A rapid detection system for pathogenic bacteria based on LSPR and photonic crystal double field enhancement and a construction method thereof

Abstract

The application discloses a kind of based on LSPR and photonic crystal double field enhancement's free amplification pathogenic bacteria rapid detection system and its construction method, belongs to sensing technology field.The present application includes the construction of photonic crystal film, the construction of LSPR enhanced composite nanomaterial, the preparation of integrated recognition probe, the preparation of detection end liquid for free amplification pathogenic bacteria rapid detection system sample, the construction of free amplification pathogenic bacteria rapid detection system based on LSPR and photonic crystal double field enhancement and the like steps.Detection system is by PVC base plate used as bottom physical support and is laid on mutual lap joint sample pad, combination pad, nitrocellulose membrane and absorption pad composition;Detection line and quality control line are drawn on nitrocellulose membrane, and photonic crystal film is arranged below detection line.Detection end liquid is dropped to sample pad, and after chromatography, the fluorescence peak area of detection line and quality control line is measured, and T / C ratio is calculated, to realize trace pathogenic nucleic acid super-sensitive quantitative detection.

Description

Technical Field

[0001] This invention belongs to the field of sensing technology, specifically relating to a rapid detection system for amplified pathogens based on LSPR and photonic crystal dual-field enhancement and its construction method. Background Technology

[0002] Respiratory infectious diseases pose a serious threat to human health, and rapid and accurate pathogen detection is a prerequisite for developing effective treatment plans. Currently, nucleic acid-based molecular diagnostics (such as quantitative real-time PCR, digital PCR, and metagenomic sequencing) have become the gold standard for etiological diagnosis due to their high sensitivity and specificity. However, mainstream nucleic acid molecular diagnostic technologies heavily rely on central laboratories and high-precision temperature-controlled equipment, which not only requires highly skilled operators but is also time-consuming and costly, making it difficult to promote in non-laboratory environments such as primary healthcare institutions and communities. Although isothermal amplification-based nucleic acid detection methods have been developed in recent years, reducing dependence on instruments, the nucleic acid amplification process is highly susceptible to aerosol contamination and false positives, inevitably increasing the complexity of on-site testing.

[0003] To overcome the contamination risks and high costs associated with nucleic acid amplification, existing technologies have developed amplification-free nucleic acid detection methods based on CRISPR-associated nucleases (Cas nucleases) or nanozymes. While these methods combine the accuracy of molecular diagnostics with the convenience of immunological detection, showing promising prospects for point-of-care testing (POCT), they still face technical bottlenecks in practical applications. Limited by the sensitivity constraints of existing fluorescence sensing technologies, the detection limits of amplification-free nucleic acid detection methods are generally in the pM to fM range, making it difficult to meet the clinical needs for early (trace level) diagnosis of highly pathogenic respiratory pathogens. How to achieve ultrasensitive detection of trace amounts of pathogenic nucleic acid molecules without relying on nucleic acid amplification is a key scientific problem currently facing pathogen molecular diagnostics.

[0004] Furthermore, the luminescence properties (quantum yield or brightness) of fluorescent probes are the core factor limiting the sensitivity of fluorescence sensing technology, and existing conventional fluorescent materials all have inherent technical limitations. Specifically, organic fluorescent dyes are prone to quenching and photobleaching, have poor luminescence stability, and their small Stokes shift leads to severe background interference from actual samples; rare-earth upconversion luminescent materials can effectively reduce biological autofluorescence interference, but their luminescence efficiency is extremely low (usually below 10%), making it difficult to detect pathogens with extremely low abundance; although semiconductor quantum dots overcome the problems of photobleaching and low luminescence efficiency, their single luminescence brightness is still insufficient when used directly for amplification-free detection of trace pathogens in complex or non-laboratory environments. How to further improve the luminescence brightness while maintaining the high quantum yield of quantum dot fluorescent probes is the core and key to achieving ultrasensitive detection in fluorescence biosensing technology.

[0005] In summary, existing molecular diagnostic technologies generally face technical bottlenecks such as reliance on large-scale equipment, susceptibility to contamination during nucleic acid amplification, and low sensitivity of conventional amplification-free fluorescence detection. Therefore, there is an urgent need in this field to develop a novel optical sensing detection mechanism for pathogens with ultra-high sensitivity, high signal-to-noise ratio, and no need for nucleic acid amplification, to be used with portable devices and achieve accurate and rapid diagnosis in complex community environments. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement, and its construction method.

[0007] This system first synthesizes high-fluorescence quantum yield materials by precisely controlling the crystal and electronic structure of semiconductor quantum dots, and then deeply integrates the localized surface plasmon resonance (LSPR) effect of noble metal nanoparticles to successfully construct a high signal-to-noise ratio LSPR-enhanced fluorescent nanocomposite material that effectively suppresses back-transfer of energy and significantly improves luminescence performance. Based on this, by introducing flexible interface design and pathogen-specific recognition molecule orientation modification on the surface of this composite material, a specific fluorescent composite probe capable of efficiently targeting and enriching low-abundance respiratory pathogens is prepared. Furthermore, this invention integrates the above-mentioned high-brightness fluorescent probe with CRISPR technology and the RNA-DNA complex recognition mechanism to establish a completely nucleic acid-free biological signal cascade amplification strategy; simultaneously, it is arrayed and coupled onto a polymer photonic crystal substrate, thereby constructing an ultrasensitive sensing and detection pathway that synergistically combines physical light field enhancement and biochemical enzymatic digestion. Finally, a portable visual detection device based on lateral flow chromatography or multi-channel chips is developed, completely realizing rapid, accurate, and ultrasensitive on-site screening of respiratory pathogens, typically represented by Staphylococcus aureus, in complex non-laboratory environments.

[0008] The present invention discloses a method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement, the steps of which are as follows:

[0009] S1, Construction of photonic crystal thin films;

[0010] Construction of S2 and LSPR-enhanced composite nanomaterials;

[0011] S3. Preparation of the integrated recognition probe (LSPR-QD-Probe A);

[0012] S4. Preparation of the final detection solution for adding samples to the rapid detection system for amplified pathogens;

[0013] S5. Construction of a rapid detection system for amplified pathogens based on LSPR and photonic crystal dual-field enhancement.

[0014] Furthermore, the construction steps of the photonic crystal thin film described in step S1 are as follows:

[0015] (1) Synthesis of PMMA microspheres: Add 30-40 mg of potassium persulfate (K2S2O8) and 70-90 mL of deionized water to a flask. After the solution stabilizes, add 5.5-6.5 mL of methyl methacrylate (MMA) and start stirring. React in an oil bath at 85-90 °C for 90-100 min to obtain a PMMA microsphere dispersion with a mass fraction of 5.5%-7.0% and a particle size of 200-240 nm. Then add deionized water to dilute and obtain a PMMA microsphere dispersion with a mass fraction of 0.25%-0.27%.

[0016] (2) Construction of photonic crystal thin film: A clean glass substrate is vertically inserted into a PMMA microsphere dispersion with a mass fraction of 0.25%~0.27%, and the solvent is slowly evaporated at 30~40℃ for 24~30h for self-assembly. Finally, it is placed in an oven at 110~130℃ for 50~80min to cure, thereby obtaining a photonic crystal thin film with a thickness of 10~12μm on the glass substrate.

[0017] Furthermore, the construction steps of the LSPR-enhanced composite nanomaterial described in step S2 are as follows:

[0018] (1) Preparation of quantum dot precursor solution: Accurately weigh 0.03~0.05g selenium powder (Se) and 0.08~0.12g sodium borohydride (NaBH4), then add 8~12mL deionized water, purge with nitrogen (N2) to remove oxygen, and stir magnetically (700~900rpm) at room temperature for 40~50min until the black selenium powder is completely dissolved and the solution becomes clear and transparent, thus obtaining NaHSe quantum dot precursor solution;

[0019] (2) Preparation of quantum dots: Weigh 0.10~0.12g of cadmium chloride (CdCl2·2.5H2O) and dissolve it in 40~60mL of deionized water, add 80~120μL of 3-mercaptopropionic acid (MPA); then add 0.8~1.2M NaOH solution dropwise to adjust the pH value to 9.5~10.5 to make the solution clear; purge the solution with nitrogen gas for 25~30min to remove oxygen, and then quickly inject 0.8~1.2mL of the NaHSe quantum dot precursor solution prepared in step (1) under nitrogen protection and magnetic stirring (700~900rpm), quickly heat the system to 90~110°C, and condense the reaction under reflux for 2~4h, then immediately stop heating and cool rapidly with an ice bath to terminate the reaction. Add an equal volume of anhydrous ethanol to the cooled reaction solution, and centrifuge and wash at 7000-9000 rpm for 8-12 min; discard the supernatant, and disperse the obtained product in 8-12 mL of deionized water to obtain an aqueous solution of CdSe quantum dots;

[0020] (3) Preparation of gold seeds: Mix 4.0~6.0 mL of 0.18~0.22 M hexadecyltrimethylammonium bromide (CTAB) aqueous solution with 4.0~6.0 mL of 0.4~0.6 m M chloroauric acid (HAuCl4) aqueous solution and gently stir in a water bath at 25~30°C (100~300 rpm) until the mixture is uniformly light yellow; then quickly inject 0.5~0.7 mL of 0.008~0.012 M sodium borohydride (NaBH4) aqueous solution that has been cold filtered in an ice bath into the mixture and stir at 500~700 rpm for 2~3 min and then stop; place the resulting brown solution in a water bath at 25~30°C and let it stand for aging for 1~2 h to obtain a gold seed solution with a size of about 2 nm;

[0021] (4) Growth of gold nanorods: 40-60 mL of 0.18-0.22 M hexadecyltrimethylammonium bromide (CTAB) aqueous solution and 40-60 mL of 0.4-0.6 mM chloroauric acid (HAuCl4) aqueous solution are slowly stirred at 25-30°C (80-120 rpm). Then, 0.7-0.9 mL of 3.5-4.5 mM silver nitrate (AgNO3) aqueous solution is added, and the mixture is gently stirred (80-120 rpm). Next, 0.6-0.8 mL of 0.07-0.09 M L-ascorbic acid (vitamin C) aqueous solution is added dropwise. The solution will gradually fade from golden yellow to completely colorless and transparent, yielding a colorless growth solution. 0.10-0.15 mL of the gold seed solution obtained in step (3) is quickly injected into the above colorless growth solution and stirred at 80-120 rpm for 10-20 s to mix it evenly. The reaction system is sealed and placed in a constant temperature oven at 25-30°C for 15-20 h to obtain an aqueous solution of gold nanorods. The aqueous solution of gold nanorods is transferred to a centrifuge tube and centrifuged at 8000-10000 rpm for 10-20 min. The supernatant is discarded and the precipitate is resuspended in ultrapure water by sonication. The "centrifugation-sonic resuspension" operation is repeated 2-3 times. Finally, the supernatant is discarded by centrifugation again and the precipitate is dispersed in 4-6 mL of deionized water to obtain a purified aqueous solution of gold nanorods, which is then placed at 4°C for later use.

[0022] (5) Silanization and amination modification: Take 3-5 mL of the gold nanorod aqueous solution obtained in step (4), add it to 18-22 mL of isopropanol (IPA), and then add 0.4-0.6 mL of concentrated ammonia (mass fraction 25%-28%); under stirring at 600-800 rpm, slowly add 10-15 μL of tetraethyl orthosilicate (TEOS), and continue stirring at room temperature for 2-4 h. Then add 15-25 μL of 3-aminopropyltris(2 ... Ethoxysilane (APTES) was stirred for 8-12 hours in the dark at room temperature, then centrifuged at 4000-6000 rpm for 8-12 minutes. The supernatant was discarded, and the precipitate was resuspended in anhydrous ethanol by sonication. The "centrifugation-sonication resuspension" operation was repeated 2-3 times. Finally, the supernatant was discarded by centrifugation, and the resulting precipitate was dispersed in 4-6 mL of 1×PBS buffer (pH=7.4) to obtain a gold nanorod / silica-NH2 nanoparticle PBS dispersion.

[0023] (6) Covalently coupled nanocomposite materials: Take 1.5~2.5 mL of the CdSe quantum dot aqueous solution obtained in step (2), add 4~6 mg of EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) and 4~6 mg of NHS (N-hydroxysuccinimide) in sequence, stir at 700~900 rpm for 25~35 min at room temperature and in the dark, and then slowly add it dropwise to 4~6 mL of the gold nanorod / silica-NH2 nanoparticle PBS dispersion obtained in step (5); seal the reaction system and stir at 80~120 rpm for 4~6 h at room temperature and in the dark; during this period, the activated carboxyl groups undergo dehydration condensation with the amino groups on the SiO2 surface to form stable amide bonds (-CO-NH-). After the reaction is complete, centrifuge at 3000-5000 rpm for 8-12 min, discard the supernatant, and resuspend the precipitate in 1×PBS buffer (pH=7.4) by sonication. Repeat the "centrifugation-sonication resuspension" operation 2-3 times to completely remove free quantum dots and residual reagents. Finally, centrifuge again and discard the supernatant. Disperse the precipitate in 4-6 mL of 1×PBS buffer (pH=7.4) to obtain the PBS dispersion of LSPR-enhanced nanocomposite material, and store it in a refrigerator at 4°C in the dark.

[0024] Furthermore, the preparation steps of the integrated recognition probe (LSPR-QD-Probe A) in step S3 are as follows:

[0025] Take 1.5-2.5 mL of the PBS dispersion of the LSPR-enhanced nanocomposite material prepared in step S2 (its surface has free carboxyl groups -COOH due to the quantum dot ligands), add 4-6 mg of EDC and 4-6 mg of NHS, and stir at 700-900 rpm for 30-40 min at room temperature and in the dark to activate the surface carboxyl groups of the LSPR-enhanced nanocomposite material. After activation, add 15-25 μL of 100 μM single-stranded DNA capture probe A (probe A, sequence complementary to one end of the bridging probe) modified with amino groups, and incubate gently with shaking at 4°C and in the dark for 4-6 h to covalently couple the capture probe A (probe A) to the LSPR-enhanced nanocomposite material. After the reaction, centrifuge at 3000-5000 rpm for 8-12 min, discard the supernatant, and resuspend the resulting precipitate in 1×PBS buffer (pH=7.4). Repeat the "centrifugation-sonic resuspending" operation 2-3 times to completely remove the free capture probe A (probe A). A); Finally, centrifuge again to discard the supernatant, and disperse the resulting precipitate in 1.5~2.5mL of 1×PBS buffer (pH=7.4, containing 1% w / v BSA) to obtain the integrated recognition probe (LSPR-QD-Probe A) solution, and store at 4℃ protected from light.

[0026] Furthermore, the preparation steps for the final detection solution used in step S4 for adding samples to the rapid detection system for amplified pathogens are as follows:

[0027] (1) Target extraction and dilution: 16S rRNA of pathogens (such as Staphylococcus aureus) was extracted in a nuclease-free, ultra-clean environment to obtain lysis supernatant; then, nuclease-free water was used to dilute the lysis supernatant (original concentration approximately 1.42 × 10⁻⁶). 9 The concentration (CFU / mL) was serially diluted to obtain a final concentration of 4 × 10⁻⁶. 7 ~4×10 4 A series of test target samples with CFU / mL;

[0028] (2) Annealing to form RNA-DNA hybridization complex (RD-t): Add 15~25 μL of the above to a final concentration of 4×10 7 ~4×10 4A series of CFU / mL target samples were mixed with 15–25 μL of a specific DNA probe pool (containing 1–10 short SA-DNA fragments designed for the adjacent sequence of 16S rRNA) at a concentration of 1.5–2.5 μM. The mixture was then placed in a PCR instrument for a simple annealing procedure: the nucleic acid was first denatured and dissolved at 60–80 °C for 5–7 min, and then rapidly cooled to 35–37 °C for 12–18 min. This allowed the short DNA in the DNA probe pool to bind efficiently to the surface of 16S rRNA, resulting in a large number of target RNA-DNA hybrid complexes (RD-t) assembled in situ.

[0029] (3) Cascade component design: A highly specific crRNA is designed for the target RNA-DNA hybrid complex (RD-t) to guide the CRISPR-associated Cas13a endonuclease (a recombinant protein commonly known in the art). The specific components of the crRNA are designed as follows: it contains a backbone repeat sequence (conserved stem-loop structure) for binding the Cas13a protein, and a spacer sequence (guide sequence) that is completely and specifically complementary to a specific region of the Staphylococcus aureus 16S rRNA target.

[0030] TtCsm6 endonuclease (a dimeric RNA endonuclease activated by oligoadenylates) derived from *Thermus thermophilus* and dead ribonuclease H1 (dRNH1, a recognition protein that loses its cleavage activity but retains extremely high RNA-DNA hybridization affinity) were recombinantly fused with a yeast transcription activator-derived GCN4 polypeptide fragment and a single-chain variable fragment (scFv), respectively. Subsequently, the two recombinant proteins were non-covalently linked in space using the Suntag linker peptide assembly system (a supramolecular peptide linking system based on the specific affinity between the scFv single-chain antibody and the GCN4 polypeptide, designed to provide sufficient spatial freedom to eliminate steric hindrance between proteins), thus obtaining a TtCsm6 / dRNH1 fusion protein that ensures each retains its independent, complete functional conformation and catalytic / binding activity.

[0031] Simultaneously, an A4U6 substrate (sequence 5'-rArArArAUUUUUU-3', after Cas13a binds to the target and is activated, it can paracleave the A4U6 substrate and release an activating oligoadenylate intermediate (cA4) for further potent activation of the downstream TtCsm6 enzyme) and a hairpin-type chimeric substrate containing an RNA loop and a DNA stem (specifically designed as follows: an RNA loop composed of 5 consecutive ribonucleotides rA as a site specifically recognized and cleaved by the TtCsm6 enzyme, and a DNA stem composed of complementary deoxyribonucleotide sequences at both ends); wherein, the RNA loop can be specifically cleaved by TtCsm6, and the DNA stem hides two specific recognition sequences, the single-stranded bridging probes released by its unwinding can respectively bind to the capture probe A (Probe A) on the surface of the integrated recognition probe (LSPR-QD-Probe A) and the capture probe B (Probe B) fixed on the detection line (T line). B) Specific complementary hybridization to obtain the TtCsm6 / dRNH1 fusion protein and related nucleic acid components that participate in subsequent signal cascade amplification;

[0032] (4) Preparation of 13RNP premix: First, mix 3-5 μL of Cas13a protein (100-150 nM), 6-10 μL of crRNA (300-500 nM), and 1-3 μL of 10×Reaction buffer, and then incubate at 35-37°C for 15-20 min to form a stable Cas13a-crRNA recognition complex. Then, add 60-65 μL of deionized water and 6-10 μL of 10×Reaction buffer to the system. The premix consisted of 8-12 μL of A4U6 substrate at a concentration of 8-12 μM, 0.8-1.2 μL of TtCsm6 / dRNH1 fusion protein at a concentration of 0.8-1.2 μM, and 1.5-2.5 μL of hairpin-type chimeric substrate, bringing the total volume of the premix to 90-100 μL to obtain the premix 13RNP premix.

[0033] (5) Cascade signal amplification: Add 2-5 μL of the target RNA-DNA complex (RD-t) prepared in step (2) to the 90-100 μL premixed solution 13RNP prepared above, so that the total volume reaches 92-105 μL; place the resulting mixture in a constant temperature incubator at 35-37℃ and incubate in the dark for 45-50 min to obtain the final detection solution that has completed the amplification-free nucleic acid cascade signal amplification reaction and can be directly used for sample pad loading in the amplification-free rapid detection system for pathogens.

[0034] Furthermore, the construction steps of the amplification-free rapid detection system for pathogens described in step S5 are as follows:

[0035] (1) Basic structure preparation of the rapid detection system for amplified pathogens: Select a PVC base plate as the physical support of the bottom layer, and lay on it a sample pad (made of cellulose filter paper, about 0.35 mm thick), a conjugate pad (made of glass fiber, about 0.35 mm thick), a nitrocellulose membrane (NC membrane, as the substrate for T / C line scribing) and an absorbent pad (made of pure cotton absorbent paper, about 0.80 mm thick).

[0036] (2) Preparation of functionalized conjugate pads: Take the integrated recognition probe (LSPR-QD-Probe A) solution obtained in step S3 and centrifuge at 3000~5000 rpm for 8~12 min. Discard the supernatant and resuspend the obtained precipitate in 1×PBS buffer (pH=7.4) by sonication. Repeat the "centrifugation-sonic resuspension" operation 2~3 times. After centrifugation, resuspend in 1 mL of conjugate pad treatment solution (containing 5% w / v sucrose, 1% w / v BSA, 0.5% v / v Tween-20 in 1×PBS buffer, pH=7.4). Use a gold spraying device to uniformly spray the conjugate pad (glass fiber) pre-cut to a specific size by a cutting machine at a spraying volume of 3~5 μL / cm. Place the sprayed conjugate pad in a freeze dryer and freeze-dry overnight. After taking it out, store it in a sealed bag containing silica gel desiccant to obtain the conjugate pad pre-loaded with the integrated recognition probe (LSPR-QD-Probe A).

[0037] (3) Streaking and fixation of nitrocellulose membrane: Streaking was performed on the nitrocellulose membrane (NC membrane) using a benchtop streaker. Specifically, the detection line (T line) was streaked with probe B solution at a depth of 0.8~1.2 μL / cm; then, the quality control line (C line) was streaked with probe C solution at a distance of 4 mm from the detection line (T line) at a depth of 0.8~1.2 μL / cm; the membrane was then dried for 1.5~3 h to fix it, thus obtaining the nitrocellulose membrane (NC membrane) with the detection line (T line) and the quality control line (C line) fixed.

[0038] (4) Assembly of the amplification-free rapid detection system for pathogens: The photonic crystal film constructed in step S1 is tightly attached and fixed below the T-line of the nitrocellulose membrane (NC membrane). Then, the nitrocellulose membrane (NC membrane) is attached to the PVC substrate. The conjugate pad and the absorbent pad are then overlapped and attached to both ends of the nitrocellulose membrane (NC membrane), and the other ends of the conjugate pad and the absorbent pad are attached to the PVC substrate. Then, the sample pad is overlapped and attached to the other end of the conjugate pad, and the other end of the sample pad is attached to the PVC substrate. After assembly, the assembled PVC substrate, NC membrane and the sample pad, conjugate pad, absorbent pad and photonic crystal film are cut into amplification-free rapid detection system with a width of 4~6mm using a programmable strip cutter. Then, they are sealed in an aluminum foil bag containing desiccant. Finally, the amplification-free rapid detection system for pathogens based on LSPR and photonic crystal dual field enhancement is completed.

[0039] The rapid detection system for pathogens without amplification based on LSPR and photonic crystal dual-field enhancement described in this invention is constructed using the method described above.

[0040] Working principle:

[0041] This invention constructs an ultrasensitive quantitative detection system for pathogens based on CRISPR multi-enzyme cascade amplification and dual-field fluorescence enhancement technology. The detection principle is as follows: 16S rRNA of pathogens is extracted and a short-chain DNA probe is added, which is then annealed to form an RNA-DNA hybridization complex target. In the reaction system, the TtCsm6 / dRNH1 fusion protein, prepared by fusion expression and pre-assembled into the system, specifically anchors the target, efficiently enriching the Csm6 enzyme around the Cas13a protein. The target activates Cas13a paralogous cleavage to produce the intermediate cA4, which in turn strongly activates the local high concentration of Csm6. The activated Csm6 extensively cleaves the chimeric hairpin substrate in the system, releasing a large amount of single-stranded DNA "bridging probes". The final detection solution is obtained. This final detection solution is dropped onto the sample pad in the amplification-free rapid pathogen detection system. The bridging probes flow through the binding pad via capillary action and are specifically bound by the high-brightness integrated recognition probe (LSPR-QD-Probe A). As the liquid continues to chromatographically up to the nitrocellulose membrane (NC membrane), the capture probe B fixed on the detection line (T line) precisely intercepts the complex again, forming a sandwich structure of "photonic crystal / Probe B—bridging probe—Probe A / LSPR-QD-Probe A". Excess free nanoprobes are intercepted by the control line (C line). After the rapid detection system for amplified pathogens is allowed to stand for 10-15 minutes, it is inserted into a dry fluorescence immunochromatography analyzer. Under the excitation light of a specific wavelength, thanks to the exponential amplification of biological nucleic acids brought about by CRISPR multi-enzyme cascade cleavage, and the perfect superposition of the microscopic near-field enhancement of the gold nanorod LSPR effect at the detection line (T line) and the macroscopic microcavity bandgap extraction of the photonic crystal at the bottom, the fluorescence of the detection line (T line) is extremely bright, and the instrument captures an extremely high intensity fluorescence signal. The system automatically scans the fluorescence peak areas of the detection line (T line) and the control line (C line) and calculates the T / C ratio, thereby achieving ultrasensitive quantitative detection of trace pathogen nucleic acids (POCT).

[0042] The rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement has the following advantages:

[0043] 1. It innovatively combines the "biological exponential amplification" of CRISPR multi-enzyme cascade with the dual-field physical amplification of "LSPR nano-near field enhancement + photonic crystal macroscopic microcavity extraction", enabling trace pathogen nucleic acids with extremely low abundance to be excited with extremely strong fluorescence, achieving ultra-high sensitivity detection;

[0044] 2. Employing a one-step rapid thermal lysis extraction method combined with spontaneous hybridization of isothermal / room temperature probes, this method completely eliminates the dependence on temperature-dependent amplification equipment inherent in traditional PCR. The entire detection process can be completed in as little as 40 minutes, truly achieving a rapid "sample in, result out" response.

[0045] 3. Complex nano-optical elements and biological enzyme systems are integrated onto low-cost chromatographic test strips. This allows for rapid visual screening under portable light sources, as well as precise quantification within 15 minutes using a dry fluorescence analyzer, making it ideal for on-site, real-time testing in remote areas, customs, and primary healthcare facilities. Attached Figure Description

[0046] Figure 1 Transmission spectra of photonic bandgap modulation in photonic crystal construction;

[0047] Figure 1 This is a transmission spectrum of photonic crystal films with different microsphere sizes (i.e., different bandgap positions) constructed by varying the amount of monomer methyl methacrylate (MMA) in Example 1 of this invention. The spectrum was measured using a UV-Vis spectrophotometer, with wavelength on the x-axis and transmittance on the y-axis. The results show that precise control of the bandgap can be achieved by adjusting the microsphere size, and a photonic crystal film with a bandgap characteristic peak at 510 nm was successfully prepared. This perfectly matches the excitation wavelength of the LSPR-enhanced composite nanomaterial of this invention, providing a physical basis for the synergistic amplification of macroscopic physical fields.

[0048] Figure 2 : Schematic diagram of the preparation process of the LSPR-enhanced composite nanomaterial of this invention;

[0049] First, ascorbic acid removes Au from chloroauric acid. 3+ Mild reduction to metastable Au + When tiny spherical gold seeds are introduced, they act as catalytic centers, initiating autocatalytic reduction of Au. + It begins to be reduced to solid gold atoms (Au) on its surface. 0 And it continues to deposit. At this time, silver ions (Ag) +Underpotential deposition occurs, preferentially adhering to the high surface energy sides of the gold seed (such as the 110 crystal face), and combining with the surfactant hexadecyltrimethylammonium bromide to form a dense protective film, thus physically blocking the growth path of the gold seed's sides. While the sides are confined, the two ends of the gold seed (such as the 111 crystal face) remain exposed, forcing the continuous accumulation of newly formed gold atoms towards the ends; ultimately, guided by the soft template of hexadecyltrimethylammonium bromide rod-shaped micelles, the originally isotropic spherical seed is gradually elongated longitudinally, perfectly developing into a highly anisotropic gold nanorod. A very thin silica layer is formed on the surface of the gold nanorod under the action of tetraethyl orthosilicate (TEOS). This silica layer not only acts as a physical spacer layer, precisely controlling the distance between the metal core and the surrounding fluorescent material to prevent fluorescence quenching, but also provides a hydroxyl-rich reaction substrate for subsequent surface modification. Then, 3-aminopropyltriethoxysilane (APTES) condenses on the surface of the silica layer, thereby attaching a large number of amino groups to the outermost layer. Finally, after CdSe quantum dots were modified with 3-mercaptopropionic acid (MPA) to acquire carboxyl groups, they were then activated by EDC / NHS coupling, which enabled the free carboxyl groups on the CdSe quantum dots to form stable amide bonds with the amino groups on the surface of the silica layer, ultimately yielding LSPR-enhanced composite nanomaterials.

[0050] Figure 3 : A schematic diagram of the microscopic molecular mechanism of the CRISPR multi-enzyme cascade signal amplification reaction described in this invention;

[0051] Figure 3 As shown, ① the 16S of Staphylococcus aureus The rRNA annealing with the DNA probe pool forms a hybrid RNA-DNA complex. Guided by the crDNA guide sequence, Cas13a-crRNA specifically recognizes and binds to the RNA-DNA complex, thereby precisely activating the Cas13a-crRNA recognition complex in situ. ② This indicates that the activated Cas13a initiates paraphyletic (trans) cleavage activity, specifically cleaving the upstream substrate precursor A4U6 (rArArArAUUUUUU) in the system. ③ The activator intermediate molecule 3'-cyclic oligoapeptide (rArArArA>p, i.e., cA4) generated by cleavage is released locally in the microenvironment. ④ This indicates that rArArArA>p binds to and strongly activates the TtCsm6 core enriched in the surrounding area. The activated TtCsm6 efficiently cleaves the RNA loop of the chimeric hairpin substrate in the system. ⑤ This indicates that the disruption of the RNA loop of the chimeric hairpin substrate triggers stem unwinding, releasing a large number of free single-stranded bridging probes, ultimately achieving signal cascade amplification and probe release under nucleic acid amplification-free conditions.

[0052] Figure 4The present invention presents a schematic diagram (a) of the structure of the rapid detection system for pathogens without amplification based on dual-field enhancement of LSPR and photonic crystal and a close-up schematic diagram (b) of the dual-field physical enhancement mechanism of LSPR and photonic crystal synergistic amplification.

[0053] like Figure 4 As shown in (a), the physical hierarchy and specific recognition process of the rapid detection system for amplified pathogens based on LSPR and photonic crystal dual-field enhancement are illustrated: The rapid detection system for amplified pathogens based on LSPR and photonic crystal dual-field enhancement consists of a sample pad, a conjugate pad, a nitrocellulose membrane (NC membrane), and an absorbent pad, which are assembled from left to right on a PVC substrate. An integrated recognition probe (LSPR-QD-Probe A) is pre-sprayed and freeze-dried uniformly on the conjugate pad; a detection line (T line) and a control line (C line) are sequentially drawn on the nitrocellulose membrane (NC membrane) at intervals of 4-5 mm along the liquid flow direction, wherein a capture probe B (Probe B) is fixed on the detection line (T line) and a control probe C (Probe C) is fixed on the control line (C line). A photonic crystal film is tightly attached and fixed between the PVC substrate and the nitrocellulose membrane (NC membrane), directly below the detection line (T line). When the final detection solution obtained in step (4) is added to the sample pad, the liquid flows forward under capillary action to chromatographically redissolve the LSPR-QD-Probe A probe on the pad and bind to the target complex it carries. Then it continues to flow through the NC membrane and is finally specifically intercepted by Probe B at the T line, forming a sandwich structure of "photonic crystal / Probe B-bridging probe-Probe A / LSPR-QD-Probe A".

[0054] like Figure 4 As shown in (b), the optical physical mechanism of the synergistic enhancement of fluorescence signals by the localized plasma field (near field) and the photonic crystal field (far field) is illustrated in detail: At the microscale (excitation radio frequency stage): after the gold nanorods aggregated on the T-line are irradiated with excitation light, a strong localized surface plasmon resonance (LSPR) is induced, generating an extremely strong localized electric field around the nanoparticles (inducing the Purcell effect). Combined with the physical isolation effect of the extremely thin SiO2 shell on the energy quenching of the metal surface, the spontaneous emission rate and luminescence yield of the outer single-particle CdSe quantum dots are significantly improved. At the macroscale (spatial extraction stage): the photonic crystal film directly below the detection line (T-line) acts as an optical mirror, utilizing the high-magnification reflection characteristics of the photonic bandgap to efficiently reflect and extract the fluorescence that would otherwise be scattered and lost towards the substrate, greatly increasing the light collection efficiency of the detection instrument. The two work synergistically: the local LSPR field and the far field of the photonic crystal act independently on two independent physical processes—the enhancement of fluorescence excitation yield (microscopic) and the spatial propagation and extraction (macroscopic)—and are perfectly coupled in space, ultimately producing a product-level nonlinear physical synergistic amplification effect.

[0055] Figure 5 Fluorescence spectrum of photonic crystal field-enhanced LSPR composite nanomaterials;

[0056] in, Figure 5 (a) is a matching spectrum of the characteristic spectrum of the photonic crystal and the excitation spectrum of the LSPR composite nanomaterial, indicating that the photonic crystal obtained by bandgap modulation (bandgap at 510 nm) is perfectly matched to the excitation wavelength of the LSPR-enhanced composite nanomaterial. Figure 5 (b) is a comparison of the fluorescence emission spectra of the composite nanomaterial with and without a photonic crystal substrate. The emission spectra were obtained by scanning the photonic crystal substrate (and blank glass substrate) coated with LSPR-enhanced composite nanomaterial using a fluorescence spectrophotometer. The horizontal axis represents the wavelength range set by the fluorescence spectrophotometer, and the vertical axis represents the fluorescence intensity collected by the fluorescence spectrophotometer within that wavelength range. The results show that due to the precise matching of the band gap, the photonic crystal substrate produces a significant macroscopic microcavity physical amplification effect, which makes the final fluorescence intensity of the composite material increase by 86.0 times compared with that without a photonic crystal substrate, confirming the extremely high signal amplification efficiency of the dual-field enhancement mechanism.

[0057] Figure 6 The fluorescence response spectra of the system of the present invention against different concentrations of Staphylococcus aureus targets;

[0058] in, Figure 6 (a) The fluorescence response spectra of the detection line (T line) of the rapid detection system for Staphylococcus aureus target samples without amplification under different concentrations. The vertical axis data is the fluorescence signal radiated by the sandwich structure at the position of the detection line (T line) captured by the detection element of the dry fluorescence analyzer. The horizontal axis corresponds to the known concentration of Staphylococcus aureus that was absolutely quantified using the standard plating method before the experiment. The results show that the fluorescence signal intensity of the detection line (T line) decreases with the decrease of Staphylococcus aureus. Figure 6 (b) is a standard curve of linear fitting between the fluorescence signal (T / C ratio) and the logarithm of the pathogen concentration. The horizontal axis corresponds to the known concentration of Staphylococcus aureus absolutely quantified using the standard plating method before the experiment, and the vertical axis is the ratio of the fluorescence value of the detection line (T line) to the fluorescence value of the control line (C line) for each concentration group. This fitting curve shows a very high linear correlation (R²) between the T / C ratio and the pathogen concentration. 2 The experimental data (>0.981) confirms the excellent ultrasensitive quantitative detection capability and ultra-low detection limit of this system. Detailed Implementation

[0059] Example 1: Construction of photonic crystal thin films

[0060] Photonic crystal thin films are formed by the self-assembly of polymethyl methacrylate (PMMA) microspheres on a clean glass substrate. The PMMA microspheres are synthesized by polymerizing methyl methacrylate (MMA) using potassium persulfate (K2S2O8) as an initiator. First, 36 mg of K2S2O8 was added to a flask, followed by 80 mL of deionized water. After the solution stabilized, 6 mL of MMA was added and stirring was started. The mixture was then reacted in an oil bath at 90 °C for 95 min to obtain a well-dispersed PMMA microsphere dispersion (6.2% by mass) with a particle size of 220 nm. 2.5 mL of the PMMA microsphere dispersion was mixed evenly with 60 mL of deionized water and transferred to a beaker. A clean glass substrate (75 mm × 25 mm × 1 mm) was vertically inserted into the beaker, and the solvent was slowly evaporated at 35 °C for 25 h. As the solvent evaporated, the PMMA microspheres self-assembled on the surface of the glass substrate to form a preliminary photonic crystal film. The glass substrate was then placed in an oven at 120 °C for 60 min to bake and cure, thereby obtaining a photonic crystal film with a thickness of 10 μm, firmly attached to the glass substrate, and with stable optical properties. The band gap characteristic peak was located at 510 nm.

[0061] Furthermore, by varying the amount of MMA monomer, photonic crystal films with different band gaps were obtained: 4.8 mL of monomeric MMA resulted in PMMA microspheres with an average particle size of approximately 190 nm and a photonic crystal band gap of 450 nm; 7.2 mL of monomeric MMA resulted in PMMA microspheres with an average particle size of approximately 250 nm and a photonic crystal band gap of 580 nm; 11.5 mL of monomeric MMA resulted in PMMA microspheres with an average particle size of approximately 375 nm and a photonic crystal band gap of 875 nm; 12.6 mL of monomeric MMA resulted in PMMA microspheres with an average particle size of approximately 405 nm and a photonic crystal band gap of 940 nm; and 14.0 mL of monomeric MMA resulted in PMMA microspheres with an average particle size of approximately 440 nm and a photonic crystal band gap of 1030 nm.

[0062] Example 2: Construction of LSPR-enhanced composite nanomaterials

[0063] (1) Preparation of quantum dot precursor solution: Accurately weigh 0.04 g selenium powder (Se) and 0.1 g sodium borohydride (NaBH4), place them in a small flask, add 10 mL of deionized water, pass nitrogen gas (N2) to remove oxygen, and stir magnetically (800 rpm) for 45 min at room temperature until the black selenium powder is completely dissolved and the solution becomes clear and transparent, thus obtaining a fresh NaHSe quantum dot precursor solution;

[0064] (2) Preparation of quantum dots: Weigh 0.114 g of cadmium chloride (CdCl2·2.5H2O, about 0.5 mmol) and dissolve it in 50 mL of deionized water. Add 100 μL of 3-mercaptopropionic acid (MPA, as a stabilizer and to provide carboxyl groups). The solution may become turbid at this time. Add 1 M NaOH solution dropwise to adjust the pH value to about 10. The solution will become clear again. Transfer the solution to a three-necked flask and purge with nitrogen for 28 min to remove oxygen. Then, keep the three-necked flask under nitrogen protection and magnetic stirring (800 rpm). Quickly inject 1 mL of the NaHSe quantum dot precursor solution prepared in step (1) with a syringe. Quickly heat the system to 100°C and reflux for 3 h. Then immediately stop heating and cool quickly with an ice bath to terminate the reaction. Add an equal volume of anhydrous ethanol to the cooled reaction solution and centrifuge at 8000 rpm for 10 min. Discard the supernatant and disperse the resulting product in 10 mL of deionized water to obtain an aqueous solution of CdSe quantum dots.

[0065] (3) Preparation of gold seeds: 5.0 mL of 0.2 M hexadecyltrimethylammonium bromide (CTAB) aqueous solution and 5.0 mL of 0.5 m M chloroauric acid (HAuCl4) aqueous solution were mixed and gently stirred in a 28°C water bath until the mixture was uniformly light yellow; then 0.6 mL of 0.01 M sodium borohydride (NaBH4) aqueous solution that had been filtered through an ice bath was quickly added to the mixture in one go, and the mixture was stirred at 600 rpm for 2.5 min before stopping. The resulting brown solution was placed in a 28°C water bath and allowed to stand for 1.5 h to age, resulting in a gold seed solution with a size of about 2 nm.

[0066] (4) Growth of gold nanorods: Add 50 mL of 0.2 M hexadecyltrimethylammonium bromide (CTAB) aqueous solution and 50 mL of 0.5 mM chloroauric acid (HAuCl4) aqueous solution to a flask, and stir slowly at 28°C until homogeneous. Add 0.8 mL of 4.0 mM silver nitrate (AgNO3) aqueous solution and stir gently (100 rpm). Then add 0.7 mL of 0.0788 M ascorbic acid (vitamin C) aqueous solution dropwise. The color of the solution will gradually fade from golden yellow to completely colorless and transparent, resulting in a colorless growth solution. Take 0.12 mL of the gold seed solution obtained in step (3) and quickly inject it into the above colorless growth solution. Stir at 100 rpm for 15 s to mix it evenly. The reaction system was sealed and placed in a constant temperature incubator at 28°C for 18 hours to obtain an aqueous solution of gold nanorods. The gold nanorod solution was transferred to a centrifuge tube and centrifuged at 9000 rpm for 15 min. The supernatant was discarded, and the precipitate was resuspended in ultrapure water by sonication. The above "centrifugation-sonication resuspension" operation was repeated twice. The supernatant was discarded again after centrifugation, and the precipitate was dispersed in 5 mL of deionized water to obtain a purified aqueous solution of gold nanorods, which was then stored at 4°C for later use.

[0067] (5) Silanization and amination modification: Take 4 mL of the gold nanorod aqueous solution obtained in step (4), add it to 20 mL of isopropanol (IPA), and then add 0.5 mL of concentrated ammonia (mass fraction 28%). Under stirring at 700 rpm, slowly add 12 μL of tetraethyl orthosilicate (TEOS), and continue stirring at room temperature for 3 h. Then add 20 μL of 3-aminopropyltriethoxysilane (APTES) to the reaction solution, and continue stirring at room temperature in the dark for 10 h. Then centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the obtained precipitate with anhydrous ethanol by sonication. Repeat the above "centrifugation-sonication resuspension" operation twice. Centrifuge again and discard the supernatant. Disperse the obtained precipitate in 5 mL of 1×PBS buffer (pH=7.4) to obtain a PBS dispersion of gold nanorods / silica-NH2 nanoparticles.

[0068] (6) Covalently coupled nanocomposite materials: Take 2 mL of the CdSe quantum dot aqueous solution obtained in step (2), and add 5 mg of EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) and 5 mg of NHS (N-hydroxysuccinimide) in sequence. Stir at 800 rpm for 30 min at room temperature and in the dark, and slowly add it dropwise to 5 mL of the gold nanorod / silica-NH2 nanoparticle PBS dispersion obtained in step (5). Seal the reaction system and stir at 100 rpm for 5 h at room temperature and in the dark. During this period, the activated carboxyl groups undergo dehydration condensation with the amino groups on the SiO2 surface to form stable amide bonds (-CO-NH-). After the reaction is complete, the mixture is centrifuged at 4000 rpm for 10 min, the supernatant is discarded, and the resulting precipitate is resuspended in 1×PBS buffer (pH=7.4) by sonication. The above "centrifugation-sonication resuspension" operation is repeated twice to completely remove free quantum dots and residual reagents. The mixture is centrifuged again, the supernatant is discarded, and the resulting precipitate is dispersed in 5 mL of 1×PBS buffer (pH=7.4) to obtain a PBS dispersion of LSPR-enhanced nanocomposite material, which is stored in a 4°C refrigerator protected from light.

[0069] Example 3: Preparation of the integrated recognition probe (LSPR-QD-Probe A)

[0070] Take 2 mL of the PBS dispersion of the LSPR-enhanced nanocomposite material prepared in Example 2 (its surface has free carboxyl groups -COOH due to the quantum dot ligands), add 5 mg of EDC and 5 mg of NHS. Stir at 800 rpm for 35 min at room temperature in the dark to activate the surface carboxyl groups of the LSPR-enhanced nanocomposite material. After activation, add 20 μL of 100 μM amino-terminated single-stranded DNA capture probe A (Probe A, sequence complementary to one end of the bridging probe). Incubate gently with shaking at 4°C in the dark for 5 h to covalently couple the capture probe A (Probe A) to the LSPR-enhanced nanocomposite material. After the reaction was completed, the sample was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the resulting precipitate was resuspended in 1×PBS buffer (pH=7.4). The above "centrifugation-sonic resuspension" operation was repeated twice to completely remove free capture probe A (Probe A). The sample was centrifuged again and the supernatant was discarded. The resulting precipitate was dispersed in 2 mL of 1×PBS buffer (pH=7.4, containing 1% w / v BSA) to obtain the integrated recognition probe (LSPR-QD-Probe A) solution, which was stored at 4℃ protected from light.

[0071] Example 4: Preparation of the final detection solution for use in a rapid detection system for amplified pathogens

[0072] (1) Target extraction and dilution: Staphylococcus aureus 16S rRNA was extracted using the rapid lysis reagent in a commercially available bacterial RNA rapid extraction kit (QIAGEN, RNeasy Mini Kit, 74104) in a nuclease-free clean environment to obtain lysis supernatant; then, the lysis supernatant (original concentration approximately 1.42 × 10⁻⁶) was diluted with nuclease-free water. 9 The 16S rRNA was serially diluted (CFU / mL), with nuclease-free water as a negative control, to obtain a final concentration of 4 × 10⁻⁶ CFU / mL. 7 CFU / mL up to 4×10 4 A series of target samples with CFU / mL;

[0073] (2) Annealing to form hybridization complex RD-t: Prepare 40 μL of annealing system in a 200 μL PCR tube: Add 20 μL of the above series of target samples with different final concentrations and 20 μL of a specific DNA probe pool with a concentration of 2 μM to a 200 μL PCR tube (this specific DNA probe pool is a mixture of multiple short-chain DNAs specially designed and synthesized for the target sequence, containing multiple short-chain fragments SA-DNA 1~10 designed for the adjacent sequence of 16S rRNA, the specific short-chain DNA sequences are shown in Table 1). After mixing evenly, place it in a PCR instrument for a simple annealing procedure: first incubate at 70℃ for 6 min to denature and melt the nucleic acid, then quickly cool to 37℃ for 15 min to allow the short-chain DNA in the DNA probe pool to efficiently and complementaryly bind to the surface of 16S rRNA, so as to obtain a large number of target RNA-DNA hybridization complexes (RD-t) assembled in situ.

[0074] Table 1: DNA probe sequence information designed for the detection of Staphylococcus aureus

[0075] name Sequence (5`~3`) SA-DNA 1 GCCAGCGTTCATCCTGAGCC SA-DNA 2 TTCTCGTCCGTTCGCTCGAC SA-DNA 3 TGTTACTCACCCGTCCGCCG SA-DNA 4 TTCCCGAAGTTATCCCAGTC SA-DNA 5 AACCATGCGGTTCAAAATAT SA-DNA 6 ATCCATCTATAAGTGACAGC SA-DNA 7 TCGGCTACGTATCGTTGCCT SA-DNA 8 TGCCTCCCGTAGGAGTCTGG SA-DNA 9 TCCGTCAGGCTTTCGCCCAT SA-DNA 10 GTTCTTCCCTAATAACAGAG

[0076] (3) Cascade Component Design: A highly specific crRNA was designed to guide the Cas13a protein against the target RNA-DNA hybridization complex (RD-t). The specific nucleotide sequence of this crRNA was designed as follows: 5'-UAGACCACCCCAAAAAUGAAGGGGACUAAAACCCGAUCCACACGGAGUACUU CGAAGACCUUCAUCACUCAC -3'. The crRNA comprises two parts: a backbone repeat sequence (conserved stem-loop structure) for binding the Cas13a protein, and a spacer sequence (guide sequence) that is completely and specifically complementary to a specific region of the Staphylococcus aureus 16S rRNA target. The Cas13a protein is a commercially available recombinant protein commonly used in the art;

[0077] TtCsm6 endonuclease (a dimeric RNA endonuclease that can be activated by oligoadenylate) and dRNH1 (a recognition protein that loses its cleavage activity but retains extremely high RNA-DNA hybridization affinity) derived from *Thermus thermophilus* were fused with GCN4 peptide and scFv single-chain antibody fragment (a known component with a sequence known in the art), respectively. Then, using the Suntag linker peptide assembly system (a supramolecular peptide linking system based on the specific affinity between scFv single-chain antibody and GCN4 peptide, designed to provide sufficient spatial freedom to eliminate steric hindrance between proteins), the two recombinant proteins were non-covalently linked in space, thereby obtaining a TtCsm6 / dRNH1 fusion protein that ensures that each retains its independent and complete functional conformation and catalytic / binding activity;

[0078] The design incorporates an A4U6 substrate (sequence 5'-rArArArAUUUUUU-3', which, upon Cas13a binding to and activation of the target, can paracleave to release an activating oligoadenylate intermediate (cA4) for further potent activation of the downstream TtCsm6 enzyme) and a hairpin-type chimeric substrate comprising an RNA loop and a DNA stem (specifically designed as follows: an RNA loop consisting of 5 consecutive ribonucleotides rA serving as a site specifically recognized and cleaved by TtCsm6, and a DNA stem consisting of complementary deoxyribonucleotide sequences at both ends, AGCTGCCGATT-rArArArArA-AATCGGCAGCT). The RNA loop is specifically cleaved by TtCsm6, and the DNA stem contains two specific recognition sequences. The unwinding releases single-stranded bridging probes that can respectively bind to the capture probe A (Probe A) on the surface of the integrated recognition probe (LSPR-QD-Probe A). A) and the capture probe B (Probe B) fixed to the detection line (T line) are specifically complementary hybridized to obtain the TtCsm6 / dRNH1 fusion protein and related nucleic acid components that participate in the subsequent signal cascade amplification;

[0079] (4) Preparation of 13RNP premix: To ensure efficient assembly of the complex, the reaction was carried out in two steps. First, 4 μL of 125 nM Cas13a protein, 8 μL of 400 nM crRNA and 2 μL of 10× Reaction buffer were added to a centrifuge tube. After mixing by pipetting, the tube was incubated in a 37°C incubator for 18 min to form a stable Cas13a-crRNA recognition complex. Then, 62.5 μL of deionized water, 8 μL of 10× Reaction buffer, 10 μL of 10 μM A4U6 substrate, 1 μL of 1 μM TtCsm6 / dRNH1 fusion protein and 2 μL of hairpin-type chimeric substrate were added to the system in sequence to make the total volume of the premix 97.5 μL to obtain the pre-assembled 13RNP premix.

[0080] (5) Cascade signal amplification: Add 2.5 μL of the target RNA-DNA complex (RD-t) prepared in step (2) to the 97.5 μL premixed solution 13RNP prepared above, so that the total volume reaches 100 μL. Place the resulting mixture in a 37℃ constant temperature incubator and incubate in the dark for 48 min to obtain the final detection solution that has completed the amplification-free nucleic acid cascade signal amplification reaction and can be directly used for sample addition in the amplification-free rapid pathogen detection system.

[0081] Example 5: Construction of a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement

[0082] (1) Basic structure preparation of the rapid detection system for amplified pathogens: The basic support structure of the rapid detection system for amplified pathogens is assembled using conventional chromatography consumables available in the field. Specifically, it includes a PVC base plate used as the bottom physical support, and overlapping sample pads (made of cellulose filter paper, about 0.35 mm thick), conjugate pads (made of glass fiber, about 0.35 mm thick), nitrocellulose membranes (NC membrane, reserved for marking T and C lines) and absorbent pads (made of pure cotton absorbent paper, about 0.80 mm thick).

[0083] (2) Preparation of functionalized conjugate pads: The integrated recognition probe (LSPR-QD-Probe A) solution obtained in Example 3 was centrifuged at 4000 rpm for 10 min. The supernatant was discarded and the resulting precipitate was resuspended by sonication in 1×PBS buffer (pH=7.4). The "centrifugation-sonication resuspension" operation was repeated twice. After centrifugation, the precipitate was resuspended in 1 mL of conjugate pad treatment solution (containing 5% w / v sucrose, 1% w / v BSA, 0.5% v / v Tween-20 in 1×PBS buffer, pH=7.4). The solution was uniformly sprayed onto the conjugate pad (glass fiber) at a spray volume of 4 μL / cm using a gold sprayer. The sprayed conjugate pad was placed in a freeze dryer and lyophilized overnight. After removal, it was stored in a sealed bag containing silica gel desiccant to obtain the conjugate pad preloaded with the integrated recognition probe (LSPR-QD-Probe A).

[0084] (3) Streaking and fixation of nitrocellulose membrane: Streaking was performed on the nitrocellulose membrane (NC membrane) using a benchtop streaker. Specifically, the detection line (T line, streaking amount of 1.0 μL / cm) was drawn by absorbing the capture probe B solution, and the quality control line (C line, streaking amount of 1.0 μL / cm) was drawn by absorbing the quality control probe C solution at a distance of 4 mm from the detection line (T line). After drying for 2 hours, the nitrocellulose membrane (NC membrane) with the detection line (T line) and the quality control line (C line) fixed was obtained.

[0085] (4) Assembly of the amplification-free rapid detection system for pathogens: The photonic crystal film constructed in Example 1 is tightly attached and fixed below the T-line of the nitrocellulose membrane (NC membrane). Then, the nitrocellulose membrane (NC membrane) is attached to the PVC substrate. The conjugate pad and the absorbent pad are then attached to both ends of the nitrocellulose membrane (NC membrane), and the other ends of the conjugate pad and the absorbent pad are attached to the PVC substrate. The sample pad is then attached to the other end of the conjugate pad, and the other end of the sample pad is attached to the PVC substrate. After assembly, the assembled PVC substrate, NC membrane, and the sample pad, conjugate pad, absorbent pad, and photonic crystal film are cut into strips with a width of 5 mm using a programmable strip cutter. The strips are then placed in aluminum foil bags containing desiccant and sealed. Finally, the amplification-free rapid detection system for pathogens based on LSPR and photonic crystal dual-field enhancement is obtained. (Near-field LSPR: derived from an integrated recognition probe (LSPR-QD-Probe) released from the conjugate pad) A) The localized surface plasmon resonance (LSPR) near-field electric field enhancement generated by the gold nanorod core; far-field photonic crystal: derived from the far-field extraction of optical bandgap reflection provided by the photonic crystal film fixed in the region directly below the T-line of the corresponding NC film on the PVC substrate.

[0086] Example 1: Fluorescence amplification effect of photonic crystals on LSPR-enhanced nanocomposites

[0087] The glass substrate with the photonic crystal thin film constructed in Example 1 was used as the experimental group, while a glass substrate without a photonic crystal was set up as the blank group. 100 μL and 625 µM of the integrated recognition probe (LSPR-QD-Probe A) obtained in Example 3 were uniformly sprayed onto the glass substrates of the experimental and blank groups, respectively. The emission spectra of both were measured using a fluorescence spectrophotometer under 510 nm excitation, and the integrated intensity in the 700–800 nm wavelength range was calculated. Finally, the fluorescence amplification factor was obtained. Experimental results show that the integrated fluorescence intensity of the experimental group is 86.0 times that of the blank group. This result fully demonstrates that the photonic crystal thin film constructed in this invention, through precise matching of the physical bandgap, generates a significant optical bandgap reflection far field, successfully achieving physical cascade amplification of the nanoprobe emission signal, and confirming the effectiveness of the dual-field synergistic enhancement mechanism.

[0088] Example 2: Fluorescence response of the detection system to different concentrations of pathogenic targets

[0089] Take 90 μL of the final detection solution obtained in Example 4 and add it dropwise at a uniform rate to the sample pad of the amplification-free rapid pathogen detection system based on LSPR and photonic crystal dual-field enhancement assembled in Example 5. The liquid flow is propelled forward by capillary action. Allow the system to stand for chromatography for 15 min to allow the reaction system to fully complete specific capture and assembly at the detection line (T line). Then, insert the amplification-free rapid pathogen detection system into a dry fluorescence immunochromatographic analyzer. Under 510 nm excitation light, the dry fluorescence immunochromatographic analyzer automatically scans the fluorescence peak areas of the T line and C line, and the instrument captures the fluorescence signal. Take the arithmetic mean of three T line readings, which is the average fluorescence intensity of the T line shown in Table 2. Similarly, take the arithmetic mean of three C line readings and calculate the T / C ratio to achieve ultrasensitive quantitative detection of trace pathogen nucleic acids (POCT).

[0090] Table 2: Results data for different concentrations of Staphylococcus aureus

[0091] Sample number Staphylococcus aureus concentration Average fluorescence intensity of T-line T-value / C-value 1 <![CDATA[10 7 CFU / mL]]> 12354.45 1.870 2 <![CDATA[10 6 CFU / mL]]> 11198.63 1.695 3 <![CDATA[10 5 CFU / mL]]> 9246.58 1.400 4 <![CDATA[10 4 CFU / mL]]> 7046.23 1.067 5 Blank 6606.21 1.000

[0092] The data in Table 2 show that as the concentration of the Staphylococcus aureus target gradually decreases (from 10...), the... 7 CFU / mL decreased to 10 4 The average fluorescence intensity of the T line and the T / C ratio both showed a regular gradient decrease (CFU / mL), demonstrating an excellent concentration-response relationship and confirming the system's accurate quantitative detection capability. Furthermore, even at 10... 4Even at an extremely low target concentration of CFU / mL, the signal response value (T / C = 1.067) was still significantly higher than that of the Blank control group (T / C = 1.000, which used an equal volume of nuclease-free water instead of the target sample, and all reactions and chromatography steps were performed in parallel under the same experimental conditions). This indicates that, thanks to the synergistic coupling of biological enzyme digestion amplification and photonic crystal / LSPR dual-field physical amplification, this detection system successfully achieved 10 CFU / mL signal response under completely nucleic acid amplification-free conditions. 4 Ultrasensitive detection limit at the CFU / mL level.

Claims

1. A method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement, comprising the following steps: S1, Construction of photonic crystal thin films; Construction of S2 and LSPR-enhanced composite nanomaterials; S3. Preparation of the integrated recognition probe LSPR-QD-Probe A; S4. Preparation of the final detection solution for adding samples to the rapid detection system for amplified pathogens; S5. Construction of a rapid detection system for amplified pathogens based on LSPR and photonic crystal dual-field enhancement.

2. The method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement as described in claim 1, characterized in that: The construction steps of the photonic crystal thin film described in step S1 are as follows: (1) Synthesis of PMMA microspheres: Add 30-40 mg of potassium persulfate and 70-90 mL of deionized water to a flask. After the solution stabilizes, add 5.5-6.5 mL of methyl methacrylate and start stirring. React in an oil bath at 85-90 °C for 90-100 min to obtain a PMMA microsphere dispersion with a mass fraction of 5.5%-7.0% and a particle size of 200-240 nm. Then add deionized water to dilute and obtain a PMMA microsphere dispersion with a mass fraction of 0.25%-0.27%. (2) Construction of photonic crystal thin film: A clean glass substrate is vertically inserted into a PMMA microsphere dispersion with a mass fraction of 0.25%~0.27%, and the solvent is slowly evaporated at 30~40℃ for 24~30h for self-assembly. Finally, it is placed in an oven at 110~130℃ for 50~80min to cure, thereby obtaining a photonic crystal thin film with a thickness of 10~12μm on the glass substrate.

3. The method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement as described in claim 1, characterized in that: The construction steps of the LSPR-enhanced composite nanomaterials described in step S2 are as follows: (1) Preparation of quantum dot precursor solution: Accurately weigh 0.03~0.05g selenium powder and 0.08~0.12g sodium borohydride, then add 8~12mL deionized water, purge with nitrogen to remove oxygen, and stir magnetically at room temperature for 40~50min until the black selenium powder is completely dissolved and the solution becomes clear and transparent to obtain NaHSe quantum dot precursor solution; (2) Preparation of quantum dots: Weigh 0.10~0.12g of cadmium chloride and dissolve it in 40~60mL of deionized water, add 80~120μL of 3-mercaptopropionic acid; then add 0.8~1.2M NaOH solution dropwise to adjust the pH value to 9.5~10.5; purge the solution with nitrogen gas for 25~30min to remove oxygen, and then quickly inject 0.8~1.2mL of the NaHSe quantum dot precursor solution prepared in step (1) under nitrogen protection and magnetic stirring. Quickly heat the system to 90~110°C and condense the reaction under reflux for 2~4h. Then immediately stop heating and cool it quickly with an ice bath to terminate the reaction; add an equal volume of anhydrous ethanol to the cooled reaction solution, and centrifuge and wash at 7000~9000rpm for 8~12min; discard the supernatant, and disperse the obtained product in 8~12mL of deionized water to obtain CdSe quantum dot aqueous solution; (3) Preparation of gold seeds: Mix 4.0~6.0 mL of 0.18~0.22 M hexadecyltrimethylammonium bromide aqueous solution with 4.0~6.0 mL of 0.4~0.6 mM chloroauric acid aqueous solution and stir gently in a water bath at 25~30°C until the mixture is uniformly light yellow; then quickly inject 0.5~0.7 mL of 0.008~0.012 M sodium borohydride aqueous solution that has been cold filtered in an ice bath into the mixture and stir at 500~700 rpm for 2~3 min and then stop; place the resulting brown solution in a water bath at 25~30°C and let it stand for aging for 1~2 h to obtain a gold seed solution with a size of about 2 nm; (4) Gold nanorod growth: 40-60 mL of 0.18-0.22 M hexadecyltrimethylammonium bromide aqueous solution and 40-60 mL of 0.4-0.6 mM chloroauric acid aqueous solution were slowly stirred at 25-30°C until homogeneous. 0.7-0.9 mL of 3.5-4.5 mM silver nitrate aqueous solution was added and stirred gently. Then, 0.6-0.8 mL of 0.07-0.09 M L-ascorbic acid aqueous solution was added dropwise to obtain a colorless growth solution. 0.10-0.15 mL of the gold seed solution obtained in step (3) was quickly injected into the above colorless growth solution. In the solution, stir at 80-120 rpm for 10-20 seconds to ensure uniform mixing; seal the reaction system and place it in a constant temperature incubator at 25-30°C for 15-20 hours to obtain an aqueous solution of gold nanorods; transfer the aqueous solution of gold nanorods to a centrifuge tube and centrifuge at 8000-10000 rpm for 10-20 minutes, discard the supernatant, and resuspend the obtained precipitate in ultrapure water by sonication. Repeat the "centrifugation-sonication resuspension" operation 2-3 times; finally, centrifuge again and discard the supernatant, disperse the obtained precipitate in 4-6 mL of deionized water to obtain a purified aqueous solution of gold nanorods, which is then stored at 4°C for later use. (5) Silanization and amination modification: Take 3-5 mL of the gold nanorod aqueous solution obtained in step (4), add it to 18-22 mL of isopropanol, and then add 0.4-0.6 mL of concentrated ammonia with a mass fraction of 25%-28%; under stirring at 600-800 rpm, slowly add 10-15 μL of tetraethyl orthosilicate, and continue stirring at room temperature for 2-4 h. Then add 15-25 μL of 3-aminopropyltriethoxysilane to the reaction solution, and continue stirring at room temperature in the dark for 8-12 h. Then centrifuge at 4000-6000 rpm for 8-12 min, discard the supernatant, and resuspend the precipitate with anhydrous ethanol by sonication. Repeat the "centrifugation-sonication resuspension" operation 2-3 times. Finally, centrifuge again and discard the supernatant. Disperse the obtained precipitate in 4-6 mL of 1×PBS buffer to obtain gold nanorod / silica-NH2 nanoparticle PBS dispersion. (6) Covalently coupled nanocomposite materials: Take 1.5~2.5 mL of the CdSe quantum dot aqueous solution obtained in step (2), and add 4~6 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide and 4~6 mg of other components sequentially. mg of N-hydroxysuccinimide was stirred at 700-900 rpm for 25-35 min at room temperature and in the dark. Then, it was slowly added dropwise to 4-6 mL of the gold nanorod / silica-NH2 nanoparticle PBS dispersion obtained in step (5). The reaction system was sealed and stirred at 80-120 rpm for 4-6 h at room temperature and in the dark. After the reaction was completed, the mixture was centrifuged at 3000-5000 rpm for 8-12 min. The supernatant was discarded and the precipitate was resuspended in 1×PBS buffer by sonication. The "centrifugation-sonication resuspension" operation was repeated 2-3 times to completely remove free quantum dots and residual reagents. Finally, the mixture was centrifuged again and the supernatant was discarded. The precipitate was dispersed in 4-6 mL of 1×PBS buffer to obtain the PBS dispersion of LSPR-enhanced nanocomposite material. The precipitate was stored in a 4°C refrigerator in the dark.

4. The method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement as described in claim 1, characterized in that: In step S3, 1.5-2.5 mL of the PBS dispersion of the LSPR-enhanced nanocomposite prepared in step S2 is taken, and 4-6 mg of EDC and 4-6 mg of NHS are added. The mixture is stirred at 700-900 rpm for 30-40 min at room temperature and in the dark to activate the surface carboxyl groups of the LSPR-enhanced nanocomposite. After activation, add 15-25 μL of 100 μM amino-terminated single-stranded DNA capture probe A and incubate gently with shaking at 4°C in the dark for 4-6 h to covalently couple the capture probe A with the LSPR-enhanced nanocomposite material. After the reaction, centrifuge at 3000-5000 rpm for 8-12 min, discard the supernatant, and resuspend the precipitate in 1×PBS buffer. Repeat the "centrifugation-sonic resuspension" operation 2-3 times to completely remove free capture probe A. Finally, centrifuge again and discard the supernatant. Disperse the precipitate in 1.5-2.5 mL of 1×PBS buffer containing 1% w / v BSA to obtain the integrated recognition probe LSPR-QD-Probe A solution, and store at 4°C in the dark.

5. The method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement as described in claim 1, characterized in that: The preparation steps for the final detection solution used in the amplification-free rapid detection system for pathogens described in step S4 are as follows: (1) Target extraction and dilution: 16S rRNA of the pathogen was extracted in a nuclease-free clean environment to obtain lysis supernatant; then, the lysis supernatant was serially diluted with nuclease-free water to obtain a final concentration of 4×10⁻⁶. 7 ~4×10 4 A series of test target samples with CFU / mL; (2) Annealing to form RNA-DNA hybridization complex RD-t: Add 15~25 μL of the above to a final concentration of 4×10 7 ~4×10 4 The CFU / mL series of test target samples and 15-25 μL of specific DNA probe pool with a concentration of 1.5-2.5 μM were mixed evenly and then placed in a PCR instrument for a simple annealing procedure: first, incubate at 60-80℃ for 5-7 min to denature and denature the nucleic acid, and then rapidly cool to 35-37℃ for 12-18 min to allow the short-chain DNA in the DNA probe pool to bind efficiently to the surface of 16S rRNA, so as to obtain a large number of target RNA-DNA hybrid complexes RD-t that are assembled in situ. (3) Cascade component design: A highly specific crRNA is designed for the target RNA-DNA hybrid complex RD-t to guide the CRISPR-related Cas13a endonuclease. The crRNA contains a backbone repeat sequence for binding the Cas13a protein, i.e. a conserved stem-loop structure, and a spacer sequence that is completely and specifically complementary to a specific region of the Staphylococcus aureus 16S rRNA target, i.e. a guide sequence. The TtCsm6 endonuclease derived from thermophilic bacteria and the non-catalytically active ribonuclease H1 were recombinantly fused with a GCN4 polypeptide fragment derived from yeast transcription activator and a single-chain antibody variable region fragment, respectively. Subsequently, the two recombinant proteins were spatially non-covalently linked using the Suntag linker polypeptide assembly system to obtain the TtCsm6 / dRNH1 fusion protein, which ensures that each retains its independent and complete functional conformation and catalytic / binding activity. The design includes an A4U6 substrate with the sequence 5'-rArArArAUUUUUU-3' and a hairpin-type chimeric substrate containing an RNA loop and a DNA stem; wherein the RNA loop can be specifically cleaved by TtCsm6, and the DNA stem hides two specific recognition sequences. The single-stranded bridging probes released by the unwinding can specifically and complementaryly hybridize with the capture probe A on the surface of the integrated recognition probe LSPR-QD-Probe A and the capture probe B fixed by the detection line, respectively, to obtain the TtCsm6 / dRNH1 fusion protein that participates in the subsequent signal cascade amplification; (4) Preparation of 13RNP premix: First, mix 3-5 μL of Cas13a protein (100-150 nM), 6-10 μL of crRNA (300-500 nM), and 1-3 μL of 10×Reaction buffer, and then incubate at 35-37°C for 15-20 min to form a stable Cas13a-crRNA recognition complex. Then, add 60-65 μL of deionized water and 6-10 μL of 10×Reaction buffer to the system. The premix consisted of 8-12 μL of A4U6 substrate at a concentration of 8-12 μM, 0.8-1.2 μL of TtCsm6 / dRNH1 fusion protein at a concentration of 0.8-1.2 μM, and 1.5-2.5 μL of hairpin-type chimeric substrate, bringing the total volume of the premix to 90-100 μL to obtain the premix 13RNP premix. (5) Cascade signal amplification: Add 2-5 μL of the target RNA-DNA complex RD-t prepared in step (2) to the 90-100 μL premixed solution 13RNP prepared in step (4) to make the total volume reach 92-105 μL; place the resulting mixture in a constant temperature incubator at 35-37℃ and incubate in the dark for 45-50 min to obtain the final detection solution that has completed the amplification-free nucleic acid cascade signal amplification reaction and can be directly used for sample pad loading in the amplification-free rapid detection system for pathogens.

6. The method for constructing a rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement as described in claim 1, characterized in that: The construction steps of the amplification-free rapid detection system for pathogens described in step S5 are as follows: (1) Basic structure preparation of the rapid detection system for amplified pathogens: Select a PVC base plate as the underlying physical support, and lay sample pads, conjugate pads, nitrocellulose membranes and absorbent pads on it. The material of the sample pads is cellulose filter paper, the material of the conjugate pads is glass fiber, and the material of the absorbent pads is pure cotton absorbent paper. (2) Preparation of functionalized conjugate pads: Take the integrated recognition probe LSPR-QD-Probe A solution obtained in step S3 and centrifuge at 3000~5000rpm for 8~12min. Discard the supernatant and resuspend the obtained precipitate in 1×PBS buffer by sonication. Repeat the "centrifugation-sonication resuspension" operation 2~3 times. After centrifugation, resuspend in 1mL of conjugate pad treatment solution. Use a gold spraying device to uniformly spray the conjugate pads of a specific size pre-cut by a cutting machine at a spraying volume of 3~5μL / cm. Place the sprayed conjugate pads in a freeze dryer and freeze-dry overnight. After removal, store in a sealed bag containing silica gel desiccant to obtain conjugate pads pre-loaded with integrated recognition probe LSPR-QD-Probe A. The conjugate pad treatment solution is 1×PBS buffer containing 5% w / v sucrose, 1% w / v BSA, and 0.5% v / v Tween-20. (3) Streaking and fixation of nitrocellulose membrane: Streaking is performed on the nitrocellulose membrane using a benchtop streaker. Specifically, the detection line is streaked by applying the capture probe B solution at a depth of 0.8~1.2 μL / cm. Then, the quality control line is streaked by applying the quality control probe C solution at a distance of 4 mm from the detection line at a depth of 0.8~1.2 μL / cm. The membrane is then dried for 1.5~3 h to fix it, thus obtaining the nitrocellulose membrane with the detection line and quality control line fixed. (4) Assembly of the amplification-free rapid detection system for pathogens: The photonic crystal film constructed in step S1 is tightly attached and fixed on the nitrocellulose membrane below the detection line. Then, the nitrocellulose membrane is attached to the PVC base plate. The conjugate pad and the absorber pad are then attached to the two ends of the nitrocellulose membrane respectively, and the other end of the conjugate pad and the absorber pad is attached to the PVC base plate. Then, the sample pad is attached to the other end of the conjugate pad, and the other end of the sample pad is attached to the PVC base plate. After assembly, the assembled PVC base plate, NC membrane and the sample pad, conjugate pad, absorber pad and photonic crystal film are cut into amplification-free rapid detection system with a width of 4~6mm using a programmable strip cutter. Then, they are sealed in an aluminum foil bag containing desiccant. Finally, the amplification-free rapid detection system for pathogens based on LSPR and photonic crystal dual field enhancement is completed.

7. A rapid detection system for amplification-free pathogens based on LSPR and photonic crystal dual-field enhancement, characterized in that: It is constructed by the construction method described in any one of claims 1 to 6.

Images