A specific DNA fragment for identifying a specific DNA fragment of a golden apple snail, products and methods

Abstract

This invention relates to the field of biological detection, specifically to a specific DNA fragment, identification reagent, and identification method for identifying *Pomacea canaliculata*. The invention proposes a genomic DNA fragment, as shown in SEQ ID NO:1, which is unique to the target species *Pomacea canaliculata*, exhibiting higher specificity, reducing the false positive rate, and improving the detection rate and accuracy. This enables accurate detection under conditions such as different survival states and incomplete specimens. The invention also proposes a kit and method for identifying *Pomacea canaliculata*, designed based on the aforementioned specific genomic DNA fragment, which has advantages such as simple operation and fast reaction speed.

Description

Invention Field

[0001] This invention relates to the field of biological detection, specifically to a reagent and method for identifying specific DNA fragments from the golden apple snail. Background Technology

[0002] Small golden apple snail ( Pomacea canaliculata The golden apple snail (Pomacea canaliculata) is a freshwater snail native to South America. It is listed by the International Union for Conservation of Nature (IUCN) as one of the world's 100 invasive alien species and is also included in my country's first list of invasive alien species. The golden apple snail has a flexible diet, consuming not only crops and aquatic plants but also preying on small snails and other aquatic animals. It is characterized by high reproductive rate, rapid growth, and a lack of effective natural predators in invasive wetlands. It also exhibits strong adaptability to harsh environmental conditions such as low dissolved oxygen concentrations, high nutrient content, limited food supply, and extreme temperatures. The health, economic, and environmental problems caused by the invasion of the golden apple snail are irreversible, and most effective control methods are not only costly but also prone to environmental damage.

[0003] Rapid identification and control of invasive species are crucial for their early prevention and integrated management. (Examples: *Pomacea canaliculata* and *Pomacea maculatus*) Pomacea maculata Similar in characteristics and morphology, these organisms are easily confused based on morphology alone, making them difficult to distinguish in the field. Currently, commonly used molecular identification markers mainly consist of specific segments of conserved mitochondrial genes (COⅠ, 16S rDNA, etc.). However, their accuracy is still insufficient for detecting invasive species with complex genetic populations, rapid evolutionary rates, and varying risks of causing disasters, such as pathogenic microorganisms. Therefore, the development of novel markers that utilize multi-omics big data, including genomics, is urgently needed.

[0004] Currently, commonly used molecular identification methods mainly include RAPD (Randomly Amplified Polymorphic DNA), RFLP (Restriction Fragment Length Polymorphism), AFLP (Amplified Fragment Length Polymorphism), SSCP (Single Strand Conformation Polymorphisms), and DNA sequence analysis. RAPD technology is a basic molecular identification and genetic polymorphism analysis method. Its advantages include requiring relatively few DNA samples, simple experimental operation, short cycle time, and the ability to screen a large number of samples simultaneously. However, due to its low annealing temperature, it suffers from poor specificity and reproducibility. RFLP technology, based on polymerase chain reaction (PCR), involves cutting specific fragments and then detecting them using agarose gel electrophoresis. It is characterized by its intuitiveness, sensitivity, good reproducibility, and high specificity. However, because this method is based on known sequences, it cannot obtain satisfactory results for species with unknown sequences, making it less suitable for population polymorphism studies. SSCP technology uses non-denaturing polyacrylamide as a medium to electrophores appropriately sized single-stranded DNA (ssDNA) fragments, which are then visualized to observe differences in migration rates between the ssDNA fragments. However, this technology may not detect all mutation sites, and the results are easily affected by electrophoresis temperature, buffer composition, and electrophoresis conditions.

[0005] In summary, existing detection methods suffer from drawbacks such as long operation time, high operational requirements, and poor detection accuracy, and some methods are also expensive. Therefore, it is necessary to research a fast, highly specific, and low-cost identification product and method for *Pomacea canaliculata*. Summary of the Invention

[0006] The primary objective of this invention is to provide a method, product, and approach for identifying specific DNA fragments from Pomacea canaliculata. This invention overcomes the shortcomings of existing methods, such as long operation time, high operational requirements, and poor detection accuracy.

[0007] This invention proposes the use of gene fragments, such as those shown in SEQ ID NO: 1, in the identification of Pomacea canaliculata.

[0008] This invention proposes a product for identifying Pomacea canaliculata, comprising: a reagent for detecting whether a sample to be tested contains a gene fragment as shown in SEQ ID NO: 1.

[0009] This invention proposes a primer pair and probe for identifying *Pomacea canaliculata*. The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3; the probe has a nucleotide sequence as shown in SEQ ID NO: 4.

[0010] Optionally, the upstream primer or the downstream primer has an A attached to its 5' or 3' end, and the probe has a B attached to its 5' or 3' end; wherein A and B represent different markers. Optionally, A is selected from biotin or digoxin, and B is selected from FITC.

[0011] This invention proposes an isothermal amplification kit for identifying Pomacea canaliculata, comprising isothermal amplification reagent and test strip; the isothermal amplification reagent contains the aforementioned primer pair and probe; Optionally, the isothermal amplification reagent includes a primer mixture and a reaction enzyme mixture.

[0012] Optionally, based on a 50 μL reaction system, the concentration of the upstream primer in the primer mixture is 0.1 ~ 1 nmol / L, the concentration of the downstream primer is 0.1 ~ 1 nmol / L, and the concentration of the probe is 0.02 ~ 0.2 nmol / L.

[0013] Optionally, based on a 50 μL reaction system, the concentration of the upstream primer is 0.2 nmol / L, the concentration of the downstream primer is 0.2 nmol / L, and the concentration of the probe is 0.06 nmol / L.

[0014] Optionally, the primer mixture also contains buffer A and buffer B; buffer A has a volume percentage of 55% to 60% and buffer B has a volume percentage of 4% to 6%.

[0015] Optionally, buffer A contains 20 mM Tris-HCl, 150 mM KCl, 5 v / v% PEG, and 1 v / v% TRITON-X100; buffer B contains 200 mM magnesium acetate.

[0016] Optionally, the reaction enzyme mixture contains reverse transcriptase, endonuclease, DNA polymerase, single-stranded DNA-binding protein, and recombinase.

[0017] Optionally, the content of each component in the reaction enzyme mixture is as follows: based on a 50 μL reaction volume, the reaction enzyme mixture contains 520-725 ng / μL of recombinant enzyme, 100-200 ng / μL of single-stranded DNA binding protein, 350-450 ng / μL of DNA polymerase, 300-400 ng / μL of endonuclease, and 480-500 ng / μL of reverse transcriptase.

[0018] Optionally, the reaction enzyme mixture is a lyophilized powder, and also includes a lyophilization support agent.

[0019] Optionally, the isothermal amplification kit also includes colloidal gold test strips.

[0020] Optionally, when the 5' end of the downstream primer is connected to marker A and the 5' end of the probe is connected to marker B, the conjugation pad of the colloidal gold test strip is coated with an antibody-colloidal gold labeling against marker A, the detection line of the colloidal gold test strip is coated with an anti-B antibody, and the control line of the colloidal gold test strip is coated with a secondary antibody for binding A.

[0021] Optionally, when the 5' end of the downstream primer is connected to biotin and the 5' end of the probe is connected to FITC, the conjugation pad of the colloidal gold test strip is coated with a biotin antibody-colloidal gold label, the detection line of the colloidal gold test strip is coated with FITC antibody, and the control line of the colloidal gold test strip is coated with a secondary antibody for binding biotin.

[0022] Optionally, when the 5' end of the downstream primer is connected to digoxigenin and the 5' end of the probe is connected to FITC, the conjugation pad of the colloidal gold test strip is coated with digoxigenin antibody-colloidal gold label, the detection line of the colloidal gold test strip is coated with FITC antibody, and the control line of the colloidal gold test strip is coated with secondary antibody for binding digoxigenin.

[0023] This invention also proposes a method for identifying *Pomacea canaliculata*, using the aforementioned isothermal amplification kit.

[0024] Optionally, the following steps are included: Add the DNA sample to be tested to the isothermal amplification reagent. After the isothermal amplification reaction, use the test strip to develop color and observe the interpretation results of the control line and the test line. Optionally, the DNA sample to be tested and the primer mixture are added to the reaction enzyme mixture. After the amplification reaction is carried out at an isothermal temperature, the reaction product is diluted and the test strip is used for color development. If both the control line and the test line show color, the result is positive. If only the control line shows color, the result is negative. If neither the control line nor the test line shows color, the result is invalid.

[0025] Optionally, the temperature of the isothermal amplification reaction is 30 to 40°C.

[0026] Optionally, the isothermal amplification reaction takes 10 to 30 minutes.

[0027] Optionally, the dilution factor of the diluted reaction product is 10 to 50 times, and more specifically 20 times.

[0028] Compared with the prior art, the technical solution of this invention has the following advantages: This invention screens and obtains a specific genomic DNA fragment unique to the target species, Pomacea canaliculata. This fragment differs from traditional mitochondrial markers, exhibiting higher specificity, reducing the false positive rate, and improving the detection rate and accuracy. It enables accurate detection under various survival states and incomplete sample conditions.

[0029] This invention also proposes a reagent for identifying *Pomacea canaliculata*, designed based on the aforementioned specific genomic DNA fragment. This invention employs the Multienzyme Isothermal Amplification (MIRA-LFD) method, utilizing three core components—DNA polymerase, single-stranded DNA-binding protein, and recombinase—to assist DNA amplification. This achieves extremely high detection sensitivity and specificity in a short time, suitable for rapid detection of various samples, requiring less than 20 minutes. In a preferred embodiment, by designing primers and probes with modified groups, combined with a sandwich-style nucleic acid detection strip, the detection of different targets in the sample can be achieved.

[0030] The method of this invention does not require repeated temperature changes and has significant advantages over PCR in terms of detection speed and portability. It is characterized by simple operation, speed, high sensitivity and specificity, and has good development prospects. Attached Figure Description

[0031] Figure 1 Electrophoresis results of specific primers for *Pomacea canaliculata*: 1. *Pomacea canaliculata* P. canaliculata 2. Spotted apple snail P. maculata 3. Pear-shaped ring-shaped snail B. purificata 4. Corner Moon Clam L. cornuum 5. Short-fleshed spear mussel L. glayana ; 6. Japanese clam C. japonica 7. Guangxi Gouquan S. guangxiensis ; Figure 2 Preliminary screening of primers and probes for the MIRA-LFD system of Pomacea canaliculata; Figure 3 Secondary screening of primers and probes for the MIRA-LFD system of Pomacea canaliculata; Figure 4 For the specificity detection of primers and probes in the MIRA-LFD system of Pomacea canaliculata; Figure 5To detect the sensitivity of primers and probes in the MIRA-LFD system of *Pomacea canaliculata*. Detailed Implementation

[0032] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the specification.

[0033] For detailed implementation methods of this invention, please refer to the embodiments. Unless otherwise specified, the experimental methods and reagents described in the embodiments are conventional experimental methods and reagents. The following embodiments are for illustration and explanation only, and are not intended to limit the invention in any way.

[0034] The first aspect of this invention proposes the application of a gene fragment, as shown in SEQ ID NO: 1, in the identification of *Pomacea canaliculata*, establishing a simple, rapid, specific, and simultaneous nucleic acid detection method for *Pomacea canaliculata* and similar species such as *Pomacea canaliculata*. The gene fragment shown in SEQ ID NO: 1 proposed in this invention differs from traditional mitochondrial markers, such as the traditional Cox1 gene marker, which is present in all species. Its species specificity mainly stems from differences in the sequence of certain bases, and its resolution decreases with increasing species diversity and complexity. This invention obtains a specific DNA fragment from the genome, unique to the target species *Pomacea canaliculata*, exhibiting higher specificity and significantly reducing the false positive rate when used for *Pomacea canaliculata* identification.

[0035] The nucleotide sequence of SEQ ID NO: 1 is as follows: ctttaggctttgaaggcccatggtcttattaacctaaaatcttacaattataaatttactagaagaaatagtctttcttaaggaatcaaaatccttcgtgccaaacaccgcttagtaacaaaata agtacattttttaaatttattaatcttcttacttggaaggtaagtgtacaactattatacttaaaatgttataatgtattgatacaaattttatatttttagtataaaaatactcttttgagatg aaatttcaacgtgcatacatacaccataaaaactcttgtaaataaatgttaaagtttatttagttttaattaattcttttaatcaaaaattgatttgatcttagttgtaataataaataatatg aacttggaaatacacatggttcttttagttggggtgaggtagataaataatttttttataaattaaaaattgtaaaaaatttttttaactaagtattatttacaagataatgctaaatggaaaca In this embodiment of the invention, the specific sequence of *Pomacea canaliculata* shown in SEQ ID NO: 1 was compared with the genome data of several other similar mollusks. The results showed that the sequence could only be matched with *Pomacea canaliculata*, indicating that the selected *Pomacea canaliculata*-specific fragment has obvious specificity.

[0036] A second aspect of this invention provides a product for identifying *Pomacea canaliculata*, comprising a reagent for detecting whether a sample contains a gene fragment as shown in SEQ ID NO: 1. This identification product can be applied using various methods, such as conventional PCR amplification or isothermal amplification.

[0037] A third aspect of this invention proposes a primer pair and probe for identifying *Pomacea canaliculata* using an isothermal amplification method. The primer pair includes an upstream primer with the nucleotide sequence shown in SEQ ID NO: 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO: 3; the probe has the nucleotide sequence shown in SEQ ID NO: 4; the 5' or 3' end of the upstream or downstream primer is connected to A, and the 5' or 3' end of the probe is connected to B; wherein A and B represent different markers; optionally, A is selected from biotin or digoxigenin, and B is selected from FITC. The sequences of the primers and probe are shown in Table 1.

[0038] Table 1 The isothermal amplification method proposed in this invention identifies primer pairs and probes for *Pomacea canaliculata*. Following the principle of colloidal gold test strips, the selected primers are modified: a marker A is labeled at the 5' end of the downstream primer; a sequence complementary to the target fragment is designed between the upstream and downstream primers, with an antigen marker modified at its 5' end; a dSpacer is labeled at the midpoint between the 5' and 3' ends; and a modifying group is labeled at the 3' end.

[0039] A fourth aspect of this invention provides an isothermal amplification kit for identifying *Pomacea canaliculata*, comprising an isothermal amplification reagent and a test strip. The isothermal amplification reagent contains the aforementioned primer pair and probe. This isothermal amplification kit eliminates the need for repeated temperature changes during use, offering significant advantages over conventional PCR in terms of detection speed and portability. It is characterized by its simplicity, speed, high sensitivity, and specificity, and thus shows promising development prospects.

[0040] As an improvement of this invention, the isothermal amplification reagent includes separately packaged primer mixtures and reaction enzyme mixtures. Aliquoting the primers and reaction enzymes reduces the risk of contamination and cross-contamination, extends shelf life, improves the reproducibility and consistency of the experiment, and facilitates experimental procedures.

[0041] As an improvement to this embodiment of the invention, based on a 50 μL reaction system, the concentration of the upstream primer in the primer mixture is 0.1 ~ 1 nmol / L, the concentration of the downstream primer is 0.1 ~ 1 nmol / L, and the concentration of the probe is 0.02 ~ 0.2 nmol / L.

[0042] As an improvement to this embodiment of the invention, based on a 50 μL reaction system, the concentration of the upstream primer in the primer mixture is 0.2 nmol / L, the concentration of the downstream primer is 0.2 nmol / L, and the concentration of the probe is 0.06 nmol / L.

[0043] As an improvement of this embodiment of the invention, the primer mixture also contains A buffer and B buffer; the volume percentage of A buffer is 60% to 66.7%, and the volume percentage of B buffer is 4% to 6%.

[0044] Buffer A contains 20 mM Tris-HCl (pH 8.5, 25℃), 150 mM KCl, 5 v / v% PEG, and 1 v / v% TRITON-X100; Buffer B contains 200 mM magnesium acetate.

[0045] As an improvement to this invention, the reaction enzyme mixture contains reverse transcriptase, endonuclease, DNA polymerase, single-stranded DNA-binding protein, and recombinase. The kit of this invention employs the Multi-Enzyme Isothermal Amplification Strip Method (MIRA-LFD), using three core substances—DNA polymerase, single-stranded DNA-binding protein, and recombinase—to assist DNA amplification. This achieves extremely high detection sensitivity and specificity in a short time, suitable for rapid detection of various samples, requiring less than 20 minutes. This suitability for rapid detection of various samples accelerates the realization of "one-sample, one-test" for plant and animal pests.

[0046] As an improvement of this embodiment of the invention, the content of each component in the reaction enzyme mixture is as follows: based on a 50 μL reaction volume, the reaction enzyme mixture contains 520-725 ng / μL of recombinant enzyme, 100-200 ng / μL of single-stranded DNA binding protein, 350-450 ng / μL of DNA polymerase, 300-400 ng / μL of endonuclease, and 480-500 ng / μL of reverse transcriptase.

[0047] The reaction enzyme mixture is a lyophilized powder, and also contains lyophilization support agents, etc.

[0048] As an improvement to this embodiment of the invention, the composition of the kit of this embodiment is shown in Table 2: Table 2 As a specific embodiment of the present invention, the composition of the kit of the present invention is shown in Table 3: Table 3 The fifth aspect of this invention provides a method for identifying *Pomacea canaliculata*, using the aforementioned isothermal amplification kit. Specifically, the method includes the following steps: adding the DNA sample of the insect to be tested to the isothermal amplification reagent, mixing thoroughly, and allowing the reaction to proceed. After the reaction, the amplification product is diluted with ddH2O, mixed thoroughly, and then tested with a test strip for color development. The results of interpreting the control line and the test line are observed. If both the control line and the test line show color, the result is positive; if only the control line shows color, the result is negative; if neither the control line nor the test line shows color, the result is invalid.

[0049] As an improvement to this invention, the DNA sample of the insect to be tested can be extracted using a thermal lysis method. This method is simple, rapid, efficient, widely applicable, and requires no expensive equipment.

[0050] As an improvement to this embodiment of the invention, the temperature of the isothermal reaction can be 30 to 40°C.

[0051] As an improvement to this embodiment of the invention, the isothermal reaction time can be 10 to 30 minutes, specifically 15 minutes.

[0052] As an improvement of this invention, the dilution factor of the dilution reaction product is 10 to 50 times, and more specifically 20 times.

[0053] Example 1 This embodiment is used to illustrate the bioinformatics specificity of the gene fragment shown in SEQ ID NO: 1.

[0054] Genome data for *Pomacea canaliculata* and its closely related species, including *Pomacea maculata*, *Lanistes nyassanus*, *Marisa cornuarietis*, *Sinotaia purificata*, and *Oncomelania hupensis*, were retrieved from the National Center for Biotechnology Information (NCBI) database. A database of genomes of closely related species of *Pomacea canaliculata* was established. Genome alignment was performed using a self-developed program to screen for specific fragments from *Pomacea canaliculata*. The selected sequences were then validated for specificity using the NCBI Nucleotide BLAST alignment function.

[0055] The specific fragments of *Pomacea canaliculata* were compared with gene fragments from other similar species using blastn alignment analysis in BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0056] To verify its bioinformatics specificity, this sequence was compared with those of the genera *Pomacea* (taxid: 72702), *Gastropoda* (taxid: 6448), *Mollusca* (taxid: 6447), and protostomes via BLAST. Only the genome of *Pomacea canaliculata* was matched. This indicates that this sequence is specific to *Pomacea canaliculata*.

[0057] Example 2 This embodiment verifies the specificity of the gene fragment shown in SEQ ID NO: 1 using conventional PCR.

[0058] The primers used in routine PCR are shown in Table 4: Table 4: Common PCR Primers The reaction system is shown in Table 5: Table 5: PCR reaction system The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 20 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min. The marker used was GoldBand DL2,000 DNA Marker (Yisheng Biotechnology). PCR products were analyzed by 1% agarose gel electrophoresis (140V for 20 min) using a gel imaging system. The electrophoresis results of different species amplified with *Pomacea canaliculata*-specific primers are shown below. Figure 1 As shown.

[0059] like Figure 1 As shown, only the PCR product of the Golden Apple Snail DNA template showed a clear band, proving that the primer can achieve specific amplification of Golden Apple Snail, further verifying that the fragment is a specific fragment of Golden Apple Snail.

[0060] Example 3 This embodiment presents an isothermal amplification kit for identifying Pomacea canaliculata.

[0061] The kit contains isothermal amplification reagents and probe excision reagents, the specific composition of which is shown in Table 3, and the sequences of primers and probes are shown in Table 1.

[0062] The method of use is as follows: DNA samples to be tested are extracted using the thermal lysis method, and blood samples are extracted using the DNeasyBlood&Tissue Kit.

[0063] Example 4 This example illustrates the primer screening process: 1. Initial screening: The isothermal amplification primer set is designed as shown in the table. The reaction system is configured according to the reagent composition in Table 3. The detection method is the same as in Example 3.

[0064] Preliminary screening of the designed primer sets was performed using Pomacea canaliculata DNA. The results showed that the control and test lines of all six primer sets and the positive control were colored. Figure 2 The result was positive, indicating that all six primer sets could amplify the DNA from the golden apple snail.

[0065] Table 6: Preliminary screening of primer sets Preliminary screening of the designed primer sets was performed using *Pomacea canaliculata* DNA. Results showed that all six primer sets and the positive control showed color development at both the control and test lines. The experimental results are as follows: Figure 2 As shown.

[0066] Depend on Figure 2 As can be seen, all groups showed positive results, indicating that all six primer groups could amplify the DNA from the golden apple snail.

[0067] 2. Secondary screening: To verify whether false positives would occur with each primer set, two treatments were set for each of the six primer sets (primers in the same set were treated with a small tube of golden apple snail DNA and primers in DEPC water only) for secondary screening. The results are as follows: Figure 3 As shown.

[0068] Depend on Figure 3 It can be seen that only the control line and test line of the treatment group with added golden apple snail DNA showed color and were positive in all primer sets. This indicates that all six primer sets can be used for subsequent experiments. The test results of primer set 2 have higher color differentiation between the test line and the control line, and the results are more convenient and accurate to interpret by the naked eye. The test stability is stronger. Therefore, primer set 2 was selected for subsequent experiments.

[0069] Example 4 This embodiment verifies the specificity of the primers using an isothermal amplification method.

[0070] To verify its specificity experimentally, upstream and downstream primers were designed based on the screened sequences: upstream primer N7-FW and downstream primer N7-RV, respectively. Seven DNA samples were used in the PCR reaction: *Pomacea canaliculata*, *Pomacea canaliculata*, *Bellamya purificata*, *Lamprotula cornuum*, *Lanceolaria glayana*, *Corbicula japonica*, and *Sulcospira guangxiensis*. The reaction system was prepared according to the reagent composition in Table 3, and the detection method was the same as in Example 3. The detection results are as follows: Figure 4 As shown.

[0071] Depend on Figure 4 It can be seen that, except for the positive control, only the *Pomacea canaliculata* sample showed color development on both the control and test lines, indicating a positive result. The other samples and the negative control only showed color development on the control line, indicating a negative result. These results indicate that this primer set can achieve specific amplification of *Pomacea canaliculata*.

[0072] Example 5 This embodiment verifies the sensitivity of the method using an isothermal amplification method.

[0073] The concentration of *Pomacea canaliculata* DNA template used was 75 ng / μL. It was serially diluted 6 times (10-fold) with DEPC water. After adding 2 μL of template DNA to each test, the concentrations of *Pomacea canaliculata* DNA in each test were: 15 ng, 1.5 ng, 0.15 ng, 0.015 ng, 0.0015 ng, and 0.00015 ng, respectively. The reaction system was prepared according to the reagent composition in Table 3, and the detection method was the same as in Example 3. The experimental results are as follows: Figure 5 As shown.

[0074] Depend on Figure 5 It can be seen that both the control line and the test line will show color when the DNA template content is 0.015 ng or higher. However, the band color of the test line is lighter when the DNA template content is 0.015 ng, indicating that the system can detect a minimum DNA template content of about 0.015 ng. If the DNA template concentration used is too low, it will affect the test results.

[0075] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments described herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Including the use of the gene fragment shown in SEQ ID NO: 1 in the identification of Pomacea canaliculata.

2. A product for identifying *Pomacea canaliculata*, characterized in that, The product includes a reagent for detecting whether a sample to be tested contains a gene fragment as shown in SEQ ID NO:

1.

3. A primer pair and probe for identifying *Pomacea canaliculata*, characterized in that, The primer pair comprises: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4; Optionally, the upstream primer or the downstream primer has an A connected to its 5' or 3' end, and the probe has a B connected to its 5' or 3' end; wherein A and B represent different markers; Optionally, A is selected from biotin or digoxin, and B is selected from FITC.

4. A thermostatic amplification kit for identifying *Pomacea canaliculata*, characterized in that, The isothermal amplification kit contains isothermal amplification reagents and test strips; the isothermal amplification reagents contain the primer pairs and probes as described in claim 3; Optionally, the isothermal amplification reagent includes a primer mixture and a reaction enzyme mixture.

5. The isothermal amplification kit according to claim 4, characterized in that, Based on a 50 μL reaction system, the concentration of the upstream primer in the primer mixture is 0.1 ~ 1 nmol / L, the concentration of the downstream primer is 0.1 ~ 1 nmol / L, and the concentration of the probe is 0.02 ~ 0.2 nmol / L. Optionally, based on a 50 μL reaction system, the concentration of the upstream primer is 0.2 nmol / L, the concentration of the downstream primer is 0.2 nmol / L, and the concentration of the probe is 0.06 nmol / L; Optionally, the primer mixture further contains buffer A and buffer B; buffer A has a volume percentage of 55% to 60%, and buffer B has a volume percentage of 4% to 6%. Optionally, buffer A contains 20 mM Tris-HCl, 150 mM KCl, 5 v / v% PEG, and 1 v / v% TRITON-X100; buffer B contains 200 mM magnesium acetate.

6. The isothermal amplification kit according to claim 4, characterized in that, The reaction enzyme mixture contains reverse transcriptase, endonuclease, DNA polymerase, single-stranded DNA binding protein, and recombinase; Optionally, the content of each component in the reaction enzyme mixture is as follows: based on a 50 μL reaction volume, the reaction enzyme mixture contains 520-725 ng / μL of recombinant enzyme, 100-200 ng / μL of single-stranded DNA binding protein, 350-450 ng / μL of DNA polymerase, 300-400 ng / μL of endonuclease, and 480-500 ng / μL of reverse transcriptase; Optionally, the reaction enzyme mixture is a lyophilized powder, and also includes a lyophilization support agent.

7. The isothermal amplification kit according to claim 4, characterized in that, The isothermal amplification kit also includes colloidal gold test strips; Optionally, when the 5' end of the downstream primer is connected to marker A and the 5' end of the probe is connected to marker B, the conjugation pad of the colloidal gold test strip is coated with an antibody-colloidal gold label against marker A, the detection line of the colloidal gold test strip is coated with an anti-B antibody, and the control line of the colloidal gold test strip is coated with a secondary antibody for binding A. Optionally, when the 5' end of the downstream primer is connected to biotin and the 5' end of the probe is connected to FITC, the conjugation pad of the colloidal gold test strip is coated with a biotin antibody-colloidal gold label, the detection line of the colloidal gold test strip is coated with FITC antibody, and the control line of the colloidal gold test strip is coated with a secondary antibody for binding biotin. Optionally, when the 5' end of the downstream primer is connected to digoxigenin and the 5' end of the probe is connected to FITC, the conjugation pad of the colloidal gold test strip is coated with digoxigenin antibody-colloidal gold label, the detection line of the colloidal gold test strip is coated with FITC antibody, and the control line of the colloidal gold test strip is coated with secondary antibody for binding digoxigenin.

8. A method for identifying the small-tubed golden apple snail, characterized in that, Identification was performed using the isothermal amplification kit as described in any one of claims 4 to 7.

9. The identification method according to claim 8, characterized in that, Includes the following steps: Add the DNA sample to be tested to the isothermal amplification reagent, and after the isothermal amplification reaction, use the test strip to develop color and observe the interpretation results of the control line and the test line; Optionally, the DNA sample to be tested and the primer mixture are added to the reaction enzyme mixture, and after the isothermal amplification reaction, the reaction product is diluted and the test strip is used for color development. If both the control line and the test line show color, the result is positive. If only the control line shows color, the result is negative; If neither the control line nor the test line shows any color, the result is invalid.

10. The identification method according to claim 9, characterized in that, The temperature of the isothermal amplification reaction is 30 ~ 40℃; Optionally, the isothermal amplification reaction takes 10 to 30 minutes; Optionally, the dilution factor of the diluted reaction product is 10 to 50 times, and more specifically 20 times.

Images