A primer probe composition for detecting a nodular skin disease infectious pathogen, and a kit and application thereof

Abstract

The application provides a primer probe composition for detecting a nodular skin disease infection pathogen, and a kit and application thereof, and belongs to the technical field of biological medicine reagents. The primer probe composition provided by the application can simultaneously detect five kinds of nodular skin disease related pathogens, namely, Sarcodina, Mycobacterium marinum, Mycobacterium tuberculosis complex, Mucor and Rhizopus, the detection between each target does not interfere with each other, the CT values of the multiplex detection system and the single detection system are basically consistent, and the detection specificity and accuracy both reach 100%. The kit can effectively detect the above five kinds of pathogens in paraffin-embedded tissue samples, and provides molecular detection product support for the pathogen identification of nodular skin diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedical reagent technology, and in particular to a primer-probe composition for detecting pathogens causing nodular dermatitis, a kit thereof, and its application. Background Technology

[0002] Infectious nodular dermatosis is a skin disease caused by various microorganisms, resulting in nodular lesions on the skin. The pathogens causing this type of disease are numerous, including different types of fungi and mycobacteria. While the clinical manifestations of different types of pathogens may be similar, the treatment regimens differ significantly. Therefore, accurate identification of the pathogen is crucial for rational drug use in clinical practice.

[0003] Currently, pathogen detection for infectious nodular dermatitis mainly relies on methods such as microbial culture, histopathological examination, and single polymerase chain reaction (PCR). Microbial culture is a traditional detection method, but fungi and mycobacteria have long growth cycles, requiring cultivation times of several days to weeks. Furthermore, the positive detection rate is affected by various factors such as sample quality, transportation conditions, and culture medium selection, making it difficult to meet the clinical needs for rapid diagnosis. Histopathological examination identifies pathogens by observing the morphological characteristics of diseased tissues, but this method requires a high level of expertise from the operator, and the morphological characteristics of some pathogens in tissue sections lack sufficient differentiation, posing a risk of misdiagnosis and missed diagnosis. While single polymerase chain reaction (PCR) has high sensitivity and specificity, each reaction can only detect one pathogen. When clinical needs require the identification of multiple possible pathogens, the same sample must be tested multiple times, increasing reagent consumption and operation time, and also consuming limited clinical samples.

[0004] Furthermore, multiplex molecular assays targeting pathogens associated with nodular dermatitis are scarce in the market. Therefore, developing an assay capable of simultaneously detecting multiple common pathogens associated with nodular dermatitis in a single-tube reaction system is of significant practical importance for improving testing efficiency and meeting clinical needs. Summary of the Invention

[0005] The purpose of this invention is to provide a primer and probe composition for detecting pathogens causing nodular dermatitis, which solves the technical problem that existing pathogen detection products for nodular dermatitis cannot simultaneously and efficiently detect five pathogens—Sporothrix schenckii complex, Mycobacterium marinum, Mycobacterium tuberculosis complex, Mucor, and Rhizopus—in a single-tube reaction system.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides a primer probe composition comprising primer pairs for detecting Mucor, primer pairs for detecting Rhizopus, primer pairs for detecting Sporothrix schenckii complex, primer pairs for detecting Mycobacterium marineum, and primer pairs for detecting Mycobacterium tuberculosis complex. The upstream primer of the primer pair used for detecting Mucor is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2; The upstream primer of the primer pair used for detecting Rhizopus is shown in SEQ ID NO.3, and the downstream primer is shown in SEQ ID NO.4; The upstream primer of the primer pair used to detect Schenck's Sporothrix complex is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6; The upstream primer of the primer pair used for detecting Mycobacterium marineum is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.8; The upstream primer of the primer pair used for detecting Mycobacterium tuberculosis complex is shown in SEQ ID NO.9, and the downstream primer is shown in SEQ ID NO.10; It also includes probes for detecting Mucor, probes for detecting Rhizopus, probes for detecting Schenck's Sporothrix complex, probes for detecting Mycobacterium marineum, and probes for detecting Mycobacterium tuberculosis complex.

[0007] Preferably, the probe for detecting Mucor is as shown in SEQ ID NO.11; The probe used to detect Rhizopus is shown in SEQ ID NO.12; The probe used to detect Schenck's Sporothrix complex is shown in SEQ ID NO.13; The probe used to detect Mycobacterium marineum is shown in SEQ ID NO.14; The probe used to detect Mycobacterium tuberculosis complex is shown in SEQ ID NO.15.

[0008] Preferably, the probes for detecting Mucor, Rhizopus, Sporothrix schenckii complex, Mycobacterium marineum, and Mycobacterium tuberculosis complex optionally carry a labeling group. The labeling group optionally includes a fluorescent group labeled at the 5' end of the probe and / or a quenching group labeled at the 3' end of the probe, wherein the fluorescent group is FAM, ROX or Cy5 and the quenching group is MGB or BHQ2.

[0009] Preferably, the primer-probe composition further includes primer pairs and probes for detecting internal reference genes.

[0010] Preferably, the internal reference gene is RPP30, and the primer pairs and probes used to detect the internal reference gene are shown in SEQ ID NO.16~SEQ ID NO.18.

[0011] The present invention also provides a kit for detecting pathogens causing nodular dermatitis, comprising the above-described primer-probe composition.

[0012] Preferably, in the kit, the final concentration of any primer in the reaction system is 0.05 μM to 0.25 μM, and the final concentration of any probe in the reaction system is 0.025 μM to 0.2 μM.

[0013] Preferably, the kit includes a first group of reagents and a second group of reagents; The first set of reagents includes primer pairs and probes for detecting Schenck's Sporothrix complex, primer pairs and probes for detecting Mycobacterium marineum, primer pairs and probes for detecting Mycobacterium tuberculosis complex, and primer pairs and probes for detecting internal reference genes. The second set of reagents includes primer pairs and probes for detecting Mucor, primer pairs and probes for detecting Rhizopus, and primer pairs and probes for detecting internal reference genes.

[0014] Preferably, the test result interpretation criteria of the kit are as follows: for any pathogen among the Mucor, Rhizopus, Schenck's Sporothrix complex, Mycobacterium marinum and Mycobacterium tuberculosis complex, when the CT value of the detection channel corresponding to the pathogen is ≤38, the pathogen is determined to be positive; When the CT value of the detection channel corresponding to the pathogen is greater than 38 and less than or equal to 40, the detection result of the pathogen is determined to be uncertain and the sample needs to be retested. When the CT value of the detection channel corresponding to the pathogen is greater than 40 or there is no CT value, the pathogen is judged to be negative.

[0015] The present invention also provides the use of the above-described primer-probe composition or kit in the preparation of products for detecting pathogens causing nodular dermatitis.

[0016] The beneficial effects of this invention are: The primer and probe composition provided by this invention can simultaneously detect five pathogens associated with nodular dermatitis: Sporothrix schenckii complex, Mycobacterium marinum, Mycobacterium tuberculosis complex, Mucor, and Rhizopus. The detection of each target does not interfere with each other, and the CT values ​​of the multiplex detection system are essentially consistent with those of the single-detection system. Both the detection specificity and accuracy reach 100%. The kit of this invention can effectively detect the above five pathogens in paraffin-embedded tissue samples, providing molecular detection product support for the etiological identification of nodular dermatitis. Attached Figure Description

[0017] Figure 1 Fluorescence curves were screened for primers and probes for the Schenck's Sporothrix complex (groups 1-3). Figure 2 Fluorescence curves were screened for Mycobacterium marineis primers and probes (groups 1-3). Figure 3 Fluorescence curves were screened for primers and probes for Mycobacterium tuberculosis complex (groups 1-8). Figure 4 Fluorescence curves for screening primers and probes for Mucor (Groups 1 and 2); Figure 5 Fluorescence curves for Rhizopus primers and probes were screened (groups 1-3). Figure 6 The fluorescence curves for single and multiple contrast tests are shown for tube A. Figure 7 The fluorescence curves for single and multiple contrast tests in tube B are shown. Note: In each figure, the horizontal axis represents the cycle number (Cycles), and the vertical axis represents the fluorescence intensity (ΔRn). Positive amplification curves exhibit a typical S-shaped curve, while negative curves show no amplification. Detailed Implementation

[0018] This invention provides a primer probe composition comprising primer pairs for detecting *Mucor*, primer pairs for detecting *Rhizopus*, primer pairs for detecting *Sporothrix schenckii* complex, primer pairs for detecting *Mycobacterium marineum*, and primer pairs for detecting *Mycobacterium tuberculosis* complex. The upstream primer for the primer pair for detecting *Mucor* is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2. The upstream primer for the primer pair for detecting *Rhizopus* is shown in SEQ ID NO.3, and the downstream primer is shown in SEQ ID NO.4. The upstream primer for the primer pair for detecting *Sporothrix schenckii* complex is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6. The upstream primer for the primer pair for detecting *Mycobacterium marineum* is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.8. The upstream primer for the primer pair for detecting *Mycobacterium tuberculosis* complex is shown in SEQ ID NO.9, and the downstream primer is shown in SEQ ID NO.9. As shown in IDNO.10; it also includes probes for detecting Mucor, probes for detecting Rhizopus, probes for detecting Schenck's Sporothrix complex, probes for detecting Mycobacterium marineum, and probes for detecting Mycobacterium tuberculosis complex.

[0019] In this invention, a primer pair refers to a pair of oligonucleotide sequences, including a forward primer and a reverse primer, used as the starting point for DNA synthesis in polymerase chain reaction (PCR). By specifically binding to the complementary region of the target nucleic acid sequence, the primer extends from the 3' end under the action of DNA polymerase, achieving exponential amplification of the target nucleic acid fragment. A probe refers to a labeled oligonucleotide sequence. In real-time quantitative PCR, the probe is free in the reaction system. When the probe specifically binds to the target nucleic acid sequence, as PCR amplification proceeds, the probe is progressively cleaved by the 5' exonuclease activity of DNA polymerase, thereby separating the fluorescent group and quencher group carried on the probe, generating a fluorescent signal detectable by a quantitative PCR instrument. By monitoring the accumulation of the fluorescent signal, real-time quantitative detection of the target nucleic acid can be achieved. In this invention, SEQ ID NO.1 to SEQ ID NO.15 are sequence identifiers used to refer to the corresponding specific nucleotide sequences in the sequence listing. Detailed information for each sequence is described in the sequence listing appended to this invention.

[0020] In this invention, the probe for detecting Mucor is shown in SEQ ID NO.11; the probe for detecting Rhizopus is shown in SEQ ID NO.12; the probe for detecting Schenck's Sporothrix complex is shown in SEQ ID NO.13; the probe for detecting Mycobacterium marineum is shown in SEQ ID NO.14; and the probe for detecting Mycobacterium tuberculosis complex is shown in SEQ ID NO.15.

[0021] In one embodiment of the present invention, the probes for detecting Mucor, Rhizopus, Schenck's Sporothrix complex, Mycobacterium marineum, and Mycobacterium tuberculosis complex optionally carry labeling groups; the labeling groups optionally include a fluorescent group labeled at the 5' end of the probe and / or a quenching group labeled at the 3' end of the probe, wherein the fluorescent group is FAM, ROX, or Cy5, and the quenching group is MGB or BHQ2. In this invention, FAM, or 6-carboxyfluorescein, is a fluorescent dye that is excited at a wavelength of 480 nm and emits fluorescence at a wavelength of 520 nm. It is one of the most commonly used fluorescent groups in real-time fluorescent PCR. ROX, or 6-carboxy-X-rhodamine, is a fluorescent dye that is excited at a wavelength of 580 nm and emits fluorescence at a wavelength of 608 nm. It is commonly used as a reference fluorescent group or a target detection fluorescent group in multiplex PCR. Cy5, or cyanine dye 5, is a fluorescent dye that is excited at a wavelength of 633-650 nm and emits fluorescence at a wavelength of 665-670 nm. It is suitable for far-infrared channel detection in multiplex PCR. MGB, or minor groove binder, is a chemical modification group that enhances the stability of probe binding to target DNA by non-covalently binding to the minor groove region of the DNA double helix. Probes modified with MGB have higher melting temperatures, allowing for shorter probe sequences and improved allele differentiation specificity. BHQ2, or black hole quencher 2, is a non-fluorescent dark quencher group that efficiently absorbs the fluorescence energy emitted by fluorophores through fluorescence resonance energy transfer (FRET). Its absorption spectrum covers the range of 520-650 nm and is suitable for quenching the emission signals of fluorophores such as ROX and Cy5. In this invention, the optional labeling of the probe means that the probe sequence can exist in an unlabeled form or in a form with a fluorophore at the 5' end and a quencher group at the 3' end. Both forms are within the scope of protection of this invention. Those skilled in the art can select a suitable combination of fluorophores and quenchers based on the fluorescence channel configuration of the actual detection platform. The fluorophore can also be any one of HEX, JOE, TET, CY3, or Texas Red; the quencher group can also be any one of TAMRA or BHQ1.

[0022] In this invention, the primer-probe composition further includes primer pairs and probes for detecting internal reference genes. Internal reference genes are genes that are stably expressed in all tissue types and cells, and whose expression levels are unaffected by experimental conditions. They serve as a monitoring indicator of sample quality, used to assess the effectiveness of the entire process of clinical sample collection, nucleic acid extraction, and PCR amplification, avoiding false negative results due to poor sample quality or operational errors. In clinical sample testing, a positive result for the internal reference gene indicates that the nucleic acid quality in the sample meets the testing requirements; a negative result suggests that the sample may have problems such as nucleic acid degradation, extraction failure, or amplification inhibition, and the test result of this sample should be deemed invalid, requiring resampling or re-extraction and testing. In one embodiment of this invention, the internal reference gene is RPP30. The RPP30 gene encodes the human ribonuclease P protein subunit p30. This gene is a single-copy gene, stably expressed in all human tissues, and is one of the widely used human internal reference genes in the field of clinical molecular diagnostics. Primer pairs and probes used to detect RPP30 can be designed based on conserved regions of the gene. Their sequences can be the sequences disclosed in this invention, or other sequences that can specifically bind to conserved regions of the RPP30 gene and achieve effective amplification and detection.

[0023] This invention also provides a kit for detecting pathogens causing nodular dermatitis, comprising the aforementioned primer and probe composition. In this invention, the kit refers to a product formed by combining and packaging the primer and probe composition with other necessary detection components. The kit may also contain a qPCR premix, which is a pre-prepared solution containing all components necessary for real-time quantitative PCR except for primers and template. The qPCR premix typically contains DNA polymerase, a PCR buffer system, magnesium chloride, and a mixture of deoxyribonucleoside triphosphates. DNA polymerase catalyzes the polymerization of deoxyribonucleoside triphosphates according to the template sequence to form new DNA chains; the PCR buffer system maintains the reaction system under optimal pH and ionic strength conditions for enzymatic reaction; magnesium chloride acts as a cofactor for DNA polymerase, and its concentration directly affects the polymerase activity and amplification specificity; the mixture of deoxyribonucleoside triphosphates serves as a raw material for DNA synthesis. The qPCR premix can be a commercially available product or can be prepared by those skilled in the art based on known formulations. The kit may also include reagents for nucleic acid extraction. Nucleic acid extraction refers to the process of isolating and purifying DNA or RNA from clinical samples. Its purpose is to remove substances such as proteins, lipids, and polysaccharides that may inhibit PCR reactions, obtaining high-quality nucleic acid templates suitable for amplification. Nucleic acid extraction can be performed using a centrifugal column method, which utilizes silica gel or glass fiber membranes to selectively adsorb nucleic acids under specific buffer conditions. After washing to remove impurities, the nucleic acids are eluted with a low-salt buffer or water. Nucleic acid extraction can also be performed using a magnetic bead method, which utilizes nano-magnetic beads with functional groups modified on their surface to adsorb nucleic acids under specific buffer conditions. An external magnetic field is used to separate the magnetic beads from the liquid phase, and after washing, the nucleic acids are eluted from the magnetic beads with a low-salt buffer. Nucleic acid extraction can also be performed using a phenol-chloroform extraction method or a surfactant-based direct lysis method. In one embodiment of the invention, nucleic acid extraction can be performed using Tiangen's DP331 paraffin-embedded tissue extraction kit or Omega's D3399-01 paraffin-embedded tissue extraction kit.

[0024] In one embodiment of the present invention, the final concentration of primers in the reaction system of the kit is 0.05 μM to 0.25 μM, and the final concentration of probes in the reaction system is 0.025 μM to 0.2 μM. The final concentration of primers in the reaction system is further preferably 0.08 μM to 0.22 μM, further preferably 0.1 μM to 0.2 μM, and most preferably 0.2 μM. The final concentration of probes in the reaction system is further preferably 0.05 μM to 0.15 μM, further preferably 0.05 μM to 0.1 μM, and most preferably 0.1 μM. The above concentrations refer to the final concentrations of each primer or probe in the final prepared PCR reaction system. When the concentrations of primers and probes are within this range, balanced amplification can be achieved among the targets.

[0025] In one embodiment of the present invention, the kit contains primer pairs and probes for detecting *Sporothrix schenckii* complex, primer pairs and probes for detecting *Mycobacterium marineum*, and primer pairs and probes for detecting *Mycobacterium tuberculosis* complex, configured as a first group of reagents; primer pairs and probes for detecting *Mucor* and primer pairs and probes for detecting *Rhizopus*, configured as a second group of reagents; the first group and the second group of reagents independently contain primer pairs and probes for detecting the internal reference gene. This grouping configuration refers to dividing the primer-probe composition into two groups according to the target detection requirements, with each group stored in an independent container. During detection, the two groups of reagents can be added to different reaction tubes. Grouping the primer-probe composition in this manner allows the first group and the second group of reagents to be suitable for the detection requirements of different types of pathogens, making the usage more flexible. Both the first group and the second group of reagents contain primer pairs and probes for detecting the internal reference gene, enabling tubes A and B to independently complete the detection of the internal reference gene.

[0026] In one embodiment of the present invention, the interpretation criteria for the test results of the kit are as follows: a CT value of the target to be tested ≤ 38 is positive, 38 < CT value ≤ 40 is the gray zone, and a CT value > 40 or no CT value is negative. The full name of CT value is cycle threshold, which refers to the number of PCR cycles corresponding to the first time the fluorescent signal reaches the set threshold during the real-time fluorescent quantitative PCR amplification process. The CT value is inversely proportional to the copy number of the initial template in the sample, that is, the smaller the CT value, the higher the initial content of the target nucleic acid in the sample; the larger the CT value, the lower the initial content of the target nucleic acid in the sample; when the sample does not contain the target nucleic acid, the PCR amplification curve is flat and does not produce a typical S-shaped amplification curve, which is recorded as no CT value at this time. In the above interpretation criteria, a CT value of the target to be tested ≤ 38 is positive, indicating that the nucleic acid of the corresponding pathogen is present in the sample; 38 < CT value ≤ 40 is the gray zone, indicating that a trace amount of the corresponding pathogen nucleic acid may be present in the sample, which is in a critical state of being detectable but with a low copy number, and it is recommended to repeat the test on the sample to confirm the result; a CT value > 40 or no CT value is negative, indicating that the nucleic acid of the corresponding pathogen is not present in the sample. The interpretation criteria for the CT value of the internal reference gene are as follows: an internal reference CT value ≤ 35 is valid, indicating that the sample quality meets the test requirements; an internal reference CT value > 35 is invalid, indicating that the sample may have nucleic acid degradation or amplification inhibition, the test result is not credible, and it is necessary to re-extract the nucleic acid or re-sample before performing the test again. Further, a CT value of the target to be tested ≤ 35 is positive, 35 < CT value ≤ 38 is weakly positive, 38 < CT value ≤ 40 is the gray zone, and a CT value > 40 or no CT value is negative. The validity judgment criteria for the test results are as follows: when the negative control has no amplification and the CT value of each target channel of the positive control is ≤ 32, the current test is valid; otherwise, the current test is invalid, and the test needs to be performed again.

[0027] The present invention also provides the application of the above-mentioned primer-probe composition or kit in the preparation of a product for detecting the pathogen causing lumpy skin disease infection. In the present invention, the product refers to a reagent-based product that detects the pathogen nucleic acid in a clinical sample based on nucleic acid amplification technology. The product can be provided in the form of a kit, which contains the primer-probe composition and necessary test components. The product can be used to detect the pathogen causing lumpy skin disease infection in paraffin-embedded tissue samples, fresh tissue samples, paraffin section samples or puncture tissue samples. The preparation of the product for detecting the pathogen causing lumpy skin disease infection includes combining the primer-probe composition with acceptable auxiliary materials, carriers or other test reagents to form a test product form that is convenient for clinical use and commercial circulation. In one embodiment of the present invention, the preparation of the product for detecting the pathogen causing lumpy skin disease infection includes formulating a PCR reaction solution by mixing the primer-probe composition, qPCR master mix and nuclease-free water in a certain proportion, dispensing it into a suitable container, and storing it under appropriate conditions.

[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1: Primer-Probe Composition This embodiment provides a primer-probe composition comprising specific primer pairs and probes for the simultaneous detection of five pathogens: Mucor, Rhizopus, Schenck's Sporothrix complex, Mycobacterium marinum, and Mycobacterium tuberculosis complex.

[0030] The primer sequences are shown in Table 1 below: Table 1 Primer Sequences

[0031] The probe sequences are shown in Table 2 below: Table 2 Probe Sequences

[0032] The probes specifically bind to their respective target amplification products in real-time fluorescent PCR reactions. The fluorescent signal is released by the cleavage of the fluorescent groups labeled on the probes, enabling real-time monitoring of the amplification process.

[0033] The primer-probe composition of this embodiment further includes primer pairs and probes for detecting an internal reference gene, wherein the internal reference gene is RPP30, and the primer pairs and probe sequences are as follows: RPP30-F: CCGAGGCCTGGCTTTTGA, as shown in SEQ ID NO.16; RPP30-R: CCTTTGCAGATTTGCATCAAATT, as shown in SEQ ID NO.17; RPP30-P: VIC-AGCCCTGCTATCAAAGACTCCACAATGAGAAGGT-BHQ1, as shown in SEQ ID NO.18.

[0034] To facilitate the identification and reference of primer and probe components in subsequent embodiments, the codes for relevant target and internal reference genes are defined as follows: Ssc: Sporothrix schenckii complex Mmar: Mycobacterium marinum MTBC: Mycobacterium tuberculosis complex Rhi: Genus Rhizopus Muc: Genus Mucor RPP30: Internal reference gene RPP30 In primer names, F at the end indicates the upstream primer and R indicates the downstream primer; in probe names, P at the end indicates the probe. The fluorescent labels for each target probe in the multiplex reaction system are as follows: Ssc-P is FAM, Mmar-P is ROX, MTBC-P is Cy5, Rhi-P is FAM, Muc-P is ROX, and RPP30-P is VIC. Based on these rules, for example, "Ssc-F" indicates the upstream primer for detecting the Schenckella sp. complex, and "RPP30-P" indicates the probe for detecting the internal reference gene RPP30.

[0035] Example 2: Kit for detecting pathogens causing nodular dermatitis This embodiment provides a kit for detecting pathogens causing nodular dermatitis, the kit comprising the primer and probe composition described in Example 1.

[0036] 1. Reagent kit components The kit includes qPCR Master Mix, Primer-Probe Mix-A, Primer-Probe Mix-B, nuclease-free water, negative control, and positive control. The qPCR Master Mix is ​​Novizan Q112 (2X concentration). Primer-Probe Mix-A is used to detect *Sporothrix schenckii* complex, *Mycobacterium tumefaciens*, *Mycobacterium tuberculosis* complex, and the internal reference gene. Primer-Probe Mix-B is used to detect *Rhizopus*, *Mucor*, and the internal reference gene.

[0037] The preparation methods for each primer-probe mixture are shown in Tables 3-4: Table 3 Primer-Probe Mixture-A Preparation Recipe

[0038] Table 4 Primer-Probe Mixture-B Preparation Recipe

[0039] Note: F / R at the end of the primer name represents the upstream and downstream primers (e.g., Ssc-F2 / Ssc-R2); P at the end of the probe name represents the probe (e.g., Ssc-P2, RPP30-P). See the explanation at the end of Example 1 for the correspondence between target codes and their Chinese names. The primer and probe concentrations were both 100 μM. The amount of primer added per person was 0.04 μl, and the amount of probe added was 0.02 μl, then brought to a final volume of 2 μl with nuclease-free water.

[0040] 2. Preparation of the reaction system The primer-probe mixture was prepared with qPCR Master Mix, nuclease-free water, and nucleic acid template according to the volumes shown in Table 5 to obtain the complete PCR reaction system (hereinafter referred to as "detection tube A" and "detection tube B"). Detection tube A was used for the detection of Schenck's Sporothrix complex, Mycobacterium marinum, and Mycobacterium tuberculosis complex, while detection tube B was used for the detection of Rhizopus and Mucor.

[0041] Table 5 Reagent system preparation

[0042] Note: The concentration of qPCR Master Mix is ​​2X, and the volume used per person is 10μl. It can be used directly.

[0043] 3. Amplification Procedure After preparation, place test tube A and test tube B in a real-time PCR instrument and amplify according to the procedure shown in Table 6.

[0044] Table 6 Amplification Procedure

[0045] Note: The temperature of the hot cap is 105℃, and fluorescence is collected at 60℃; 4. Result Interpretation Criteria: After amplification, the detection results were interpreted according to the rules shown in Table 7. The internal reference gene (VIC channel) was used to assess sample quality and the effectiveness of the reaction system, while the Ct value of each target channel was used to determine the positive or negative result for the corresponding pathogen.

[0046] 1) Positive results are shown in Table 7: Table 7 Rules for Interpreting Positive Results

[0047] 2) Gray Zone Results: If the detection channel corresponding to the pathogen to be tested in the detection well of detection tube A or B shows a clear S-shaped amplification curve, and 38 < Ct value ≤ 40, with the internal control Ct value < 35, the detection result is considered to be in the gray zone, and retesting is recommended. If the corresponding detection channel still shows a clear S-shaped amplification curve during retesting, and the Ct value ≤ 40, with the internal control Ct value < 35, the detection result is considered positive; otherwise, the result is considered negative. If the sample does not show a clear S-shaped amplification curve in the detection channel, but a Ct value is reported, it is still considered negative.

[0048] 3) Negative result: If the internal reference Ct value in the detection well corresponding to detection tube A or B is <35, and the Ct value of the target to be tested in other reaction wells is >40 or No Ct, then the test result is considered negative.

[0049] 4) Invalid results: If the internal reference Ct value in the detection well corresponding to detection tube A or B is >35, and the target detection Ct value in other reaction wells is >38, the detection result is deemed invalid, and samples should be collected and tested again.

[0050] 5. Positive control To monitor the effectiveness of the detection process, this kit also includes positive controls for each target and internal reference gene. The positive controls are recombinant plasmids containing the target-specific sequences, and their target names, target gene names, and fragment lengths are shown in Table 8.

[0051] Table 8 Positive Controls

[0052] Note: Negative and positive controls were subjected to nucleic acid extraction and PCR amplification simultaneously with clinical samples. If the negative control showed no typical amplification curve for each target channel, and the positive control showed typical amplification curves for each target channel with a Ct value ≤ 32, the experiment was considered valid; otherwise, the experiment was invalid and retesting was required.

[0053] The method of using the reagent kit provided in this embodiment is described in Embodiment 3.

[0054] Example 3: Method for detecting paraffin-embedded tissue samples using the aforementioned kit This embodiment provides a method for detecting pathogens causing nodular dermatitis in clinical paraffin-embedded tissue samples using the kit described in Example 2.

[0055] 1. Sample pretreatment (nucleic acid extraction) The extraction kits that can be used in this invention are: paraffin-embedded tissue extraction kits (Tiangen-DP331 or Omega's D3399-01). In this embodiment, all experiments used the Tiangen DP331 extraction kit.

[0056] Sample preparation: Take paraffin sections (5-10 μm thick, 1) 1cm 2 (Size) 5-8 sheets; Paraffin block: scrape approximately 30mg of tissue sample with a scalpel (remove as much paraffin as possible); Place the paraffin sections or blocks into a 1.5 mL centrifuge tube, add 1 mL of xylene, and vortex vigorously for 10 seconds. Centrifuge at 12000 rpm at room temperature for 2 min, then discard the supernatant; Add 1 ml of anhydrous ethanol to the tube above and vortex to mix for 10 seconds. Centrifuge at 12000 rpm at room temperature for 2 min, then discard the supernatant; Let it sit at room temperature for 5-10 minutes to allow the ethanol to evaporate completely. Add 200 μl buffer GA and 20 μl proteinase K, mix thoroughly, and incubate at 56 °C for 1 h until the sample is completely lysed. Incubate at 90℃ for 1 hour; Add 220 μl of buffer GB to the tube and vortex to mix. Then add 250 μl of anhydrous ethanol, vortex to mix thoroughly, and briefly centrifuge to collect the solution on the tube wall to the bottom of the tube. Add the mixture obtained in the previous step to an adsorption column, centrifuge at 8000 rpm at room temperature for 2 min, discard the waste liquid, and put the adsorption column back into the collection tube. Add 500 μl of buffer GD to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 8000 rpm at room temperature for 60 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 600 μl of washing buffer PW to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 8000 rpm at room temperature for 60 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Repeat the previous step; Place the adsorption column back into the collection tube, centrifuge at 12000 rpm for 2 minutes, discard the waste liquid, and leave the adsorption column uncapped at room temperature for 2-5 minutes to thoroughly dry the residual rinsing liquid in the adsorption material. Transfer the adsorption column to a clean centrifuge tube, add 50 μL of elution buffer TE or ddH2O preheated to 65°C to the middle of the adsorption membrane for elution, incubate at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min, and store the centrifuge tube containing DNA at -20°C. 2. Reaction system preparation and amplification procedure The reaction system preparation scheme and amplification procedure are shown in Tables 5 and 6 of Example 2, respectively, wherein the amount of nucleic acid template added is 5 μl.

[0057] 3. Result Interpretation After amplification, the results were interpreted according to the interpretation criteria described in Section 4 of Example 2.

[0058] Example 4: Primer and probe screening and single / multiplex contrast experiments In this embodiment, primer-probe combinations for five targets were screened and optimized, and the optimal combination obtained by screening was compared and verified in single-reaction and multiple-reaction systems.

[0059] 1. Primer and probe screening Multiple primer-probe combinations were designed and screened for five targets: Sporothrix schenckii complex, Mycobacterium marineum, Mycobacterium tuberculosis complex, Mucor, and Rhizopus. The primer-probe sequences used in the screening are as follows: Schenck's Sporothrix complex primer and probe sequences: SSc-F1: AAGTATTGCTAGTAATCGTGAAT, as shown in SEQ ID NO.25 SSc-R1: CGAGATGGGATTCACCGTGAC, as shown in SEQ ID NO.26 SSc-P1: TCACGGTGAATCCCATCTCGGTTT, as shown in SEQ ID NO.27 SSc-F2: CATGTCACGGTGAATCCCAT, as shown in SEQ ID NO.28 SSc-R2: GGTAGTACCAAACCGAGATGGG, as shown in SEQ ID NO.29 SSc-P2: TGGTACTAACCACTCGTCGCAT, as shown in SEQ ID NO.30 SSc-F3: ACCACTCGTCGCATGCTGAA, as shown in SEQ ID NO.31 SSc-R3: TCCTTTCAGCATGCGACGAG, as shown in SEQ ID NO.32 SSc-P3: GGTACTAACCACTCGTCGCATGCT, as shown in SEQ ID NO.33.

[0060] Mycobacterium marineis primer and probe sequences: Mmar-F1: TTTCCGATGCCCGAGACGTG, as shown in SEQ ID NO.34 Mmar-R1: GCGTGCTGCAATCGGGAATC, as shown in SEQ ID NO.35 Mmar-P1: AGGCCAGTGTTGTACACGCCCGA, as shown in SEQ ID NO.36 Mmar-F2: CAAGGCCAGTGTTGTACACG, as shown in SEQ ID NO.37 Mmar-R2: CGAAGTTCGGGCTATCAGAATG, as shown in SEQ ID NO.38 Mmar-P2: CCCAGGTTGGCGATTCCCGATT, as shown in SEQ ID NO.39 Mmar-F3: GATTTGCAGCGCACCGACATT, as shown in SEQ ID NO.40 Mmar-R3: GATACTCGGGATTGCTGAATCT, as shown in SEQ ID NO.41 Mmar-P3: CTGATAGCCCGAACTTCCGAAGG, as shown in SEQ ID NO.42.

[0061] Mycobacterium tuberculosis complex (all combinations share one probe): MTBC-P: CGTCGGCTTTCTTCGCGGCCGA, as shown in SEQ ID NO.43 MTBC-F1: GACAACGCCGAATTGCGAAG, as shown in SEQ ID NO.44 MTBC-R1: TGCGGTGGCCCTGATGATCG, as shown in SEQ ID NO.45 MTBC-F2: CGAATTGCGAAGGGCGAACG, as shown in SEQ ID NO.46 MTBC-R2: GATGATCGGCGATGAACCGG, as shown in SEQ ID NO.47 MTBC-F3: GCGAAGGGCGAACGCGATTT, as shown in SEQ ID NO.48 MTBC-R3: TAATTAGCGTGCTGGCCGGTC, as shown in SEQ ID NO.49 MTBC-F4: GAACGCGATTTTAAAGACCGC, as shown in SEQ ID NO.50 MTBC-R4: CGTGGCTGGCCGTCGAGCT, as shown in SEQ ID NO.51 MTBC-F5: GATTTTTAAAGACCGCGTCGG, as shown in SEQ ID NO.52 MTBC-R5: GCTGGCCGGTCGAGCTCGGC, as shown in SEQ ID NO.53 MTBC-F6: AAAGACCGCGTCGGCTTTCT, as shown in SEQ ID NO.54 MTBC-R6: AACCGGGT AATTAGCGTGCTGG, as shown in SEQ ID NO.55 MTBC-F7: GACCGCGTCGGCTTTCTTCG, as shown in SEQ ID NO.56 MTBC-R7: TCGCCGATCATCAGGGCCAC, as shown in SEQ ID NO.57 MTBC-F8: TTCGCGGCCGAGCTCGACCG, as shown in SEQ ID NO.58 MTBC-R8: CGGTGGCCCTGATGATCGGC, as shown in SEQ ID NO.59.

[0062] Mucor primer and probe sequences: Muc-F1: CGCATGGCCTTGTGCTAGCG, as shown in SEQ ID NO.60 Muc-R1: AATCTCAACCATGATAGGGCAG, as shown in SEQ ID NO.61 Muc-P1: CGACGGTCCACTCGATTTTCTGCC, as shown in SEQ ID NO.62 Muc-F2: TCGATTTTTCTGCCCTATCATGG, as shown in SEQ ID NO. 63 Muc-R2: TGTAGGCATTGTAAGCCTCTAT, as shown in SEQ ID NO.64 Muc-P2: GTTGAGATTGAGAGAGAGAGCTT, as shown in SEQ ID NO.65.

[0063] Rhizopus primer and probe sequences: Rhi-F1: AGCGGATCGCATGGCCTTGT, as shown in SEQ ID NO.66 Rhi-R1: GATAGGGCAGAAAATCGAGTGG, as shown in SEQ ID NO.67 Rhi-P1: TGCTAGCGACGGTCCACTCGAT, as shown in SEQ ID NO.68 Rhi-F2: GTGCTAGCGACGGTCCACTC, as shown in SEQ ID NO. 69 Rhi-R2: CCCGTTACCCGTTGTAGGCAT, as shown in SEQ ID NO.70 Rhi-P2: CTGCCCTATCATGGTTGAGATTG, as shown in SEQ ID NO.71 Rhi-F3: ATCATGGTTGAGATTGTAAGATAG, as shown in SEQ ID NO.72 Rhi-R3: CCTAATTCCCGTTACCCGTT, as shown in SEQ ID NO.73 Rhi-P3: AGGCTTACAATGCCTACAACGG, as shown in SEQ ID NO.74.

[0064] The Ct values ​​of the fluorescent labels and detection templates for each combination are as follows: 1.1 Primer and probe screening for Schenck's sporophytum complex The Ct values ​​of the primer and probe screening results for Schenck's Sporothrix complex are shown in Table 9, and the fluorescence curves are shown in […]. Figure 1 .

[0065] Table 9. Ct values ​​for primer and probe screening of Schenck's Sporothrix complex

[0066] 1.2 Screening of primers and probes for Mycobacterium marineum The Ct values ​​for primer and probe screening of Mycobacterium marineis are shown in Table 10, and the fluorescence curves are shown in [Table 10]. Figure 2 .

[0067] Table 10 Ct values ​​for screening primers and probes for Mycobacterium marineis

[0068] 1.3 Screening of primers and probes for Mycobacterium tuberculosis complex The Ct values ​​of the Mycobacterium tuberculosis complex primer-probe screening results are shown in Table 11, and the fluorescence curves are shown in [Table 11]. Figure 3 .

[0069] Table 11 Ct values ​​for screening primers and probes for Mycobacterium tuberculosis complexes

[0070] 1.4 Screening of Mucor primers and probes The Ct values ​​of the primer and probe screening results for Mucor are shown in Table 12, and the fluorescence curves are shown in [Table 12]. Figure 4 .

[0071] Table 12 Ct values ​​for screening primers and probes of Mucor.

[0072] 1.5 Rhizopus primer and probe screening The Ct values ​​of Rhizopus primer-probe screening are shown in Table 13, and the fluorescence curves are shown in [Table 13]. Figure 5 .

[0073] Table 13 Ct values ​​for Rhizopus primer and probe screening

[0074] 1.6 Determining the Optimal Combination Combining Ct values ​​and amplification curves ( Figures 1-5 Based on the screening results, the optimal primer-probe combinations for each target were determined as follows: Group 2 for Schenck's Sporothrix complex, Group 2 for Mycobacterium marineum, Group 7 for Mycobacterium tuberculosis complex, Group 2 for Mucor, and Group 1 for Rhizopus. The sequences of each primer and probe in the above optimal combinations are shown in Example 1.

[0075] 2. Single and multiple comparison experiments 2.1 Comparison of Single and Multiple Weights of Tube A Primer and probe combinations for Schenck's Sporothrix A (FAM), Mycobacterium marineii (ROX), and Mycobacterium tuberculosis complex (Cy5) were compared and detected in both single-component and multiplex (tube A) systems. Ct values ​​are shown in Table 14, and fluorescence curves are shown in […]. Figure 6 .

[0076] Table 14 Ct values ​​for single and multiple tube weights in tube A

[0077] 2.2 Comparison of Single and Multiple B-tube Weights Primer-probe combinations of *Rhizopus* (FAM) and *Mucor* (ROX) were compared and detected using both single-base and multiple-base (B-tube) systems. The Ct values ​​are shown in Table 15, and the fluorescence curves are shown in [Table 15]. Figure 7 .

[0078] Table 15 Ct values ​​for single and multiple tube weight comparisons in tube B

[0079] 2.3 Comparative Conclusions As shown in Tables 14 and 15, the Ct values ​​detected for each target in the multiplex reaction system (tubes A and B) are basically consistent with the Ct values ​​in the single-detection system, indicating that the amplification efficiency of the primer-probe combination of each target in the multiplex system is comparable to that in the single-detection system, and there is no mutual interference between the targets.

[0080] Example 5: Specificity and Clinical Performance Validation This embodiment verifies the detection specificity and clinical detection performance of the primer and probe composition described in Example 1 and the kit described in Example 2.

[0081] 1. Experimental Materials The proximate interference strains used for specificity verification were all purchased from Beina Biotechnology. Specific information is shown in Table 16.

[0082] Table 16 Information on interfering strains

[0083] All samples used in the clinical validation were provided by the hospital, and all samples were paraffin-embedded tissues. Mycobacterium marinum and Mycobacterium tuberculosis were tested using BNCC364972 and BNCC382280 from Beina Biotechnology, respectively. Other targets (Sporothrix schenckii complex, Rhizopus, and Mucor) were tested using recombinant plasmids of the corresponding targets.

[0084] 2. Specificity verification Using the nucleic acids of the eight proximal interfering strains listed in Table 16 as templates, the kits described in Example 2 were used to detect the samples according to the method described in Example 3, and the specificity of each target primer-probe combination was evaluated.

[0085] The results showed that none of the interfering strains exhibited typical amplification curves or non-specific amplification signals in any detection channel, and the specificity of each target primer-probe combination was 100%.

[0086] 3. Clinical performance validation Clinical paraffin-embedded tissue samples were tested using the kit described in Example 2. The detection accuracy, precision, and sensitivity of each target were evaluated. Accuracy was evaluated by the detection concordance rate of known positive / negative samples; precision was evaluated by the coefficient of variation (CV%) of the Ct value after repeated testing of the same positive sample; and detection sensitivity was evaluated by the detection rate (95% or higher) at the lowest concentration of the target nucleic acid that could be stably detected. The results of each performance indicator are shown in Table 17.

[0087] Table 17 Clinical performance validation results of the reagent kit

[0088] As shown in Table 17, the primer and probe composition and kit of the present invention have achieved 100% specificity, accuracy and sensitivity for the detection of five pathogens causing nodular dermatitis, and the precision (Ct value coefficient of variation) is less than 5%, indicating that the kit has good detection accuracy and repeatability and can meet the needs of clinical testing.

[0089] As shown in the above embodiments, the present invention provides a primer-probe composition for detecting pathogens causing nodular dermatitis and a kit containing the composition. The present invention obtained primer-probe combinations with good specificity by screening multiple primer-probe combinations for each of five targets. In singlet and multiplex comparison experiments, the amplification efficiency of the primer-probe composition for each target in the multiplex reaction system was basically consistent with that in the singlet reaction system, indicating that there was no mutual interference between the primer-probe groups. Specificity verification results showed that the present invention did not cause non-specific amplification of eight closely related interfering bacteria. Clinical sample detection results showed that the kit of the present invention could effectively detect the corresponding target pathogens from paraffin-embedded tissue samples. Furthermore, the present invention established clear result interpretation criteria, with clear criteria for positive and negative results, which can effectively guide actual detection operations.

[0090] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe composition, characterized in that, This includes primer pairs for detecting Mucor, primer pairs for detecting Rhizopus, primer pairs for detecting Sporothrix schenckii complex, primer pairs for detecting Mycobacterium marineum, and primer pairs for detecting Mycobacterium tuberculosis complex. The upstream primer of the primer pair used for detecting Mucor is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2; The upstream primer of the primer pair used for detecting Rhizopus is shown in SEQ ID NO.3, and the downstream primer is shown in SEQ ID NO.4; The upstream primer of the primer pair used to detect Schenck's Sporothrix complex is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6; The upstream primer of the primer pair used for detecting Mycobacterium marineum is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.8; The upstream primer of the primer pair used for detecting Mycobacterium tuberculosis complex is shown in SEQ ID NO.9, and the downstream primer is shown in SEQ ID NO.10; It also includes probes for detecting Mucor, probes for detecting Rhizopus, probes for detecting Schenck's Sporothrix complex, probes for detecting Mycobacterium marineum, and probes for detecting Mycobacterium tuberculosis complex.

2. The primer-probe composition according to claim 1, characterized in that, The probe used to detect Mucor is shown in SEQ ID NO.11; The probe used to detect Rhizopus is shown in SEQ ID NO.12; The probe used to detect Schenck's Sporothrix complex is shown in SEQ ID NO.13; The probe used to detect Mycobacterium marineum is shown in SEQ ID NO.14; The probe used to detect Mycobacterium tuberculosis complex is shown in SEQ ID NO.

15.

3. The primer-probe composition according to claim 2, characterized in that, The probes for detecting Mucor, Rhizopus, Schenck's Sporothrix complex, Mycobacterium marineum, and Mycobacterium tuberculosis complex optionally carry a labeling group. The labeling group optionally includes a fluorescent group labeled at the 5' end of the probe and / or a quenching group labeled at the 3' end of the probe, wherein the fluorescent group is FAM, ROX or Cy5 and the quenching group is MGB or BHQ2.

4. The primer-probe composition according to claim 1, characterized in that, The primer-probe composition also includes primer pairs and probes for detecting internal reference genes.

5. The primer-probe composition according to claim 4, characterized in that, The internal reference gene is RPP30, and the primer pairs and probes used to detect the internal reference gene are shown in SEQ ID NO.16~SEQ ID NO.

18.

6. A kit for detecting pathogens causing nodular dermatitis, characterized in that, The primer-probe composition comprising any one of claims 1 to 5.

7. The reagent kit according to claim 6, characterized in that, In the kit, the final concentration of any primer in the reaction system is 0.05 μM to 0.25 μM, and the final concentration of any probe in the reaction system is 0.025 μM to 0.2 μM.

8. The reagent kit according to claim 6, characterized in that, The kit includes a first group of reagents and a second group of reagents; The first set of reagents includes primer pairs and probes for detecting Schenck's Sporothrix complex, primer pairs and probes for detecting Mycobacterium marineum, primer pairs and probes for detecting Mycobacterium tuberculosis complex, and primer pairs and probes for detecting internal reference genes. The second set of reagents includes primer pairs and probes for detecting Mucor, primer pairs and probes for detecting Rhizopus, and primer pairs and probes for detecting internal reference genes.

9. The reagent kit according to claim 6, characterized in that, The test result interpretation criteria of the kit are as follows: for any pathogen among the Mucor, Rhizopus, Schenck's Sporothrix complex, Mycobacterium marineum and Mycobacterium tuberculosis complex, when the CT value of the detection channel corresponding to the pathogen is ≤38, the pathogen is judged to be positive. When the CT value of the detection channel corresponding to the pathogen is greater than 38 and less than or equal to 40, the detection result of the pathogen is determined to be uncertain and the sample needs to be retested. When the CT value of the detection channel corresponding to the pathogen is greater than 40 or there is no CT value, the pathogen is judged to be negative.

10. The use of the primer-probe composition of any one of claims 1 to 5 or the kit of any one of claims 6 to 9 in the preparation of a product for detecting pathogens causing nodular dermatitis.

Images