A method for quantitative detection of sfmnpv in soil

Abstract

This invention discloses a quantitative detection method for SfMNPV in soil, belonging to the fields of agricultural biotechnology and environmental microbiology detection. The method includes: air-drying and sieving a soil sample to remove impurities before sampling; adding an alkaline lysis buffer to the soil sample for lysis, followed by dilution to release viral DNA; centrifuging to precipitate viral particles, desorbing the virus adsorbed on the soil colloid surface using a salt solution, and purifying the viral DNA; using the extracted DNA as a template to target SfMNPV. me53 qPCR amplification was performed using gene-specific primers; a standard curve was established using recombinant plasmid standards, and the Ct value of the test sample was substituted into the standard curve to calculate the viral DNA copy number; based on the quantitative relationship between viral DNA copy number and inclusion body number, the copy number was converted into the inclusion body number. This invention achieved a recovery rate of 89.34% and a detection limit as low as 1.09 × 10⁻⁶. 3 With copies / μL and a coefficient of variation of less than 5%, it is suitable for monitoring the residues of SfMNPV in different types of farmland soils.

Description

Technical Field

[0001] This invention relates to the fields of agricultural biotechnology and environmental microbial detection, and in particular to a quantitative detection method for Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) inclusion bodies (OBs) in soil based on quantitative real-time PCR (qPCR). Background Technology

[0002] SfMNPV is the natural pathogen of the fall armyworm (Spodoptera frugiperda). As a highly specific and environmentally friendly biopesticide, it is safe for non-target organisms and unlikely to induce resistance, making it valuable in the integrated management of fall armyworm. After field application, SfMNPV enters the soil environment through the lysis of dead insects, rainwater leaching, and transport by agricultural machinery. Studies have shown that viral inclusion bodies can maintain infectivity for a relatively long time under the physicochemical protection of soil particles and humus, forming a soil viral reservoir and providing sustained control over pest populations. Therefore, accurate detection and quantification of SfMNPV residues in soil are crucial for assessing the environmental fate, persistence, and ecological effects of viral pesticides.

[0003] However, the complexity of the soil matrix presents significant challenges to the accurate quantitative detection of SfMNPV, mainly in the following three aspects: First, interference from soil PCR inhibitors. The abundant humic acid, fulvic acid, polyphenolic compounds, and heavy metal ions in the soil can strongly inhibit the activity of Taq DNA polymerase, interfering with the signal reading of fluorescent groups, leading to decreased qPCR amplification efficiency, Ct value drift, and even false negative results. Conventional soil DNA extraction methods often co-extract large amounts of humic acid, which has a significant inhibitory effect when directly used for qPCR.

[0004] Second, the adsorption and dissociation of viral inclusion bodies are difficult. SfMNPV inclusion bodies have a particle size of approximately 1-3 μm and a negatively charged surface, making them readily adsorbed onto the surface of soil colloids (such as clay minerals and organic matter) through electrostatic interactions, hydrogen bonds, and hydrophobic interactions. Conventional direct lysis methods or mild extraction methods are insufficient to effectively dissociate and recover the adsorbed inclusion bodies, resulting in extremely low and unstable virus recovery rates.

[0005] Third, the balance between alkaline hydrolysis conditions and DNA integrity. Viral inclusion bodies have a protein crystal structure and encapsulate viral DNA. Alkaline hydrolysis is required to break down the inclusion body structure and release the viral DNA. However, alkaline hydrolysis conditions (alkali concentration, time, and temperature) directly affect the lysis efficiency and DNA integrity: insufficient alkaline hydrolysis results in incomplete DNA release, while excessive alkaline hydrolysis leads to DNA breakage and degradation, both of which affect the quantitative accuracy of subsequent qPCR.

[0006] Existing methods for detecting soil viruses each have significant limitations. Direct counting (optical microscopy) can observe inclusion body morphology, but it is labor-intensive, subjective, and cannot distinguish between live and dead viruses or different virus species; its sensitivity is also insufficient at low concentrations. Insect bioassays, which detect viral activity by feeding susceptible insect hosts, can reflect viral infectivity, but they are time-consuming (5-7 days), cumbersome, lack sensitivity at low virus concentrations, and are greatly affected by individual insect differences. Conventional PCR methods, while possessing high sensitivity, lack precise quantification capabilities, allowing only qualitative or semi-quantitative analysis, and are also susceptible to interference from soil inhibitors. Real-time quantitative PCR (qPCR) technology can theoretically achieve precise quantification of trace DNA, but existing reported soil virus qPCR methods are mostly for plant viruses or bacteriophages; soil qPCR detection methods for insect baculovirus inclusion bodies are rarely reported, and the problems of soil inhibitor interference and low inclusion body recovery rates have not been systematically addressed.

[0007] Therefore, there is an urgent need in this field to establish a quantitative detection method that can efficiently recover SfMNPV inclusion bodies in soil, effectively eliminate interference from soil PCR inhibitors, and has high sensitivity and good repeatability. Summary of the Invention

[0008] To address the aforementioned technical problems, the purpose of this invention is to provide a highly sensitive, specific, repeatable, and high-recovery method for the quantitative detection of SfMNPV in soil, providing a reliable technical means for environmental monitoring, efficacy assessment, and ecological risk analysis of baculovirus pesticides.

[0009] The objective of this invention is achieved through the following technical solution: A method for quantitative detection of SfMNPV in soil, comprising: Step S1: The soil sample is air-dried, sieved, and impurities are removed before sampling. Step S2: Add alkaline lysis buffer to the soil sample for lysis, dilute after lysis, and release viral DNA. Step S3 involves centrifuging to precipitate virus particles, using a salt solution to desorb the virus adsorbed on the surface of soil colloids, and obtaining viral DNA after purification. Step S4 uses the extracted DNA as a template and employs targeted SfMNPV. me53Gene-specific primers were used for qPCR amplification; Step S5: Establish a standard curve using recombinant plasmid standards, substitute the Ct value of the sample to be tested into the standard curve, and calculate the viral DNA copy number. Step S6 converts the copy number into the number of inclusion bodies based on the quantitative relationship between viral DNA copy number and inclusion body number.

[0010] Further, step S1 includes: passing the air-dried sample through a 30-mesh sieve to remove plant residues and stones, and weighing 0.25g of soil for subsequent analysis.

[0011] Furthermore, in step S2: The alkaline lysis buffer is a 0.1 M KOH solution or a 0.1 M NaOH solution; The alkaline lysis buffer was lysed at 22–25°C for 8 hours, and the lysis products were diluted 100 times with sterile water to obtain the lysis dilution buffer.

[0012] Furthermore, in step S3, the centrifugation is performed at 12000 rpm for 10 min; the desorption is performed by vortexing with 2% KCl solution; and the purification is performed by phenol-chloroform extraction or a commercial DNA purification kit.

[0013] Furthermore, the amount of the 2% KCl solution used was 500 μL, and the vortexing time was 20 minutes.

[0014] Furthermore, the nucleotide sequence of the specific primer in step S4 is as follows: SEQ ID NO.2: CGGCTGATGAAGTCCGTTCT; SEQ ID NO. 3: CCGCATTCTCCCTGACACTT.

[0015] Furthermore, the qPCR reaction system in step S4 is 20 μL, including: 2.0 μL template DNA, 10.0 μL 2×SYBRGreen premix, 0.4 μL 10 μmol / L forward primer, 0.4 μL 10 μmol / L reverse primer, and 7.2 μL ddH2O.

[0016] Furthermore, the qPCR amplification program in step S4 is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 40 cycles; melting curve analysis is performed after the cycles are completed.

[0017] Further, the method for constructing the standard curve in step S5 is as follows: using SfMNPV DNA as a template, the target fragment is amplified using primers shown in SEQ ID NO.2 and SEQ ID NO.3, cloned into the pEASY-Blunt vector, transformed into E. coli DH5α, the recombinant plasmid is extracted and sequenced for verification; the plasmid concentration is determined, and the copy number is calculated. Copy number (copies / μL) = [6.02 × 10⁻⁶] 23 × Plasmid concentration (ng / μL) × 10 -9 [DNA length (bp) × 660]; The recombinant plasmid was serially diluted 10-fold to 10⁻⁶. 1 ~10 9 After copying / μL, the sample was used as a template for qPCR amplification, and a standard curve was plotted. The equation of the standard curve is: Ct = -3.38155 × lg(copies / μL) + 41.97998.

[0018] Furthermore, the quantitative relationship between the viral DNA copy number and the number of inclusion bodies in step S6 is expressed as follows: lg(copies) = 1.04177 × lg(OBs) + 4.32911 Where copies represent the viral DNA copy number and OBs represent the number of inclusion bodies.

[0019] Compared with the prior art, one or more embodiments of the present invention may have the following advantages: 1) By systematically optimizing alkaline hydrolysis conditions (virus suspension: lysis buffer = 1:9, lysis for 8 h) and adopting an extraction strategy of 2% KCl desorption combined with vortexing for 20 min, this invention can achieve efficient recovery of SfMNPV inclusion bodies in soil, with a recovery rate of 89.34%, which is significantly better than the traditional direct lysis method and conventional soil DNA extraction kit method.

[0020] 2) Specific primers designed based on the SfMNPV me53 gene, verified by BLAST alignment and experiments, exhibited good amplification specificity for SfMNPV and showed no cross-reactivity with other common baculoviruses and soil microorganisms. The detection limit was as low as 1.09 × 10⁻⁶. 3 Copies / μL, detectable down to 3.3 × 10 2 Virus content in soil (OBs / g).

[0021] 3) By optimizing the dilution factor (100-fold dilution) and using 2% KCl desorption treatment, the co-extraction of PCR inhibitors such as humic acid in the soil was effectively reduced; at the same time, the 100-fold dilution significantly reduced the inhibitory effect of residual alkali in the lysis buffer on the qPCR reaction, ensuring amplification efficiency and quantitative accuracy.

[0022] 4) The method of the present invention has a coefficient of variation (CV) of less than 5% for both intra-batch and inter-batch samples with different concentration gradients, and has good repeatability and stability.

[0023] 5) The method of this invention does not require expensive large-scale equipment. It can be completed mainly using conventional centrifuges and qPCR instruments. It is suitable for the quantitative detection of SfMNPV in different types of farmland soil and can also provide a methodological reference for the monitoring of other baculoviruses in the soil environment. Attached Figure Description

[0024] Figure 1 This is a standard curve diagram for qPCR detection in this invention; where a is the amplification curve; b is the melting curve; and c is the fitting curve of Ct value versus copy number logarithm. Figure 2 This is a graph showing the optimization results of the alkaline hydrolysis conditions of this invention; where a represents the optimized volume ratio of virus to lysis buffer; b represents the optimized lysis time; and c represents the optimized dilution factor. Figure 3 This is a graph showing the optimization results of the soil viral DNA extraction method of the present invention; where a represents a comparison of different extraction methods; b represents a comparison of physical dispersion methods; c represents a comparison of chemical buffer solutions; and d represents a comparison of dilution factors. Figure 4 This is a fitted curve showing the relationship between the number of inclusion bodies and the copy number in this invention. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be described in further detail below with reference to the embodiments and accompanying drawings.

[0026] Example 1: Design and validation of SfMNPV-specific qPCR primers Primer design: Based on the SfMNPV genome sequence (GenBank accession number: KM245561), the highly conserved me53 gene, which exhibits low homology with other baculoviruses, was selected as the target region. Specific primers were designed using Primer Premier 5.0 software; the primer sequences are as follows: Forward primer me53-F: 5'-CGGCTGATGAAGTCCGTTCT-3' (SEQ ID NO.2); Negative primer me53-R: 5'-CCGCATTCTCCCTGACACTT-3' (SEQ ID NO.3); The expected amplified fragment length is 140 bp (SEQ ID NO.1), and its nucleotide sequence is: 5'-CGGCTGATGAAGTCCGTTCTCCGATTCTCCAGCGAGTATGTGCAAGGCGTGCGGCGCGTCAATGATCTTGTGGAGATGAAGTGCGACGACACCAAGTGTAAAGAGATCACGACAAACGCCAAGTGTCAGGGAGAATGCGG-3'.

[0027] The expected amplified fragment length is 140 bp.

[0028] Primer specificity verification: Conventional PCR amplification was performed using SfMNPV DNA, cotton bollworm nucleopolyhedrovirus (HaNPV) DNA, beet armyworm nucleopolyhedrovirus (SeMNPV) DNA, diamondback moth granulovirus (PlxyGV) DNA, and total DNA from healthy soil microorganisms as templates.

[0029] PCR reaction system (25 μL): template DNA 1.0 μL, 2×Taq PCR Master Mix 12.5 μL, 1.0 μL each of 10 μmol / L forward and reverse primers, and ddH2O to bring the total to 25 μL.

[0030] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0031] The amplified products were detected by 1.5% agarose gel electrophoresis. The results showed that only the SfMNPV DNA template showed a specific band at 140 bp, while no amplification bands were observed for other viral and soil microbial DNA, indicating that the me53 primers designed in this invention have high specificity for SfMNPV.

[0032] Example 2: Establishment of the Standard Curve Preparation of recombinant plasmid standards: Using SfMNPV genomic DNA as a template, PCR amplification was performed using primers shown in SEQ ID NO.1 and SEQ ID NO.2, and the 140 bp target fragment was recovered. The recovered fragment was ligated into the pEASY-Blunt cloning vector, transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated at 37°C for 12 h. Positive clones were picked for colony PCR verification, and the verified clones were sent to a sequencing company for sequencing. The sequencing results were consistent with the SfMNPV me53 gene sequence, indicating successful construction of the recombinant plasmid.

[0033] Extract and verify the correct recombinant plasmid DNA, and use a NanoDrop 2000 micro spectrophotometer to determine the plasmid concentration and purity (A260 / A280 ratio between 1.8 and 2.0).

[0034] Calculation of the number of copies of the standard product: Calculate the copy number concentration of the recombinant plasmid using the following formula: Copy number (copies / μL) = [6.02 × 10⁻⁶] 23 × Plasmid concentration (ng / μL) × 10 -9 [DNA length (bp) × 660] Wherein, DNA length = vector length (3839 bp) + insert fragment length (140 bp) = 4026 bp.

[0035] Plotting the standard curve: The calculated recombinant plasmid standard was serially diluted 10-fold with sterile TE buffer to prepare 10-fold dilutions. 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 Copies / μL series of concentration standards.

[0036] Using standards of various concentrations as templates, amplification was performed according to the qPCR method of this invention. Three technical replicates were set up for each concentration.

[0037] qPCR reaction system (20 μL): template DNA 2.0 μL, 2×SYBR Green premix 10.0 μL, 10 μmol / L me53-F and me53-R 0.4 μL each, ddH2O 7.2 μL.

[0038] qPCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 40 cycles (e.g., ...). Figure 1 a); After the cycle is completed, perform melting curve analysis (60℃ to 95℃, fluorescence is read once every 0.5℃).

[0039] The results showed that the standard sample was within 10... 3 ~10 9 A good linear relationship was observed within the range of copies / μL (e.g., Figure 1 c), The equation of the standard curve is: Ct = -3.38155 × lg(copies / μL) + 41.97998 The correlation coefficient R² = 0.9998, and the amplification efficiency is 97.8%. The melting curve shows a single sharp peak (e.g., Figure 1 (b) indicates that the amplification product has good specificity, with no primer dimers or non-specific amplification.

[0040] Example 3: Optimization of alkaline hydrolysis conditions SfMNPV inclusion bodies have a protein crystal structure and require alkaline hydrolysis to release viral DNA. To achieve optimal hydrolysis efficiency while ensuring DNA integrity, this invention systematically optimized the hydrolysis solution ratio, lysis time, and dilution factor.

[0041] Experimental method: Add a known concentration (3.3 × 10⁻⁵) of sterilized soil to 0.25 g of soil. 6 The SfMNPV virus suspension of OBs was subjected to the following optimization experiments.

[0042] Optimization of the volume ratio of virus suspension to lysis buffer: The viral suspension to lysis buffer (0.1 M KOH) volume ratios were set at 1:1, 1:3, 1:5, 1:7, 1:9, and 1:11, respectively. Lysis was performed at room temperature for 8 h. The lysate was diluted 100-fold before DNA extraction and qPCR detection. The copy number determined by qPCR was used as the evaluation index for alkaline lysis efficiency.

[0043] Results (e.g.) Figure 2 a) The results showed that the highest copy number was detected by qPCR at a volume ratio of 1:9, significantly higher than other ratios (P<0.05). A ratio that was too low (1:1~1:5) resulted in insufficient alkaline digestion and incomplete DNA release; a ratio that was too high (1:11) may lead to DNA degradation. Therefore, the optimal volume ratio was determined to be 1:9.

[0044] Optimization of pyrolysis time: With a virus suspension: lysis buffer ratio of 1:9, lysis times were set to 1 h, 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h, respectively. The lysis products were then diluted 100 times before detection.

[0045] Results (e.g.) Figure 2 b) showed that the copy number detected at 8 h of lysis reached its peak and was not significantly different from the 10 h and 12 h groups (P>0.05), but was significantly higher than all groups within 8 h (P<0.05). Considering both efficiency and DNA integrity, the optimal lysis time was determined to be 8 h.

[0046] Optimization of dilution factor after lysis: Under the conditions of virus suspension: lysis buffer = 1:9 and lysis for 8 h, qPCR detection was performed by setting the dilution factors of lysis products to 10, 50, 100, 200, 500 and 1000 times respectively.

[0047] Results (e.g.) Figure 2 c) shows that the highest copy number was detected by qPCR at a dilution of 100-fold. When the dilution factor was too low (10-fold, 50-fold), residual alkali inhibited the PCR reaction; when the dilution factor was too high (above 200-fold), the viral DNA template concentration was excessively diluted, leading to a decrease in detection sensitivity. Therefore, the optimal dilution factor was determined to be 100-fold.

[0048] Example 4: Optimization of Soil Virus DNA Extraction Method Comparison of different extraction methods: Compare the extraction efficiency of the following four methods for SfMNPV DNA from soil: Method A (direct lysis method): Soil samples were directly used for qPCR after alkaline hydrolysis without DNA extraction and purification; Method B (commercial kit method): Use a soil DNA extraction kit from a certain brand and follow the instructions. Method C (traditional phenol-chloroform method): After alkaline hydrolysis, phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation are performed; Method D (High-speed direct precipitation method of the present invention): After alkaline hydrolysis, centrifuge at 12000 rpm for 10 min, add 2% KCl to the precipitate and vortex for 20 min, centrifuge and take the supernatant for purification.

[0049] Add 3.3 × 10 to 0.25 g of sterilized soil. 6 OBs and SfMNPV were processed using the four methods described above and then subjected to qPCR detection.

[0050] Results (e.g.) Figure 3a) The results show that the copy number detected by method D (the method of this invention) is significantly higher than that of the other three methods (P<0.05), indicating that high-speed direct precipitation combined with KCl desorption can effectively recover virus particles adsorbed on soil colloids.

[0051] Comparison of different physical dispersion methods: Based on high-speed direct precipitation, the effects of the following physical dispersion methods on desorption efficiency were compared: no shaking, manual shaking for 5 min, vortexing for 10 min, vortexing for 20 min, vortexing for 30 min, and sonication for 10 min.

[0052] Results (e.g.) Figure 3 b) showed that the vortexing time of 20 min resulted in the highest detection copy number, significantly better than other treatment groups (P<0.05). Insufficient vortexing time leads to incomplete desorption, while excessive vortexing or sonication may damage the integrity of viral DNA.

[0053] Comparison of different chemical buffer solutions: Compare the effects of the following chemical buffers on the desorption of viral particles: sterile water, 0.9% NaCl, 1% KCl, 2% KCl, 2.5% KCl, 5% KCl, 0.1 M PBS (pH 7.4), and 0.1 M Tris-HCl (pH 8.0).

[0054] Results (e.g.) Figure 3 c) shows that the 2% KCl solution had the best desorption effect, significantly higher than other buffer solutions (P<0.05). KCl can neutralize the electrostatic adsorption between soil colloids and viral inclusion bodies through ion exchange, and the 2% concentration achieves the best balance between desorption efficiency and osmotic pressure protection.

[0055] The effect of dilution factor after enrichment on qPCR reaction: The detection effects of qPCR were compared after the DNA extraction products were diluted 0 times (stock solution), 10 times, and 100 times.

[0056] Results (e.g.) Figure 3 d) showed that the Ct values ​​of the 10-fold and 100-fold dilution groups were significantly lower than those of the original solution group (P<0.05), and the amplification efficiency of the 100-fold dilution group was the best, indicating that appropriate dilution can effectively eliminate the interference of soil residual inhibitors on qPCR.

[0057] Example 5: Establishing the conversion relationship between inclusion body number and copy number To establish a quantitative conversion relationship between qPCR detection results (copy number) and actual biologically significant units (inclusion body number, OBs), the following experiment was conducted: The SfMNPV inclusion body suspension was accurately counted using a hemocytometer to prepare a solution of 3.3 × 10⁻⁶ cells / mL.2 3.3×10 3 3.3×10 4 3.3×10 5 3.3×10 6 3.3×10 7 3.3×10 8 OBs / mL series concentrations. Samples of each concentration were subjected to alkaline digestion, DNA extraction, and qPCR detection to obtain the corresponding copy number.

[0058] like Figure 4 'a' represents the Ct-copy number fitting curve, where the inclusion body-copy number fitting is performed using linear regression analysis with lg(OBs) as the x-axis and lg(copies) as the y-axis. The results (e.g.) Figure 4 b) shows that the two have a significant linear relationship, and the fitted equation is: lg(copies) = 1.04177 × lg(OBs) + 4.32911 The correlation coefficient R² = 0.9985. This equation can be used to convert the DNA copy number determined by qPCR into the number of inclusion bodies in the soil, thereby expressing the biological significance of the quantitative results.

[0059] Example 6: Quantitative detection of SfMNPV in soil (field application) This embodiment uses a soil sample from a cornfield in Yunnan after continuous application of SfMNPV pesticide as an example to illustrate the specific application of the method of the present invention.

[0060] Sample collection and processing: Topsoil samples (0-10 cm) were collected at 0, 7, 30, 90, 180, 360 days, and 21 months after pesticide application. Five sampling points were set up at each time point, and the samples were combined into one composite sample. After air drying, the soil samples were sieved through a 30-mesh sieve to remove plant debris and stones, and stored at -20℃ for later use. 0.25 g of soil was weighed for analysis before testing.

[0061] Alkaline treatment: Add 0.1 M KOH lysis buffer to the soil sample to ensure the total liquid volume of the sample suspension meets the virus suspension:lysis buffer ratio of 1:9 (adjust the amount of lysis buffer added appropriately if the soil moisture content varies). Incubate at room temperature (25℃) for 8 hours. Dilute the lysis products 100 times with sterile water.

[0062] DNA extraction: Centrifuge the lysis dilution buffer at 12000 rpm for 10 min and discard the supernatant. Add 500 μL of 2% KCl solution to the precipitate, vortex for 20 min, centrifuge at 12000 rpm for 5 min, and collect the supernatant. After phenol-chloroform extraction and ethanol precipitation, dissolve the supernatant in 30 μL of sterile TE buffer and store at -20℃ for later use.

[0063] qPCR detection: Using the extracted DNA as a template, qPCR amplification was performed using me53-specific primers. The reaction mixture (20 μL) consisted of: 2.0 μL template DNA, 10.0 μL 2×SYBR Green premix, 0.4 μL each of forward and reverse primers, and 7.2 μL ddH2O. The amplification program was: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, for 40 cycles.

[0064] Quantitative analysis: Substitute the sample Ct value into the standard curve equation to calculate the viral DNA copy number, and then calculate the SfMNPV inclusion body content in the soil according to the inclusion body-copy number conversion formula.

[0065] The test results showed that the SfMNPV content in the soil after the first application was 4.81 × 10⁻⁶. 2 The viral load (OBs / g) gradually accumulated in the soil over time, reaching 6.46 × 10⁻⁶ after 21 months. 4 OBs / g. This dynamic trend is consistent with the sustained control effect of field pest incidence, indicating that this method can effectively monitor the residual dynamics of SfMNPV in the soil.

[0066] Determination of method recovery: Three concentration levels of SfMNPV inclusion body standards (low, medium, and high) were added to sterilized soil samples known to be free of SfMNPV, respectively, to achieve final concentrations of 3.3 × 10⁻⁶. 3 3.3×10 5 3.3×10 7 OBs / g soil. Six replicates were prepared for each concentration, and extraction and qPCR detection were performed according to the method of this invention.

[0067] Recovery rate (%) = (Number of OBs converted from measured copy number / Theoretical number of added OBs) × 100% The results showed that the average recoveries at the three concentration levels were 87.52%, 89.34%, and 90.12%, respectively, with an overall average recovery of 89.34% and relative standard deviations (RSDs) of less than 5%. This indicates that the method of the present invention has good accuracy and stability.

[0068] Example 8: Repeatability Verification of the Method Take 3.3 × 10 4 3.3×10 5 3.3×10 6 3.3×10 7 SfMNPV samples with four concentration gradients of OBs were extracted three times independently (intra-batch replication) and repeatedly detected for three consecutive days (inter-batch replication) according to the method of this invention.

[0069] The results showed that the coefficients of variation (CV) for intra-batch repeatability were 2.60%, 1.13%, 0.50%, and 0.60%, respectively; and the CVs for inter-batch repeatability were 3.85%, 2.47%, 1.82%, and 1.55%, respectively. All CV values ​​were less than 5%, indicating that the method of the present invention has good repeatability and stability.

[0070] Example 9: Verification of the regional applicability of the method Soil samples from cornfields in Hunan, Guizhou, Hainan, and Guangdong provinces, five years after continuous pesticide application, were tested using the method of this invention. The soil types in the four provinces were red soil, yellow soil, lateritic red soil, and paddy soil, respectively, with pH values ​​ranging from 4.5 to 7.8 and organic matter content ranging from 1.2% to 3.5%.

[0071] Soil samples were collected from three representative fields in each province, and SfMNPV was quantitatively detected according to the method of this invention. The results showed that the SfMNPV content in the soils of the four provinces ranged from 1.44 × 10⁻⁶. 4 Up to 3.77×10 4 The OBs / g and the detection CV values ​​between different soil types were all less than 5%. This indicates that the method of the present invention is applicable to the quantitative detection of SfMNPV in different types of farmland soils and has strong regional applicability and matrix tolerance.

[0072] Example 10: Determination of detection limit and quantitation limit The recombinant plasmid standard was serially diluted with sterile TE buffer to prepare 10... 0 10 1 10 2 10 3 10 4 The concentrations were serialized in copies / μL. qPCR was performed using each concentration as a template, with 10 replicates per concentration.

[0073] The lowest concentration that can be stably detected (detection rate ≥ 95%) within a 95% confidence interval is used as the limit of detection (LOD); the lowest concentration with a relative standard deviation ≤ 20% and a recovery rate in the range of 80%-120% is used as the limit of quantitation (LOQ).

[0074] The results showed that when the concentration was 1.09 × 10⁻⁶3 At a concentration of copies / μL, the amplification efficiency was consistently high in 10 replicates, and the detection limit was determined to be 1.09 × 10⁻⁶. 3 copies / μL. Based on the inclusion body-copy number conversion relationship, the corresponding limit of quantitation for inclusion bodies is 3.3 × 10⁻⁶. 2 OBs / g soil.

[0075] While the embodiments disclosed in this invention are as described above, the content is merely for the purpose of facilitating understanding of the invention and is not intended to limit the invention. Any person skilled in the art to which this invention pertains may make any modifications and variations in form and detail of the implementation without departing from the spirit and scope disclosed herein; however, the scope of patent protection for this invention shall still be determined by the scope defined in the appended claims.

Claims

1. A method for quantitative detection of SfMNPV in soil, characterized in that, Includes the following steps: Step S1: The soil sample is air-dried, sieved, and impurities are removed before sampling. Step S2: Add alkaline lysis buffer to the soil sample for lysis, dilute after lysis, and release viral DNA. Step S3 involves centrifuging to precipitate virus particles, using a salt solution to desorb the virus adsorbed on the surface of soil colloids, and obtaining viral DNA after purification. Step S4 uses the extracted DNA as a template and employs targeted SfMNPV. me53 Gene-specific primers were used for qPCR amplification; Step S5: Establish a standard curve using recombinant plasmid standards, substitute the Ct value of the sample to be tested into the standard curve, and calculate the viral DNA copy number. Step S6 converts the copy number into the number of inclusion bodies based on the quantitative relationship between viral DNA copy number and inclusion body number.

2. The method for quantitative detection of SfMNPV in soil according to claim 1, characterized in that, Step S1 includes: passing the air-dried sample through a 30-mesh sieve to remove plant residues and stones, and weighing 0.25g of soil for subsequent analysis.

3. The method for quantitative detection of SfMNPV in soil according to claim 1, characterized in that, In step S2: The alkaline lysis buffer is a 0.1 M KOH solution or a 0.1 M NaOH solution; The alkaline lysis buffer was lysed at 22–25°C for 8 hours, and the lysis products were diluted 100 times with sterile water to obtain the lysis dilution buffer.

4. The method for quantitative detection of SfMNPV in soil according to claim 1, characterized in that, In step S3, centrifugation is performed at 12000 rpm for 10 min; desorption is performed by vortexing with 2% KCl solution; and purification is performed by phenol-chloroform extraction or a commercial DNA purification kit.

5. The method for quantitative detection of SfMNPV in soil according to claim 4, characterized in that, The amount of the 2% KCl solution used was 500 μL, and the vortexing time was 20 minutes.

6. The method for quantitative detection of SfMNPV in soil according to claim 1, characterized in that, The nucleotide sequence of the specific primer in step S4 is as follows: SEQ ID NO.2: CGGCTGATGAAGTCCGTTCT; SEQ ID NO. 3: CCGCATTCTCCCTGACACTT.

7. The method for quantitative detection of SfMNPV in soil according to claim 1 or 6, characterized in that, The qPCR reaction system in step S4 is 20 μL, including: 2.0 μL template DNA, 10.0 μL 2×SYBR Green premix, 0.4 μL 10 μmol / L forward primer, 0.4 μL 10 μmol / L reverse primer, and 7.2 μL ddH2O.

8. The method for quantitative detection of SfMNPV in soil according to claim 1 or 6, characterized in that, The qPCR amplification program in step S4 is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 40 cycles; melting curve analysis is performed after the cycles are completed.

9. The method for quantitative detection of SfMNPV in soil according to claim 6, characterized in that, The method for constructing the standard curve in step S5 is as follows: using SfMNPV DNA as a template, the target fragment is amplified using primers shown in SEQ ID NO.2 and SEQ ID NO.3, cloned into the pEASY-Blunt vector, transformed into E. coli DH5α, and the recombinant plasmid is extracted and sequenced for verification; the plasmid concentration is determined, and the copy number is calculated. Copy number (copies / μL) = [6.02 × 10⁻⁶] 23 × Plasmid concentration (ng / μL) × 10 -9 [DNA length (bp) × 660]; The recombinant plasmid was serially diluted 10-fold to 10⁻⁶. 1 ~10 9 After copying / μL, the sample was used as a template for qPCR amplification, and a standard curve was plotted. The equation of the standard curve is: Ct = -3.38155 × lg(copies / μL) + 41.97998.

10. The method for quantitative detection of SfMNPV in soil according to claim 1, characterized in that, The quantitative relationship between viral DNA copy number and inclusion body number in step S6 is expressed as follows: lg(copies) = 1.04177 × lg(OBs) + 4.32911 Where copies represent the viral DNA copy number and OBs represent the number of inclusion bodies.

Images