A molecular marker, primer set, and breeding application of a FOXO3 gene enhancer SNP associated with meat production traits in pigs.

Abstract

This invention belongs to the field of animal molecular genetics and breeding technology, specifically involving a molecular marker, primer set, and breeding application of a SNP (single nucleotide polymorphism) in the FOXO3 gene enhancer associated with meat production traits in pigs. The SNP is located at 74,651,264 bp on pig chromosome 1, exhibiting a T / C single nucleotide polymorphism, and situated within the enhancer regulatory region of the FOXO3 gene intron. Dual-luciferase assays confirmed that this sequence region possesses enhancer regulatory activity, with the C allele showing higher transcriptional activation activity than the T allele. Population association analysis showed that this SNP is significantly associated with growth, carcass, and meat quality traits in Duroc pigs. This invention allows for targeted selection of breeding pigs based on breeding objectives: selecting the TT genotype for faster growth and superior carcass, and selecting the TC genotype for tender meat. This can be used for early and precise selection of breeding pigs, improving breeding efficiency and achieving synergistic improvement of multiple traits.

Description

Technical Field

[0001] This invention belongs to the field of animal molecular genetics and breeding technology, specifically involving a molecular marker, primer set, and breeding application of a FOXO3 gene enhancer SNP related to the meat production trait in pigs. Background Technology

[0002] The hog industry is a vital pillar of agriculture, ensuring the supply of livestock products and impacting people's livelihoods. Breeding high-performing pigs is the core approach to improving breeding efficiency, reducing production costs, and promoting the high-quality development of the hog industry. The meat production traits of pigs are key indicators determining the economic benefits of pig farming, encompassing three main categories: growth traits, carcass traits, and meat quality traits. Growth traits directly affect the breeding cycle and feed conversion efficiency; carcass traits determine slaughter output and lean meat percentage; and meat quality traits influence product market value and consumer acceptance. These three traits together constitute the core target traits for hog breeding.

[0003] Traditional pig breeding primarily relies on phenotypic selection, which involves genetic evaluation through individual performance testing and pedigree information. This approach has significant limitations: first, phenotypic testing requires waiting for individuals to reach specific growth stages, resulting in long generation intervals, lengthy breeding cycles, and slow genetic progress; second, phenotypic values ​​are easily affected by non-genetic factors such as feeding environment, nutritional levels, and management conditions, limiting selection accuracy; and third, complex correlations often exist between traits such as growth, carcass, and meat quality, making it difficult to achieve synergistic optimization of multiple traits through phenotypic selection alone, thus limiting the rapid utilization of superior genetic resources and the genetic improvement of comprehensive traits. Therefore, developing more precise and efficient breeding techniques is of urgent practical significance for improving the efficiency of pig breeding.

[0004] With the rapid development of molecular genetics and genomics, marker-assisted selection (MAG) technology has provided a new pathway for livestock and poultry breeding. This technology enables genotypic selection by directly detecting genes controlling traits or molecular markers closely linked to them. It allows for early and precise screening of breeding pigs, effectively shortening generation intervals and improving selection accuracy, especially for traits with low heritability, limited traits, and late-expressed traits. Single nucleotide polymorphisms (SNPs) are among the most abundant types of genetic variation in the genome, characterized by their abundance, wide genomic distribution, genetic stability, high detection throughput, and ease of automated analysis. They have become a core genetic resource for marker-assisted breeding in animals.

[0005] Functional genomics studies have shown that non-coding regions in the genome are not non-functional sequences; they contain numerous cis-regulatory elements that broadly participate in trait development by regulating gene transcription. Intron regions, as non-coding sequences within genes, can contain important regulatory elements such as enhancers and silencers, regulating target gene expression levels through binding to transcription factors and mediating chromatin interactions. Specialized nuclei (SNPs) located in intron regulatory regions can alter the sequence of regulatory elements, affecting transcription factor binding capacity or enhancer activity, thereby leading to differences in target gene expression levels and ultimately participating in the formation of complex traits such as animal growth, development, and meat production. Compared to coding region SNPs, which primarily affect traits by altering protein structure, intron regulatory region SNPs often participate in the regulation of quantitative traits through fine-grained regulation of gene expression, making them important targets for elucidating the genetic basis of meat production traits and developing functional molecular markers. Therefore, identifying SNPs with regulatory functions within gene intron regions is of great significance for enriching livestock and poultry molecular breeding marker resources.

[0006] Forkhead box O3 (FOXO3) is an important member of the forkhead box O (FOXO) transcription factor family. This family is highly conserved evolutionarily and widely participates in various biological processes, including cell proliferation, cell differentiation, metabolic regulation, oxidative stress response, and tissue development. FOXO3 is highly expressed in skeletal muscle and adipose tissue and can influence animal muscle growth and fat metabolism by regulating pathways such as myocyte proliferation and differentiation, myofiber development, and fat deposition. It is an important candidate gene for regulating meat production traits. Previous studies have shown that genetic variations in the FOXO3 gene are significantly associated with animal growth and meat production-related traits: for example, in yaks, genetic variations in the FOXO3 gene have been found to be associated with some growth traits; in chickens, FOXO3 gene polymorphisms are associated with muscle growth and development-related traits. These studies suggest that genetic variations in the FOXO3 gene can participate in regulating skeletal muscle development and the formation of meat production traits by affecting its function or expression level.

[0007] However, current research on the genetic variation of the porcine FOXO3 gene remains relatively limited. Existing studies mostly focus on coding region variations and gene expression pattern analysis, with a severe lack of systematic identification, functional verification, and trait association studies of SNPs in its intron regulatory regions. Whether there are genetic variations with enhancer regulatory functions in the intron regions of the porcine FOXO3 gene, whether such variations are associated with key meat-producing traits such as growth, carcass, and meat quality, and whether they can be developed into molecular markers for breeding pigs remain unclear. This situation not only hinders a deeper understanding of the regulatory function and trait regulation mechanisms of the porcine FOXO3 gene but also limits the exploration of its application value in porcine molecular breeding.

[0008] Therefore, identifying SNPs with regulatory functions in the intron regions of the porcine FOXO3 gene that are significantly associated with meat production traits, developing corresponding molecular detection markers and primer sets, and establishing breeding methods for pigs based on these markers are of great theoretical significance and practical value for elucidating the genetic regulatory basis of pork meat production traits, enriching molecular marker resources, realizing synergistic genetic improvement of multiple traits such as growth, carcass, and meat quality, and improving the efficiency of breeding pigs. Summary of the Invention

[0009] The purpose of this invention is to provide a molecular marker, primer set, and breeding application of the FOXO3 gene enhancer SNP associated with the meat production trait in pigs. This provides a scientific and reliable target site for molecular marker-assisted breeding of pigs, which can be applied to the early and precise screening of breeding pigs, effectively shortening the breeding cycle and improving breeding efficiency.

[0010] The objective of this invention is achieved through the following technical solution: This invention provides a SNP molecular marker for an enhancer of the FOXO3 gene associated with meat production traits in pigs. The SNP molecular marker is located in the intron regulatory region of the FOXO3 gene on pig chromosome 1, corresponding to the genomic location Chr1:74651264bp. The site exhibits a T / C single nucleotide polymorphism, and the SNP molecular marker is significantly associated with pig growth traits, slaughter traits, and meat quality traits.

[0011] Furthermore, the growth traits are selected from at least one of the following: final weight, age at 100 kg, and age at 120 kg; the slaughter traits are selected from at least one of the following: slaughter weight, carcass length, carcass oblique length, and backfat thickness; and the meat quality traits are selected from at least one of the following: intramuscular fat content (IMF), muscle fiber density, muscle fiber diameter, and muscle fiber area.

[0012] Furthermore, the intron sequence region of the FOXO3 gene containing the SNP has enhancer regulatory activity.

[0013] Furthermore, the T / C allele difference at the SNP site can lead to changes in the transcriptional regulatory activity of the enhancer region, wherein the transcriptional activation activity corresponding to the C allele is higher than that of the T allele.

[0014] Furthermore, the SNP site is located at position 151 of the nucleotide sequence shown in SEQ ID NO.3.

[0015] The present invention also provides a primer set for detecting the SNP molecular marker, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0016] The present invention also provides the application of the SNP molecular marker or the primer set described herein in the evaluation of pork meat production traits or in the early selection of breeding pigs.

[0017] This invention also provides a molecular breeding method for pig meat production traits based on FOXO3 gene enhancer SNPs, comprising the following steps: (1) Extract genomic DNA from the pig tissue samples to be tested; (2) The genomic DNA extracted in step (1) was amplified by PCR using the primer set described in claim 6, and the amplification product was sequenced. (3) Determine the genotype of the Chr1:74651264bp site of the pig to be tested based on the sequencing results, and select breeding pigs with the corresponding genotype according to the breeding objectives.

[0018] Furthermore, the screening rules in step (3) are as follows: when the goal is to breed lean-type pigs with fast growth rate and good carcass performance, individuals with the TT genotype are selected for breeding; when the goal is to breed high-quality pigs with good meat tenderness and flavor, individuals with the TC genotype are selected for breeding.

[0019] Furthermore, the method is used for the synergistic breeding of growth traits, carcass traits, and meat quality traits in Durgod pig populations.

[0020] The beneficial effects of this invention are as follows: This invention identifies a functional SNP molecular marker located in the enhancer region of an intron in the porcine FOXO3 gene. This site exhibits a T / C single nucleotide polymorphism and is significantly correlated with growth traits, carcass traits, and meat quality traits in pigs, demonstrating pleiotropic effects. Compared to molecular markers that can only associate with a single trait, this SNP simultaneously covers three core meat production indicators: growth rate, carcass composition, and meat quality. Individuals with the TT genotype have advantages such as fast growth rate, high slaughter weight, large carcass length, and low backfat thickness, while individuals with the TC genotype have advantages such as high intramuscular fat content, excellent muscle fiber characteristics, and good meat tenderness. Breeders can flexibly select the corresponding genotype individuals for breeding according to different market demands and breeding goals. This provides a scientific and reliable target site for molecular marker-assisted breeding of pigs, which can be applied to the early and precise screening of breeding pigs, effectively shortening the breeding cycle and improving breeding efficiency.

[0021] This invention breaks through the conventional method of screening molecular markers solely through genetic association analysis. By combining bioinformatics prediction with dual-luciferase functional verification, it confirms that the sequence region containing the SNP site has enhancer regulatory activity and clarifies the differences in transcriptional activation activity corresponding to different alleles. The enhancer transcriptional activation activity of the C allele is higher than that of the T allele. This reveals the potential mechanism by which genetic variation in the intron regulatory region of the FOXO3 gene affects the formation of the meat production trait in pigs. It provides a new research approach for exploring functional molecular markers in non-coding regions and also provides a solid functional basis for the breeding application of this molecular marker, which can further improve the accuracy and stability of breeding pig selection.

[0022] This invention provides a set of specific detection primers for this SNP site and a corresponding molecular breeding method. The method is simple to operate, provides accurate results, and can be directly applied to pig breeding practices. Breeding based on this molecular marker can optimize genetic improvement programs for pigs, improving growth efficiency and carcass meat production performance while allowing for targeted regulation of meat quality traits. This enables synergistic improvement of multiple traits, helps reduce breeding and raising costs, enhances the overall production performance of commercial pigs and the market value of pork products, and promotes the development of the pig industry towards precision and efficiency. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is an agarose gel electrophoresis result of the PCR amplification product of the target fragment containing the SNP site at position 74651264 of pig chromosome 1 in an embodiment of the present invention; wherein, the agarose gel concentration is 1.0%, the lane marker is the DL1000 molecular weight standard, and the lane PCR is the PCR amplification product of the target fragment. Figure 2 This is the Sanger sequencing map of the FOXO3 gene Chr1:74651264 site in this embodiment of the invention; Figure 3This is a graph showing the results of verifying the regulatory activity of the FOXO3 intron enhancer region in the SKM porcine skeletal muscle cell line using a dual-luciferase reporter gene assay in an embodiment of the present invention; where pGL3-promoter is the empty vector control group, pGL3-FOXO3-TT is the recombinant vector group carrying the T allele, and pGL3-FOXO3-CC is the recombinant vector group carrying the C allele, and the vertical axis represents the relative luciferase activity. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] Example 1: Identification, functional verification, and trait association analysis of SNP molecular markers in the FOXO3 gene enhancer. This embodiment uses Durgod pigs as the research object to identify functional SNP sites in the intron region of the FOXO3 gene, verify the enhancer regulatory activity of the sequence containing the site, and systematically analyze the association between the SNP and pig growth traits, carcass traits, and meat quality traits, providing a basis for its application in molecular breeding.

[0031] 1. Laboratory animals and trait determination The experimental animals were 584 Duroc pigs from a pig farm in Sanshui, Foshan, Guangdong. This group was a crossbreed of (Small-eared Spotted Pig × Duroc Pig) × Duroc Pig.

[0032] When the pigs reached 7 months of age, slaughter testing was conducted according to the "Livestock and Poultry Slaughter Operation Procedures for Pigs" (GB / T 17236), and all trait collection operations complied with national standards. The tested traits covered three categories of meat-producing related indicators: (1) Growth traits: measured body weight, age at 100kg, age at 120kg, backfat at 100kg, backfat at 120kg, eye muscle depth at 120kg, body height, and body length; (2) Carcass characteristics: slaughter weight, straight length of carcass, oblique length of carcass, back fat thickness at the thickest part of the shoulder, back fat thickness at the last rib, back fat thickness at the loin-sac junction, back fat thickness at the 6th-7th rib, and average back fat thickness. (3) Meat characteristics: Intramuscular fat content (IMF), moisture, muscle fiber density, muscle fiber diameter, and muscle fiber area.

[0033] Ear tissue samples were collected from each pig at the time of slaughter, placed in centrifuge tubes containing 70% alcohol, and stored in a -20°C refrigerator for later use.

[0034] 2. Genomic DNA extraction Genomic DNA was extracted from porcine ear tissue using the Tiangen Cell / Tissue DNA Extraction Kit (catalog number: DP304), following the kit's instructions. After extraction, the concentration and purity of the DNA were determined using a nucleic acid concentration detection device. Qualified samples were uniformly diluted to 50 ng / μL and stored at -20℃ for later use.

[0035] 3. PCR amplification primer design and reaction system Specific amplification primers were designed targeting the Chr1:74651264 locus within the intron of the porcine FOXO3 gene (transcription ID: ENSSSCT0090053204). The primer sequences are as follows: Upstream primer Primer F (SEQ ID NO.1): 5'-TGGAGGCATCCTGTGGAAAC-3' Downstream primer Primer R (SEQ ID NO.2): 5'-GCCAGTGCCTACAAAAGAGC-3' Using the extracted genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.1 and SEQ ID NO.2. The total PCR reaction volume was 20 μL, and the components were as follows: 2×Taq Master Mix: 10.0 μL; 10 μM upstream primer (Primer F): 0.4 μL; 10 μM downstream primer (Primer R): 0.4 μL; ddH2O: 8.2 μL; 50 ng / μL DNA template: 1.0 μL.

[0036] The PCR reaction program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 36 cycles; 72℃ final extension for 5 min; and storage of the amplified products at 4℃.

[0037] 4. Electrophoresis detection and SNP genotyping The PCR amplification products were taken and the amplification effect was detected by 1.0% agarose gel electrophoresis. The detection results are as follows: Figure 1 As shown. By Figure 1 As can be seen, the PCR amplification product bands were single, the fragment lengths were consistent with expectations, there were no non-specific amplification bands, and the amplification quality met the requirements for subsequent sequencing.

[0038] The PCR amplification products were subjected to Sanger sequencing, and the resulting sequencing map is shown below. Figure 2 As shown. Sequence alignment software was used to compare the sequencing results with the reference sequence of the porcine FOXO3 gene intron in the GenBank database, accurately identifying a T / C single nucleotide polymorphism at nucleotide position 74651264 on porcine chromosome 1. This SNP site is located at position 151 of the nucleotide sequence shown in SEQ ID NO.3. The complete sequence of SEQ ID NO.3 is as follows: 5'-CGTCCTCTGGCAGCCACAATGCACCTTACAGGCCTCCAACCCTTGAGGAATGACCACCTTGTGGCAGTCCTGTAATACAGAGTGGTGGGGCCTGAGTAAGTGGTTGCAACTTGGAGGCGTGTGACTTTGGAAAAGTTACACTGCATGTGAT / CGTTTAAAAGAATTAGTCACTTTGTGCCACAGGAATGGACATAGTTAGCCGGATCAATGGCTTTAATTGGCAGTGATTTGCTGCAAGGGAAATTTGTGGTTTCATCAGTCTTAATGCTGGGCAGCCGTTTCATTACACACTGTTGAGTAGA-3' 5. Dual-luciferase validation of intron region enhancer activity To verify the enhancer regulatory function of the sequence region containing the SNP site, 150 bp upstream and downstream of the SNP site, for a total length of 301 bp (i.e., the sequence shown in SEQ ID NO.3), were extracted to construct pGL3-promoter dual-luciferase recombinant vectors carrying the T allele and the C allele, respectively.

[0039] The two recombinant vectors were transfected into the SKM porcine skeletal muscle cell line, respectively. After transfection, luciferase activity was measured according to the instructions of the dual-luciferase assay kit. The quantitative results are as follows: Figure 3 As shown.

[0040] The results showed that, compared with the empty pGL3-promoter vector, the sequence fragment containing this SNP site significantly enhanced the transcriptional activity of luciferase, demonstrating that this region has enhancer-like regulatory activity. At the same time, the luciferase activity of the recombinant vector carrying the C allele was significantly higher than that of the recombinant vector carrying the T allele, indicating that the T / C variation at this SNP site can alter the transcriptional activation activity of the enhancer region of the FOXO3 gene intron, with the enhancer corresponding to the C allele having a stronger transcriptional activation ability.

[0041] 6. Population genetic association analysis Based on the sequencing results, genotyping was performed on 584 Duroc pigs, including 445 individuals with the TT genotype and 139 individuals with the TC genotype. Using a mixed linear model in SPSS Statistics software and employing the Bonferroni correction method for multiple comparisons, the association between the SNP locus genotype and pig growth traits, carcass traits, and meat quality traits was analyzed. The results are shown in Tables 1, 2, and 3, respectively.

[0042] Table 1 Association analysis between SNPs (T / C) and growth traits in Durgod pigs

[0043] Table 2 Association analysis between SNPs (T / C) and carcass traits of Durex pigs

[0044] Table 3. Association analysis between SNPs (T / C) and pork quality traits of Dudu Flower Pork

[0045] 7. The application value of marker breeding The association analysis results in Tables 1 to 3 show that the SNP site of the intron of the FOXO3 gene at position 74651264 on chromosome 1 of pigs is significantly associated with growth traits, carcass traits, and meat quality traits of Durex pigs (P<0.05). This variation has pleiotropic effects and can simultaneously affect the growth rate, carcass composition, and meat quality characteristics of pigs.

[0046] Specifically, compared to individuals with the TC genotype, individuals with the TT genotype exhibit superior growth and carcass meat production performance—reaching target weight at a shorter age, with higher weight, height, and length; greater slaughter weight and carcass length, and lower backfat thickness in all parts, resulting in better lean meat percentage. Meanwhile, individuals with the TC genotype demonstrate more prominent meat quality traits—significantly higher intramuscular fat content, greater muscle fiber density, smaller diameter, and smaller surface area, leading to better tenderness and flavor.

[0047] Based on this SNP molecular marker, breeders can flexibly conduct targeted breeding according to market demand: when the goal is to breed lean-type pigs with fast growth rate and high carcass lean meat percentage, individuals with the TT genotype should be given priority for breeding; when the breeding goal is to improve meat tenderness and enhance muscle flavor, individuals with the TC genotype should be given priority for breeding. This marker can be applied to the early and precise screening of breeding pigs, effectively shortening the breeding cycle, improving breeding efficiency, reducing breeding costs, and promoting the precision and efficiency of molecular breeding of pigs.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A SNP molecular marker for an enhancer of the FOXO3 gene associated with the meat production trait in pigs, characterized in that, The SNP molecular marker is located in the intron regulatory region of the FOXO3 gene on pig chromosome 1, corresponding to the genomic location Chr1:74651264bp. The site exhibits T / C single nucleotide polymorphism, and the SNP molecular marker is significantly associated with pig growth traits, slaughter traits, and meat quality traits.

2. The SNP molecular marker according to claim 1, characterized in that, The growth traits are selected from at least one of the following: gross body weight, age at 100 kg, and age at 120 kg; the slaughter traits are selected from at least one of the following: slaughter body weight, carcass length, carcass oblique length, and backfat thickness; the meat quality traits are selected from at least one of the following: intramuscular fat content (IMF), muscle fiber density, muscle fiber diameter, and muscle fiber area.

3. The SNP molecular marker according to claim 1, characterized in that, The intron sequence region of the FOXO3 gene containing the SNP has enhancer regulatory activity.

4. The SNP molecular marker according to claim 3, characterized in that, The T / C allele difference at the SNP site leads to changes in the transcriptional regulatory activity of the enhancer region, with the transcriptional activation activity corresponding to the C allele being higher than that of the T allele.

5. The SNP molecular marker according to claim 1, characterized in that, The SNP site is located at position 151 of the nucleotide sequence shown in SEQ ID NO.

3.

6. A primer set for detecting the SNP molecular marker of claim 1, characterized in that, It includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.1 and the nucleotide sequence of which is shown in SEQ ID NO.

2.

7. The application of the SNP molecular marker of claim 1 or the primer set of claim 6 in the evaluation of pork meat production traits or in the early selection of breeding pigs.

8. A molecular breeding method for pig meat production traits based on FOXO3 gene enhancer SNPs, characterized in that, Includes the following steps: (1) Extract genomic DNA from the pig tissue samples to be tested; (2) The genomic DNA extracted in step (1) was amplified by PCR using the primer set described in claim 6, and the amplification product was sequenced. (3) Determine the genotype of the Chr1:74651264bp site of the pig to be tested based on the sequencing results, and select breeding pigs with the corresponding genotype according to the breeding objectives.

9. The molecular breeding method according to claim 8, characterized in that, The selection rules in step (3) are as follows: when the goal is to breed lean-type pigs with fast growth rate and good carcass performance, individuals with the TT genotype are selected for breeding; when the goal is to breed high-quality pigs with good meat tenderness and good flavor, individuals with the TC genotype are selected for breeding.

10. The molecular breeding method according to claim 8, characterized in that, The method is used for the synergistic selection of growth traits, carcass traits and meat quality traits in Durgod pig populations.

Images