pericarps of overexpressing and RNAi lines (15 days post-pollination) and comparison with the corresponding wild-type controls. Scale bar: 10 μm; (b) TEM images of the cuticle of overexpressing and RNAi lines (15 days post-pollination). Red double arrows indicate the thickness of the fruit cuticle (CL). Scale bar: 500 nm; (c) Quantitative analysis of fruit cuticle thickness based on TEM images in (b); bar charts represent mean ± standard deviation (N = 9 independent biological replicates); different letters indicate significant differences ( P < 0.05, one-way ANOVA with Tukey test); Figure 4 Analysis of the content of cuticle and wax components in the cuticle of the CsLTPG1-RNAi strain.

[0027] Total stratum corneum content and content of various components of (ab)3630 and CsLTPG1-RNAi#7; (cd) Analysis of total wax content and content of various components in each strain.

[0028] The bar chart represents the mean ± standard deviation ( N=3 independent biological replicates); different letters indicate significant differences ( P < 0.05, one-way ANOVA with Tukey test).

[0029] Figure 5 CsLTPG1-KO does not affect the morphology of thorns and nodules.

[0030] (ae) Microscopic images of spines and nodules of wild-type 3653, CsDULL-KO strains (KO#3, KO#4), and CsLTPG1-KO strains (KO#1, KO#2). Red arrows indicate spines; green arrows indicate nodules. Scale bar: 2 mm.

[0031] Quantitative analysis of the spine base width and height, and the tubercles width and height (fj) showed no significant difference between the CsLTPG1-KO strain and the wild type. In (gj): the bar chart represents the mean ± standard deviation ( ). N = 9 independent biological replicates); different letters indicate significant differences ( P < 0.05 (one-way ANOVA with Tukey test); Figure 6 Leaf morphology and wax analysis of the CsLTPG1-KO strain.

[0032] Comparison of leaf morphology and SEM images of leaf surface wax of wild-type 3653, CsDULL-KO strain (KO#3, KO#4) and CsLTPG1-KO strain (KO#1, KO#2). Detailed Implementation

[0033] The technical solutions of the embodiments of this application will be further described clearly and completely below with reference to the accompanying drawings. It should be noted that the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0034] Example 1: Obtaining cucumber CsLTPG1 gene-edited plants 1.1 sgRNA sequence design According to cucumber CsLTPG1Based on the coding sequence of the gene (gene ID: CsaV3_5G030220.1), two sgRNA sequences targeting different exon regions were designed. The sgRNA target site sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. The design principles for sgRNAs were: selecting target sites with a GC content of 40%-60% and high specificity, and ensuring that the downstream of the target site contained a PAM sequence (NGG). BLAST alignment was used to ensure the specificity of the target sites in the cucumber genome.

[0035] SEQ ID NO:3 sequence: GTTGTTTCGCGTACGCGACGGG; SEQ ID NO:4 Sequence: CAGCATCCGGTGAATTCGCCGG.

[0036] 1.2 Construction of CRISPR / Cas9 vectors Dual single-guide RNAs (sgRNAs) were amplified from the pCBC-DT1T2 template using a four-primer strategy and cloned into the pKSE402 vector carrying a GFP tag (containing a CaMV 35S promoter-driven SpCas9 nuclease and a U6 promoter-driven sgRNA expression cassette) to construct a gene editing vector. After sequencing verification that the sgRNA insertion direction was correct and the sequence was error-free, the CRISPR / Cas9-CsLTPG1 editing vector was obtained.

[0037] The primers for vector construction are: CsLTPG1-DT1-BsF2: ATATATGGTCTCGATTGGTTGTTTCGCGTACGCGACGTT (SEQ ID NO.5) CsLTPG1-DT1-F0:TGGTTGTTTCGCGTACGCGACGTTTTAGAGCTAGAAATAGC (SEQ ID NO.6) CsLTPG1-DT2-R0:AACGCGAATTCACCGGATGCTGCAATCTCTTAGTCGACTCTAC (SEQ IDNO.7) CsLTPG1-DT2-BsR2: ATTATTGGTCTCGAAACGCGAATTCACCGGATGCTGCAA (SEQ ID NO.8) The sequencing primers are: U626-IDF:TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO.9) U629-IDR:AGCCCTCTTTCTTTCGATCCATCAAC (SEQ ID NO.10) 1.3 Obtaining CsLTPG1 transgenic plants Transgenic plants were created using Agrobacterium-mediated cotyledon genetic transformation. The pKSE402 editing vector was transformed into Agrobacterium tumefaciens strain GV3101. Cucumber cotyledons were used as explants and infected with Agrobacterium bacterial suspension containing recombinant plasmids (OD600=0.3) for 1.5 minutes each time, for a total of two infections. After infection, the explants were placed on co-culture medium and cultured in the dark for 3 days, and then transferred to differentiation medium to induce adventitious shoot formation. After the adventitious shoots emerged, positive adventitious shoots with GFP fluorescence were selected using a LUYOR-3415RG light source (Shanghai Luyang Instrument Co., Ltd.), cut off, and transferred to rooting medium for further culture. After the regenerated plants had fully developed their root systems, they were transplanted to a greenhouse to obtain the T0 generation transgenic plants.

[0038] 1.4 T0 Target Practice Identification Genomic DNA was extracted from T0 generation plants, and primers designed with flanking sequences at the CsLTPG1 target site were used for PCR amplification. The PCR products were sequenced by Sanger sequencing and compared with wild-type sequences to identify the editing type. Editing efficiency was analyzed using NGS (next-generation sequencing), and positive plants with frameshift mutations or large deletions were screened. T1 generation seeds were obtained by self-pollination of T0 generation plants.

[0039] The sequencing primers are: NGSL-F: AAGTAACTTTAACCGTCATGTT (SEQ ID NO.11) NGSL-R: CTCCAACTTCCAGTTTATCC (SEQ ID NO.12) 1.5 Screening of T2 generation homozygous edited plants T2 generation seeds were obtained by self-pollination of T1 generation plants. Genomic DNA was extracted from T2 generation plants for PCR sequencing and identification, and homozygous knockout lines of the CsLTPG1 gene were obtained through screening. The complete loss of CsLTPG1 gene expression was verified by RT-qPCR, resulting in two independent homozygous edited lines, CsLTPG1-KO#1 and CsLTPG1-KO#2.

[0040] The primers used for RT-qPCR are: CsLTPG1-qRT-F: AGTGGTGAGTTGTTTCGCGT (SEQ ID NO.13) CsLTPG1-qRT-R:CCGGTGAGGTCGAATTGCTA (SEQ ID NO.14) Example 2: Construction and phenotypic analysis of CsLTPG1 overexpression and RNAi lines 2.1 Construction of overexpression vectors Using cucumber pericarp cDNA as a template, the complete CDS sequence of the CsLTPG1 gene was amplified and inserted into a pCY-35s-His vector carrying a GFP marker to obtain an overexpression vector.

[0041] The primers for vector construction are: LTPG-F: ATGAAGAGCGGAAGAAAGGTG (SEQ ID NO.15) LTPG-R: TCAGGCGTAAGTGATCGGC (SEQ ID NO. 16) B-pCY-F: GGGGACGAGCTCGGTACCCGGGATGAAGAGCGGAAGAAAGG (SEQ ID NO. 17) B-pCY-R:GTGGTGGTGGTGGTGGTCGACTCAGGCGTAAGTGATCGGC (SEQ ID NO.18) The sequencing primers are: CX-pcy-R:CGGCAACAGGATTCAATCTTA (SEQ ID NO.19) 2.2 RNAi vector construction A specific cDNA fragment of CsLTPG1 (221 bp) was cloned and ligated into a pFGC1008 plasmid carrying a hygromycin tag to construct an RNA interference (RNAi) vector. All constructs were introduced into Agrobacterium tumefaciens strain GV3101.

[0042] Sequencing confirmed that the inserted sequence was correct.

[0043] The primers for vector construction are: CsLTPG1-RNAi-F1: GGAGAGGACACGCTCGAGGCCCAAAGCTTCTCGGGTTAC (SEQ ID NO.20) CsLTPG1-RNAi-R1: GTTGTAAAAATAGAGCTCTCAGGCGTAAGTGATCGGCGA (SEQ ID NO. 21) CsLTPG1-RNAi-F2:ACAATTACCATGGGGCGCGCCCATTGGGCTCTTCGAAACCCG (SEQ IDNO.22) CsLTPG1-RNAi-R2: TGTTCATCTGGGGATTTAAATAGCGGCTAGTGAATGCGGACT (SEQ IDNO.23) The sequencing primer sequences are as follows: RNI-ESQ-F: ATCCCACTATCCTTCGCAAGAC (SEQ ID NO.24) RNI-ESQ-R: TGAACGATCGGGGAAATTCGAGCT (SEQ ID NO.25) 2.3 Obtaining transgenic plants Using the same Agrobacterium-mediated cotyledon transformation method as in Example 1, the overexpression vector and RNAi vector were transformed into glossy-fruited line 2073-2 and dull-fruited line 3630, respectively. After screening and regeneration, T0 generation transgenic plants were obtained. Transgenic positive lines were verified by GFP fluorescence detection and RT-qPCR.

[0044] The primers used for RT-qPCR are: CsLTPG1-qRT-F: AGTGGTGAGTTGTTTCGCGT (SEQ ID NO.26) CsLTPG1-qRT-R:CCGGTGAGGTCGAATTGCTA (SEQ ID NO.27) 2.4 Fruit phenotypic observation Overexpression of CsLTPG1 in the glossy-fruited line 2073-2 background yielded CsLTPG1-OE#4 and CsLTPG1-OE#5 lines. Compared to the control 2073-2, the overexpressed lines showed significantly reduced fruit gloss (Gs value decreased from approximately 6.5 to approximately 2.5-3.5), and the fruit surface exhibited a dull phenotype. RNAi silencing of CsLTPG1 in the dull-fruited line 3630 background yielded CsLTPG1-RNAi#7 and CsLTPG1-RNAi#9 lines. Compared to the control 3630, the RNAi lines showed significantly increased fruit gloss (Gs value increased from approximately 2.0 to approximately 5.0), and the fruit surface exhibited a high-gloss phenotype.

[0045] 2.5 SEM / TEM Analysis Scanning electron microscopy (SEM) analysis showed that the CsLTPG1 overexpressing lines (OE#4, OE#5) had more pronounced cuticle ridges on the pericarp surface and significantly increased wax crystal coverage; yellow arrows indicate wax crystals, and green arrows indicate cuticle ridges. In contrast, the CsLTPG1-RNAi lines (RNAi#7, RNAi#9) showed significantly reduced cuticle ridges on the pericarp surface, and complete elimination of epidermal wax crystals. Transmission electron microscopy (TEM) analysis showed that the cuticle thickness increased in the overexpressing lines, while it significantly decreased in the RNAi lines.

[0046] Example 3: Application of CsLTPG1-KO strain in breeding cucumbers with high-gloss peel 3.1 Improved fruit gloss in KO strains In a dull-fruited line 3630 background, the CsLTPG1 gene was knocked out using CRISPR / Cas9 to obtain homozygous knockout lines CsLTPG1-KO#1 and CsLTPG1-KO#2. Gloss analysis showed that the KO line fruits had significantly higher Gs values ​​than the wild-type 3630, exhibiting a bright, glossy peel, demonstrating that CsLTPG1 dysfunction effectively enhances fruit gloss.

[0047] 3.2 Analysis of the cuticle structure TBO staining showed that the cuticle of the CsLTPG1-KO strain was lighter in color, indicating reduced cuticle deposition. TEM analysis showed a significant decrease in cuticle thickness in the KO strain. Quantitative analysis of cuticle components showed that compared with wild-type 3630, the total cutin load of the CsLTPG1-KO strain was significantly reduced, with significant decreases in the contents of fatty acids, dicarboxylic acids, ω-hydroxy acids, polyhydroxy acids, and amides. The total wax load was also significantly reduced, with significant decreases in the contents of fatty acids, alkanes, alcohols, esters, and triterpenoids.

[0048] 3.3 Morphological analysis of spines and nodules Morphological analysis was performed on the spines and tubercles of the CsLTPG1-KO line. Compared with the wild type 3653, there were no significant differences in the width of spine base, height of spine base, width of tubercle, and height of tubercle in the CsLTPG1-KO#1 and CsLTPG1-KO#2 lines, indicating that the spine and tubercle morphology were completely normal. This result demonstrates that the CsLTPG1 knockout successfully decoupled glossiness from spine / tubercles traits, overcoming the pleiotropic defects caused by the CsDULL knockout (the spine base of the CsDULL-KO line was significantly narrower, and the tubercles were significantly smaller), providing key technical support for the commercial breeding of high-gloss cucumber varieties.

[0049] Furthermore, the leaf morphology and leaf surface wax structure of the CsLTPG1-KO strain were not significantly different from those of the wild type, further demonstrating that the phenotypic changes caused by CsLTPG1 knockout are fruit-specific and do not affect the normal development of other organs.

[0050] Example 4: Subcellular localization and expression analysis of CsLTPG1 4.1 Tissue expression profile analysis Analysis using RT-qPCR CsLTPG1 The expression patterns of the gene in different cucumber tissues were investigated. The results showed that CsLTPG1 was expressed in the root, stem, leaf, tendril, male flower, peel, and flesh, with the highest expression level observed in the peel (approximately 10 times higher than in the root), significantly exceeding that in other tissues. CsLTPG1 It plays a major role in the formation of the cuticle of the pericarp. During fruit development, CsLTPG1 The expression level gradually increases from the S1 phase, reaches a peak in the S8 phase (relative expression level of about 22 times), and then gradually decreases, consistent with the dynamic process of stratum corneum deposition.

[0051] 4.2 Subcellular localization The CsLTPG1-GFP fusion protein was transiently expressed in the epidermal cells of tobacco (Nicotiana benthamiana) leaves, and its subcellular localization was observed using confocal laser scanning microscopy. The results showed that the CsLTPG1-GFP fluorescence signal was distributed in a reticular pattern at the cell edge, and highly co-localized with the red fluorescence signal of the plasma membrane marker (mCherry-Aquaporin) (shown in yellow in the Merge plot), confirming that the CsLTPG1 protein is localized to the plasma membrane (PM). This result is consistent with the prediction that CsLTPG1 is a GPI-anchored protein, which anchors it to the outer surface of the plasma membrane, participating in the transmembrane transport of cuticle lipids from the plasma membrane to the cell wall.

[0052] 4.3 In situ hybridization verification The spatial expression pattern of CsLTPG1 mRNA in cucumber pericarp was detected using in situ hybridization. The results showed that... CsLTPG1 The antisense probe showed a clear hybridization signal (dark purple) in the epidermal cell layer of the pericarp, while the sense probe control showed no signal, further confirming that CsLTPG1 is highly expressed in the pericarp epidermal cells, which is consistent with its function of regulating the formation of the pericarp cuticle and wax.

[0053] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of this application. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.

Claims

1. Cucumber CsLTPG1 The application of genes in regulating cucumber peel brightness is characterized by, The cucumber CsLTPG1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The cucumber CsLTPG1 The gene encodes a GPI-anchored nonspecific lipid transfer protein, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The application involves using genetic engineering techniques to reduce the cucumber's... CsLTPG1 The expression level of the gene regulates the brightness of the cucumber peel without affecting the morphology of the cucumber's spines and nodules.

4. A method for constructing a high-gloss cucumber peel material, characterized in that, Using genetic engineering to knock out, silence, or inhibit cucumbers CsLTPG1 Gene expression was used to obtain cucumber materials with high pericarp gloss.

5. The method according to claim 4, characterized in that, The knockout, silencing, or suppression is performed using CRISPR-Cas9 or RNAi.

6. The method according to claim 5, characterized in that, The CRISPR / Cas9 knockout method includes the following steps: (1) Design of targeted cucumber CsLTPG1 sgRNA sequences in the gene coding region; (2) Construct an expression vector containing the Cas9 nuclease and the sgRNA; (3) The expression vector was transformed into cucumber plants using Agrobacterium-mediated transformation; (4) Select cucumbers CsLTPG1 Homozygous mutant lines with gene knockout.

7. The method according to claim 6, characterized in that, The targeted cucumber CsLTPG1 The nucleotide sequences of the target site sequences of the sgRNA sequences in the gene coding region are shown in SEQ ID NO.3 and SEQ ID NO.

4.

8. A method for breeding cucumbers with high-gloss peel, characterized in that, Using the methods described in claims 4-7, cucumber plants can be obtained as parent plants, and cucumbers with high-gloss peels can be obtained through transgenic, hybrid, backcross, self-pollination, or asexual reproduction.

Images