Use of reagent for detecting expression level of abrcl in preparation of diagnostic product for benign prostatic hyperplasia

Abstract

The application discloses application of a reagent for detecting ABRACL expression level in preparation of a benign prostatic hyperplasia diagnosis product. The application first discovers and proves that ABRACL protein is closely related to occurrence and development of benign prostatic hyperplasia (BPH), and has important clinical application value. Through serum proteomic analysis on 398 subjects (121 healthy controls and 277 BPH patients), the application determines that ABRACL is significantly increased in serum of the BPH patients, and the expression level thereof is positively correlated with the clinical symptom severity reflected by the IPSS score and increases in an incremental manner, that is, the expression amount of ABRACL in patients with moderate and severe LUTS is significantly higher than that in patients with mild LUTS. The discovery shows that ABRACL can be used as an auxiliary diagnosis marker of BPH, and can also be used for assessing the severity of the disease and prognosis monitoring.

Description

Technical Field

[0001] This invention relates to the fields of medical diagnostics and treatment, specifically to the application of reagents for detecting ABRACL expression levels in the preparation of diagnostic products for benign prostatic hyperplasia. Background Technology

[0002] Benign prostatic hyperplasia (BPH) is a common urological disease in middle-aged and elderly men, and its incidence increases with age. With the deepening of global population aging, the number of BPH patients is expanding year by year, leading to a continuous upward trend in the disease burden and medical resource consumption. Although BPH is a benign condition, its long-term progression seriously affects the physical and mental health and quality of life of patients, while also significantly increasing the medical expenses and care burden on families and society. The exact cause of this disease is not yet fully understood, but existing research suggests that its development may be closely related to multiple mechanisms, including abnormal contraction of prostatic smooth muscle, increased tension caused by tissue fibrosis, and glandular enlargement and urinary tract obstruction due to an imbalance between glandular cell proliferation and apoptosis.

[0003] It is noteworthy that BPH patients often lack specific clinical manifestations in the early stages of the disease, leading many to fail to notice changes in their condition in time. They often only seek treatment after experiencing significant urinary obstruction or even complications, thus missing the optimal window for early intervention and slowing disease progression. In terms of treatment, current clinical practice primarily relies on medication and surgery. However, medication has limitations in overall efficacy and significant individual variability; furthermore, long-term use of some drugs may cause adverse reactions such as sexual dysfunction, affecting patient adherence. While surgery can effectively relieve obstructive symptoms, as an invasive procedure, it carries risks such as bleeding and infection, and may even cause permanent damage to prostate function, failing to meet patients' practical needs for long-term, precise, and minimally invasive prevention and treatment. Therefore, in-depth exploration of the molecular mechanisms of BPH development and progression, and the identification of new, safe, and effective therapeutic targets, has become a crucial scientific issue urgently needing to be addressed in this field. Summary of the Invention

[0004] The main objective of this invention is to propose the application of reagents for detecting ABRACL expression levels in the preparation of diagnostic products for benign prostatic hyperplasia (BPH), aiming to provide a safe and effective therapeutic target for BPH.

[0005] To achieve the above objectives, this invention proposes the application of a reagent for detecting ABRACL expression levels in the preparation of diagnostic products for benign prostatic hyperplasia.

[0006] Preferably, the nucleotide sequence of the ABRACL is shown in SEQ ID NO: 1.

[0007] Preferably, the ABRACL is upregulated in patients with benign prostatic hyperplasia.

[0008] Preferably, the reagent is used to assess the severity of benign prostatic hyperplasia by detecting the expression level of ABRACL, wherein the expression level of ABRACL increases with the severity of benign prostatic hyperplasia.

[0009] Preferably, the test sample for the reagent is a venous blood sample or a urine sample.

[0010] Preferably, the product includes a formulation or a kit.

[0011] Preferably, the formulation or kit includes specific primers for ABRACL; the specific primer pair for ABRACL includes an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO: 3.

[0012] Preferably, the kit further includes reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescent probe, RNase inhibitor and Taq enzyme.

[0013] The present invention also proposes the application of an ABRACL gene expression vector in the preparation of a pharmaceutical composition for the treatment of benign prostatic hyperplasia.

[0014] Preferably, the pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention is the first to discover and confirm that ABRACL protein is closely related to the occurrence and development of benign prostatic hyperplasia (BPH), and has important clinical application value. Through serum proteomics analysis of 398 subjects (121 healthy controls and 277 BPH patients), this invention clarifies that ABRACL expression is significantly increased in the serum of BPH patients, and its expression level increases positively correlated with the severity of clinical symptoms reflected by the IPSS score, that is, the ABRACL expression level in patients with moderate to severe LUTS is significantly higher than that in patients with mild LUTS. This finding indicates that ABRACL can not only serve as an auxiliary diagnostic marker for BPH, but also be used to assess the severity of the patient's condition and monitor prognosis, providing a new molecular target for non-invasive and convenient detection of BPH, and making up for the lack of specificity in existing BPH diagnostic methods.

[0016] (2) This invention validates the effectiveness and feasibility of ABRACL as a therapeutic target for BPH through both in vitro cell experiments and in vivo animal experiments. At the cellular level, knockdown of ABRACL significantly inhibits the proliferation of prostate stromal cells WPMY-1 and epithelial cells RWPE-1, while promoting their apoptosis, suggesting that ABRACL plays a key regulatory role in the abnormal proliferation of prostate cells. At the animal level, lentivirus-mediated knockdown of ABRACL significantly reduces the prostate index, epithelial thickness, and collagen fiber and smooth muscle content in a testosterone propionate-induced BPH rat model, effectively inhibiting pathological hyperplasia of prostate tissue. Furthermore, this intervention did not significantly affect the rat's body weight, indicating good safety and specificity. In summary, the ABRACL target and related intervention strategies revealed in this invention provide a solid experimental basis and novel therapeutic targets for the development of new BPH drugs, demonstrating significant clinical translational potential and application prospects. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This invention provides a graph showing the expression levels of ABRACL protein in the serum of healthy individuals and patients with benign prostatic hyperplasia; *** represents P <0.001.

[0019] Figure 2 This invention provides a graph showing the expression levels of ABRACL in the serum of patients with mild, moderate, and severe LUTS and benign prostatic hyperplasia; * represents P <0.05, ** represents P <0.01.

[0020] Figure 3 The following diagram illustrates the effect of ABRACL knockdown on WPMY-1 and RWPE-1 prostate cells provided by this invention: A: Verification diagram of mRNA levels (left) and protein levels (right) of WPMY-1 and RWPE-1 cells after ABRACL interference; B: Diagram of the proliferation capacity of WPMY-1 and RWPE-1 cells before and after ABRACL interference determined by CCK8 assay; C: Diagram of apoptosis in prostate cells after ABRACL interference detected by flow cytometry; * represents... P <0.05, ** represents P <0.01, *** represents P <0.001.

[0021] Figure 4 The following figures illustrate the effect of ABRACL knockdown on prostatic hyperplasia in rats, as provided by this invention: A: Gross images of prostatic tissue from rats in the sham+shNC, sham+shABRACL, T-BPH+shNC, and T-BPH+shABRACL groups; B: Histograms of prostatic weight index (prostatic weight / body weight) × 1000 and rat body weight curves for the four groups; C: Representative images of hematoxylin-eosin (HE) staining of prostatic tissue from the four groups of rats and bar charts showing the percentage of epithelial area; D: Representative images of Masson staining of prostatic tissue from the four groups of rats and bar charts showing the percentage of collagen fiber area; * represents... P <0.05, ** represents P <0.01, *** represents P <0.001.

[0022] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0025] Reagents, instruments, and cell sources used in the examples: 1. Table 1 Experimental Reagents Experimental reagents Manufacturer DMEM medium Gibco PEpiCM prostate epithelial cell culture medium ScienCell Trypsin (0.25% Trypsin-EDTA) Gibco Penicillin-Streptomycin-Amphotericin B Solution (100X) Azure Sky South American fetal bovine serum Gibco Annexin V-APC / 7-AAD Double Staining Apoptosis Detection Kit KGI Bio Cell Counting Kit-8 (CCK-8) - Cell Proliferation-Toxicity Assay Kit Biosharp ABRACL antibody Thermo Fisher Horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) Azure Sky 2. Table 2 Experimental Instruments Instrument Name Source or supplier pipette Thermo Fisher (USA) Biosafety cabinet Thermo Fisher (USA) Carbon dioxide cell incubator Thermo Fisher (USA) microscope Olympus 4℃ medical refrigerator Zhongke Meiling (China) -20℃ Medical Low Temperature Refrigerator Zhongke Meiling (China) -80℃ Medical Ultra-Low Temperature Freezer Zhongke Meiling (USA) Mini-PROTEAN Tetra Vertical Electrophoresis Tank Bio-Rad (USA) NanoDrop™ One / One Micro-UV-Vis Spectrophotometer Thermo Fisher (USA) CFX Connect PCR Instrument Bio-Rad (USA) S1000 Thermal Cycler PCR Instrument Bio-Rad (USA) Flow cytometer NovoCyte (Hangzhou) Microcentrifuge Thermo Fisher (USA) Multifunctional ELISA reader Thermo Fisher (USA) 3. Cell source Both prostate cell lines WPMY-1 and RWPE-1 were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and all cells were validated by STR.

[0026] Example 1: Detection of serum ABRACL expression in healthy individuals and BPH patients This study collected serum samples from 398 individuals, including healthy individuals (N=121) and patients with benign prostatic hyperplasia (BPH) (N=277). First, protein extraction was performed on these serum samples, followed by concentration determination using the BCA method. After detection, Trypsin was added to the obtained proteins for enzymatic digestion, and the treated samples were then analyzed by DIA mass spectrometry. Finally, based on the quantitative results obtained from mass spectrometry, the expression levels of ABRACL protein were compared among different groups. This study was approved by the Medical Ethics Committee of Zhongnan Hospital, Wuhan University (ethics number 2022173).

[0027] The results showed that, compared with healthy individuals, patients with BPH had significantly higher serum ABRACL expression levels (P<0.001). Figure 1 Furthermore, based on the IPSS score, BPH patients were divided into mild LUTS (IPSS≤7), moderate LUTS (8≤IPSS≤19), and severe LUTS (20≤IPSS≤35). It was found that compared with mild LUTS, the expression levels of ABRACL were significantly increased in moderate and severe LUTS. Figure 2 The above results indicate that ABRACL protein expression is increased in patients with benign prostatic hyperplasia (BPH) and is positively correlated with clinical symptoms. ABRACL may be a target for the detection and treatment of BPH.

[0028] Example 2 Cell Experiment 1. Cell transfection Logarithmic growth phase cells WPMY-1 and RWPE-1 were used at a rate of 2 × 10⁶ cells per well. 5Cells were seeded at a density of 1000 cells / well in 6-well plates and transfected when the cell confluence reached 60%-70%. Sterile EP tubes were used to dilute Lipofectamine 3000 reagent and lentiviral vector shABRACL (experimental group) or shNC (control group) with Opti-MEM serum-depleted medium, respectively. The mixture was incubated at room temperature for 20 minutes to form a complex. The complete medium was removed from the wells, Opti-MEM serum-depleted medium was added, and then the complex was added dropwise. The plate was gently shaken and incubated for 5 hours, then replaced with complete medium for further incubation. Sixty hours after transfection, the interference efficiency of ABRACL at the mRNA and protein levels was detected by qRT-PCR and Western blotting. The human validation RefSeq for ABRACL was NM_021243.3, corresponding to the protein NP_067066.1, and its nucleotide mRNA sequence is shown in SEQ ID NO: 1. Primer and interference sequence information for ABRACL is shown in Tables 3 and 4 below.

[0029] Table 3 Primer sequence information Gene Forward primer (5' – 3') Reverse primer (5' – 3') ABRACL TTTGGGGTCCTCTTCCGTGATG (SEQ ID NO: 2) GAACACCTTGCAGAAGCAGCTC (SEQ ID NO: 3) ACTIN CCTGGCACCCAGCACAAT (SEQ ID NO: 4) GGGCCGGACTCGTCATAC (SEQ ID NO: 5) Table 4 Interference Sequence Information Gene shABRACL#1 shABRACL#2 ABRACL GCATTGGTAGGAACTCTTAAA (SEQ ID NO: 6) TCCTCTTCCGTGATGATAAAT (SEQ ID NO: 7) 2. Cell proliferation The transfected prostate cells were digested with trypsin, centrifuged, and resuspended. After cell counting, an appropriate amount of cell suspension was taken at 3000 cells per well, thoroughly mixed, and seeded into 96-well plates. The plates were then incubated at 37°C for 2 hours. The absorbance at 450 nm was measured using a microplate reader. A growth curve was plotted with absorbance on the ordinate and incubation time on the x-axis over 4 days. Five replicates were used for each group to ensure the reliability of the experimental data.

[0030] 3. Apoptosis detection (1) After transfecting the above prostate cells for 48 hours, cell samples were collected. Annexin V-APC and 7-AAD staining solution were added to the collected cells and gently mixed. The mixture was incubated at room temperature in the dark for 5 minutes, and then analyzed by flow cytometry. To ensure the accuracy and reliability of the experimental results, three replicate samples were set up in this experiment.

[0031] 4. Cellular Experiment Results ABRACL knockdown cell models were constructed by transfecting WPMY-1 prostatic stromal cells and RWPE-1 prostatic epithelial cells with lentiviral vectors shNC and shABRACL. The figure shows that both mRNA and protein levels decreased after ABRACL interference. Figure 3 A). CCK8 assay results showed that knockdown of ABRACL significantly reduced the proliferation of WPMY-1 and RWPE-1 prostate cells (A). Figure 3 B). Representative flow cytometry data of apoptosis revealed significant differences between the two groups, regardless of whether it was early or late apoptosis. Quantitative results also showed that, compared with the control group, knockdown of ABRACL significantly increased the total apoptosis rate of WPMY-1 and RWPE-1 cells. Figure 3 C).

[0032] Example 3 Animal Experiment 1. Constructing an animal model Eight-week-old male SPF-grade SD rats were acclimatized for one week and then divided into groups to establish sham-operated and testosterone propionate-induced benign prostatic hyperplasia (BPH) rat models. In the sham-operated group, a subcutaneous injection of corn oil (5 mg / kg / d) was performed 1 week after an abdominal incision, followed by intraprostatic injection of 5 μL of lentivirus (concentration 4 × 10⁻⁶). 8 The T-BPH group received subcutaneous injections of testosterone propionate (5 mg / kg / d) one week after castration, followed by intraprostatic injection of 5 μL of lentivirus (concentration 4 × 10⁻⁶ TU / mL). The control group received the corresponding lentivirus as a control. 8 The rats were injected with TU / mL, and the control group was injected with the corresponding lentivirus. The incision was then closed layer by layer, and the skin was disinfected with povidone-iodine before suturing. The rats' body weight was monitored during the operation. The rats were euthanized 4 weeks after the operation, and the prostate tissue samples were collected and weighed for subsequent HE and MASSON staining.

[0033] 2. HE staining After a series of treatments including fixation, dehydration, clearing, paraffin infiltration, and embedding, prostate tissue samples were sliced ​​into 4μm thick sections using a microtome and mounted onto glass slides. The slides were then baked in an oven at approximately 60°C for 45 minutes. The slides were then sequentially immersed in xylene I and xylene II for 12 minutes each to completely remove the paraffin. Next, they were immersed in anhydrous ethanol, 95%, 90%, 80%, and 70% ethanol solutions for 5 minutes each, followed by immersion in distilled water for 3 minutes. After staining with hematoxylin for approximately 10 minutes, the slides were rinsed with tap water, and then decolorized in 1% hydrochloric acid ethanol solution, rinsing with tap water to regain the blue color. The slides were then immersed in various ethanol solutions, stained with 0.5% eosin for 3 minutes, and the excess solution was washed away. The slides were then immersed in 95% ethanol to wash away excess red, and then immersed in anhydrous ethanol for 5 minutes. Excess ethanol was blotted with absorbent paper, and the slides were immersed in xylene I and II for 5 minutes each. Finally, the slides were mounted with neutral resin. Finally, an optical microscope was used to take pictures, and ImageJ software was used to calculate the thickness of the prostate epithelium.

[0034] 3. MASSON staining The tissue sample sections, dewaxing, and washing were performed according to the HE staining procedure. Slides were fixed in Bouin's fixative for 2 hours, followed by rinsing with tap water for 10 minutes. Slides were then stained with hematoxylin for 5 minutes to stain the cell nuclei blue, followed by rinsing with tap water to remove excess stain. The sections were then differentiated with 1% hydrochloric acid ethanol for a few seconds, followed by rinsing with tap water for 10 minutes to restore blue color. Slides were then stained with Ponceau S Acid Fuchsin for 5 minutes to stain collagen fibers and muscle fibers to varying degrees of red. Sections were treated with 1% phosphomolybdic acid aqueous solution for 4 minutes to remove unbound Ponceau S Acid Fuchsin stain and to differentiate different tissue components. Slides were then directly stained with aniline blue stain for 8 minutes to stain collagen fibers blue. The sections were then quickly rinsed with 0.2% glacial acetic acid aqueous solution to remove excess aniline blue stain. Subsequent steps were the same as for HE staining. Under a microscope, cell nuclei appear blue-black, collagen fibers appear blue, and muscle fibers and erythrocytes appear red; these different colors clearly distinguish different tissue components. Finally, optical microscope images were taken, and ImageJ software was used to quantitatively analyze the percentage area of ​​collagen fibers and muscle fibers in the Masson stained images.

[0035] 4. Experimental Results We conducted animal experiments by injecting shABRACL lentivirus and the control shNC lentivirus into rat prostate tissue and observing morphological and histopathological changes to explore their effects on rat prostate tissue. We set up four groups of rats: sham-operated interference control group (sham+shNC), sham-operated interference group (sham+shABRACL), testosterone propionate-induced BPH interference control group (T-BPH+shNC), and testosterone propionate-induced BPH interference group (T-BPH+shABRACL). As shown in the figure, compared with the sham+shNC group, the prostate tissue appearance in the sham+shABRACL group was significantly smaller; compared with the T-BPH+shNC group, there was no significant change in the prostate tissue appearance in the T-BPH+shABRACL group. Figure 4 A). Regarding the prostate index, the prostate index of the sham+shABRACL group was significantly lower than that of the sham+shNC group; and the prostate index of the T-BPH+shABRACL group was significantly lower than that of the T-BPH+shNC group. Figure 4 B). There was no significant difference in rat body weight among the four groups, suggesting that knocking down ABRACL does not affect rat body weight. Figure 4 B). The sequence of shABRACL in this experiment is shown in SEQ ID NO: 8.

[0036] HE staining analysis showed that, compared with the sham+shNC group, the epithelial thickness of the sham+shABRACL group was significantly reduced, and compared with the T-BPH+shNC group, the epithelial thickness of the T-BPH+shABRACL group also showed a significant decreasing trend. Figure 4 C). Masson staining showed that, compared with the sham+shNC group, the sham+shABRACL group had significantly reduced collagen fibers and smooth muscle content, and compared with the T-BPH+shNC group, the T-BPH+shABRACL group also had significantly reduced collagen fiber and smooth muscle content. Figure 4 D). The above results indicate that ABRACL knockdown can significantly reduce the prostate index, epithelial thickness, collagen fiber and smooth muscle content in BPH rats, and inhibit prostate hyperplasia.

[0037] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. Application of reagents for detecting ABRACL expression levels in the preparation of diagnostic products for benign prostatic hyperplasia.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the ABRACL is shown in SEQ ID NO:

1.

3. The application according to claim 1, characterized in that, The ABRACL is upregulated in patients with benign prostatic hyperplasia.

4. The application according to claim 1, characterized in that, The reagent is used to assess the severity of benign prostatic hyperplasia by detecting the expression level of ABRACL, wherein the expression level of ABRACL increases with the severity of benign prostatic hyperplasia.

5. The application according to claim 1, characterized in that, The reagent is used to test venous blood or urine samples.

6. The application according to claim 1, characterized in that, The products include formulations or kits.

7. The application according to claim 6, characterized in that, The formulation or kit includes specific primers for ABRACL; the specific primer pair for ABRACL includes an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO:

3.

8. The application according to claim 7, characterized in that, The kit also includes reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescent probe, RNase inhibitor and Taq enzyme.

9. The use of an expression vector containing the sequence shABRACL in the preparation of a pharmaceutical composition for treating benign prostatic hyperplasia, characterized in that, The sequence shABRACL is shown in SEQ ID NO:

8.

10. The application according to claim 9, characterized in that, The pharmaceutical composition also includes pharmaceutically acceptable excipients.

Images