A method for preparing polydeoxyribonucleotides (PDRN) based on recombinant DNA technology

Abstract

This invention relates to a method for preparing polydeoxyribonucleotides (PDRNs) based on recombinant DNA technology. This invention designs a novel method for preparing PDRNs, applying recombinant DNA technology to the large-scale preparation of PDRNs. This eliminates dependence on animal-derived raw materials, utilizes a microbial fermentation platform for production, completely avoiding contamination by animal-derived pathogens and the risk of allergens. From DNA sequence design and fermentation to purification, all process parameters can be precisely monitored and standardized, ensuring precise and controllable product quality, high batch-to-batch consistency, and easy process scaling. This lays the foundation for the widespread application of PDRNs.

Description

[0001] This application claims priority to patent application number 202511422587.X (the earlier application was filed on September 30, 2025, and was entitled "A Method for Preparing Polydeoxyribonucleotide PDRN Based on Recombinant DNA Technology"). Technical Field

[0002] This invention belongs to the field of bioengineering technology and relates to a method for preparing polydeoxyribonucleotides (PDRN) based on recombinant DNA technology. Background Technology

[0003] Polydeoxyribonucleotide (PDRN) is a degradation product derived from salmon (Oncorhynchus keta) sperm DNA, composed of deoxyribonucleotide fragments of varying lengths. Studies have shown that PDRN possesses excellent tissue repair, anti-inflammatory, collagen regeneration-promoting, and skin microcirculation-improving effects, and is widely used in high-end skincare products, post-cosmetic surgery repair products, and medical devices.

[0004] Currently, commercially available PDRN primarily relies on extraction from salmon sperm. For example, CN118109455A discloses a method for extracting high-quality polydeoxyribonucleotides from frozen salmon testis tissue. The specific steps of this method are: S1: homogenizing salmon testis; S2: lysing to release DNA; S3: collecting and purifying DNA; S4: precipitating and concentrating DNA; S5: washing DNA; S6: ultrasonically breaking down DNA to obtain PDRN. However, this traditional method has many inherent drawbacks. High dependence on raw materials: The supply of raw materials is unstable due to limitations of fishery resources, season, and geographical factors; Large batch-to-batch variability: Different batches of salmon have slightly different genetic backgrounds, resulting in fluctuations in the DNA fragment composition and biological activity of the final product, affecting the uniformity of product quality; Biosafety risks: Despite purification processes, there is still a potential risk of introducing fish pathogens, viruses, or allergens, requiring extremely high safety control of the production process; Complex purification process: Purifying DNA fragments of a specific size from complex fish cell lysates involves cumbersome steps and high costs. Therefore, developing a salmon-independent method for preparing PDRN is currently one of the key issues of concern in this field. For example, CN119286960A discloses an enzymatic synthesis method for polydeoxyribonucleotides, which includes the following steps: 1) synthesizing a single-stranded DNA molecule at the 3' end of a base primer using TdT enzyme; the base primer is a single-stranded DNA molecule with a length of 5-100 nt composed of random bases; 2) amplifying the single-stranded DNA molecule to obtain an amplification product; 3) breaking the amplification product to obtain polydeoxyribonucleotides.

[0005] In conclusion, developing a novel method for the stable, safe, and scalable production of PDRN that is not dependent on salmon is of great significance to the field of PDRN. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a method for preparing polydeoxyribonucleotides (PDRN) based on recombinant DNA technology, developing a method for preparing PDRN that is independent of fish extraction, has uniform quality, and is safe and efficient.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for preparing polydeoxyribonucleotides, the method comprising: DNA tandem repeat sequences are fragmented to obtain polydeoxyribonucleotides; the DNA tandem repeat sequences contain multiple tandem repeat units; the repeat units are random sequences.

[0008] This invention presents a novel method for preparing polydeoxyribonucleotides. By breaking down specific DNA tandem repeat sequences, polydeoxyribonucleotides can be prepared efficiently. By using artificial recombinant DNA as raw material, the method eliminates the dependence on animal raw materials, ensures precise and controllable product quality, maintains high batch consistency, and facilitates process scaling up, thus possessing strong industrialization potential.

[0009] In this invention, the sequence and length of the repeating units can be set according to actual needs.

[0010] Preferably, the length of the repeating unit is 50~200 bp, for example, it can be 55, 60, 65, 70, 80, 90, 100, 150, 160, 170, 180, 185, 190 or 195 bp, etc.

[0011] Preferably, the proportion of A and T bases in the repeating unit is 50% to 70%, for example, it can be 51%, 52%, 53%, 54%, 55%, 60%, 65%, 66%, 67%, 68% or 69%, etc., preferably 58% to 62%.

[0012] In one specific embodiment of this application, the repeating unit sequence is shown in SEQ ID NO.1.

[0013] Preferably, the number of repeating units in the DNA tandem repeat sequence is 5 to 100.

[0014] Preferably, the length of the DNA tandem repeat sequence is 1 to 20 kb, for example, it can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 kb.

[0015] Preferably, the 5' and 3' ends of the DNA tandem repeat sequence have unique and distinct restriction endonuclease recognition sites.

[0016] Preferably, the restriction enzyme site at the 5' end of the DNA tandem repeat sequence includes EcoRI.

[0017] Preferably, the restriction enzyme site at the 3' end of the DNA tandem repeat sequence includes Hind III.

[0018] Preferably, the preparation method further includes the step of amplifying the DNA tandem repeat sequence, specifically including: The DNA tandem repeat sequence is inserted into an expression vector to obtain a recombinant vector. The recombinant vector is transduced into a host bacterium for fermentation culture. The bacterial cells are collected to isolate the recombinant plasmid. The 5' and 3' restriction enzyme sites of the DNA tandem repeat sequence in the recombinant plasmid are digested to separate the DNA tandem repeat sequence.

[0019] Preferably, the expression vector includes a plasmid vector.

[0020] Preferably, the plasmid vector includes pUC19 or pUC57.

[0021] Preferably, the host cell comprises Escherichia coli.

[0022] Preferably, the Escherichia coli includes Escherichia coli DH5α.

[0023] In this invention, parameters throughout the entire process, from DNA sequence design and fermentation to purification, can be precisely monitored and standardized, fundamentally solving the industry pain point of large batch-to-batch differences in natural products and ensuring the stability and reliability of product efficacy.

[0024] Preferably, the method for separating DNA tandem repeat sequences includes anion exchange chromatography.

[0025] This invention employs industrial-grade liquid chromatography to purify the target polymer, enabling seamless integration of the entire production process and facilitating large-scale scaling. It overcomes the core technological bottleneck hindering the industrialization of polydeoxyribonucleotides. This ensures the final product is 100% free of plasmid vector sequences, meeting the highest safety regulatory requirements for medical and cosmetic raw materials.

[0026] Preferably, the disruption process includes enzymatic digestion or ultrasonic treatment.

[0027] In this invention, by adjusting the base composition and breaking conditions of the repeating units, customized polydeoxyribonucleotide products with different functional focuses, such as stronger anti-inflammatory properties and better collagen-promoting abilities, can be produced in a targeted manner, achieving a leap from "extraction" to "design".

[0028] Preferably, the enzyme digestion process includes digesting the DNA tandem repeat sequence with deoxyribonuclease I.

[0029] Preferably, the interruption process further includes a purification step.

[0030] Preferably, the purification method includes ultrafiltration or size exclusion chromatography.

[0031] The fermentation, plasmid extraction, enzymatic digestion, and chromatographic purification technologies involved in this invention are all mature and scalable platform technologies in the biopharmaceutical field. The processes are robust, the costs are controllable, and they are easy to industrialize, laying the foundation for the widespread application of polydeoxyribonucleotides.

[0032] As a preferred technical solution, the schematic diagram of the preparation method of the polydeoxyribonucleotide is shown below. Figure 1 As shown, the specific steps include: (1) Insert the DNA tandem repeat sequence into a prokaryotic cloning vector to obtain a recombinant vector, and transduce the recombinant vector into a host bacterium to obtain an engineered bacterium; (2) Take the engineered bacteria for fermentation culture; (3) Collect the fermented bacterial cells and isolate and purify the recombinant plasmids therein; (4) The 5' and 3' restriction sites of the DNA tandem repeat sequence in the recombinant plasmid obtained in step (3) are used to separate and purify the DNA tandem repeat sequence; (5) The isolated DNA tandem repeat sequence was randomly digested by deoxyribonuclease I; the digested product was separated and purified by ultrafiltration or size exclusion chromatography to obtain polydeoxyribonucleic acid.

[0033] In a second aspect, the present invention provides a polydeoxyribonucleotide, which is prepared by the polydeoxyribonucleotide preparation method described in the first aspect.

[0034] Preferably, the polydeoxyribonucleotide has a molecular weight of 20 to 1000 kilodaltons.

[0035] Thirdly, the present invention provides the application of the polydeoxyribonucleotides described in the second aspect in beauty and skin care or in the preparation of corresponding cosmetics; the beauty and skin care includes at least one of skin regeneration, elasticity enhancement, skin tone improvement or anti-inflammatory repair formulas.

[0036] Compared with the prior art, the present invention has the following beneficial effects: This invention presents a novel method for preparing polydeoxyribonucleotides, applying recombinant DNA technology to the large-scale preparation of polydeoxyribonucleotides. This method eliminates the dependence on animal raw materials and utilizes a microbial fermentation platform, completely avoiding contamination by animal-derived pathogens and the risk of allergens. From DNA sequence design and fermentation to purification, all process parameters can be precisely monitored and standardized, ensuring precise and controllable product quality, high batch-to-batch consistency, and easy process scaling. This lays the foundation for the widespread application of polydeoxyribonucleotides. Attached Figure Description

[0037] Figure 1 This is a schematic diagram of the preparation method of polydeoxyribonucleotides of the present invention.

[0038] Figure 2 This is a diagram of the agarose gel electrophoresis results.

[0039] Figure 3 This is a graph showing the qPCR results.

[0040] Figure 4 This is a diagram showing the results of an epidermal cell scratch repair experiment. Detailed Implementation

[0041] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0042] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0043] In a specific embodiment of the present invention, taking the repeat unit sequence as SEQ ID NO.1 as an example, the technical solution is verified that the DNA tandem repeat sequence includes 5 tandem repeat unit sequences.

[0044] SEQ ID NO.1: TCTCAAACAGTGAGAGCGTTCTACCTCGTTAGGTCTGCTAACGCGCTATAATATAGTTAAAGAGCATGTGGTTTCAAACCGTTTTCAGGCCTTCTATTTCGACACAGTAACCACAGAGCCAAATTCCGCTCTTAACGTATGGAAATATCGAATGTAATCTAATCCATGTAGAATAACTCTATAGATCTACCAACGGCAT.

[0045] In a specific embodiment of the present invention, the fermentation medium is LB liquid medium.

[0046] In a specific embodiment of the present invention, the restriction endonuclease EcoR I (NEB #R0101), the restriction endonuclease HindIII (NEB #R0104), and the deoxyribonuclease I (DNase I, Yisheng Bio #10607ES81) are used.

[0047] Example 1 This embodiment constructs an engineered bacterium that expresses DNA tandem repeat sequences.

[0048] A synthetic DNA tandem repeat sequence was created, with an EcoRI restriction site introduced at the 5' end and a HindIII restriction site introduced at the 3' end. This sequence was then cloned into a high-copy-number plasmid vector (pUC19) to construct a recombinant expression plasmid. This plasmid was transformed into the engineered host bacterium *Escherichia coli* DH5α to obtain a genetically engineered bacterium that produces high levels of DNA polymers. Colony PCR and other verification methods were performed to identify successfully transformed engineered bacteria.

[0049] Example 2 This embodiment involves engineered bacterial fermentation and plasmid extraction.

[0050] The engineered bacteria constructed in Example 1 were fermented and cultured at 37°C for 48 h with a shaking speed of 180 rpm. After fermentation, the bacterial cells were collected, and high-purity recombinant expression plasmids were isolated and purified from the bacterial cells using alkaline lysis combined with chromatography, effectively removing impurities such as host genomic DNA, RNA, and protein.

[0051] Example 3 This embodiment involves the enzyme digestion and purification of the recombinant expression plasmid.

[0052] The recombinant expression plasmid prepared in Example 2 was double-digested with two corresponding restriction endonucleases (EcoR I and HindIII). The digestion reaction system is shown in Table 1. The digestion reaction conditions were 37℃ for 4 h, yielding a mixture of DNA tandem repeat sequences, linearized vector sequences, and possibly incompletely digested products. To separate the DNA tandem repeat sequences, anion exchange chromatography (Nanomicro #NW Rose Q FF) was used to separate and purify the mixed products after double digestion. The method was as follows: the column was equilibrated with 20 mM Tris-HCl pH8, and the sample was loaded at a fixed flow rate for double digestion to ensure sufficient binding of nucleic acid molecules to the chromatographic packing material. After loading, 20 mM Tris-HCl pH8 was used to wash away insufficiently bound nucleic acid molecules. Finally, 20 mM Tris-HCl and 200 mM NaCl pH8 were used to collect the high-purity DNA tandem repeat sequences.

[0053] Table 1 Example 4 This embodiment describes the preparation of polydeoxyribonucleotides.

[0054] The DNA tandem repeat sequence prepared in Example 3 was randomly digested with deoxyribonuclease I. The digestion reaction system is shown in Table 2. The digestion reaction conditions were: 37℃ for 1 h.

[0055] Table 2 After enzyme digestion, the target polydeoxyribonucleotide fragment mixture of 50-1000 bp length is separated and purified using a 30kD ultrafiltration membrane or size exclusion chromatography. Preferably, this embodiment uses size exclusion chromatography to separate and purify polydeoxyribonucleotides as an example. The method is as follows: After equilibrating the NW Rose4 FF chromatography column with 20mM PB 150mM NaCl pH 7.4 buffer, the sample is digested with enzyme at a fixed flow rate of 1% of the column volume. After the sample is loaded, the target polydeoxyribonucleotide fragment mixture of 50-1000 bp length is slowly eluted with 20mM PB 150mM NaCl pH 7.4 buffer.

[0056] The purified polydeoxyribonucleotides are dissolved in sterile water to form a solution, or freeze-dried to form a powder.

[0057] Example 5 This embodiment further verifies and tests the prepared polydeoxyribonucleotides.

[0058] Specifically, this includes: performing agarose gel electrophoresis on the polydeoxyribonucleotides prepared in Example 4. The electrophoresis method is as follows: a 1% agarose gel is prepared with 1×TAE solution. After purification, the polydeoxyribonucleotides are mixed with the loading buffer and loaded onto the gel. The gel is run at 120V for 30 minutes, followed by imaging with a UV gel imaging system. The agarose gel electrophoresis results are as follows. Figure 2 As shown, the product distribution is 50-1000 bp, indicating that the polydeoxyribonucleotide was successfully prepared. The polydeoxyribonucleotides prepared in Example 4 were used as a detection template, and the pUC19 vector was used as a standard for qPCR detection. The qPCR method is as follows: 1 μL of the template was mixed with qPCR reagent, and amplification was performed using primers designed with the pUC19 vector-specific sequence ampicillin gene (5': AGCGTTACCCAACTTAATCGC, 3': TCATGTAATCGTCTATGACGTTG). The qPCR results are shown below. Figure 3 As shown, the vector fragment in the amplification product using PDRN as a template showed no signal, confirming the absence of pUC19 vector sequence residue. The polydeoxyribonucleotides prepared in Example 4 were used to conduct an epidermal cell scratch repair experiment. The specific method is as follows: human dermal fibroblasts (HDF) in the logarithmic growth phase were digested with trypsin and then resuspended in complete culture medium to 5×10⁻⁶. 5 Cells were seeded at a rate of 2 mL / well in a 6-well cell culture plate and cultured at 37°C and 5% CO2 for 24 h until cell confluence was greater than 90%. A uniformly wide slit was made in the center of each well using a 200 mL sterile pipette tip. Cells were washed three times with PBS buffer. A low-serum medium solution containing 100 μg / mL of prepared polydeoxyribonucleotides was added as a control, and the cells were cultured for another 24 h. The results were observed using a fluorescence inverted microscope. Figure 4 As shown, the cell scratches with added polydeoxyribonucleotides were significantly narrowed, proving that the recombinant PDRN obtained by the method of this invention has repair capabilities.

[0059] In summary, this invention applies recombinant DNA technology to the large-scale preparation of PDRN, providing not only a new product but also a novel technical pathway for the production of active DNA raw materials through a "design-fermentation-purification" process, offering new ideas for the preparation of corresponding products.

[0060] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A method for preparing polydeoxyribonucleotides, characterized in that, The method includes: DNA tandem repeat sequences were fragmented to obtain polydeoxyribonucleotides; The DNA tandem repeat sequence contains multiple tandem repeat units; The repeating unit is a random sequence.

2. The method for preparing polydeoxyribonucleotides according to claim 1, characterized in that, The length of the repeating unit is 50~200 bp.

3. The method for preparing polydeoxyribonucleotides according to claim 1 or 2, characterized in that, The number of repeat units in the DNA tandem repeat sequence is 5 to 100; Preferably, the length of the DNA tandem repeat sequence is 1~20 kb; Preferably, the 5' and 3' ends of the DNA tandem repeat sequence have unique and distinct restriction endonuclease recognition sites; Preferably, the restriction enzyme site at the 5' end of the DNA tandem repeat sequence includes EcoRI; Preferably, the restriction enzyme site at the 3' end of the DNA tandem repeat sequence includes Hind III.

4. The method for preparing polydeoxyribonucleotides according to any one of claims 1-3, characterized in that, The preparation method further includes the step of amplifying the DNA tandem repeat sequence, specifically including: The DNA tandem repeat sequence is inserted into an expression vector to obtain a recombinant vector. The recombinant vector is transduced into a host bacterium for fermentation culture. The bacterial cells are collected to isolate the recombinant plasmid. The 5' and 3' restriction enzyme sites of the DNA tandem repeat sequence in the recombinant plasmid are digested to separate the DNA tandem repeat sequence.

5. The method for preparing polydeoxyribonucleotides according to claim 4, characterized in that, The expression vector includes a plasmid vector; Preferably, the plasmid vector comprises pUC19 or pUC57; Preferably, the host cell comprises Escherichia coli; Preferably, the Escherichia coli includes Escherichia coli DH5α.

6. The method for preparing polydeoxyribonucleotides according to any one of claims 1-5, characterized in that, The disruption process includes enzymatic digestion or ultrasonic treatment.

7. The method for preparing polydeoxyribonucleotides according to claim 6, characterized in that, The enzyme digestion process includes digesting the DNA tandem repeat sequence with deoxyribonuclease I; Preferably, the interruption process further includes a purification step; Preferably, the purification method includes ultrafiltration or size exclusion chromatography.

8. A polydeoxyribonucleotide, characterized in that, The polydeoxyribonucleotide is prepared by the method for preparing polydeoxyribonucleotide according to any one of claims 1-7.

9. The polydeoxyribonucleotide according to claim 8, characterized in that, The molecular weight of the polydeoxyribonucleotide is 20-1000 kilodaltons.

10. The application of the polydeoxyribonucleotide according to claim 8 or 9 in skin care or in the preparation of corresponding cosmetics; The beauty and skincare products mentioned include at least one of the following: skin regeneration, elasticity enhancement, skin tone improvement, or anti-inflammatory repair.

Images