Corn transformant LIKE024 and detection method thereof

Abstract

The present application relates to nucleic acid molecules of corn transformant LIKE024, detection methods and applications, the sequence of the nucleic acid molecules of the corn LIKE024 includes the sequence shown in SEQ ID NO. 1 or its reverse complement, or the sequence shown in SEQ ID NO. 2 or its reverse complement.The corn transformant LIKE024 of the present application has the characteristics of insect resistance and glyphosate herbicide tolerance, and the detection method can accurately and quickly identify whether the biological sample contains the DNA molecules of the corn transformant LIKE024.

Description

Technical Field

[0001] This invention relates to the field of plant biotechnology. Specifically, it relates to the nucleic acid molecule, detection method, and application of maize transformant LIKE024, and particularly to an insect-resistant and glyphosate-tolerant maize transformant LIKE024 and a nucleic acid molecule and detection method for detecting whether a biological sample contains a specific maize transformant LIKE024. Background Technology

[0002] Corn is the most widely planted and highest-yielding grain crop in my country. However, throughout its growth cycle, corn faces the dual threat of lepidopteran pests (such as the corn borer and fall armyworm) and field weeds. Statistics show that pests cause an annual yield reduction of approximately 10% to 15%; while weeds compete with crops for resources such as water, fertilizer, and light, potentially leading to yield reductions of over 30% in severe cases. Traditional chemical control methods not only increase production costs but also cause problems such as pesticide residues and environmental pollution. Therefore, developing new transgenic corn varieties that are insect-resistant and herbicide-tolerant is an effective way to reduce yield losses and improve planting efficiency.

[0003] With the development and promotion of genetically modified crops, traditional single-trait genetically modified maize can no longer meet the complex and ever-changing needs of agricultural production. Genetically modified maize with composite traits, combining multiple insect-resistant genes and herbicide-tolerant genes, is gradually becoming the mainstream development direction. By hybridizing two or more transformants, it is possible to create maize materials with composite traits that simultaneously possess multiple insect resistance spectra and herbicide tolerance, thereby expanding the insect resistance spectrum, improving resistance levels to target insects, and delaying the evolution of pest resistance.

[0004] However, the effectiveness of gene fusion is influenced by a variety of complex factors. First, the integration location of exogenous genes in the plant genome is random; differences in chromatin structure at the insertion site in different transformants can lead to significant differences in the expression levels of exogenous genes (position effect). Different transformants obtained from the same expression vector transforming the same recipient variety may exhibit vastly different traits such as exogenous gene expression levels, insect resistance, and herbicide tolerance. Second, antagonistic effects may occur between different genes—when two or more exogenous genes fuse in the same plant, they may interfere with each other, leading to the suppression of the expression of one gene or producing unintended phenotypic effects. Therefore, not all transformants with superior single traits are suitable for gene fusion; specific fusion tests and systematic phenotypic evaluations are needed to screen for fusion combinations that balance various aspects of performance. Summary of the Invention

[0005] The purpose of this invention is to provide a maize transformant (also called a transformation event) with excellent insect resistance and herbicide tolerance traits, as well as a nucleic acid molecule for detecting LIKE024 and its detection method.

[0006] To achieve the above objectives, the present invention provides a nucleic acid molecule, wherein the sequence of the nucleic acid molecule is the sequence shown in SEQ ID NO. 1 and / or SEQ ID NO. 2, or the reverse complementary sequence thereof.

[0007] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4, or its reverse complementary sequence.

[0008] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO. 6 and / or SEQ ID NO. 7, or its reverse complementary sequence.

[0009] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO. 5 or its reverse complementary sequence.

[0010] The nucleic acid molecules are derived from the plant, seeds, or cells of the maize transformant LIKE024. The seeds of the transformant LIKE024 are deposited at the China Center for Type Culture Collection (CCTCC), located at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and are classified as maize seed LIKE024 Zea mays L., with the Latin name Zea mays L., accession number CCTCC NO: P202628, and accession date of September 9, 2026.

[0011] The present invention also provides a probe for detecting maize transformant LIKE024, characterized in that the sequence of the probe includes the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or SEQ ID NO. 6 or SEQ ID NO. 7 or its reverse complementary sequence.

[0012] The present invention also provides a primer pair for detecting maize transformant LIKE024, characterized in that the amplification product of the primer pair contains the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or SEQ ID NO. 6 or SEQ ID NO. 7 or its reverse complementary sequence.

[0013] In some embodiments, the sequences of the primer pairs described above are shown in SEQ ID NO. 8 and SEQ ID NO. 9; or in SEQ ID NO. 10 and SEQ ID NO. 11.

[0014] The present invention also provides a kit or microarray for detecting maize transformant LIKE024, characterized in that it comprises the above-described probe and / or primer pairs.

[0015] The present invention also provides a method for detecting the maize transformant LIKE024, characterized in that it includes using the above-described probe or primer pair or probe and primer pair or kit or microarray to detect the presence of the transformant in the sample to be tested.

[0016] The present invention also provides a method for breeding maize, characterized in that the method includes the following steps:

[0017] 1) Obtain corn containing the above-mentioned nucleic acid molecules;

[0018] 2) Obtain maize plants, seeds, plant cells, progeny plants, or plant parts by means of pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, self-pollination, or hybridization, or a combination thereof, using the maize obtained in step 1). Optionally,

[0019] 3) The offspring plants obtained in step 2) are tested for the presence of the transformant using the methods described above.

[0020] Furthermore, the present invention also provides articles made from corn plants, seeds, plant cells, progeny plants or plant parts obtained by the above method, including food, feed or industrial raw materials.

[0021] In the present invention for detecting nucleic acid molecules in maize plants and the detection method thereof, the following definitions and methods are intended to better define the present invention and guide those skilled in the art to implement it. Unless otherwise stated, the terms shall be understood according to their conventional usage by those skilled in the art.

[0022] The term "maize" refers to maize (Zea mays) and includes all plant species that can interbreed with maize, including wild maize species.

[0023] The term "includes" means "including but not limited to".

[0024] A transformant is obtained by transforming plant cells with a heterologous DNA construct, comprising at least one nucleic acid expression cassette containing a target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerating the plant population, and selecting specific plants with characteristics of the insertion at a specific genomic site. "Transformant" refers to the original transformant containing heterologous DNA and its offspring; it also refers to the offspring obtained by sexual hybridization between a transformant and other varietal individuals containing heterologous DNA, where the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid offspring even after repeated backcrosses with a backcross parent; and it also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.

[0025] The maize transformant LIKE024 is a superior transformation event obtained through systematic screening. It exhibits strong tolerance to glyphosate herbicides and outstanding resistance to major lepidopteran pests such as the corn borer and fall armyworm. More importantly, combining LIKE024 with other transformants carrying glyphosate resistance and insect resistance genes not only broadens the insect resistance spectrum but also improves resistance levels against each target insect, demonstrating excellent gene aggregation compatibility and the potential for compound trait superposition. Therefore, the LIKE024 transformant has broad application prospects in the creation of transgenic maize with compound traits. Attached Figure Description

[0026] Figure 1 Physical map of expression carrier 7.

[0027] Figure 2 Results of indoor bioassay of corn borer.

[0028] Figure 3 Results of indoor bioassay of the fall armyworm.

[0029] Figure 4 PCR results of the left and right boundaries of the LIKE024 transformant. 1: Recipient control B104; 2: Detection of the left boundary of LIKE024; 3: Detection of the right boundary of LIKE024.

[0030] M: Molecular weight standard, with band size indicated next to it, in units of bp.

[0031] Figure 5 Schematic diagram of exogenous sequence insertion structure. Detailed Implementation

[0032] The transformant LIKE024 involved in this application refers to a maize plant obtained by genetic transformation using maize B104 as the recipient, in which a foreign gene insert (T-DNA insert) is inserted between specific genomic sequences. In a specific embodiment, the expression vector used for the transgene has Figure 1 The physical map shown indicates that the obtained T-DNA insert has the sequence shown in nucleotides 709-14546 of SEQ ID NO. 5. Transformer LIKE024 can refer to this transgenic process, the T-DNA insert within the genome obtained by this process, a combination of the T-DNA insert and flanking sequences, or the maize plant obtained by this transgenic process. In specific instances, this event also applies to plants obtained by transforming other recipient varieties with the same expression vector, thereby inserting the T-DNA insert into the same genomic location. Transformer LIKE024 can also refer to offspring plants obtained by asexual reproduction, sexual reproduction, doubling or multiplication, or a combination thereof, from the aforementioned plants.

[0033] Example 1: Obtaining and breeding transformants

[0034] To breed insect-resistant maize varieties resistant to two major maize pests—the corn borer and the fall armyworm—and tolerating glyphosate, the inventors constructed maize transformation vectors using nucleic acid molecules encoding three proteins: Cry1Ab, Cry1Da, and CP4 EPSPS. Cry1Ab is expected to be effective against the corn borer, Cry1Da against the fall armyworm, and CP4 EPSPS is expected to provide tolerance to glyphosate herbicides. Since different codons and regulatory elements can affect protein expression levels and functional effects, the inventors designed different coding genes and regulatory elements to construct different expression cassettes and vectors to obtain transformants with superior traits. Specific vector structures are shown in Table 1.

[0035]

[0036]

[0037] Using Agrobacterium-mediated transformation, the above-mentioned vectors were transformed into receptor B104, yielding at least 50 independent positive transformants from each vector. Each transformant was then self-pollinated to obtain T1 generation transgenic maize seeds. Thirty transformants from each vector were selected for herbicide tolerance and insect resistance assessment.

[0038] Each transformant was sown with 30 seeds. During the seedling stage, newly hatched larvae of fall armyworm, corn borer, bollworm, and armyworm were fed on positive maize leaves (leaves from a single positive maize plant from each transformant were mixed and divided into 5 portions, serving as 5 technical replicates, with 5 larvae per replicate) to evaluate the insect resistance of the materials. The plant's resistance to insects was evaluated based on the corrected mortality rate of the tested insects 6 days after feeding. The number of transformants reaching high resistance (corrected mortality rate ≥95% for corn borer, and ≥90% for fall armyworm, bollworm, and armyworm) was counted. The corrected mortality rate was calculated using the following formula. After sampling detached leaves, a medium dose of glyphosate (4 times the recommended dosage) was sprayed. One week after application, the phytotoxicity level of the maize plants was identified, and the damage rate was calculated. The number of transformants with a damage rate <10% (high resistance) was counted. The formulas for calculating the corrected mortality rate and damage rate are as follows.

[0039]

[0040] The results of insect resistance and herbicide resistance identification for each transformant are shown in Table 3. Considering the overall balance of resistance to the four target pests and herbicides, vector No. 7 yielded more highly resistant transformants, which is beneficial for further systematic breeding of the transformants. Therefore, vector No. 7 was used to further transform more transformants, and transformants highly resistant to all four target pests and glyphosate were selected using the same insect resistance and herbicide resistance identification methods as in this embodiment.

[0041]

[0042] The results showed that a total of 318 positive transformants were generated using vector No. 7, and 97 highly resistant transformants were screened using the above method. Further in vitro bioassays were performed on the filaments and seeds of these 97 transformants, using the same method as for detached leaves. Twelve transformants with high resistance to all four target pests in both filaments and seeds were selected.

[0043] The inventors further identified the field insect resistance of each transformant in the T2 generation, using the specific identification method described in "Environmental Safety Testing of Transgenic Plants and Their Products - Insect-Resistant Maize Part 1: Insect Resistance" (Ministry of Agriculture Announcement No. 953-10-2007). Specifically, for each corn borer, 10 plants were inoculated at the whorl stage and silking stage; for each fall armyworm and oriental armyworm, 10 plants were inoculated at the whorl stage; and for each cotton bollworm, 10 plants were inoculated at the silking stage. Each plant was inoculated with at least 30 insects.

[0044] The resistance of each transformant to each target pest was assessed by investigating the leaf-eating level and the ear-damage level. Specific results are shown in Table 4. In terms of leaf and ear damage levels, E7 showed the best overall resistance with damage levels below 2.0 for all target pests; followed by E1, where only the leaf-eating level of the Eastern armyworm exceeded 2.0, while the others were below 2.0; E5 showed leaf-eating levels exceeding 2.0 for the fall armyworm and the Eastern armyworm, and E10 also showed leaf-eating levels exceeding 2.0 for the corn borer and the ear-damage level of the cotton bollworm, indicating good performance.

[0045]

[0046] Example 2: Analysis of the insertion position of the converter

[0047] Tail-PCR was used to isolate the flanking sequences of the exogenous sequences in the maize genome from E1, E5, E7, and E10 transformants, thus clarifying the insertion sites of the exogenous sequences in the maize genome. The specific method is as follows:

[0048] 1. Analysis of flanking sequences at insertion sites of exogenous sequences in the maize genome

[0049] 100 mg of plant leaves were collected, rapidly ground in liquid nitrogen, and total DNA was extracted using the CTAB method. Tail-PCR was used to isolate the insertion sites of the T-DNA region sequences in the genome, and specific primers were designed to verify the insertion sites.

[0050] First, Tail-PCR was performed using three pairs of specific primers and degenerate primers on the right boundary. The specific primer information is shown in Table 5.

[0051]

[0052] The Tail-PCR reaction system and reaction procedure are shown below:

[0053] Tail-PCR reaction system for round 1:

[0054]

[0055] Second round Tail-PCR reaction system:

[0056]

[0057] The third round of Tail-PCR reaction system:

[0058]

[0059] Reaction procedure:

[0060]

[0061] The products obtained from the third round of Tail-PCR were sequenced, and the sequencing results were compared with the maize reference genome (MaizeGDB database https: / / www.maizegdb.org / blast, with Zm-B73-REFERENCE-NAM-5.0 as the reference sequence) to determine the specific location of the sequence in the genome, which is the insertion site. The insertion sites of the four transformants are shown in Table 6. Among them, the exogenous sequences of E5 and E7 transformants were inserted into intergenic regions of the maize genome, respectively, and have better expected value. E1 and E10 were not preferred choices because they were inserted into endogenous maize genes, which may affect future phenotypic performance and stability.

[0062]

[0063] Example 3: Effect of composite traits after hybridization and polymerization of transformants

[0064] E5 and E7 were crossed with other transformants to test their phenotypic performance after hybridization. Based on the target genes contained in the E5 and E7 transformants, transformants containing genes with different herbicide resistance than those in the E5 and E7 transformants, and whose insect resistance genes were not in the same family, were selected as hybrid parents. Following this principle, the inventors selected the MN85N-E6 transformant (see CN119372370 B) and hybridized it with E5 and E7 respectively. The insect resistance and herbicide tolerance of the hybrids were evaluated in the F1 generation, using the same evaluation methods as in the above examples. The results showed that the E5×MN85N-E6 and E7×MN85N-E6 hybrids could simultaneously tolerate 4 times the recommended dose of glyphosate and glufosinate-ammonium herbicides, with damage rates of <10% one week after application. However, in terms of resistance to corn borer, fall armyworm, and bollworm, E7×MN85N-E6 showed stronger resistance than E7 and MN85N-E6 alone, thus the polymerization effect of E7 with other transformants was better. E7 was named LIKE024.

[0065]

[0066] Example 4: Detection method for LIKE024

[0067] Using the Primerblast software on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast), forward and reverse primers were designed on the flanking sequences of the genome and the exogenous insertion sequence at the left and right boundaries of the insertion site, respectively (as shown in Table 8). Using the genomic DNA of the transgenic maize line as a template, the insertion site was verified by PCR amplification. The amplification product fused a portion of the maize genome sequence and a portion of the T-DNA sequence, and the PCR product was sequenced and analyzed.

[0068] The PCR reaction system specifically includes 1.0 μL of genomic DNA, 10.0 μL of 2×PCR Mixture, 0.5 μL of forward primer (10 μM) and 0.5 μL of reverse primer (10 μM), and water is added to bring the volume to 20 μL.

[0069] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, annealing for 30 s, extension at 72℃ for a certain time (set at 60 s / kb), 30 cycles; extension at 72℃ for 7 min.

[0070] PCR amplification results are shown below Figure 4 The PCR amplification products at the left and right boundaries were sequenced to obtain the LIKE024 transformant T-DNA insertion boundary sequence and flanking sequences, which were assembled as follows (uppercase letters represent maize genome sequences, lowercase letters represent T-DNA sequences, and bold indicates the positions of transformant-specific PCR primers):

[0071] Left boundary: SEQ ID NO. 6

[0072] GTCAGTTTCACTTGTCATGAGCATCTATAACTTTCTCTTCAATCGTATCATATACAGCCACAATTAACCTTCAAGAGTGATCCAGAAAATTTCTGTTTATTGTTGACCAACAAATGAAAACGAAGTAAGAAACCCTAAATGCTTATGTTTCCCTTCTTCCCACTTAGGGCTTGTTCGGTTCTACCCCAATCCATATGGATTGAGGGGGATTGAGGGGTTTCAATCCCTAGCAAGTTAAAATCCCTCCTAATCCGTATCAATCCCCTCCAATTCATATGGATTGAAAATAACCGAACAAGCCCTTAAGGGATACATAACTGGTTTTGAAAACATTTTGTTTTGAAAATAACTGTCTCCTGCTTACAACACTTGCTCCAATTCATCATCAAAATGTGCTACTTGGAGTAGAAACTTAACTTCTATAGCCTTATTTTTTCTTCTATCGTTTAGCAAAAGATATACTCCCTCCTCCCAAATTATATGTGGTTTTGGCTTTTCTAGGTATTTAGCTTTTGCTATGCACCTACATATACGTTGTGTCTAGATAAGTAAAAACACTGACATCAGAATATTCTTTAGTGGAAATCCTGCTAGTACAATTTTCACGTCACATTTTATTTTAATAATTTTATGCATGTTTATTTTTTGGACCAAGGCTTATAAAGATTAGTTGCCAAATTCTAGAATGAAAAGAGAATGGTGGGATTAgacgcttagacaacttaataacacattgcggacgtttttaatgtactgaattaacgccgaattaattagtgagaattaattaaGTAAAACGACGGCCAGTGAATTCctgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttagga

[0073] Right boundary: SEQ ID NO. 7

[0074] gtccttcgctgcatttacagtccatacagacacagcatttccattttgcacaagatagagaacaacaatcagccttttaggtcaatcccaagtgtgcataagcttggcgtaatcatggtcatagctgtttcctggtttaaaccggtgtcatctatCAGGAAACGTTAGAGGCTATTCTGTTTCTAGTTGGAAAGAATTGATGGATTTTT TTTTAAAAAAAGTGAGAAATAAAATTCATGGTACAGTTGCTCTAGTTTCAATACAAGTTTACCTCTGCTAACCAGTAACCATAACTAAATTATTAATGTTCACATAAAGTAAATATGTTATATGCACAATTACCTACGTGGGAATTGCTATAAGCATAATTATCATTTTGGAATGGGGATCGGGTTGTTTTGTATGAATATTTATATCA TTCAACCCTTTATGAGTTTGTTTCCAAAATACGTTTCAAGTAATAGATAGACCTCAATCGTGTATCTTTTAGTGTCACTTTTTTCCCTTTTGAAAGTTCTCTAGAGCTAAAATTACGCTTATGCAAATATGCACCACATTGGAGCTGTTGGTAACCGTAGAATACTAAGAATTTTGAATCTTATAATTGAGTACGTATTTGCAGGAACC GAGTTAATGTGGAGGACGAGGAGACACTTTCAAGCGTTGCTCAATGTATTGAGCAACTACGACAGAGTTCTTCATCCTCACAGGAGAAAGAGAGCTCTTTGAAGCAGTTATTAGATCTTGTTCAAACTCGTGATACTGCATTCGGAGCTGTTGGGTCACATTCACAGGCTGTTCCGATACTTGTATCTCTCCTTAGGTCTGGACCATCTG

[0075] Sequencing analysis showed that the exogenous fragment LIKE024 was stably inserted into the maize genome at positions chr6: 123070764-123070826. The transgenic process resulted in a 61 bp insertion mutation in the maize genome, with a 30 bp deletion at the LB end and a 57 bp deletion at the RB end of the T-DNA.

[0076] 2. Analysis of in vitro full-length insertion sequences in transformed organisms

[0077] Using SEQ ID NO: 8 and SEQ ID NO: 11 as primers and the genomic DNA of the transformant LIKE024 as a template, PCR amplification was performed, and the obtained PCR product was the exogenous full-length insert sequence. Sequencing analysis and sequence assembly of the PCR product yielded the actual insert sequence of the LIKE024 transformant and the left and right flanking maize genome sequences, as shown in SEQ ID NO: 5. The insert structure is as follows. Figure 5 As shown.

[0078] New varieties can be bred from the maize transformant LIKE024 and used to produce agricultural products or commodities. If a sufficient amount is detected in the agricultural product or commodity, it is expected to contain a nucleotide sequence capable of diagnosing the presence of the maize transformant LIKE024 material in the agricultural product or commodity. The agricultural product or commodity includes, but is not limited to, corn oil, cornmeal, corn flour, corn paste, starch, and other condiments or any other food source intended for animal consumption, or cosmetics, industrial products, etc. Nucleic acid detection methods and / or kits based on probe or primer pairs can be developed to detect the nucleotide sequence of the maize transformant LIKE024, such as shown in SEQ ID NO. 1 or SEQ ID NO. 2, in biological samples, wherein the probe sequence or primer amplification sequence is selected from sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7, to diagnose the presence of the maize transformant LIKE024.

[0079] One of the detection methods is to use PCR to detect the specific boundary sequences in maize plants obtained by backcrossing transformant LIKE024 with other maize germplasm. The PCR primer pairs used are SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10, SEQ ID NO. 11, respectively.

[0080] The PCR reaction system is as follows:

[0081]

[0082] The PCR reaction procedure is as follows:

[0083]

[0084] The PCR products were electrophoresed on a 1% (w / v) 1×TAE agarose gel. The results are shown in the figure. Figure 4The LIKE024 transformant can amplify the expected target bands (SEQ ID NO. 6 and / or SEQ ID NO. 7, respectively). Furthermore, this PCR method can track the presence of transformants, thus enabling its application in breeding work.

[0085] In summary, the maize transformant LIKE024 of this invention can improve the insect resistance and tolerance to glyphosate herbicides in plants, and can also be used to improve other maize germplasm and create new maize hybrid combinations. Its detection method can accurately and rapidly identify whether biological samples contain the DNA molecules of the maize transformant LIKE024.

[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A nucleic acid molecule for identifying the transformant LIKE024, characterized in that, It can be any of the following: i) Nucleic acid molecules containing the sequences shown in SEQ ID NO. 1 and / or SEQ ID NO. 2, or their reverse complementary sequences; ii) Nucleic acid molecules containing the sequences shown in SEQ ID NO. 3 and / or SEQ ID NO. 4, or their reverse complementary sequences; iii) Nucleic acid molecules containing the sequences shown in SEQ ID NO. 6 and / or SEQ ID NO. 7, or their reverse complementary sequences; iv) A nucleic acid molecule containing the sequence shown in SEQ ID NO. 5, or its reverse complementary sequence; The nucleic acid molecules are derived from the plant, seeds, or cells of the transformant LIKE024, and the seeds of the transformant LIKE024 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO: P202628.

2. A method for breeding maize, characterized in that, The method includes the following steps: 1) Obtaining corn containing the nucleic acid molecule of claim 1; 2) The maize obtained in step 1) is subjected to pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, self-pollination or hybridization or a combination thereof to obtain maize plants, seeds, plant cells, progeny plants or plant parts; 3) Detect the presence of LIKE024 transformants in the offspring plants obtained in step 2).

3. A method for protecting corn plants from damage caused by herbicides, characterized in that, This includes applying an effective dose of glyphosate herbicide to a field where at least one transgenic maize plant is planted, said transgenic maize plant containing the nucleic acid sequence of SEQ ID NO. 5 at positions 815-14490 in its genome B73 NAM-5.0 version chr6:123070764-123070826, or said transgenic maize plant containing SEQ ID NO. 5 at positions 123070764-123070826 in its genome B73 NAM-5.0 version chr6:123070764-123070826; said transgenic maize plant is tolerant to glyphosate herbicide; The genetically modified corn variety is B104.

4. A method for protecting corn plants from insect infestation, characterized in that, The method includes providing at least one transgenic maize plant cell in the diet of target insects, said transgenic maize plant cell containing the nucleic acid sequence of SEQ ID NO. 5 at positions 815-14490 in its genome B73 NAM-5.0 version chr6:123070764-123070826, or the transgenic maize plant cell containing SEQ ID NO. 5 at positions 123070764-123070826 in its genome B73 NAM-5.0 version chr6:123070764-123070826; target insects that ingest said transgenic maize plant cells are inhibited from further ingesting said maize plant; The genetically modified corn variety is B104; The target insects are fall armyworm, corn borer, cotton bollworm, or oriental armyworm.

Images