Use of snp molecular markers on pig chromosome 17 associated with body length and height

Abstract

The application discloses application of a SNP molecular marker related to body length and body height on chromosome 17 of pigs, wherein the site of the SNP molecular marker is rs80809111, and the genotype of the SNP molecular marker is CC, CT or TT. By detecting the single nucleotide polymorphism and / or genotype of the SNP molecular marker, the body length and body height of the pigs can be identified. In the process of genetic breeding, by eliminating the pigs with the genotype of TT, the frequency of the allele C of the site can be improved, the body length and body height of the offspring pigs can be effectively improved, and the economic benefits of the pigs can be improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of SNP molecular markers located on pig chromosome 17 that are associated with body length and body height. Background Technology

[0002] Pork is a major source of animal protein for humans, and improving meat production efficiency remains a core objective of the global pig farming industry. In commercial pig production, body condition traits such as body length and height are key economic indicators. Body length and height are important body size traits that measure skeletal development and body structure in pigs, directly affecting slaughter performance and meat production. Individuals with longer body lengths typically have longer carcasses and higher carcass yields, while body height is closely related to longitudinal skeletal development and overall body frame. Improving body length and height through genetic modification is of great significance for enhancing meat production efficiency and the economic benefits of pig farming.

[0003] Body length and height are quantitative traits with moderate heritability. While traditional phenotypic selection can achieve some genetic progress, the speed of genetic improvement in conventional breeding is limited because these traits can only be accurately measured late in the individual's growth and the measurement workload is substantial. Molecular marker-assisted selection, through the early selection of target genotypes using DNA markers closely linked to the trait, can shorten the generation interval and improve selection accuracy, providing a new technical approach for improving body size traits in pigs.

[0004] Currently, candidate genes and QTL mapping have been used to identify some candidate genes affecting growth traits. However, these methods are only applicable to genes with known biological functions or with large mapping intervals, which greatly limits the application of molecular markers for complex traits in livestock genetics and breeding. Summary of the Invention

[0005] The purpose of this invention is to provide an application of a SNP molecular marker located on chromosome 17 of pigs that is significantly associated with pig body length and height.

[0006] According to a first aspect of the invention, the application of SNP molecular markers located on pig chromosome 17 that are associated with body length and body height is provided, specifically, the application includes at least one of the following (1) to (2): (1) Identify the body length and / or body height traits of pigs; (2) Genetic improvement of pig body length and / or body height traits.

[0007] The present invention relates to a SNP molecular marker located on pig chromosome 17 that is associated with body length and height. The site is rs80809111, corresponding to the T>C mutation at position 15421803 bp on chromosome 17 in the International Pig Reference Genome 11.1. This mutation has a significant impact on both body length and height traits in pigs. The genotype of this SNP molecular marker is CC, CT, or TT.

[0008] Association analysis of different genotypes with body length and height phenotypes demonstrates that the SNP molecular markers provided in this invention are significantly correlated with body length and height traits in pigs. Specifically, the average body length and height phenotypes of pigs with the CC genotype are significantly greater than those of pigs with the CT and TT genotypes. Therefore, by detecting the single nucleotide polymorphisms and / or genotypes of the SNP molecular markers of this invention, the body length and / or height traits in pigs can be identified. Furthermore, in pig genetic breeding, by preferentially selecting individuals with the CC genotype and eliminating individuals with the TT genotype to progressively increase the frequency of the C allele at this locus, the body length and height of pigs can be significantly improved, achieving genetic improvement of these traits.

[0009] According to a second aspect of the invention, an application is provided for detecting the SNP molecular markers of the invention located on porcine chromosome 17 that are associated with body length and body height, the application comprising at least one of the following (1) to (4): (1) Identify the body length and / or body height traits of pigs; (2) Prepare products for identifying the body length and / or body height traits of pigs; (3) Pig genetic improvement, based on eliminating pigs with the SNP molecular marker genotype TT to improve the body length and / or height of pigs and achieve the genetic improvement of the body length and / or height traits of pigs; (4) Prepare products for assisting in the genetic improvement of pigs, which are based on the identification of SNP molecular markers to assist in the genetic improvement of pig body length and / or body height traits.

[0010] In some embodiments, products for detecting SNP molecular markers on porcine chromosome 17 that are associated with body length and height may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers on porcine chromosome 17 that are associated with body length and height.

[0011] In some embodiments, the reagents used to detect SNP molecular markers on pig chromosome 17 that are associated with body length and height may include at least one of the following: primers or probes for detecting SNP molecular markers on pig chromosome 17 that are associated with body length and height.

[0012] In some implementations, the pig is a Landrace pig or its synthetic line.

[0013] In some embodiments, the primers used to detect SNP molecular markers associated with body length and height located on pig chromosome 17 include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify an amplified fragment containing the single nucleotide polymorphism at position 148 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 148 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 15421803 bp on chromosome 17 of the International Pig Reference Genome Version 11.1, is T or C.

[0014] In some embodiments, the kit for detecting SNP molecular markers associated with body length and height located on porcine chromosome 17 may include primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0015] According to a third aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 17 of pigs that are associated with body length and body height; (2) Eliminate individuals with genotype TT to increase the frequency of allele C at that locus in each generation, thereby increasing the body length and height of offspring pigs.

[0016] In some implementations, in step (1), the pig is a pig in the core breeding herd.

[0017] In some implementations, in step (1), the pig is a Landrace pig or its synthetic line.

[0018] In some implementations, step (1), determining the genotype of the SNP molecular markers on chromosome 17 of pigs that are associated with body length and height, includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotypes of the SNP molecular markers associated with body length and height on pig chromosome 17 were determined based on the sequencing results.

[0019] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of the SNP molecular marker rs80809111, which is located on the nucleotide sequence of pig chromosome 17 and is significantly associated with the body length and height traits of pigs, on the body length and height traits of Landrace pigs. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the body length and height traits of Landrace pigs, thereby improving the body length and height of offspring pigs and thus effectively improving the economic benefits of pigs.

[0020] (2) Based on the SNP molecular marker rs80809111 located on chromosome 17 of pigs and associated with body length and height, this invention provides a method for genetic improvement of pigs. By eliminating pigs with the genotype TT of this SNP molecular marker, the allele frequency of the dominant allele C can be significantly increased, and the body size trait of pigs can be selected and improved quickly and accurately, thus accelerating the breeding process. Attached Figure Description

[0021] Figure 1 This is a genome-wide association (GWAS) Manhattan plot of body height trait on chromosome 17 in Landrace pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P value); Figure 2 This is a genome-wide association (GWAS) Manhattan plot of body length trait on chromosome 17 in Landrace pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P value); Figure 3 Box plots showing the phenotypic distribution of body height in pigs of different genotypes, where... P <0.01, P <0.0001; Figure 4 Box plots showing the phenotypic distribution of body length in pigs of different genotypes, where... P <0.05, P <0.01, P <0.001. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0023] Example 1: Identification and Validation of SNP Molecular Markers Related to Body Length and Height Traits in Pigs (1) Experimental pig herd The experimental pig population used in this invention consisted of purebred Landrace pigs from the core breeding farm of Jiangxi Jiada Group Co., Ltd., forming the core group. A total of 1527 Landrace pigs from this resource population were selected for this experiment. The pigs had free access to feed and water, and the feeding methods and conditions remained consistent throughout the experiment, following conventional methods. Phenotypic data on body height and body length were collected from all pigs when they reached a weight of 100±5 kg.

[0024] (2) Collection of body height and body length phenotypic data Phenotypic data were collected at the end of routine performance testing. Body height (BH) was measured using a ruler and defined as the vertical distance from the highest point of the shoulder blade to the ground; body length (BL) was measured along the body contour from the midpoint of the ear to the base of the tail using a soft measuring tape. A total of 1291 Landrace pigs from the aforementioned resource population were collected and recorded for body length and height.

[0025] (3) Extraction of porcine genomic DNA The collected pig ear tissues were soaked in a 75% ethanol solution and stored at -20°C for later use.

[0026] Whole-genome DNA was extracted from ear tissue samples collected from each Landrace pig individual using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL according to the measured concentration.

[0027] (4) Pig whole genome 50K SNP typing DNA samples were genotyped using the SMIC-1 50K SNP chip. PLINK v1.90 software was used to perform quality control on the 50K chip scanning genotyping data of all samples, removing SNPs with a detection rate below 90%, a minimum allele frequency less than 0.05, and an individual detection rate below 95%. After quality control, 36,706 SNP loci were retained for subsequent analysis.

[0028] (5) Genome-wide association analysis (GWAS) To eliminate population stratification effects, this invention employs a mixed linear model (MLMA) in GCTA software for GWAS analysis. Sex, age at measurement, and the first five principal components (PC1-PC5) are included as fixed effects in the model, and population stratification is corrected using a genome relation matrix. The genome-wide significance threshold is [value missing]. P <0.05 / 36706 (approximately 1.36 × 10⁻⁶) -6 The suggestive threshold is P <1 / 36706 (approximately 2.72 × 10⁶) -5 ).

[0029] GWAS analysis results are as follows Figure 1 , Figure 2 As shown.

[0030] from Figure 1 , Figure 2 It is known that in Landrace pigs, there is a SNP locus on chromosome 17 that significantly affects body length and height. The most strongly associated SNP is g.15421803 T>C (rs80809111, body length...). P = 8.26×10 -7 Body length P =2.09×10 -6 That is, nucleotide 148 in SEQ NO.1, which corresponds to the T>C mutation at 15421803 bp on chromosome 17 in International Pig Reference Genome Version 11.1.

[0031] (6) Analyze the association between different genotypes and the body length and height phenotypes of Landrace pigs to verify the influence of SNP sites on the body length and height of Landrace pigs.

[0032] The results are shown in Tables 1 and 2. Figures 3-4 As shown.

[0033] As shown in Tables 1-2, the SNP molecular marker rs80809111 of this invention is significantly correlated with the body length and body height traits of Landrace pigs. P The value <0.001 indicates that this molecular marker significantly affects both body length and height traits in Landrace pigs. Assisted selection at this SNP site in pigs can improve body length and height, thus accelerating the breeding process.

[0034] In addition, by Figures 3-4It was found that pigs with the SNP molecular marker genotype CC had significantly greater body length and height than pigs with the CT genotype, while pigs with the CT genotype had significantly greater body length and height than pigs with the TT genotype. For body height, the average phenotypic length of CC-type individuals was 1.06 cm greater than that of TT-type individuals; for body length, the average phenotypic length of CC-type individuals was 1.98 cm greater than that of TT-type individuals. Therefore, gradually retaining individuals with the CC and CT genotypes and culling individuals with the TT genotype in breeding, thereby increasing the frequency of allele C at this locus generation by generation, can significantly increase the body length and height of this pig population, bringing greater economic benefits to pig farms.

[0035] Table 1 Correlation analysis between SNP molecular markers and body height

[0036] Table 1. Correlation analysis between SNP molecular markers and body length

[0037] (7) Effect analysis This invention provides an SNP molecular marker rs80809111 that is significantly associated with body length and height traits in Landrace pigs. For body height and body length, the dominant allele (CC type) significantly increases the phenotypic average by 1.06 cm and 1.98 cm, respectively, compared to the TT type. Therefore, by using marker-assisted selection to gradually cull pigs with the TT genotype within a population, the frequency of allele C can be significantly increased, thereby increasing the body length and height of the population, improving pig growth and production performance, and producing more high-quality lean-type commercial pigs.

[0038] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP loci significantly associated with body length and height traits in Landrace pigs is a nucleotide sequence from chromosome 17, the specific nucleotide sequence of which is shown in SEQ ID NO:1, and the primer pairs for PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0039] SEQ ID NO:1 GGCAATAACTTGTTAACTCTATCTTGCATTTGTTATTAACTATGAGTTTCATGTTCCCTCCTGCACAGAAAAGAAAAATACCATGTCTCGGTGGAGTGGAAGTGGTATCCCAAACTCAGCAACAATGATAGCATCTAACATTGACTG YGAATTTTGCAGCTTCAAATCACATAACTATGCCATCATTTCTTCCTGAAAA. The Y marked in the sequence is the mutation site, which is T or C, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0040] Upstream primer-F: 5'-GGCAATAACTTGTTAACTCT-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-TTTTTCAGGAAGAAATGATGG-3' (SEQ ID NO:3).

[0041] The genetic improvement methods for pigs include the following steps: S1. Determine the genotypes of SNP molecular markers associated with body length and height traits in pigs: (1) Take ear tissue from pigs and extract the whole genome DNA of pigs according to the standard phenol-chloroform method. Then, perform quality testing and concentration determination on the extracted DNA.

[0042] (2) PCR amplification Prepare a 25 μL mixture, including: 1 μL DNA sample, 1 μL upstream primer, 1 μL downstream primer, 12.5 μL 2×Tag PCR MasterMix, and 9.5 μL double-distilled water; the 2×Tag PCR MasterMix contains dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0043] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0044] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 148 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 15421803 bp on chromosome 17 of the International Swine Reference Genome Version 11.1, was T or C, thus determining the genotype of the SNP molecular marker rs80809111 of the pig to be tested.

[0045] S2. Select pigs with genotypes CC and CT as parents for breeding, and eliminate pigs with genotype TT.

[0046] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of SNP molecular markers located on pig chromosome 17 that are associated with body length and body height, characterized in that, The SNP molecular marker is located at rs80809111; the genotype of the SNP molecular marker is CC, CT, or TT; and the application includes at least one of the following (1) to (2): (1) Identify the body length and / or body height traits of pigs; (2) Genetic improvement of pig body length and / or body height traits.

2. The application of products that detect SNP molecular markers located on porcine chromosome 17 that are associated with body length and height, characterized in that, The SNP molecular marker site is rs80809111; the SNP molecular marker genotype is CC, CT, or TT; and the application includes at least one of the following items (1) to (4): (1) Identify the body length and / or body height traits of pigs; (2) Prepare products for identifying the body length and / or body height traits of pigs; (3) Pig genetic improvement, based on eliminating pigs with the SNP molecular marker genotype TT to improve the body length and / or height of pigs and achieve the genetic improvement of the body length and / or height traits of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pig body length and / or body height traits.

3. The application according to claim 2, characterized in that, The product for detecting SNP molecular markers located on pig chromosome 17 that are associated with body length and height includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

4. The application according to claim 3, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

5. The application according to claim 4, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

6. The application according to any one of claims 1 to 5, characterized in that, The pigs in question are Landrace pigs and their synthetic lines.

7. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 17 of pigs that are associated with body length and body height; (2) Eliminate individuals with the SNP molecular marker genotype TT; The site of the SNP molecular marker is rs80809111.

8. The method for genetic improvement of pigs according to claim 7, characterized in that, In step (1), the method for determining the genotype of the SNP molecular markers related to body length and height located on chromosome 17 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotypes of the SNP molecular markers associated with body length and height on pig chromosome 17 were determined based on the sequencing results.

9. The method for genetic improvement of pigs according to claim 7 or 8, characterized in that, The pigs in question are Landrace pigs and their synthetic lines.

Images