Plant transformation

Abstract

The present invention relates to transfer DNA which can be used to produce genetically modified plants having only DNA from the plant. The invention also relates to genetically modified plants having the transfer DNA of the invention which has been processed during integration and methods of making such plants. Also provided are DNA constructs and methods of making a multi-gene construct comprising five genes which confer enhanced resistance to a plurality of fungal pathogens to a plant.

Description

Technical Field

[0001] This invention relates to transfer DNA, which can be used to produce genetically modified plants having only DNA from the plant. The invention also relates to genetically modified plants having the transfer DNA of the invention and methods for preparing such plants, wherein the transfer DNA has been processed during integration. DNA constructs and methods for preparing multi-gene constructs comprising five genes, which confer enhanced resistance to a variety of fungal pathogens, are also provided. Background Technology

[0002] Agrobacterium tumefaciens ( Agrobacterium tumefacians Agrobacterium is a soil plant pathogen that causes crown gall by introducing a specific transfer DNA molecule (T-DNA) encoded on a Ti (tumor-inducing) plasmid into recipient plant cells. The transferred T-DNA sequence encodes an oncogene that, when expressed in the plant, leads to the growth of vesicular, tumor-like plant cells crucial for disease manifestation. Agrobacterium ( ) Agrobacterium Strains are typically grouped according to the crown gall compounds produced by their plant tumors, which are usually carmine or octopine. These crown galls provide the bacteria with carbon and nitrogen sources and are produced by bacterial genes encoded on the corresponding T-DNA transferred to the plant cells. In both cases, the bacteria use a type IV secretion system consisting of T-pillus and membrane-associated transporter complexes to transfer these T-DNAs. Biotechnology has utilized this natural gene transfer process to introduce selected genes into plant cells by removing oncogenes present in the T-DNA region (disarming the Ti plasmid) and replacing the oncogenes with the gene of interest during vector construction.

[0003] The key to successful T-DNA transfer lies in two 25 bp repeat sequences flanked by Agrobacterium tumefaciens, designated as the right boundary (RB) and left boundary (LB) sequences. These sequences depict the T-DNA region transferred to the plant cell and are present on both octopine-type and carmine-type Ti plasmids, but some sequence variations exist between these boundary repeat sequences. One strand of DNA (in the RB sequence between the third and fourth bases) is cleaved by the enzymes VirD1 and VirD2. Figure 1 The T-DNA transfer is initiated by slicing a single strand of the T-DNA sequence (indicated by a " / "). The left boundary sequence is similarly cut, such that the resulting single-stranded T-DNA encodes 21 bases of the LB repeat sequence and 3 bases of the RB repeat sequence.

[0004] When T-DNA sequences are integrated into the plant genome, boundary sequences are also integrated, resulting in the presence of bacterial DNA in the target plant cells. Although these genomic integrations often include, or sometimes exclude, only a portion of these boundary sequence repetitions (Kim et al., 2003; Zhu et al., 2013; Kleinboelting et al., 2015; Gong et al., 2021), screening plants to identify lines that do not contain sequences derived from Agrobacterium is difficult and expensive.

[0005] Cis-gene and / or intragenic plant engineering seeks to develop plants for improved products while reducing the burden of regulatory barriers. Furthermore, these engineering methods are attractive for developing and introducing novel traits because they are not hindered by the connection resistance problems associated with conventional breeding and can more quickly introduce desired traits into preferred germplasm. For producing cis-gene plants, it is preferable to have modified LB and RB sequences derived from the target plant of interest to eliminate the opportunity for bacterial sequence integration into the target plant.

[0006] There is a need for methods and techniques for producing genetically modified plant polynucleotides via Agrobacterium transformation, wherein the genetically modified plants do not possess any DNA not derived from the species. Summary of the Invention

[0007] Given the evolving regulatory acceptance of cis-transformation events, the inventors have been working to replace bacterial boundary sequences with plant genome sequences in order to develop transgenic plants that do not contain non-endogenous plant DNA sequences.

[0008] On one hand, the present invention provides a transfer DNA (T-DNA) for Agrobacterium-mediated gene transfer (AMGT), wherein the T-DNA comprises a first component and a second component, wherein i) The first component is plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of the left boundary for integration into the genome or has the left boundary, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome, and ii) The second component is within the first component, wherein the second component is a transposable element comprising a polynucleotide encoding an optional marker.

[0009] In one aspect, the present invention provides a plant having plant transfer DNA (PT-DNA) integrated into the genome of the plant, wherein the integrated PT-DNA has only DNA from the plant, and wherein the PT-DNA contains the polynucleotide of interest.

[0010] On the other hand, the present invention provides a wheat plant having wheat transfer DNA (WT-DNA) integrated into the genome of the plant, wherein the integrated WT-DNA has only wheat DNA, and wherein the WT-DNA contains the polynucleotide of interest.

[0011] On the other hand, the present invention provides a soybean plant having soybean transfer DNA (ST-DNA) integrated into the genome of the plant, wherein the integrated ST-DNA has only soybean DNA, and wherein the ST-DNA contains the polynucleotide of interest.

[0012] A plant or a portion thereof having the T-DNA of the present invention is also provided.

[0013] In another aspect, the present invention provides a plant or a portion thereof having plant transfer DNA (PT-DNA) integrated into the genome of the plant or portion thereof, wherein the integrated PT-DNA has only DNA from the plant, and wherein the PT-DNA contains the polynucleotide of interest, and wherein... i) The plant is wheat, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 1310, SEQ ID NO: 797, SEQ ID NO: 798, SEQ ID NO: 799, SEQ ID NO: 800, SEQ ID NO: 801, SEQ ID NO: 802, SEQ ID NO: 803, SEQ ID NO: 804, SEQ ID NO: 805, SEQ ID NO: 806, SEQ ID NO: 807, SEQ ID NO: 808, SEQ ID NO: 809, SEQ ID NO: 810, SEQ ID NO: 811, SEQ ID NO: 1495, SEQ ID NO: 812, SEQ ID NO: 816, SEQ ID NO: 819, SEQ ID NO: 822, SEQ ID NO: 823, SEQ ID NO: 824, SEQ ID NO: 827 ... NO: 345, SEQ ID NO: 832, SEQ ID NO: 836, SEQ ID NO: 839, SEQ ID NO: 842, SEQ ID NO: 845, SEQ ID NO: 850, SEQ ID NO: 853 or SEQ ID NO: 860, or ii) The plant is soybean, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 939, SEQ ID NO: 936, SEQ ID NO: 946, SEQ ID NO: 949, SEQ ID NO: 952, SEQ ID NO: 956, SEQ ID NO: 959, SEQ ID NO: 962, SEQ ID NO: 152, SEQ ID NO: 941, SEQ ID NO: 345, SEQ ID NO: 385, SEQ ID NO: 954, SEQ ID NO: 314 or SEQ ID NO: 303, or iii) The plant is barley, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 251, SEQ ID NO: 249, SEQ ID NO: 255, SEQ ID NO: 257, SEQ ID NO: 259, SEQ ID NO: 261, SEQ ID NO: 263, SEQ ID NO: 265, SEQ ID NO: 267, SEQ ID NO: 269, SEQ ID NO: 271, SEQ ID NO: 273, SEQ ID NO: 275, SEQ ID NO: 277, SEQ ID NO: 279, SEQ ID NO: 281, SEQ ID NO: 285, SEQ ID NO: 287, SEQ ID NO: 289 or SEQ ID NO: 291, or iv) The plant is sugarcane, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 343, SEQ ID NO: 345, SEQ ID NO: 347, SEQ ID NO: 349, SEQ ID NO: 230, SEQ ID NO: 352, SEQ ID NO: 354, SEQ ID NO: 356, SEQ ID NO: 358, SEQ ID NO: 360, SEQ ID NO: 211, SEQ ID NO: 1007, SEQ ID NO: 1008, SEQ ID NO: 365, SEQ ID NO: 367, SEQ ID NO: 369, SEQ ID NO: 371 or SEQ ID NO: 373.

[0014] In another aspect, the present invention provides a tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), wherein the Ti plasmid contains plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of the left boundary for integration into the plant genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the plant genome.

[0015] On the other hand, the present invention provides a tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), wherein the Ti plasmid contains soybean transfer DNA (ST-DNA) for integration into the genome of a soybean plant, wherein the ST-DNA contains the polynucleotide of interest and has only soybean DNA, wherein the 5' end of the ST-DNA contains a portion of the left boundary for integration into the genome, and the 3' end of the ST-DNA contains a portion of the right boundary for integration into the genome.

[0016] In another aspect, the present invention provides a tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), said Ti plasmid comprising the T-DNA or PT-DNA of the present invention.

[0017] In another aspect, the present invention provides plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome.

[0018] In another aspect, the present invention provides wheat transfer DNA (WT-DNA) for integration into the genome of a wheat plant, wherein the WT-DNA contains the polynucleotide of interest and has only wheat DNA, wherein the 5' end of the WT-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the WT-DNA contains a portion of the right boundary for integration into the genome.

[0019] In another aspect, the present invention provides soybean transfer DNA (ST-DNA) for integration into the genome of a soybean plant, wherein the ST-DNA contains the polynucleotide of interest and has only soybean DNA, wherein the 5' end of the ST-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the ST-DNA contains a portion of the right boundary for integration into the genome.

[0020] On the other hand, the present invention provides a plant transfer DNA (PT-DNA) for Agrobacterium-mediated gene transfer (AMGT) integrated into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome, and wherein... i) The PT-DNA is wheat transfer DNA (WT-DNA), and the left boundary of the PT-DNA comprises SEQ ID NO:1340, SEQ ID NO:1450, SEQ ID NO:877, SEQ ID NO:1451, SEQ ID NO:880, SEQ ID NO:1452, SEQ ID NO:882, SEQ ID NO:883, SEQ ID NO:884, SEQ ID NO:885, SEQ ID NO:887, SEQ ID NO:1453, SEQ ID NO:890, SEQ ID NO:1454, SEQ ID NO:893, SEQ ID NO:1455, SEQ ID NO:896, SEQ ID NO:1456, SEQ ID NO:899, SEQ ID NO:1457, SEQ ID NO:902, SEQ ID NO:1458, SEQ ID NO:905, SEQ ID NO:1459, SEQ ID NO: 908, SEQ ID NO: 1460, SEQ ID NO: 911, SEQ ID NO: 1461, SEQ ID NO: 914, SEQ ID NO: 1462, SEQ ID NO: 917, SEQ ID NO: 1463, SEQ ID NO: 874, SEQ ID NO: 1464, SEQ ID NO: 922 or SEQ ID NO:1465, or ii) The PT-DNA is soybean transfer DNA (ST-DNA), and wherein the left boundary comprises SEQ ID NO:977, SEQ ID NO:1466, SEQ ID NO:974, SEQ ID NO:1467, SEQ ID NO:982, SEQ ID NO:1468, SEQ ID NO:985, SEQ ID NO:1469, SEQ ID NO:988, SEQ ID NO:1470, SEQ ID NO:991, SEQ ID NO:1471, SEQ ID NO:994, SEQ ID NO:1472, SEQ ID NO:997 or SEQ ID NO:1473, or iii) The plant is barley, and the left boundary includes SEQ ID NO: 1500, SEQ ID NO: 607, SEQ ID NO: 1474, SEQ ID NO: 612, SEQ ID NO: 1475, SEQ ID NO: 615, SEQ ID NO: 1476, SEQ ID NO: 618, SEQ ID NO: 1477, SEQ ID NO: 621, SEQ ID NO: 1478, SEQ ID NO: 624, SEQ ID NO: 1479, SEQ ID NO: 627, SEQ ID NO: 1480, SEQ ID NO: 630, SEQ ID NO: 1481, SEQ ID NO: 624, SEQ ID NO: 1482, SEQ ID NO: 635, SEQ ID NO: 1483, SEQ ID NO: 638 or SEQ ID NO: 1484, or iv) The plant is sugarcane, and the left boundary includes SEQ ID NO: 683, SEQ ID NO: 1485, SEQ ID NO: 686, SEQ ID NO: 1486, SEQ ID NO: 689, SEQ ID NO: 1487, SEQ ID NO: 692, SEQ ID NO: 1488, SEQ ID NO: 695, SEQ ID NO: 1489, SEQ ID NO: 698, SEQ ID NO: 1490, SEQ ID NO: 1011, SEQ ID NO: 1491, SEQ ID NO: 703, SEQ ID NO: 1492, SEQ ID NO: 706, SEQ ID NO: 1493, SEQ ID NO: 709, or SEQ ID NO: 1494.

[0021] In one embodiment, the WT-DNA left border includes 5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaaga gtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1311), or it contains 5'-tggcaggatatattgtggtgtaaact-3' (SEQ ID NO: 5' segment of 1340).

[0022] In one embodiment, the WT-DNA left border contains 5'-cggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaaga gtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1496), or it contains 5'-cggcaggatatattgtggtgtaaac-3' (SEQ ID NO: 5' segment of 1450).

[0023] In one embodiment, the left boundary of the WT-DNA contains a 5' fragment of 5'-tggtaggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 1497), or a 5' fragment of 5'-tggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 874).

[0024] In one embodiment, the left boundary of the WT-DNA contains a 5' fragment of 5'-cggtaggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 1498), or a fragment of 5'-cggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 1464).

[0025] On the other hand, the present invention provides a polynucleotide that includes the left and / or right boundaries of the present invention.

[0026] On the other hand, the present invention provides a method for producing genetically modified plants, the method comprising incubating plant cells with Agrobacterium (…). Agrobacterium sp.) contact, wherein the Agrobacterium contains the Ti plasmid of the present invention.

[0027] In one embodiment, the cells are cells from an injured plant tissue explant.

[0028] In one embodiment, the explant is cultured to generate callus tissue after contact with the Agrobacterium.

[0029] In one embodiment, the method further includes generating a plant from the callus tissue.

[0030] In one embodiment, the method further comprises screening the plant for the WT-DNA, ST-DNA, or PT-DNA of the present invention.

[0031] In one embodiment, the method further includes screening the plant's WT-DNA, ST-DNA, or PT-DNA in the plant's germline cells.

[0032] In one embodiment, the method further comprises producing progeny plants from the germline cells of the plant having the WT-DNA, the ST-DNA, and the PT-DNA.

[0033] In another aspect, the present invention provides a plant produced by the method of the present invention, or a plant having the WT-DNA, ST-DNA, or PT-DNA of the present invention.

[0034] On the other hand, the present invention provides a method for producing genetically modified plants, the method comprising the following steps: i) Hybridizing two parent plants, wherein at least one of the parent plants is a plant of the present invention. ii) Screening one or more progeny plants from the hybridization described in i) for the presence or absence of the WT-DNA, ST-DNA, or PT-DNA of the present invention, and iii) Select progeny plants containing the WT-DNA, ST-DNA, or PT-DNA of the present invention. This results in the plant.

[0035] In another aspect, the present invention provides a method for producing genetically modified plants, the method comprising the following steps: i) Hybridizing two parent plants, wherein at least one of the parent plants is a plant of the present invention. ii) Screening for the presence or absence of integrated PT-DNA in one or more progeny plants from the hybridization described in i), and iii) Select progeny plants containing the integrated PT-DNA. This results in the plant.

[0036] In one embodiment, one parent plant is a plant having the T-DNA of the present invention, and the other parent plant is a transgenic plant expressing transposase, and step ii) comprises screening the one or more progeny plants from the hybrid for the presence or absence of the second component, and step iii) comprises selecting progeny plants lacking the second component.

[0037] In one embodiment, step ii) comprises analyzing the WT-DNA, ST-DNA, or PT-DNA of a sample containing DNA from the plant.

[0038] In one embodiment, step iii) includes selecting progeny plants that are homozygous for the WT-DNA, the ST-DNA, or the PT-DNA.

[0039] In one embodiment, the method further includes: iv) Backcross the progeny of the hybridization in step i) with a plant lacking the WT-DNA or the ST-DNA and having the same genotype as the first parent plant a sufficient number of times to produce a plant with most of the genotypes of the first parent but containing the WT-DNA or the ST-DNA, and v) Select progeny plants that have the WT-DNA or the ST-DNA.

[0040] A plant produced using the method of the present invention is also provided.

[0041] On the other hand, the present invention provides a method for identifying the plant of the present invention, the method comprising: i) Obtain samples from plants containing genomic DNA. ii) Screen the sample for the presence or absence of the WT-DNA, ST-DNA, or PT-DNA of the present invention.

[0042] On the other hand, the present invention provides a method for identifying the plant of the present invention, the method comprising: i) Obtain samples from plants containing genomic DNA. ii) Screen the sample for the presence or absence of integrated PT-DNA.

[0043] In one embodiment, the plant is a plant having the T-DNA of the present invention, and the method further comprises screening the sample for the absence of the second component.

[0044] In one embodiment, the plant is a wheat plant, and step ii) includes analyzing the presence of the WT-DNA in the DNA.

[0045] In one embodiment, the plant is a barley plant, and step ii) includes analyzing the presence of barley PT-DNA in the DNA.

[0046] In one embodiment, the plant is a sugarcane plant, and step ii) includes analyzing the DNA for the presence of sugarcane PT-DNA.

[0047] In one embodiment, the plant is a soybean plant, and step ii) includes analyzing the presence of the ST-DNA in the DNA.

[0048] In one embodiment, step ii) comprises using a polymerase chain reaction to amplify a genomic region containing the WT-DNA or the ST-DNA.

[0049] In one embodiment, amplification is achieved using oligonucleotide primers comprising a sequence of nucleotides provided as in any of SEQ ID NO: 1 to 12, or variants thereof that can be used to amplify the same region of the genome.

[0050] In one embodiment, amplification is achieved using oligonucleotide primers comprising a sequence of nucleotides provided as in any of SEQ ID NO: 1031 to 1044, or variants thereof that can be used to amplify the same region of the genome.

[0051] In one embodiment, step ii) includes sequencing the amplicon generated from genomic DNA.

[0052] In another aspect, the present invention provides a method for generating the left boundary of T-DNA for Agrobacterium-mediated gene transfer (AMGT), the method comprising: i) Search the genome of the plant species of interest for polynucleotides of 22 to 25 bases in length that share at least 16 nucleotides with the left boundary of the Agrobacterium Ti plasmid, among which... a) If the polynucleotide is 22 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 22 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. b) If the polynucleotide is 23 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 23 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. c) If the polynucleotide is 24 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 24 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. ii) Generate T-DNA with a left boundary sequence, wherein a) The left boundary of the T-DNA contains the polynucleotide, wherein the polynucleotide is 25 bases in length, or b) If the polynucleotide does not have 5'-tgg or 5'-cgg and / or is not 25 bases in length, the polynucleotide is modified to have a length of 25 bases and have 5'-tgg or 5'-cgg to produce the left boundary sequence, and iii) Use AMGT to determine whether the T-DNA can be used to transform the plant species of interest.

[0053] In one embodiment, if the plant is transformed, it is determined whether the portion of the left boundary integrated into the plant's genome lacks 5'-tgg or 5'-cgg.

[0054] In another aspect, the present invention provides a method for generating the left boundary of T-DNA for Agrobacterium-mediated gene transfer (AMGT), the method comprising: i) Search the genome of the plant species of interest for polynucleotides of 22 to 25 bases in length that share at least 16 nucleotides with the left boundary of the Agrobacterium Ti plasmid, among which... a) If the polynucleotide is 22 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 22 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. b) If the polynucleotide is 23 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 23 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. c) If the polynucleotide is 24 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 24 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. ii) Generate T-DNA with a left boundary sequence, wherein if the polynucleotide does not have 5'-tggcagga or 5'-cggcagga and / or is not 25 bases in length, the polynucleotide is modified such that it is 25 bases in length and has 5'-tggcagga or 5'-cggcagga to generate the left boundary, and iii) Use AMGT to determine whether the T-DNA can be used to transform the plant species of interest.

[0055] In one embodiment, if the plant is transformed, it is determined whether the portion of the left boundary integrated into the plant's genome lacks 5'-tggcagga or 5'-cggcagga.

[0056] In one embodiment, step i) includes searching for polynucleotides of 22 to 25 bases in length in the genome of the plant species of interest that share 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides with the left boundary of the Agrobacterium Ti plasmid.

[0057] In one embodiment, step i) includes searching for a polynucleotide of length 22 bases in the genome of the plant species of interest that shares at least 16 nucleotides with 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid.

[0058] In one embodiment, the 22 3' nucleotides on the left border of the Agrobacterium Ti plasmid are 5'-CAGGATATATTGTGGTGTAAAC-3' SEQ ID NO: 769.

[0059] In one embodiment, the 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid are 5'-CAGGATATATTGAATTGTAAAT-3' SEQ ID NO: 765.

[0060] In one embodiment, the 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid are 5'-CAGGATATATTCAATTGTAAAC-3' SEQ ID NO: 766.

[0061] In one embodiment, the 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid are 5'-CAGGATATATTTAGTTGTAAAA-3' SEQ ID NO: 767.

[0062] In one embodiment, the 22 3' nucleotides on the left border of the Agrobacterium Ti plasmid are 5'-CAGGATATATTGTGATGTAAAC-3' SEQ ID NO: 768.

[0063] In one embodiment, the 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid are 5'-CAGGATATATCAAAGTGTAAGT-3' SEQ ID NO: 770.

[0064] In one embodiment, the 22 3' nucleotides on the left border of the Agrobacterium Ti plasmid are 5'-CAGGATATATCGAGGTGTAAAA-3' SEQ ID NO: 771.

[0065] In one embodiment, the 22 3' nucleotides on the left boundary of the Agrobacterium Ti plasmid are 5'-CAGGATGTATTGTCATGTAAAA-3' SEQ ID NO: 772.

[0066] In one embodiment, the 22 3' nucleotides on the left border of the Agrobacterium Ti plasmid are 5'-CAGGATATATCGTTATGTAATC-3' SEQ ID NO: 773.

[0067] In one embodiment, the 22 3' nucleotides on the left border of the Agrobacterium Ti plasmid are 5'-CAGGATATATTGGTGTGTAAAC-3' SEQ ID NO: 774.

[0068] In one embodiment, the Ti plasmid used in step iii) is the Ti plasmid of the present invention.

[0069] In one embodiment, step iv) includes determining whether the T-DNA integrated into the plant's genome contains only DNA from the plant genus. In one embodiment, the genus is wheat.

[0070] In one embodiment, step iv) includes determining whether the T-DNA integrated into the plant's genome contains only DNA from the plant species.

[0071] In one embodiment, the plant is a cereal plant.

[0072] In one embodiment, the plant is wheat, soybean, rice, tomato, sugarcane, potato, banana, sorghum, grape, or oat.

[0073] A plant produced by the method of the present invention is also provided.

[0074] A DNA construct is also needed that can be used to enhance plant resistance to one or more fungal pathogens and is less likely to allow pathogens to evade resistance. While many proteins have been identified that confer enhanced resistance to one or more fungal pathogens, the resistance of many of these proteins is overcome when deployed as single genes. The inventors have identified a novel combination of fungal resistance genes that provides a stable construct that can be used to confer broad-spectrum fungal resistance and reduce the chances of pathogens developing resistance due to the polygenic nature of plant resistance.

[0075] Therefore, in another aspect, the present invention provides a DNA construct comprising encoding the following genes: i) A first polypeptide comprising an amino acid sequence as provided in SEQ ID NO: 13 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 13. ii) A second polypeptide comprising the amino acid sequence provided in SEQ ID NO: 14 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 14. iii) A third polypeptide comprising an amino acid sequence as provided in SEQ ID NO: 15 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 15. iv) A fourth polypeptide comprising an amino acid sequence as provided in SEQ ID NO: 16 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 16. v) A fifth polypeptide, said fifth polypeptide comprising an amino acid sequence as provided in SEQ ID NO: 17 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 17. Each gene contains a promoter that directs gene expression in plant cells, and each polypeptide confers enhanced resistance to one or more fungal pathogens.

[0076] In one embodiment, the cells are stem cells and / or leaf cells.

[0077] In one embodiment, the first polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 13, or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 13.

[0078] In one embodiment, the second polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 14, or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 14.

[0079] In one embodiment, the third polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 15 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 15.

[0080] In one embodiment, the fourth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 16 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 16.

[0081] In one embodiment, the fifth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 17 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 17.

[0082] In one embodiment, the first polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 13, or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 13.

[0083] In one embodiment, the second polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 14, or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 14.

[0084] In one embodiment, the third polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 15 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 15.

[0085] In one embodiment, the fourth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 16 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 16.

[0086] In one embodiment, the fifth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 17 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 17.

[0087] In one embodiment, the first polypeptide comprises the amino acid sequence provided in SEQ ID NO: 13.

[0088] In one embodiment, the second polypeptide comprises the amino acid sequence provided in SEQ ID NO: 14.

[0089] In one embodiment, the third polypeptide comprises the amino acid sequence provided in SEQ ID NO: 15.

[0090] In one embodiment, the fourth polypeptide comprises the amino acid sequence provided in SEQ ID NO: 16.

[0091] In one embodiment, the fifth polypeptide comprises the amino acid sequence provided in SEQ ID NO: 17.

[0092] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 19, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 19.

[0093] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 21, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 21.

[0094] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 23, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 23.

[0095] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 25 or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 25.

[0096] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 27, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 27.

[0097] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 19, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 19.

[0098] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 21, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 21.

[0099] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 23, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 23.

[0100] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 25 or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 25.

[0101] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 27, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 27.

[0102] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 19, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 19.

[0103] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 21, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 21.

[0104] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 23, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 23.

[0105] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 25 or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 25.

[0106] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 27, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 27.

[0107] In one embodiment, the gene encoding the first polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 18 or SEQ ID NO: 19.

[0108] In one embodiment, the gene encoding the second polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 20 or SEQ ID NO: 21.

[0109] In one embodiment, the gene encoding the third polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 22 or SEQ ID NO: 23.

[0110] In one embodiment, the gene encoding the fourth polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 24 or SEQ ID NO: 25.

[0111] In one embodiment, the gene encoding the fifth polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 26 or SEQ ID NO: 27.

[0112] In one embodiment, the DNA construct comprises a nucleotide sequence as provided in SEQ ID NO: 28, or a nucleotide sequence that is at least 80%, at least 90%, or at least 95% identical to SEQ ID NO: 28.

[0113] In one embodiment, each polypeptide is effective against *Stripe rust* (…). Puccinia sp.) confers resistance, such as stalk rust ( Puccinia graminis One or more of the following fungi: stem rust, stripe rust (Puccinia striiformis), and leaf rust (Puccinia triticina).

[0114] In another aspect, the present invention provides a DNA construct comprising genes encoding the following: i) A first polypeptide comprising the amino acid sequence provided in SEQ ID NO: 1271 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 1271. ii) A second polypeptide comprising the amino acid sequence provided in SEQ ID NO: 1272, or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 1272. iii) A third polypeptide comprising the amino acid sequence provided in SEQ ID NO: 1273 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 1273. iv) A fourth polypeptide comprising the amino acid sequence provided in SEQ ID NO: 1274 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 1274. v) A fifth polypeptide, said fifth polypeptide comprising the amino acid sequence provided in SEQ ID NO: 1275 or an amino acid sequence that is at least 85% identical to that in SEQ ID NO: 1275. Each gene contains a promoter that directs gene expression in plant cells, and each polypeptide confers enhanced resistance to one or more fungal pathogens.

[0115] In one embodiment, the cells are stem cells and / or leaf cells.

[0116] In one embodiment, the first polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1271, or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 1271.

[0117] In one embodiment, the second polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1272, or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 1272.

[0118] In one embodiment, the third polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1273 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 1273.

[0119] In one embodiment, the fourth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1274 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 1274.

[0120] In one embodiment, the fifth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1275 or an amino acid sequence that is at least 90% identical to that in SEQ ID NO: 1275.

[0121] In one embodiment, the first polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1271, or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 1271.

[0122] In one embodiment, the second polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1272, or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 1272.

[0123] In one embodiment, the third polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1273 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 1273.

[0124] In one embodiment, the fourth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1274 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 1274.

[0125] In one embodiment, the fifth polypeptide comprises an amino acid sequence as provided in SEQ ID NO: 1275 or an amino acid sequence that is at least 95% identical to that in SEQ ID NO: 1275.

[0126] In one embodiment, the first polypeptide comprises the amino acid sequence provided in SEQ ID NO: 1271.

[0127] In one embodiment, the second polypeptide comprises the amino acid sequence provided as SEQ ID NO: 1272.

[0128] In one embodiment, the third polypeptide comprises the amino acid sequence provided in SEQ ID NO: 1273.

[0129] In one embodiment, the fourth polypeptide comprises the amino acid sequence provided in SEQ ID NO: 1274.

[0130] In one embodiment, the fifth polypeptide comprises the amino acid sequence provided in SEQ ID NO: 1275.

[0131] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1276, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 1276.

[0132] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1277, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 1277.

[0133] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1278, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 1278.

[0134] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1279 or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 1279.

[0135] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1280, or a nucleotide sequence that is at least 80% identical to that in SEQ ID NO: 1280.

[0136] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1276, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 1276.

[0137] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1277, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 1277.

[0138] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1278, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 1278.

[0139] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1279 or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 1279.

[0140] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1280, or a nucleotide sequence that is at least 90% identical to that in SEQ ID NO: 1280.

[0141] In one embodiment, the polynucleotide encoding the first polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1276, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 1276.

[0142] In one embodiment, the polynucleotide encoding the second polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1277, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 1277.

[0143] In one embodiment, the polynucleotide encoding the third polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1278, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 1278.

[0144] In one embodiment, the polynucleotide encoding the fourth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1279 or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 1279.

[0145] In one embodiment, the polynucleotide encoding the fifth polypeptide encodes a nucleotide sequence as provided in SEQ ID NO: 1280, or a nucleotide sequence that is at least 95% identical to that in SEQ ID NO: 1280.

[0146] In one embodiment, the gene encoding the first polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 1502 or SEQ ID NO: 1276.

[0147] In one embodiment, the gene encoding the second polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 1503 or SEQ ID NO: 1277.

[0148] In one embodiment, the gene encoding the third polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 1504 or SEQ ID NO: 1278.

[0149] In one embodiment, the gene encoding the fourth polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 1505 or SEQ ID NO: 1279.

[0150] In one embodiment, the gene encoding the fifth polypeptide comprises a nucleotide sequence as provided in SEQ ID NO: 1506 or SEQ ID NO: 1280.

[0151] In one embodiment, the DNA construct comprises a nucleotide sequence as provided in SEQ ID NO: 1448, or a nucleotide sequence that is at least 80%, at least 90%, or at least 95% identical to SEQ ID NO: 1448.

[0152] In one embodiment, one or more of the polypeptides confers resistance to *Stripe rust*. In another embodiment, one or more of the polypeptides confers resistance to *Stripe rust* (wheat stripe rust).

[0153] In another aspect, the present invention provides a T-DNA comprising the DNA construct of the present invention.

[0154] In one embodiment, the T-DNA is the WT-DNA of the present invention, the ST-DNA of the present invention, or the PT-DNA of the present invention.

[0155] In another aspect, the present invention provides a chimeric vector comprising the DNA construct of the present invention. In yet another aspect, the present invention provides a T-DNA comprising the DNA construct of the present invention.

[0156] In one embodiment, the carrier is the Ti plasmid of the present invention.

[0157] In another aspect, the present invention provides a recombinant cell comprising the DNA construct of the present invention, the T-DNA of the present invention, or the vector of the present invention. In one embodiment, the recombinant cell is a bacterial cell.

[0158] In one embodiment, the recombinant cells are Agrobacterium species containing the Ti plasmid of the present invention.

[0159] In another aspect, the present invention provides a method for producing the cells of the present invention, the method comprising the step of introducing the DNA construct of the present invention, the T-DNA of the present invention, or the vector of the present invention into the cells.

[0160] On the other hand, the present invention provides a method for Agrobacterium-mediated transformation of plant cells by inserting DNA into the cells, the method comprising: i) Under conditions that allow Agrobacterium bacteria containing the Ti plasmid of the present invention to infect plant cells, the plant cells are brought into contact with the Agrobacterium bacteria, thereby transforming the plant cells. ii) Selecting and screening transformed plant cells; and iii) Regeneration of fully transgenic plants from selected and screened plant cells.

[0161] In another aspect, the present invention provides a method for generating a first polypeptide, a second polypeptide, a third polypeptide, a fourth polypeptide, and a fifth polypeptide as defined herein, the method comprising expressing a gene in a DNA construct, a T-DNA of the present invention, or a vector of the present invention in a cellular or cell-free expression system.

[0162] In another aspect, the present invention provides a genetically modified plant comprising the DNA construct of the present invention.

[0163] In one embodiment, the plant exhibits enhanced resistance to one or more fungal pathogens compared to a corresponding wild-type plant lacking a DNA construct.

[0164] In one embodiment, the one or more fungal pathogens include one or more or all of the following: *Pseudomonas stolonifera*, *Pseudomonas bryonicum*, etc. Blumeria sp.), Fusarium ( Fusarium sp.), rice blast fungus ( Magnoporthe sp.), Helicobacter prystolonifer ( Bipolaris sp.), powdery fungus ( Oidium sp.), Fusarium (sp.), Gibberellinia ( Gibberella sp.), Cyclospora ( Cochliobolus sp.), Helicobacter pylori ( Exserohilum sp.), Ursporium ( Uredo sp.), Micrococcus ( Microdochium sp.), Hemyophytes (sp.), long-lived fungi ( Helminthosporium sp.), Clostridium mingiensis ( Monographella sp.), anthrax bacteria (sp.), anthrax bacteria Colletotrichum sp.), unicellular rust ( Uromyces sp.) or powdery mildew ( Erysiphe sp.).

[0165] In one embodiment, the plant exhibits enhanced resistance to one or more of stem rust, leaf rust, or stripe rust compared to a corresponding wild-type plant lacking the DNA construct.

[0166] In one embodiment, the plant exhibits enhanced resistance to stem rust compared to the corresponding wild-type plant lacking the DNA construct.

[0167] In one embodiment, the plant is a cereal plant. Examples of cereal plants in this invention include, but are not limited to, wheat, oats, rye, barley, rice, corn, sorghum, or maize. In one embodiment, the plant is a wheat plant.

[0168] In one embodiment, the plant is a soybean or banana plant.

[0169] In one embodiment, the plant is homozygous for the DNA construct.

[0170] In one embodiment, the plant contains only the DNA found in plants of the same species (such as wheat).

[0171] In one embodiment, the plant contains only the DNA found in plants of the same species.

[0172] In another aspect, the present invention provides a method for producing a plant having the DNA construct of the present invention, the method comprising the following steps: i) Introducing the DNA construct of the present invention into plant cells. ii) Regenerating plants using the DNA construct from the cells, and iii) Optionally collect seeds from said plant, and / or iv) Optionally produce one or more progeny plants, This results in the plant.

[0173] In one embodiment, the DNA construct is contained in the T-DNA of a tumor-inducing (Ti) plasmid and introduced using Agrobacterium-mediated gene transfer (AMGT).

[0174] In another aspect, the present invention provides a method for producing a plant having the DNA construct of the present invention, the method comprising the following steps: i) Hybridizing two parent plants, wherein at least one plant contains the DNA construct of the present invention. ii) Screening one or more progeny plants from the hybridization in i) for the presence or absence of the DNA construct, and iii) Select progeny plants containing the DNA construct. This results in the plant.

[0175] In one embodiment, step ii) comprises analyzing the DNA construct of a sample containing DNA from a plant.

[0176] In one embodiment, step iii) includes: i) Select progeny plants that are homozygous for the DNA construct, and / or ii) Analyze the enhanced resistance of the plant or one or more of its progeny plants to one or more fungal pathogens.

[0177] In one embodiment, the method further includes: iv) Backcross the progeny of the hybridization in step i) with plants lacking the DNA construct and having the same genotype as the first parent plant a sufficient number of times to produce plants with most of the genotypes of the first parent but containing the DNA construct, and v) Select offspring plants that exhibit enhanced resistance to one or more fungal pathogens.

[0178] Plants produced using the method of the present invention are also provided.

[0179] In another aspect, the present invention provides a method for identifying plants with enhanced resistance to one or more fungal pathogens, the method comprising the steps of: i) Obtaining samples from plants, and ii) Screen the sample to determine whether the DNA construct of the present invention is present or not.

[0180] In one embodiment, the screening involves amplifying the genomic region of the plant.

[0181] The invention also provides the use of the Ti plasmid, the WT-DNA, the ST-DNA, the PT-DNA, the polynucleotide, or the DNA construct of the invention for producing recombinant cells and / or genetically modified plants.

[0182] In one embodiment, the plant of the present invention is grown in the field.

[0183] In another aspect, the present invention provides a population of at least 100 plants of the present invention grown in the field.

[0184] In another aspect, the present invention provides the plant portion of the plant of the present invention.

[0185] In one embodiment, the plant portion is a seed comprising the WT-DNA of the present invention, the ST-DNA of the present invention, the PT-DNA of the present invention, the T-DNA as described herein, or a DNA construct of the present invention.

[0186] In another aspect, the present invention provides a method for producing plant parts, the method comprising: a) To cause the plant of the present invention to grow, and b) Collect the plant parts.

[0187] In one embodiment, the plant part is a seed.

[0188] In another aspect, the present invention provides a method for producing flour, whole wheat flour, starch, seed flour, oil, or other products obtained from seeds, the method comprising: a) Obtaining the seed of this invention, and b) Extract the flour, the whole wheat flour, the starch, the seed flour, the oil, or the other product.

[0189] In one embodiment, the other product is rice bran.

[0190] In another aspect, the present invention provides a product derived from the plant of the present invention and / or plant parts of the present invention, wherein the product comprises a DNA construct, integrated T-DNA or integrated PT-DNA, such as integrated WT-DNA.

[0191] In one embodiment, the portion is a seed.

[0192] In one embodiment, the product is a food or beverage product.

[0193] In one embodiment, the food is selected from the group consisting of: flour, starch, fermented or unfermented bread, pasta, noodles, animal feed, animal feed, breakfast cereals, snack foods, cakes, malt, pastries, and foods containing flour-based sauces.

[0194] In one embodiment, the beverage product is beer, plant-based milk, or malt.

[0195] In one embodiment, the product is a non-food product.

[0196] In another aspect, the present invention provides a method for preparing the food of the present invention, the method comprising mixing seeds or flour, whole wheat flour, starch, seed flour or oil obtained from said seeds with another food ingredient.

[0197] In another aspect, the present invention provides a method for preparing malt, the method comprising the step of germinating the seeds of the present invention.

[0198] In another aspect, the present invention provides the use of the plant or a portion thereof as animal feed or for producing feed for animals or food for human consumption.

[0199] In another aspect, the present invention provides the use of the plant of the present invention for controlling or limiting one or more fungal pathogens in crop production.

[0200] In another aspect, the present invention provides a composition comprising the Ti plasmid of the present invention, the WT-DNA of the present invention, the ST-DNA of the present invention, the PT-DNA of the present invention, the polynucleotide of the present invention or the DNA construct of the present invention, and one or more acceptable carriers.

[0201] In another aspect, the present invention provides a method for trading seeds, the method comprising obtaining the seeds of the present invention and trading the obtained seeds for monetary gain.

[0202] In one embodiment, obtaining seeds involves cultivating the plant of the present invention and / or collecting seeds from the plant.

[0203] In one embodiment, obtaining the seed further includes placing the seed in a container and / or storing the seed.

[0204] In one embodiment, obtaining the seeds further includes transporting the seeds to different locations.

[0205] In one embodiment, the transaction is performed using an electronic device such as a computer.

[0206] In another aspect, the present invention provides a method for generating a seed box, the method comprising: a) Bundling, stacking, and / or harvesting the above-ground parts of the plant containing the seeds of the present invention. b) Threshing and / or winnowing the said portion of the plant to separate the seeds from the rest of the plant portion, and c) Screening and / or sorting the seeds separated in step b) and loading the screened and / or sorted seeds into a box, thereby producing a seed box.

[0207] Unless otherwise specified, any embodiments described herein should be considered applicable to any other embodiments after necessary modifications.

[0208] The scope of this invention is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions, and methods as described herein are clearly within the scope of this invention.

[0209] Throughout this specification, unless expressly stated otherwise or the context otherwise requires, references to a single step, a composition of substance, a group of steps, or a group of compositions of substance shall be deemed to cover one or more (i.e., one or more) of such steps, compositions of substance, groups of steps, or groups of compositions of substance.

[0210] The invention is described below by way of the following non-limiting examples and with reference to the accompanying drawings. Attached Figure Description

[0211] Figure 1 - Examples of Agrobacterium T-DNA and its integration into plant genomes.

[0212] Figure 2 - An example of Agrobacterium T-DNA (from Holsters et al., 1983).

[0213] Figure 3 - Alignment of RB sequences from 6 binary vectors. The 24 bp RB repeat sequence is highlighted. The 5' nucleotide of the RB sequence is highlighted and is conserved in five of the 6 plasmids. Arrows indicate virD cleavage sites.

[0214] Figure 4 - Wheat genome sequences used as LB and RB substitutes in plasmid pM0. The upper LB sequence substitution corresponds to nucleotides 631979550-631979773 of wheat chromosome 7D (IWGSC Chinese Spring v.2.1), while the lower RB substitution corresponds to nucleotides 553784436-553784630 of wheat chromosome 5D (IWGSC Chinese Spring genome v2.1). The underlined sequences are identical to Agrobacterium LB and RB sequences. Bases in the yellow box are not derived from wheat, i.e., synthetic plasmid sequences. Arrows indicate the location of the virD cleavage site and indicate sequences not transferred as part of T-DNA. The boxed sequence is a wheat sequence (excluding nucleotide TGA) that is identical to the binary vector plasmid sequence immediately adjacent to RB.

[0215] Figure 5 - RUBY is depicted at the top of a plasmid in a Tobacco Benedictine leaf ( N. benthamiana Transient Agrobacterium expression in ). The first small figure shows a leaf 2 days after immersion, while the lower small figure shows a leaf 5 days after immersion.

[0216] Figure 6 - Transient Agrobacterium spp. infiltration assay was used to analyze the cleavage of the wheat substitute LB. At the bottom, Agrobacterium spp. strains containing constructs 1-4 (above) are shown infiltrating sites 1-4 on a Tobacco Benedict leaf. The leaf on the right is identical to the leaf shown on the left after clarification in ethanol.

[0217] Figure 7- Wheat transformed with pM0. A) Betaine accumulation at cell clusters in cultured wheat scutellar explant tissue transformed with pM0. B) Frequency map of betaine accumulation in Fielder callus after transformation with pM0 or pUbi-RUBY / BAR. C) Regeneration of transgenic wheat shoots transformed with pM0 without selection. D) Red transgenic wheat plant transformed with pM0 (left) and control Fielder wheat plant shown on the right.

[0218] Figure 8 - PCR analysis of the cleavage of wheat LB boundary repeat substitution sequences in pM0. DNA was extracted from three wild-type Fielder calluses (w) and five calluses transformed with pM0 and showing evidence of betaine accumulation (b). The approximate location of the PCR amplification products is shown on the right side of a schematic diagram of the pM0 vector plot. The pM0 vector was used as a positive control (+).

[0219] Figure 9 - PCR analysis of the cleavage of the wheat RB boundary repeat substitution sequence in pM0. DNA was extracted from three wild-type Fielder calluses (w) and five calluses transformed with pM0 and showing evidence of betaine accumulation (b). The approximate location of the PCR amplification products is shown on the right side of a schematic diagram of the pM0 vector plot. Black lines indicate untransferred binary sequences, while blue lines indicate T-DNA sequences. The pM0 vector was used as a positive control (+).

[0220] Figure 10 - Binary constructs for co-transformation of the wheat cultivar Fielder. Each construct encoding RUBY was independently co-transformed with the wheat Sr gene stack shown below. Note that the constructs are not drawn to scale, and the wheat Sr stack construct is significantly larger, approximately 40 kb in size.

[0221] Figure 11 - The wheat chromosome 5A (IWGS Chinese Spring 2.1 version) sequence 669141979-669142155 (blue text) used in construct pM2. The underlined sequence at the 5' end shows similarity to the Agrobacterium carmine LB repeat sequence (black sequence) shown above. Nucleotide differences are shown in red.

[0222] Figure 12 - PCR results of junction sites of wheat Sr stacked constructs in transgenic plants produced by co-transformation. The figures show the number of independent transgenes that were positive for each of the indicated primer pairs in these three co-transformations.

[0223] Figure 13 - Used to replace binary carriers pCSIRO / RUBY The Agrobacterium LB and RB sequences present in the sample (see [link to sample]). Figure 5 Soybean sequences. Soybean sequences identical to those of Agrobacterium LB or RB are highlighted. True Agrobacterium LB and RB sequences are shown in purple above and below the soybean sequences, respectively.

[0224] Figure 14 - The binary vector sequence generated using soybean LB and RB substitution sequences is shown at the top. This was achieved using an Agrobacterium strain containing the indicated construct. AGL1 The culture is infused with the tobacco leaf shown below (left). The same leaf is shown on the right after clarification in 100% ethanol.

[0225] Figure 15 - A map of the pM1-5Yr-PiggyBac-35SBar wheat T-DNA sequence.

[0226] Figure 16 - The structure of T-DNA insertion after the excision of PiggyBac.

[0227] Figure 17 HyPbase in pDONOR1.

[0228] Figure 18 - This demonstrates that the 745 bp PCR product of PiggyBac-35SBAR has been excised.

[0229] Figure 19 - The barley LB sequence used in Example 11. Chromosomal 6H nucleotide sequences 500797397-500797357 are used in construct pMB1. Chromosomal 1H nucleotide sequences 151772483-151772512 are used in construct pMB2. The underlined sequence at the 5' end indicates similarity to the Agrobacterium tumefaciens carmine LB repeat sequence (black sequence) shown above.

[0230] Figure 20 - The barley chromosome 5H nucleotide sequence 50835791-508357886 is used as a substitute for the RB sequence in both constructs pMB1 and pMB2. The underlined sequence at the 3' end shows the similarity to the 5' sequence of the Agrobacterium tumefaciens carmine RB repeat sequence. The carmine RB repeat sequence is marked above in curly braces. The bases are not derived from barley and are boundary sequences of synthesis that are not transferred as part of T-DNA. The location of the virD cleavage site is indicated by a red arrow, indicating the sequence that was not transferred as part of T-DNA. The underlined bases on the barley chr 5H sequence are identical to the binary vector plasmid sequence immediately adjacent to RB, but the nucleotide TGA is part of the RB sequence.

[0231] Figure 21 - The structure of the plant T-DNA region in the binary plasmid pMX (top) and the control standard binary vector pAM, the latter encoding the wild-type Agrobacterium LB and RB sequences, the 35S-YFP gene, and the glufosinate acetyltransferase selectable marker gene under the regulation and control of the Agrobacterium spp. carmine synthase promoter.

[0232] Figure 22 - On the left are tobacco leaves soaked for 5 days with Agrobacterium strain AGL1 carrying any of the following vectors: (1) pM / 35S-YFP, (2) pMB1, or (3) pMB2. On the right are the same leaves clarified in ethanol to further highlight the production of beet pigments.

[0233] Symbol explanation of sequence lists Detailed Implementation

[0234] General techniques and selected definitions Unless otherwise specified, all technical and scientific terms used herein should be regarded as having the same meaning as commonly understood by a person skilled in the art (e.g., in cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).

[0235] Unless otherwise stated, the recombinant proteins, cell culture, and immunological techniques used in this invention are standard procedures well known to those skilled in the art. Such techniques are described and explained in the following sources: J. Perbal, *A Practical Guide to Molecular Cloning*, John Wiley and Sons (1984); J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratory Press (1989); TA Brown (ed.), *Essential Molecular Biology: A Practical Approach*, Volumes 1 & 2, IRL Press (1991); DM Glover and BD Hames (ed.), *DNA Cloning: A Practical Approach*, Volumes 1–4, IRL Press (1995 and 1996); and FMAusubel et al. (ed.), *Current Protocols in Molecular Biology*. Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date); Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory (1988); and JE Coligan et al. (eds.), Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0236] The term “and / or”, such as “X and / or Y”, should be understood to mean “X and Y” or “X or Y”, and should be regarded as providing explicit support for both meanings or either meaning.

[0237] As used herein, unless otherwise stated, the term “about” means + / - 5% of the specified value, or more preferably + / - 1%.

[0238] Transfer of nucleic acid Transfer nucleic acids can be used to deliver exogenous polynucleotides into cells and comprise one, preferably two, boundary sequences and the polynucleotide of interest. The transfer nucleic acid may or may not encode an optional marker. Preferably, the transfer nucleic acid forms part of a binary vector in bacteria, wherein the binary vector further comprises elements that allow the vector to replicate, select, or maintain bacterial cells containing the binary vector. Upon transfer to eukaryotic cells, preferably plant cells, the transfer nucleic acid component of the binary vector can integrate into the genome of the eukaryotic cell.

[0239] As used herein, the term "transfer nucleic acid" or T-DNA refers to a nucleic acid molecule capable of being transferred from bacteria (such as Agrobacterium) to eukaryotic cells (such as plant cells). T-DNA is a genetic element, known as a transferable element, which subsequently integrates the nucleotide sequence contained within its boundaries into the genome of the recipient cell. In this respect, the transfer nucleic acid is typically side-bound with two boundary sequences, although in some cases a single boundary at one end may be used, and the second end of the transferred nucleic acid is randomly generated during the transfer process. The polynucleotide of interest is typically located between the left and right boundary sequences of the transfer nucleic acid. The polynucleotide contained within the transfer nucleic acid can be operatively linked to multiple distinct promoter and terminator regulatory elements that promote its expression, i.e., transcription and / or translation of the polynucleotide. T-DNA originates from Agrobacterium (such as Agrobacterium tumefaciens or Agrobacterium rhizogenes). Agrobacterium rhizogenes Transfer DNA (T-DNA) and its artificial variants / mutants are perhaps the best examples of transgenic nucleic acids.

[0240] As used herein, “T-DNA” refers to the T-DNA derived from the *Agrobacterium tumefaciens* Ti plasmid or the *Agrobacterium rhizogenes* Ri plasmid, or an artificial variant thereof used as T-DNA. The T-DNA may comprise a complete T-DNA including both a right boundary sequence and a left boundary sequence, but only needs to contain the minimum sequence required for cis-transfer, namely the right and T-DNA boundary sequences. The T-DNA of the present invention has a polynucleotide of interest inserted anywhere between the right and left boundary sequences (if present) with a target site flanked by a site-specific recombinase. A sequence encoding a factor (such as a vir gene) required for trans-transfer of the T-DNA to plant cells may be inserted into the T-DNA, or may be present on the same replicon as the T-DNA, or preferably trans-present on a compatible replicon in an *Agrobacterium* host. Such “binary vector systems” are well known in the art.

[0241] As used herein, and for the context thereof, “plant transfer nucleic acid” (PT-DNA) refers to a transfer nucleic acid that can be used to integrate a plant-derived polynucleotide sequence into the genome of a plant, and / or a portion of a PT-DNA that has been inserted into the plant genome as a result of processing by an Agrobacterium host, having only a plant-derived polynucleotide sequence (also referred to herein as a “processed” boundary or a “part” of a boundary). Therefore, the PT-DNA of the present invention may have a left and / or right boundary comprising at least one non-plant-derived oligonucleotide sequence, but which is not integrated into the plant genome when used for plant transformation as described herein. Typically, any non-plant-derived polynucleotide sequence originates from naturally occurring Agrobacterium T-DNA. However, it has been processed during Agrobacterium-mediated gene transfer (AMGT) (e.g. Figure 1 The PT-DNA of the present invention (illustrated herein) and forming part of a plant contains only plant-derived polynucleotide sequences. In another example, the PT-DNA contains a boundary that can be shortened by one, two, three, or up to five nucleotides during processing. In one embodiment, the plant-derived polynucleotide sequences in the PT-DNA are from the same plant genus. In another embodiment, the plant-derived polynucleotide sequences in the PT-DNA are from the same plant species or sex-compatible species. The boundary sequence preferably shares at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% but less than 100% sequence identity with the T-DNA boundary sequence from Agrobacterium (such as Agrobacterium tumefaciens or Agrobacterium rhizogenes). Therefore, PT-DNA can be used instead of T-DNA to transfer the nucleotide sequence contained in the PT-DNA from, for example, Agrobacterium genus, to another cell. The PT-DNA is characterized by containing at least one right boundary sequence and preferably also contains a left boundary sequence.

[0242] In one embodiment, the plant of the present invention lacks any portion of the right and / or left PT-DNA boundary. More specifically, in some cases, the PT-DNA is not as... Figure 1 The inserted portion is depicted as having the entire right and / or left PT-DNA boundary missing upon insertion.

[0243] As used herein, and for the context thereof, “wheat transfer nucleic acid” (WT-DNA) means a transfer nucleic acid that can be used to integrate a wheat-derived polynucleotide sequence into the wheat genome, and / or a portion of a PT-DNA that has been inserted into the wheat genome and has a wheat-derived polynucleotide sequence. In addition to the wheat-derived polynucleotide sequence, the WT-DNA of the present invention may have any of the features outlined herein as described with respect to PT-DNA.

[0244] As used herein, and for the context thereof, "soybean transfer nucleic acid" (ST-DNA) refers to a transfer nucleic acid that can be used to integrate a soybean-derived polynucleotide sequence into the soybean genome, and / or a portion of a PT-DNA that has been inserted into the soybean genome and contains only a soybean-derived polynucleotide sequence. In addition to the soybean-derived polynucleotide sequence, the ST-DNA of this invention may have any of the features outlined herein as described with respect to PT-DNA.

[0245] Similar nomenclature can be applied to other plant species, such as banana (BT-DNA), rice (RT-DNA), sorghum (SOGT-DNA), tomato (TT-DNA), or potato (POT-DNA).

[0246] Boundary sequences facilitate the transfer of polynucleotides linked to them and can promote their integration into the genome of the recipient cell. In one embodiment, the length of the boundary sequence is between 5-100 base pairs (bp), between 10-80 bp, between 15-75 bp, between 15-60 bp, between 15-50 bp, between 15-40 bp, between 15-30 bp, between 16-30 bp, between 20-30 bp, between 21-30 bp, between 22-30 bp, between 23-30 bp, between 24-30 bp, between 25-30 bp, or between 26-30 bp. Boundary sequences of T-DNA from Agrobacterium are well known in the art and include those described by Lacroix et al. (2008), Tzfira and Citovsky (2006), and Glevin (2003).

[0247] While traditionally only Agrobacterium has been used to transfer genes into plant cells, numerous systems that function in similar ways to Agrobacterium have now been identified / developed. Several non-Agrobacteria have recently been genetically modified to enable gene transfer (Chung et al., 2006; Broothaerts et al., 2005). These include rhizobia (…). Rhizobium sp.) NGR234, Alfalfa rhizobium ( Sinorhizobium melilotiThe bacteria, including the slow-growing rhizobium *Mezorhizobium loti* in *Lotus spp.*, are engineered to transform various plant tissues (leaf discs, callus, and ovoid tissues), monocotyledonous or dicotyledonous plants, and a wide variety of plant species (e.g., tobacco, rice). By providing the bacteria with the mechanisms required for transformation—a set of virulence genes encoded by the *Agrobacterium* Ti-plast and a T-DNA fragment located on a separate small binary plasmid—gene transfer is achieved.

[0248] As used herein, the terms “transfection,” “transformation,” and their variants are generally used interchangeably. “Transfected” or “transformed” cells may have been manipulated to introduce the polynucleotide of interest, or may be daughter cells derived therefrom.

[0249] In one embodiment, the polynucleotide of interest is derived from sexually compatible plants.

[0250] In one embodiment, the PT-DNA comprises one, two, three, four, five, six, seven, eight, nine, ten, or more of the polynucleotide of interest. In another embodiment, the PT-DNA comprises between one and 15, or between one and 10, or between one and five of the polynucleotide of interest.

[0251] In one embodiment, the polynucleotide of interest is at least 10 kbp, at least 20 kbp, at least 30 kbp, between 10 kbp and 50 kbp, between 10 kbp and 40 kbp, between 10 kbp and 30 kbp, or between 10 kbp and 20 kbp.

[0252] PT-DNA This invention provides plant transfer DNA (PT-DNA). PT-DNA may be part of a Ti plasmid or may have been processed and incorporated into the plant genome.

[0253] For example, the present invention provides a plant having plant transfer DNA (PT-DNA) integrated into the genome of the plant, wherein the integrated PT-DNA has only DNA from the plant, and wherein the PT-DNA contains the polynucleotide of interest.

[0254] In one embodiment, the integrated PT-DNA has a processed PT-DNA right boundary, or any portion lacking a PT-DNA right boundary.

[0255] In one embodiment, the integrated PT-DNA has a processed PT-DNA left boundary, or any portion lacking a PT-DNA left boundary.

[0256] In one embodiment, the integrated PT-DNA includes a processed PT-DNA right boundary, a processed PT-DNA left boundary, and the polynucleotide of interest.

[0257] In one embodiment, the plant is wheat, soybean, corn, rice, tomato, sorghum, barley, banana, sugarcane, or potato.

[0258] In one embodiment, the polynucleotide of interest encodes wheat protein, soybean protein, corn protein, rice protein, tomato protein, sorghum protein, barley protein, banana protein, sugarcane protein, or potato protein.

[0259] The polynucleotides of interest do not naturally exist in Agrobacterium Ti plasmids or Agrobacterium T-DNA.

[0260] In one embodiment, the polynucleotide of interest encodes a protein that confers enhanced resistance to abiotic or biotic stresses.

[0261] In one embodiment, the polynucleotide of interest encodes a protein that confers enhanced disease resistance, enhanced tolerance to abiotic stresses (including salinity and metals), increased yield, increased grain quality and / or size, drought resistance, or enhanced nutrient content, such as modified protein or oil yield and / or composition.

[0262] In one embodiment, the polynucleotide of interest encodes a protein that confers enhanced disease resistance. In one embodiment, the disease is a fungal disease. In one embodiment, the fungal disease is mold, wilt, rot, smut, or rust. In one embodiment, the disease is a fungal disease. In one embodiment, the fungal disease is mold, wilt, rot, or rust. In one embodiment, the fungal disease is rust.

[0263] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-atgtatatattgtggtgtaagatagaaaatgatagcaccccaacctcat-3' (SEQ ID NO: 29), or a 5' fragment containing 5'-atgtatatattgtggtgtaaga-3' (SEQ ID NO: 30).

[0264] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtggtgtaagatagaaaatgatagcaccccaacctcat-3' (SEQ ID NO: 31), or a 5' fragment containing 5'-tatattgtggtgtaaga-3' (SEQ ID NO: 32).

[0265] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-caggatatattgtatcttttttttaatcagttgggaggac-3' (SEQ ID NO: 33), or a 5' fragment containing 5'-caggatatattgtatctttttt-3' (SEQ ID NO: 34).

[0266] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtatcttttttttaatcagttgggaggac-3' (SEQ ID NO: 35), or a 5' fragment containing 5'-tatattgtatctttttt-3' (SEQ ID NO: 36).

[0267] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-aaggatatattgtggtttgaagacagattggtggttcctaa-3' (SEQ ID NO: 37), or a 5' fragment containing 5'-aaggatatattgtggtttgaag-3' (SEQ ID NO: 38).

[0268] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtggtttgaagacagattggtggttcctaa-3' (SEQ ID NO: 39), or a 5' fragment containing 5'-tatattgtggtttgaag-3' (SEQ ID NO: 40).

[0269] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-caggatatatggtggtggtggtatgtatgtataatgatatgatataggtg-3' (SEQ ID NO: 41), or a 5' fragment containing 5'-caggatatatggtggtggtggt-3' (SEQ ID NO: 42).

[0270] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatatggtggtggtggtatgtatgtataatgatatgatataggtg-3' (SEQ ID NO: 43), or a 5' fragment containing 5'-tatatggtggtggtggt-3' (SEQ ID NO: 44).

[0271] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-ctatatatattgtggtgtaagatagaaaa-3' (SEQ ID NO: 45), or a 5' fragment containing 5'-ctatatatattgtggtgtaaga-3' (SEQ ID NO: 46).

[0272] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtggtgtaagatagaaaa-3' (SEQ ID NO: 47), or a 5' fragment containing 5'-tatattgtggtgtaaga-3' (SEQ ID NO: 32).

[0273] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-gaggatatattgtggtggacattt-3' (SEQ ID NO: 48), or a 5' fragment containing 5'-gaggatatattgtggtggacat-3' (SEQ ID NO: 49).

[0274] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtggtggacattt-3' (SEQ ID NO: 50), or a 5' fragment containing 5'-tatattgtggtggacat-3' (SEQ ID NO: 51).

[0275] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-caggatatattgtggaaggttcat-3' (SEQ ID NO: 52), or a 5' fragment containing 5'-caggatatattgtggaaggttc-3' (SEQ ID NO: 53).

[0276] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tatattgtggaaggttcat-3' (SEQ ID NO: 54), or a 5' fragment containing 5'-tatattgtggaaggttc-3' (SEQ ID NO: 55).

[0277] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-tcgataatattgtggtgaaaaccaagcaagtc-3' (SEQ ID NO: 56), or a 5' fragment containing 5'-tcgataatattgtggtgaaaac-3' (SEQ ID NO: 57).

[0278] In one embodiment, the plant is maize, and the processed left boundary of the PT-DNA in the maize genome contains 5'-aatattgtggtgaaaaccaagcaagtc-3' (SEQ ID NO: 58), or a 5' fragment containing 5'-aatattgtggtgaaaac-3' (SEQ ID NO: 59).

[0279] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-ctttaaattaaattttgtggctatcagtgtttga-3' (SEQ ID NO: 60), or a fragment of 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0280] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-caacctgatggttctcagatcagtgtttga-3' (SEQ ID NO: 63), or a fragment of 5'-tctcagatcagtgtttga-3' (SEQ ID NO: 64) or 5'-ttga-3' (SEQ ID NO: 62).

[0281] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-acattcataactaagttttgtggctatcagtgtttga-3' (SEQ ID NO: 65), or a fragment of 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0282] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-agttttgcaaaagtagccatcagtgtttga-3' (SEQ ID NO: 66), or a fragment of 5'-gtagccatcagtgtttga-3' (SEQ ID NO: 67) or 5'-ttga-3' (SEQ ID NO: 62).

[0283] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-aagctgaggcgtgctgcatatcagtgtttga-3' (SEQ ID NO: 68), or a fragment of 5'-ctgcatatcagtgtttga-3' (SEQ ID NO: 69) or 5'-ttga-3' (SEQ ID NO: 62).

[0284] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-tcataaccaagttttgtggctatcagtgtttga-3' (SEQ ID NO: 70), or a fragment of 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0285] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-agatatcaaatttttacctctatcagtgtttga-3' (SEQ ID NO: 71) or 5'-acctctatcagtgtttga-3' (SEQ ID NO: 72) or 5'-ttga-3' (SEQ ID NO: 62).

[0286] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-attcacccccccctctaggcgactatcagtgtttga-3' (SEQ ID NO: 73), or a fragment of 5'-gcgactatcagtgtttga-3' (SEQ ID NO: 74) or 5'-ttga-3' (SEQ ID NO: 62).

[0287] In one embodiment, the plant is maize, and the processed right boundary of the PT-DNA in the maize genome contains a 3' fragment of 5'-cgctcatggaagcacttaaattatcagtgtttga-3' (SEQ ID NO: 75), or a fragment of 5'-taaattatcagtgtttga-3' (SEQ ID NO: 76) or 5'-ttga-3' (SEQ ID NO: 62).

[0288] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-aactatatattgtggtgtaaccagacatccacc-3' (SEQ ID NO: 77), or a 5' fragment containing 5'-aactatatattgtggtgtaacc-3' (SEQ ID NO: 78).

[0289] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgtaaccagacatccacc-3' (SEQ ID NO: 79), or a 5' fragment containing 5'-tatattgtggtgtaacc-3' (SEQ ID NO: 80).

[0290] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-taggatatattgtggtgaaatgacgtgttatt-3' (SEQ ID NO: 81), or a 5' fragment containing 5'-taggatatattgtggtgaaatg-3' (SEQ ID NO: 82).

[0291] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgaaatgacgtgttatt-3' (SEQ ID NO: 83), or a 5' fragment containing 5'-tatattgtggtgaaatg-3' (SEQ ID NO: 84).

[0292] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-caggatatattgtttggcaacaaat-3' (SEQ ID NO: 85), or a 5' fragment containing 5'-caggatatattgtttggcaaca-3' (SEQ ID NO: 86).

[0293] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtttggcaacaaat-3' (SEQ ID NO: 87), or a 5' fragment containing 5'-tatattgtttggcaaca-3' (SEQ ID NO: 88).

[0294] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-taatatatattgtggtgtataatattttcctcga-3' (SEQ ID NO: 89), or a 5' fragment containing 5'-taatatatattgtggtgtataa-3' (SEQ ID NO: 90).

[0295] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgtataatattttcctcga-3' (SEQ ID NO: 91), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0296] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-ttggatatattgtggtgctttgaagagacaa-3' (SEQ ID NO: 93), or a 5' fragment containing 5'-ttggatatattgtggtgctttg-3' (SEQ ID NO: 94).

[0297] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgctttgaagagacaa-3' (SEQ ID NO: 95), or a 5' fragment containing 5'-tatattgtggtgctttg-3' (SEQ ID NO: 96).

[0298] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-agatcggtattgtggtgtaaaccgggaagacgatttc-3' (SEQ ID NO: 97), or a 5' fragment containing 5'-agatcggtattgtggtgtaaac-3' (SEQ ID NO: 98).

[0299] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-ggtattgtggtgtaaaccgggaagacgatttc-3' (SEQ ID NO: 99), or a 5' fragment containing 5'-ggtattgtggtgtaaac-3' (SEQ ID NO: 100).

[0300] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-taggatatattgtggttccgtatgatat-3' (SEQ ID NO: 101), or a 5' fragment containing 5'-taggatatattgtggttccgta-3' (SEQ ID NO: 102).

[0301] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggttccgtatgatat-3' (SEQ ID NO: 103), or a 5' fragment containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0302] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-aaggatatattgtggttccgtatgatattttcgt-3' (SEQ ID NO: 105), or a 5' fragment containing 5'-aaggatatattgtggttccgta-3' (SEQ ID NO: 106).

[0303] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggttccgtatgatattttcgt-3' (SEQ ID NO: 107), or a 5' fragment containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0304] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tcatatatattgtggtgcaaacatatttttggtggaatct-3' (SEQ ID NO: 108), or a 5' fragment containing 5'-tcatatatattgtggtgcaaac-3' (SEQ ID NO: 109).

[0305] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgcaaacatatttttggtggaatct-3' (SEQ ID NO: 110), or a 5' fragment containing 5'-tatattgtggtgcaaac-3' (SEQ ID NO: 111).

[0306] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tgggatatattgtgatgtaactatagcagttgttca-3' (SEQ ID NO: 112), or a 5' fragment containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0307] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtgatgtaactatagcagttgttcact-3' (SEQ ID NO: 114), or a 5' fragment containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0308] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-ttaaagccgtattctgcttttgaaactttcagtgtttga-3' (SEQ ID NO:116), or a fragment of 5'-gaaactttcagtgtttga-3' (SEQ ID NO:117) or 5'-ttga-3' (SEQ ID NO:62).

[0309] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-aatcacaacaatattcactcaactctcagtgtttga-3' (SEQ ID NO: 118), or a fragment of 5'-tcaactctcagtgtttga-3' (SEQ ID NO: 119) or 5'-ttga-3' (SEQ ID NO: 62).

[0310] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-caatcacgacatgagaactatcagtgcttga-3' (SEQ ID NO: 120) or 5'-ttga-3' (SEQ ID NO: 62).

[0311] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-caggatatattgtttggcaacaaatctactt-3' (SEQ ID NO: 122), or a 5' fragment containing 5'-caggatatattgtttggcaaca-3' (SEQ ID NO: 86).

[0312] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtttggcaacaaatctactt-3' (SEQ ID NO: 123), or a 5' fragment containing 5'-tatattgtttggcaaca-3' (SEQ ID NO: 88).

[0313] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-aactatatattgtggtgtaaccagacatccacctgagc-3' (SEQ ID NO: 124), or a 5' fragment containing 5'-aactatatattgtggtgtaacc-3' (SEQ ID NO: 78).

[0314] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgtaaccagacatccacctgagc-3' (SEQ ID NO: 125), or a 5' fragment containing 5'-tatattgtggtgtaacc-3' (SEQ ID NO: 80).

[0315] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-taatatatattgtggtgtataatattttcctcgagact-3' (SEQ ID NO: 126), or a 5' fragment containing 5'-taatatatattgtggtgtataa-3' (SEQ ID NO: 90).

[0316] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgtataatattttcctcgagact-3' (SEQ ID NO: 127), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0317] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-aaggatatattgtggttccgtatgatatttccg-3' (SEQ ID NO: 129), or a 5' fragment containing 5'-aaggatatattgtggttccgta-3' (SEQ ID NO: 106).

[0318] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggttccgtatgatatttccg-3' (SEQ ID NO: 129), or a 5' fragment containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0319] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-ttggatatattgtggtgctttgaagagacaaaag-3' (SEQ ID NO: 130), or a 5' fragment containing 5'-ttggatatattgtggtgctttg-3' (SEQ ID NO: 94).

[0320] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgctttgaagagacaaaag-3' (SEQ ID NO: 131), or a 5' fragment containing 5'-tatattgtggtgctttg-3' (SEQ ID NO: 96).

[0321] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tgggatatattgtgatgtaactatagcagttgttcactg-3' (SEQ ID NO: 132), or a 5' fragment containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0322] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtgatgtaactatagcagttgttcactg-3' (SEQ ID NO: 133), or a 5' fragment containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0323] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tcatatatattgtggtgcaaacatatttttggtggaatcttg-3' (SEQ ID NO: 134), or a 5' fragment containing 5'-tcatatatattgtggtgcaaac-3' (SEQ ID NO: 109).

[0324] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtgcaaacatatttttggtggaatcttg-3' (SEQ ID NO: 135), or a 5' fragment containing 5'-tatattgtggtgcaaac-3' (SEQ ID NO: 111).

[0325] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tgggatatattgtgatgtaactatagcagatggtcactgat-3' (SEQ ID NO: 136), or a 5' fragment containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0326] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtgatgtaactatagcagatggtcactgat-3' (SEQ ID NO: 137), or a 5' fragment containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0327] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-gaggatatattggggtgtacacaataaaaattctttcgtct-3' (SEQ ID NO: 138), or a 5' fragment containing 5'-gaggatatattggggtgtacac-3' (SEQ ID NO: 139).

[0328] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattggggtgtacacaataaaaattctttcgtct-3' (SEQ ID NO: 140), or a 5' fragment containing 5'-tatattggggtgtacac-3' (SEQ ID NO: 141).

[0329] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-gcttatatattgtggtataaaataaatctgaatcct-3' (SEQ ID NO: 142), or a 5' fragment containing 5'-gcttatatattgtggtataaaa-3' (SEQ ID NO: 143).

[0330] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed left boundary of the PT-DNA in the rice genome contains 5'-tatattgtggtataaaataaatctgaatcct-3' (SEQ ID NO: 144), or a 5' fragment containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 145).

[0331] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-aagccgtattctgcttttgaaactttcagtgtttga-3' (SEQ ID NO: 146), or a fragment of 5'-gaaactttcagtgtttga-3' (SEQ ID NO: 117) or 5'-ttga-3' (SEQ ID NO: 62).

[0332] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-tcacaacaatattcactcaactctcagtgtttga-3' (SEQ ID NO: 147) or 5'-tcaactctcagtgtttga-3' (SEQ ID NO: 119) or 5'-ttga-3' (SEQ ID NO: 62).

[0333] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and the processed right boundary of the PT-DNA in the rice genome contains a 3' fragment of 5'-tcaatcacgacatgagaactatcagtgcttga-3' (SEQ ID NO: 148) or 5'-ttga-3' (SEQ ID NO: 62).

[0334] In one embodiment, the plant is tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-gcaaatatattgtggtgtaaatctttttctt-3' (SEQ ID NO: 149), or a 5' fragment containing 5'-gcaaatatattgtggtgtaaat-3' (SEQ ID NO: 150).

[0335] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgtggtgtaaatctttttctt-3' (SEQ ID NO: 151), or a 5' fragment containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 152).

[0336] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatcgtatattgtggtgtaaatatacacctaa-3' (SEQ ID NO: 153), or a 5' fragment containing 5'-tatcgtatattgtggtgtaaat-3' (SEQ ID NO: 154).

[0337] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgtggtgtaaatatacacctaa-3' (SEQ ID NO: 155), or a 5' fragment containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 152).

[0338] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-aaggatatattgtggtcttcactccctct-3' (SEQ ID NO: 156), or a 5' fragment containing 5'-aaggatatattgtggtcttcac-3' (SEQ ID NO: 157).

[0339] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgtggtcttcactccctct-3' (SEQ ID NO: 158), or a 5' fragment containing 5'-tatattgtggtcttcac-3' (SEQ ID NO: 159).

[0340] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-caggatatattgggtcctctcgaaag-3' (SEQ ID NO: 160), or a 5' fragment containing 5'-caggatatattgggtcctctcg-3' (SEQ ID NO: 161).

[0341] In one embodiment, the plant is tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgggtcctctcgaaag-3' (SEQ ID NO: 162), or a 5' fragment containing 5'-tatattgggtcctctcg-3' (SEQ ID NO: 163).

[0342] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-caggatatattgattcctctcaatgag-3' (SEQ ID NO: 164), or a 5' fragment containing 5'-caggatatattgattcctctca-3' (SEQ ID NO: 165).

[0343] In one embodiment, the plant is tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgattcctctcaatgag-3' (SEQ ID NO: 166), or a 5' fragment containing 5'-tatattgattcctctca-3' (SEQ ID NO: 167).

[0344] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-caggatatattgggtcttctcgatggg-3' (SEQ ID NO: 168), or a 5' fragment containing 5'-caggatatattgggtcttctcg-3' (SEQ ID NO: 169).

[0345] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgggtcttctcgatggg-3' (SEQ ID NO: 170), or a 5' fragment containing 5'-tatattgggtcttctcg-3' (SEQ ID NO: 171).

[0346] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-cataatattttgtggtgtaaaaatatagtctatgcaaga-3' (SEQ ID NO: 172), or a 5' fragment containing 5'-cataatattttgtggtgtaaaa-3' (SEQ ID NO: 173).

[0347] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tattttgtggtgtaaaaatatagtctatgcaaga-3' (SEQ ID NO: 174), or a 5' fragment containing 5'-tattttgtggtgtaaaa-3' (SEQ ID NO: 175).

[0348] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-atgactatattgtggtggaaactcactaagggttcctta-3' (SEQ ID NO: 176), or a 5' fragment containing 5'-atgactatattgtggtggaaac-3' (SEQ ID NO: 177).

[0349] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgtggtggaaactcactaagggttcctta-3' (SEQ ID NO: 178), or a 5' fragment containing 5'-tatattgtggtggaaac-3' (SEQ ID NO: 179).

[0350] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-acatatatcttgtggtgtaaaattatacataatttta-3' (SEQ ID NO: 182), or a 5' fragment containing 5'-acatatatcttgtggtgtaaaa-3' (SEQ ID NO: 181).

[0351] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatcttgtggtgtaaaattatacataatttta-3' (SEQ ID NO: 182), or a 5' fragment containing 5'-tatcttgtggtgtaaaa-3' (SEQ ID NO: 183).

[0352] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-aaggaaatattgtggtgttgatggggatcaaact-3' (SEQ ID NO: 184), or a 5' fragment containing 5'-aaggaaatattgtggtgttgat-3' (SEQ ID NO: 185).

[0353] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-aatattgtggtgttgatggggatcaaact-3' (SEQ ID NO: 186), or a 5' fragment containing 5'-aatattgtggtgttgat-3' (SEQ ID NO: 187).

[0354] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-cagtatatattgtggttcatatgtttaagctat-3' (SEQ ID NO: 188), or a 5' fragment containing 5'-cagtatatattgtggttcatat-3' (SEQ ID NO: 189).

[0355] In one embodiment, the plant is a tomato, and the processed left boundary of the PT-DNA in the tomato genome contains 5'-tatattgtggttcatatgtttaagctat-3' (SEQ ID NO: 190), or a 5' fragment containing 5'-tatattgtggttcatat-3' (SEQ ID NO: 191).

[0356] In one embodiment, the plant is tomato, and the processed right boundary of the PT-DNA in the tomato genome contains 5'-cacgcaaagagaaggaaaaactttcagtgtttga-3' (SEQ ID NO: 192), or a 3' fragment containing 5'-aaaactttcagtgtttga-3' (SEQ ID NO: 193) or 5'-ttga-3' (SEQ ID NO: 62).

[0357] In one embodiment, the plant is a tomato, and the processed right boundary of the PT-DNA in the tomato genome contains a 3' fragment of 5'-aaagaaagacaacaaactatcagtttttga-3' (SEQ ID NO: 194) or 5'-caaactatcagtttttga-3' (SEQ ID NO: 195) or 5'-ttga-3' (SEQ ID NO: 62).

[0358] In one embodiment, the plant is a tomato, and the processed right boundary of the PT-DNA in the tomato genome contains a 3' fragment of 5'-ggccatttcaagtccaactatcagtgcttga-3' (SEQ ID NO: 196) or 5'-ttga-3' (SEQ ID NO: 62).

[0359] In one embodiment, the plant is tomato, and the processed right boundary of the PT-DNA in the tomato genome contains 5'-caatgttaggtatgaactatcagtgtttga-3' (SEQ ID NO: 198), or a 3' fragment containing 5'-tgaactatcagtgtttga-3' (SEQ ID NO: 199) or 5'-ttga-3' (SEQ ID NO: 62).

[0360] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-caagatatattgtggcacaactatgag-3' (SEQ ID NO: 200), or a 5' fragment containing 5'-caagatatattgtggcacaact-3' (SEQ ID NO: 201).

[0361] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggcacaactatgag-3' (SEQ ID NO: 202), or a 5' fragment containing 5'-tatattgtggcacaact-3' (SEQ ID NO: 203).

[0362] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-caggatatatgttggtgtaattgatcttg-3' (SEQ ID NO: 204), or a 5' fragment containing 5'-caggatatatgttggtgtaatt-3' (SEQ ID NO: 205).

[0363] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatatgttggtgtaattgatcttg-3' (SEQ ID NO: 206), or a 5' fragment containing 5'-tatatgttggtgtaatt-3' (SEQ ID NO: 207).

[0364] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-aagcttatattgtggtttaaaaaccttattaagtggtt-3' (SEQ ID NO: 208), or a 5' fragment containing 5'-aagcttatattgtggtttaaaa-3' (SEQ ID NO: 209).

[0365] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtttaaaaaccttattaagtggtt-3' (SEQ ID NO: 210), or a 5' fragment containing 5'-tatattgtggtttaaaa-3' (SEQ ID NO: 211).

[0366] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tggtttatattgtggtataaaatttaaact-3' (SEQ ID NO: 212), or a 5' fragment containing 5'-tggtttatattgtggtataaaa-3' (SEQ ID NO: 213).

[0367] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtataaaatttaaact-3' (SEQ ID NO: 214), or a 5' fragment containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 145).

[0368] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tttagcatattgtggtgtaaatgaagatgagctgatg-3' (SEQ ID NO: 215), or a 5' fragment containing 5'-tttagcatattgtggtgtaaat-3' (SEQ ID NO: 216).

[0369] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-catattgtggtgtaaatgaagatgagctgatg-3' (SEQ ID NO: 217), or a 5' fragment containing 5'-catattgtggtgtaaat-3' (SEQ ID NO: 218).

[0370] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-ggcgatatattgtggtgttcagtgtttagtcagaagtc-3' (SEQ ID NO: 219), or a 5' fragment containing 5'-ggcgatatattgtggtgttcag-3' (SEQ ID NO: 220).

[0371] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtgttcagtgtttagtcagaagtc-3' (SEQ ID NO: 221), or a 5' fragment containing 5'-tatattgtggtgttcag-3' (SEQ ID NO: 222).

[0372] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-acctctatattgtggtgtaattttcttgtggcaac-3' (SEQ ID NO: 223), or a 5' fragment containing 5'-acctctatattgtggtgtaatt-3' (SEQ ID NO: 224).

[0373] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtgtaattttcttgtggcaac-3' (SEQ ID NO: 225), or a 5' fragment containing 5'-tatattgtggtgtaatt-3' (SEQ ID NO: 226).

[0374] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tgatatatattgtggtgtaccacgcggcatgggt-3' (SEQ ID NO: 227), or a 5' fragment containing 5'-tgatatatattgtggtgtacca-3' (SEQ ID NO: 228).

[0375] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtgtaccacgcggcatgggt-3' (SEQ ID NO: 229), or a 5' fragment containing 5'-tatattgtggtgtacca-3' (SEQ ID NO: 230).

[0376] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-aatatgatattgtggtgtaaataactgaatattgatattt-3' (SEQ ID NO: 231), or a 5' fragment containing 5'-aatatgatattgtggtgtaaat-3' (SEQ ID NO: 232).

[0377] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-gatattgtggtgtaaataactgaatattgatattt-3' (SEQ ID NO: 233), or a 5' fragment containing 5'-gatattgtggtgtaaat-3' (SEQ ID NO: 234).

[0378] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tggtatatattgtggtgtataactctgtataaccgaagcgtaattttcaacaccctagtaatggcgcaaactttggtatatattgtggtgtataactccgtataaccgaagcaaga-3' (SEQ ID NO: 235), or a 5' fragment containing 5'-tggtatatattgtggtgtataa-3' (SEQ ID NO: 236).

[0379] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtgtataactctgtataaccgaagcgtaattttcaacaccctagtaatggcgcaaactttggtatatattgtggtgtataactccgtataaccgaagcaaga-3' (SEQ ID NO: 237), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0380] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-gataatatattgtggtgtatatgattagaaaaaaaaaac-3' (SEQ ID NO: 238), or a 5' fragment containing 5'-gataatatattgtggtgtatat-3' (SEQ ID NO: 239).

[0381] In one embodiment, the plant is sorghum, and the processed left boundary of the PT-DNA in the sorghum genome contains 5'-tatattgtggtgtatatgattagaaaaaaaaaac-3' (SEQ ID NO: 240), or a 5' fragment containing 5'-tatattgtggtgtatat-3' (SEQ ID NO: 241).

[0382] In one embodiment, the plant is sorghum, and the processed right boundary of the PT-DNA in the sorghum genome contains a 3' fragment of 5'-cctgtcttcctccaaggaactgtcagtgtttga-3' (SEQ ID NO: 242), or a fragment of 5'-ggaactgtcagtgtttga-3' (SEQ ID NO: 243) or 5'-ttga-3' (SEQ ID NO: 62).

[0383] In one embodiment, the plant is sorghum, and the processed right boundary of the PT-DNA in the sorghum genome contains 5'-ttaaactaaagttaacactatcagtgtttga-3' (SEQ ID NO: 243), or a 3' fragment containing 5'-aacactatcagtgtttga-3' (SEQ ID NO: 245) or 5'-ttga-3' (SEQ ID NO: 62).

[0384] In one embodiment, the plant is sorghum, and the processed right boundary of the PT-DNA in the sorghum genome contains 5'-tttttaataatgcctctatcagtgtttga-3' (SEQ ID NO: 246), or a 3' fragment containing 5'-gcctctatcagtgtttga-3' (SEQ ID NO: 247) or 5'-ttga-3' (SEQ ID NO: 62).

[0385] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gtggatatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 248), or a 5' fragment containing 5'-gtggatatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0386] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 250), or a 5' fragment containing 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 251).

[0387] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gtggatatattgtgatgtaaaccttgtagtaatatgt-3' (SEQ ID NO: 252), or a 5' fragment containing 5'-gtggatatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0388] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgatgtaaaccttgtagtaatatgt-3' (SEQ ID NO: 253), or a 5' fragment containing 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 251).

[0389] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-catgatatattgtggtgcatgtctctt-3' (SEQ ID NO: 254), or a 5' fragment containing 5'-catgatatattgtggtgcatgt-3' (SEQ ID NO: 255).

[0390] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtggtgcatgtctctt-3' (SEQ ID NO: 256), or a 5' fragment containing 5'-tatattgtggtgcatgt-3' (SEQ ID NO: 257).

[0391] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gtggatatattgtggcgtaaaccttgcagta-3' (SEQ ID NO: 258), or a 5' fragment containing 5'-gtggatatattgtggcgtaaac-3' (SEQ ID NO: 259).

[0392] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtggcgtaaaccttgcagta-3' (SEQ ID NO: 260), or a 5' fragment containing 5'-tatattgtggcgtaaac-3' (SEQ ID NO: 261).

[0393] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-caggatatattatggtgtagattataaaaacta-3' (SEQ ID NO: 262), or a 5' fragment containing 5'-caggatatattatggtgtagat-3' (SEQ ID NO: 263).

[0394] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattatggtgtagattataaaaacta-3' (SEQ ID NO: 264), or a 5' fragment containing 5'-tatattatggtgtagat-3' (SEQ ID NO: 265).

[0395] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-catgatatattgtggtgaaaacatgcaagaaccta-3' (SEQ ID NO: 266), or a 5' fragment containing 5'-catgatatattgtggtgaaaac-3' (SEQ ID NO: 267).

[0396] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtggtgaaaacatgcaagaaccta-3' (SEQ ID NO: 268), or a 5' fragment containing 5'-tatattgtggtgaaaac-3' (SEQ ID NO: 269).

[0397] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gtggatatattgtgatgtaatccttgcagtaata-3' (SEQ ID NO: 270), or a 5' fragment containing 5'-gtggatatattgtgatgtaatc-3' (SEQ ID NO: 271).

[0398] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgatgtaatccttgcagtaata-3' (SEQ ID NO: 272), or a 5' fragment containing 5'-tatattgtgatgtaatc-3' (SEQ ID NO: 273).

[0399] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-catgatatattgtgttgtatgcctctagtgtc-3' (SEQ ID NO: 274), or a 5' fragment containing 5'-catgatatattgtgttgtatgc-3' (SEQ ID NO: 275).

[0400] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgttgtatgcctctagtgtc-3' (SEQ ID NO: 276), or a 5' fragment containing 5'-tatattgtgttgtatgc-3' (SEQ ID NO: 277).

[0401] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-catgatatattgtgttgtatgtttcttgtgatgt-3' (SEQ ID NO: 278), or a 5' fragment containing 5'-catgatatattgtgttgtatgt-3' (SEQ ID NO: 279).

[0402] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgttgtatgtttcttgtgatgt-3' (SEQ ID NO: 280), or a 5' fragment containing 5'-tatattgtgttgtatgt-3' (SEQ ID NO: 281).

[0403] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gtggatatattgtgatgtaatccttgcggaaatat-3' (SEQ ID NO: 282), or a 5' fragment containing 5'-gtggatatattgtgatgtaatc-3' (SEQ ID NO: 271).

[0404] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgatgtaatccttgcggaaatat-3' (SEQ ID NO: 283), or a 5' fragment containing 5'-tatattgtgatgtaatc-3' (SEQ ID NO: 273).

[0405] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-gatcatatattgtggtctaaaccctaatgacgtagacatt-3' (SEQ ID NO: 284), or a 5' fragment containing 5'-gatcatatattgtggtctaaac-3' (SEQ ID NO: 285).

[0406] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtggtctaaaccctaatgacgtagacatt-3' (SEQ ID NO: 286), or a 5' fragment containing 5'-tatattgtggtctaaac-3' (SEQ ID NO: 287).

[0407] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-caagatatattgtgatgtaaatgccatcgtcact-3' (SEQ ID NO: 288), or a 5' fragment containing 5'-caagatatattgtgatgtaaat-3' (SEQ ID NO: 289).

[0408] In one embodiment, the plant is barley, and the processed left boundary of the PT-DNA in the barley genome contains 5'-tatattgtgatgtaaatgccatcgtcact-3' (SEQ ID NO: 290), or a 5' fragment containing 5'-tatattgtgatgtaaat-3' (SEQ ID NO: 291).

[0409] In one embodiment, the plant is barley, and the processed right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-ctttgcttatcgcagaaactatcagtgtttga-3' (SEQ ID NO: 292), or a fragment of 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 293) or 5'-ttga-3' (SEQ ID NO: 62).

[0410] In one embodiment, the plant is barley, and the processed right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-ctttgcttatcacagaaactatcagtgtttga-3' (SEQ ID NO: 294) or 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 291) or 5'-ttga-3' (SEQ ID NO: 62).

[0411] In one embodiment, the plant is barley, and the processed right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-ctttgcttatggtagaaactatcagtgtttga-3' (SEQ ID NO: 295), or a fragment of 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 291) or 5'-ttga-3' (SEQ ID NO: 62).

[0412] In one embodiment, the plant is barley, and the processed right boundary of the PT-DNA in the barley genome contains 5'-gccgccatagttaccaactatcagtgtttga-3' (SEQ ID NO: 296), or a 3' fragment containing 5'-ccaactatcagtgtttga-3' (SEQ ID NO: 297) or 5'-ttga-3' (SEQ ID NO: 62).

[0413] In one embodiment, the plant is barley, and the processed right boundary of the PT-DNA in the barley genome contains 5'-gatccccctggcggagaactttcagtgtttga-3' (SEQ ID NO: 298), or a 3' fragment containing 5'-agaactttcagtgtttga-3' (SEQ ID NO: 299) or 5'-ttga-3' (SEQ ID NO: 62).

[0414] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-cagcatatattgtggtgtaaaggatgtccacttccaa-3' (SEQ ID NO: 300), or a 5' fragment containing 5'-cagcatatattgtggtgtaaag-3' (SEQ ID NO: 301).

[0415] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtggtgtaaaggatgtccacttccaa-3' (SEQ ID NO: 302), or a 5' fragment containing 5'-tatattgtggtgtaaag-3' (SEQ ID NO: 303).

[0416] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caccttatattgtggtgtaaatgagttgagtgtac-3' (SEQ ID NO: 304), or a 5' fragment containing 5'-caccttatattgtggtgtaaat-3' (SEQ ID NO: 305).

[0417] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtggtgtaaatgagttgagtgtac-3' (SEQ ID NO: 306), or a 5' fragment containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 150).

[0418] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caggatatattgtggtttttgtaatcc-3' (SEQ ID NO: 307), or a 5' fragment containing 5'-caggatatattgtggtttttgt-3' (SEQ ID NO: 308).

[0419] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtggtttttgtaatcc-3' (SEQ ID NO: 309), or a 5' fragment containing 5'-tatattgtggtttttgt-3' (SEQ ID NO: 310).

[0420] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-ttgtatatattgtggtgtaacttcattatagaa-3' (SEQ ID NO: 311), or a 5' fragment containing 5'-ttgtatatattgtggtgtaact-3' (SEQ ID NO: 312).

[0421] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtggtgtaacttcattatagaa-3' (SEQ ID NO: 313), or a 5' fragment containing 5'-tatattgtggtgtaact-3' (SEQ ID NO: 314).

[0422] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caagatatattgtgatgtaaaatagactttgacttgccca-3' (SEQ ID NO: 315), or a 5' fragment containing 5'-caagatatattgtgatgtaaaa-3' (SEQ ID NO: 316).

[0423] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtgatgtaaaatagactttgacttgccca-3' (SEQ ID NO: 317), or a 5' fragment containing 5'-tatattgtgatgtaaaa-3' (SEQ ID NO: 318).

[0424] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caggatatattctggtgatgctattatgtgctct-3' (SEQ ID NO: 319), or a 5' fragment containing 5'-caggatatattctggtgatgct-3' (SEQ ID NO: 320).

[0425] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattctggtgatgctattatgtgctct-3' (SEQ ID NO: 321), or a 5' fragment containing 5'-tatattctggtgatgct-3' (SEQ ID NO: 322).

[0426] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-gaatatatattgtggtataaaattggatattaa-3' (SEQ ID NO: 323), or a 5' fragment containing 5'-gaatatatattgtggtataaaa-3' (SEQ ID NO: 324).

[0427] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattgtggtataaaattggatattaa-3' (SEQ ID NO: 325), or a 5' fragment containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 145).

[0428] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caggatattttgtgttagcactgtgtata-3' (SEQ ID NO: 326), or a 5' fragment containing 5'-caggatattttgtgttagcact-3' (SEQ ID NO: 327).

[0429] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tattttgtgttagcactgtgtata-3' (SEQ ID NO: 328), or a 5' fragment containing 5'-tattttgtgttagcact-3' (SEQ ID NO: 329).

[0430] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-caggatatattctggtgataacaccacaatggcat-3' (SEQ ID NO: 330), or a 5' fragment containing 5'-caggatatattctggtgataac-3' (SEQ ID NO: 331).

[0431] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-tatattctggtgataacaccacaatggcat-3' (SEQ ID NO: 332), or a 5' fragment containing 5'-tatattctggtgataac-3' (SEQ ID NO: 333).

[0432] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-gaggacatattgtggtgttcatagctagattcttctaaacttattt-3' (SEQ ID NO: 334), or a 5' fragment containing 5'-gaggacatattgtggtgttcat-3' (SEQ ID NO: 335).

[0433] In one embodiment, the plant is a banana, and the processed left boundary of the PT-DNA in the banana genome contains 5'-catattgtggtgttcatagctagattcttctaaacttattt-3' (SEQ ID NO: 336), or a 5' fragment containing 5'-catattgtggtgttcat-3' (SEQ ID NO: 337).

[0434] In one embodiment, the plant is a banana, and the processed right boundary of the PT-DNA in the banana genome contains a 3' fragment of 5'-aagatagatttattgataaattatcagtgtttga-3' (SEQ ID NO: 338) or 5'-ttga-3' (SEQ ID NO: 62).

[0435] In one embodiment, the plant is a banana, and the processed right boundary of the PT-DNA in the banana genome contains a 3' fragment of 5'-tgatcctctcaagggtaaactgtcagtgtttga-3' (SEQ ID NO: 339), or a fragment of 5'-taaactgtcagtgtttga-3' (SEQ ID NO: 340) or 5'-ttga-3' (SEQ ID NO: 62).

[0436] In one embodiment, the plant is a banana, and the processed right boundary of the PT-DNA in the banana genome contains a 3' fragment of 5'-cttcttcagaacaaaaactttcagtgtttga-3' (SEQ ID NO: 341), or a fragment of 5'-aaaactttcagtgtttga-3' (SEQ ID NO: 193) or 5'-ttga-3' (SEQ ID NO: 62).

[0437] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tctgatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 342), or a 5' fragment containing 5'-tctgatatattgtggtgtaaaa-3' (SEQ ID NO: 343).

[0438] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 344), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[0439] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tctaatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 346), or a 5' fragment containing 5'-tctaatatattgtggtgtaaaa-3' (SEQ ID NO: 347).

[0440] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-attgatatattgtggtgtaccacgcggcatgcat-3' (SEQ ID NO: 348), or a 5' fragment containing 5'-attgatatattgtggtgtacca-3' (SEQ ID NO: 349).

[0441] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtgtaccacgcggcatgcat-3' (SEQ ID NO: 350), or a 5' fragment containing 5'-tatattgtggtgtacca-3' (SEQ ID NO: 230).

[0442] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-atggatatattgtggtataaatttcttggtca-3' (SEQ ID NO: 351), or a 5' fragment containing 5'-atggatatattgtggtataaat-3' (SEQ ID NO: 352).

[0443] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtataaatttcttggtca-3' (SEQ ID NO: 353), or a 5' fragment containing 5'-tatattgtggtataaat-3' (SEQ ID NO: 354).

[0444] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-ttggatttattgtggtgtaacctgtcagttcggatttt-3' (SEQ ID NO: 355), or a 5' fragment containing 5'-ttggatttattgtggtgtaacc-3' (SEQ ID NO: 356).

[0445] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tttattgtggtgtaacctgtcagttcggatttt-3' (SEQ ID NO: 357), or a 5' fragment containing 5'-tttattgtggtgtaacc-3' (SEQ ID NO: 358).

[0446] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-agagatatattgtggtttaaaagatcagcata-3' (SEQ ID NO: 359), or a 5' fragment containing 5'-agagatatattgtggtttaaaa-3' (SEQ ID NO: 360).

[0447] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtttaaaagatcagcata-3' (SEQ ID NO: 361), or a 5' fragment containing 5'-tatattgtggtttaaaa-3' (SEQ ID NO: 211).

[0448] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-caggatatattgtcgtgtcttcacttcattgat-3' (SEQ ID NO: 362), or a 5' fragment containing 5'-caggatatattgtcgtgtcttc-3' (SEQ ID NO: 1007).

[0449] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtcgtgtcttcacttcattgat-3' (SEQ ID NO: 363), or a 5' fragment containing 5'-tatattgtcgtgtcttc-3' (SEQ ID NO: 1008).

[0450] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-accaatatattgtggtataaactactgcaaatcttgg-3' (SEQ ID NO: 364), or a 5' fragment containing 5'-accaatatattgtggtataaac-3' (SEQ ID NO: 365).

[0451] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtataaactactgcaaatcttgg-3' (SEQ ID NO: 366), or a 5' fragment containing 5'-tatattgtggtataaac-3' (SEQ ID NO: 367).

[0452] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-ttctatatattgtggtctaaaatatgatggaacatg-3' (SEQ ID NO: 368), or a 5' fragment containing 5'-ttctatatattgtggtctaaaa-3' (SEQ ID NO: 369).

[0453] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtctaaaatatgatggaacatg-3' (SEQ ID NO: 370), or a 5' fragment containing 5'-tatattgtggtctaaaa-3' (SEQ ID NO: 371).

[0454] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-atgaatatattgtggtataaattacatggtcattgct-3' (SEQ ID NO: 372), or a 5' fragment containing 5'-atgaatatattgtggtataaat-3' (SEQ ID NO: 373).

[0455] In one embodiment, the plant is sugarcane, and the processed left boundary of the PT-DNA in the sugarcane genome contains 5'-tatattgtggtataaattacatggtcattgct-3' (SEQ ID NO: 374), or a 5' fragment containing 5'-tatattgtggtataaat-3' (SEQ ID NO: 354).

[0456] In one embodiment, the plant is sugarcane, and the processed right boundary of the PT-DNA in the sugarcane genome contains 5'-ttgtgaattttaagtttaaaatatcagtgtttga-3' (SEQ ID NO: 375), or a 3' fragment containing 5'-taaaatatcagtgtttga-3' (SEQ ID NO: 376) or 5'-ttga-3' (SEQ ID NO: 62).

[0457] In one embodiment, the plant is sugarcane, and the processed right boundary of the PT-DNA in the sugarcane genome contains a 3' fragment of 5'-ctggtggtccaatgcaactatcagtgtttga-3' (SEQ ID NO: 377), or a fragment of 5'-gcaactatcagtgtttga-3' (SEQ ID NO: 378) or 5'-ttga-3' (SEQ ID NO: 62).

[0458] In one embodiment, the plant is sugarcane, and the processed right boundary of the PT-DNA in the sugarcane genome contains a 3' fragment of 5'-gttcaggtgcatcaactatcagtgtttga-3' (SEQ ID NO: 379) or 5'-tcaactatcagtgtttga-3' (SEQ ID NO: 380) or 5'-ttga-3' (SEQ ID NO: 62).

[0459] In one embodiment, the plant is sugarcane, and the processed right boundary of the PT-DNA in the sugarcane genome contains a 3' fragment of 5'-cctacctggcgcgccaactatcagtgtttga-3' (SEQ ID NO: 381) or 5'-ttga-3' (SEQ ID NO: 62).

[0460] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains a 5'-ttttgaatattgtggtgtaaacctaaactccttgtgtgagtgttgaaagcttg-3' (SEQ ID NO:382), or a 5' fragment containing 5'-ttttgaatattgtggtgtaaac-3' (SEQ ID NO: 383).

[0461] In one embodiment, the plant is potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-aatattgtggtgtaaacctaaactccttgtgtgagtgttgaaagcttg-3' (SEQ ID NO: 384), or a 5' fragment containing 5'-aatattgtggtgtaaac-3' (SEQ ID NO: 385).

[0462] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-caggatatattgttataacctatttgcataa-3' (SEQ ID NO: 386), or a 5' fragment containing 5'-caggatatattgttataaccta-3' (SEQ ID NO: 1009).

[0463] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgttataacctatttgcataa-3' (SEQ ID NO: 387), or a 5' fragment containing 5'-tatattgttataaccta-3' (SEQ ID NO: 1010).

[0464] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-caggatatattttggggtaggtaaagtctgcttgctg-3' (SEQ ID NO: 388), or a 5' fragment containing 5'-caggatatattttggggtaggt-3' (SEQ ID NO: 389).

[0465] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattttggggtaggtaaagtctgcttgctg-3' (SEQ ID NO: 390), or a 5' fragment containing 5'-tatattttggggtaggt-3' (SEQ ID NO: 391).

[0466] In one embodiment, the plant is potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-caggatatatttttgtgtaggggccaataagctacttttctaa-3' (SEQ ID NO: 392), or a 5' fragment containing 5'-caggatatatttttgtgtaggg-3' (SEQ ID NO: 393).

[0467] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatatttttgtgtaggggccaataagctacttttctaa-3' (SEQ ID NO: 394), or a 5' fragment containing 5'-tatatttttgtgtaggg-3' (SEQ ID NO: 395).

[0468] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-gaggatatattgtggtggacaggagatg-3' (SEQ ID NO: 396), or a 5' fragment containing 5'-gaggatatattgtggtggacag-3' (SEQ ID NO: 397).

[0469] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgtggtggacaggagatg-3' (SEQ ID NO: 398), or a 5' fragment containing 5'-tatattgtggtggacag-3' (SEQ ID NO: 399).

[0470] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-caggatatattgcagtttaggaactctg-3' (SEQ ID NO: 400), or a 5' fragment containing 5'-caggatatattgcagtttagga-3' (SEQ ID NO: 401).

[0471] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgcagtttaggaactctg-3' (SEQ ID NO: 402), or a 5' fragment containing 5'-tatattgcagtttagga-3' (SEQ ID NO: 403).

[0472] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-gaggatatattgttgtgttaggatgatatttggatc-3' (SEQ ID NO: 404), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0473] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgttgtgttaggatgatatttggatc-3' (SEQ ID NO: 406), or a 5' fragment containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0474] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-atatctatattgtggtggaaactcttttttgaaactgg-3' (SEQ ID NO: 408), or a 5' fragment containing 5'-atatctatattgtggtggaaac-3' (SEQ ID NO: 409).

[0475] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgtggtggaaactcttttttgaaactgg-3' (SEQ ID NO: 410), or a 5' fragment containing 5'-tatattgtggtggaaac-3' (SEQ ID NO: 179).

[0476] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-gaggatatattgttgtgttaggctgatagttggatcatttt-3' (SEQ ID NO: 411), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0477] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgttgtgttaggctgatagttggatcatttt-3' (SEQ ID NO: 412), or a 5' fragment containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0478] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-gaggatatattgttgtgttaggctgatatttgga-3' (SEQ ID NO: 413), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0479] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgttgtgttaggctgatatttgga-3' (SEQ ID NO: 414), or a 5' fragment containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0480] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-gaggatatattgttgtgttagtctgattgtgg-3' (SEQ ID NO: 415), or a 5' fragment containing 5'-gaggatatattgttgtgttagt-3' (SEQ ID NO: 416).

[0481] In one embodiment, the plant is a potato, and the processed left boundary of the PT-DNA in the potato genome contains 5'-tatattgttgtgttagtctgattgtgg-3' (SEQ ID NO: 417), or a 5' fragment containing 5'-tatattgttgtgttagt-3' (SEQ ID NO: 418).

[0482] In one embodiment, the plant is potato, and the processed right boundary of the PT-DNA in the potato genome contains a 3' fragment of 5'-agtatgatgctgtgcataaactatcagtatttga-3' (SEQ ID NO: 419) or 5'-taaactatcagtatttga-3' (SEQ ID NO: 420) or 5'-ttga-3' (SEQ ID NO: 62).

[0483] In one embodiment, the plant is potato, and the processed right boundary of the PT-DNA in the potato genome contains 5'-gtatgtaatttcttatttgattcaaactatcagtttttga-3' (SEQ ID NO: 748), or a 3' fragment containing 5'-caaactatcagtttttga-3' (SEQ ID NO: 195) or 5'-ttga-3' (SEQ ID NO: 62).

[0484] In one embodiment, the plant is potato, and the processed right boundary of the PT-DNA in the potato genome contains 5'-gaaaatgtatgaagagaggaaaaacttccagtgtttga-3' (SEQ ID NO: 421), or a 3' fragment containing 5'-aaaacttccagtgtttga-3' (SEQ ID NO: 422) or 5'-ttga-3' (SEQ ID NO: 62).

[0485] As another example, the present invention provides a tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), wherein the Ti plasmid contains plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of the left boundary for integration into the plant genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the plant genome.

[0486] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-atgtatatattgtggtgtaagatagaaaatgatagcaccccaacctcat-3' (SEQ ID NO: 29), or a 5' fragment containing 5'-atgtatatattgtggtgtaaga-3' (SEQ ID NO: 30).

[0487] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaagatagaaaatgatagcaccccaacctcat-3' (SEQ ID NO: 31), or a 5' fragment containing 5'-tatattgtggtgtaaga-3' (SEQ ID NO: 32).

[0488] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtatcttttttttaatcagttgggaggac-3' (SEQ ID NO: 33), or a 5' fragment thereof containing 5'-caggatatattgtatctttttt-3' (SEQ ID NO: 34).

[0489] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtatcttttttttaatcagttgggaggac-3' (SEQ ID NO: 35), or a 5' fragment thereof containing 5'-tatattgtatctttttt-3' (SEQ ID NO: 36).

[0490] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aaggatatattgtggtttgaagacagattggtggttcctaa-3' (SEQ ID NO: 37), or a 5' fragment containing 5'-aaggatatattgtggtttgaag-3' (SEQ ID NO: 38).

[0491] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtttgaagacagattggtggttcctaa-3' (SEQ ID NO: 39), or a 5' fragment containing 5'-tatattgtggtttgaag-3' (SEQ ID NO: 40).

[0492] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatatggtggtggtggtatgtatgtataatgatatgatataggtg-3' (SEQ ID NO:41), or a 5' fragment thereof containing 5'-caggatatatggtggtggtggt-3' (SEQ ID NO:42).

[0493] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatatggtggtggtggtatgtatgtataatgatatgatataggtg-3' (SEQ ID NO: 43), or a 5' fragment thereof containing 5'-tatatggtggtggtggt-3' (SEQ ID NO: 44).

[0494] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ctatatatattgtggtgtaagatagaaaa-3' (SEQ ID NO: 45), or a 5' fragment thereof containing 5'-ctatatatattgtggtgtaaga-3' (SEQ ID NO: 46).

[0495] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaagatagaaaa-3' (SEQ ID NO: 47), or a 5' fragment thereof containing 5'-tatattgtggtgtaaga-3' (SEQ ID NO: 32).

[0496] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgtggtggacattt-3' (SEQ ID NO: 48), or a 5' fragment thereof containing 5'-gaggatatattgtggtggacat-3' (SEQ ID NO: 49).

[0497] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtggacattt-3' (SEQ ID NO: 50), or a 5' fragment thereof containing 5'-tatattgtggtggacat-3' (SEQ ID NO: 51).

[0498] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtggaaggttcat-3' (SEQ ID NO: 52), or a 5' fragment thereof containing 5'-caggatatattgtggaaggttc-3' (SEQ ID NO: 53).

[0499] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggaaggttcat-3' (SEQ ID NO: 54), or a 5' fragment thereof containing 5'-tatattgtggaaggttc-3' (SEQ ID NO: 55).

[0500] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tcgataatattgtggtgaaaaccaagcaagtc-3' (SEQ ID NO: 56), or a 5' fragment containing 5'-tcgataatattgtggtgaaaac-3' (SEQ ID NO: 57).

[0501] In one embodiment, the plant is maize, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aatattgtggtgaaaaccaagcaagtc-3' (SEQ ID NO: 58), or a 5' fragment containing 5'-aatattgtggtgaaaac-3' (SEQ ID NO: 59).

[0502] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains a 5'-tggatgtatatattgtggtgtaagatagaaaatgatagcaccccaacctcat-3' (SEQ ID NO: 423), or a 5' fragment containing 5'-tggatgtatatattgtggtgtaaga-3' (SEQ ID NO: 424), or wherein the 5' t is replaced by c (SEQ ID NO: 425).

[0503] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattgtatcttttttttaatcagttgggaggac-3' (SEQ ID NO: 426), or a 5' fragment containing 5'-tggcaggatatattgtatctttttt-3' (SEQ ID NO: 427), or wherein the 5' t is replaced by c (SEQ ID NO: 428).

[0504] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains a 5'-tggaaggatatattgtggtttgaagacagattggtggttcctaa-3' (SEQ ID NO: 429), or a 5' fragment containing 5'-tggaaggatatattgtggtttgaag-3' (SEQ ID NO: 430), or wherein the 5' t is replaced by c (SEQ ID NO: 431).

[0505] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains a 5'-tggcaggatatatggtggtggtggtatgtatgtataatgatatgatataggtg-3' (SEQ ID NO: 432), or a 5' fragment containing 5'-tggcaggatatatggtggtggtggt-3' (SEQ ID NO: 433), or wherein the 5' t is replaced by c (SEQ ID NO: 434).

[0506] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains 5'-tggctatatatattgtggtgtaagatagaaaa-3' (SEQ ID NO: 435), or a 5' fragment containing 5'-tggctatatatattgtggtgtaaga-3' (SEQ ID NO: 436), or wherein the 5' t is replaced by c (SEQ ID NO: 437).

[0507] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains 5'-tgggaggatatattgtggtggacattt-3' (SEQ ID NO: 438), or a 5' fragment containing 5'-tgggaggatatattgtggtggacat-3' (SEQ ID NO: 439), or wherein the 5' t is replaced by c (SEQ ID NO: 440).

[0508] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains 5'-tggcaggatatattgtggaaggttcat-3' (SEQ ID NO: 441), or a 5' fragment containing 5'-tggcaggatatattgtggaaggttc-3' (SEQ ID NO: 442), or wherein the 5' t is replaced by c (SEQ ID NO: 443).

[0509] In one embodiment, the plant is maize, and the left boundary of the PT-DNA contains a 5'-tggtcgataatattgtggtgaaaaccaagcaagtc-3' (SEQ ID NO: 444), or a 5' fragment containing 5'-tggtcgataatattgtggtgaaaac-3' (SEQ ID NO: 445), or wherein the 5' t is replaced by c (SEQ ID NO: 446).

[0510] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ctttaaattaaattttgtggctatcagtgtttga-3' (SEQ ID NO: 60), or 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0511] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-caacctgatggttctcagatcagtgtttga-3' (SEQ ID NO: 63), or 5'-tctcagatcagtgtttga-3' (SEQ ID NO: 64) or 5'-ttga-3' (SEQ ID NO: 62).

[0512] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-acattcataactaagttttgtggctatcagtgtttga-3' (SEQ ID NO: 65), or a fragment of 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0513] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-agttttgcaaaagtagccatcagtgtttga-3' (SEQ ID NO: 66), or 5'-gtagccatcagtgtttga-3' (SEQ ID NO: 67) or 5'-ttga-3' (SEQ ID NO: 62).

[0514] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-aagctgaggcgtgctgcatatcagtgtttga-3' (SEQ ID NO: 68), or 5'-ctgcatatcagtgtttga-3' (SEQ ID NO: 69) or 5'-ttga-3' (SEQ ID NO: 62).

[0515] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-tcataaccaagttttgtggctatcagtgtttga-3' (SEQ ID NO: 70), or 5'-gtggctatcagtgtttga-3' (SEQ ID NO: 61) or 5'-ttga-3' (SEQ ID NO: 62).

[0516] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-agatatcaaatttttacctctatcagtgtttga-3' (SEQ ID NO: 71), or 5'-acctctatcagtgtttga-3' (SEQ ID NO: 72) or 5'-ttga-3' (SEQ ID NO: 62).

[0517] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-attcacccccccctctaggcgactatcagtgtttga-3' (SEQ ID NO: 73), or 5'-gcgactatcagtgtttga-3' (SEQ ID NO: 74) or 5'-ttga-3' (SEQ ID NO: 62).

[0518] In one embodiment, the plant is maize, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-cgctcatggaagcacttaaattatcagtgtttga-3' (SEQ ID NO: 75), or 5'-taaattatcagtgtttga-3' (SEQ ID NO: 76) or 5'-ttga-3' (SEQ ID NO: 62).

[0519] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-ctttaaattaaattttgtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 447), or a 3' fragment containing 5'-gtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 448) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0520] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-caacctgatggttctcagatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 450), or a 3' fragment containing 5'-tctcagatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 451) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0521] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-acattcataactaagttttgtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 452), or a 3' fragment containing 5'-gtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 448) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0522] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-agttttgcaaaagtagccatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 453), or a 3' fragment containing 5'-gtagccatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 454) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0523] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-aagctgaggcgtgctgcatatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 455), or a 3' fragment containing 5'-ctgcatatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 456) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0524] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-tcataaccaagttttgtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 457), or a 3' fragment containing 5'-gtggctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 448) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0525] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-agatatcaaatttttacctctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 458), or a 3' fragment containing 5'-acctctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 459) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0526] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-attcacccccccctctaggcgactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 460), or a 3' fragment containing 5'-gcgactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 461) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0527] In one embodiment, the plant is maize, and the PT-DNA has a right boundary containing 5'-cgctcatggaagcacttaaattatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 462), or a 3' fragment containing 5'-taaattatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 463) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0528] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aactatatattgtggtgtaaccagacatccacc-3' (SEQ ID NO:77), or a 5' fragment of it containing 5'-aactatatattgtggtgtaacc-3' (SEQ ID NO:78).

[0529] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaccagacatccacc-3' (SEQ ID NO: 79), or a 5' fragment of it containing 5'-tatattgtggtgtaacc-3' (SEQ ID NO: 80).

[0530] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-taggatatattgtggtgaaatgacgtgttatt-3' (SEQ ID NO: 81), or a 5' fragment containing 5'-taggatatattgtggtgaaatg-3' (SEQ ID NO: 82).

[0531] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgaaatgacgtgttatt-3' (SEQ ID NO: 83), or a 5' fragment thereof containing 5'-tatattgtggtgaaatg-3' (SEQ ID NO: 84).

[0532] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtttggcaacaaat-3' (SEQ ID NO: 85), or a 5' fragment containing 5'-caggatatattgtttggcaaca-3' (SEQ ID NO: 86).

[0533] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtttggcaacaaat-3' (SEQ ID NO: 87), or a 5' fragment of it containing 5'-tatattgtttggcaaca-3' (SEQ ID NO: 88).

[0534] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-taatatatattgtggtgtataatattttcctcga-3' (SEQ ID NO: 89), or a 5' fragment containing 5'-taatatatattgtggtgtataa-3' (SEQ ID NO: 90).

[0535] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtataatattttcctcga-3' (SEQ ID NO: 91), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0536] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ttggatatattgtggtgctttgaagagacaa-3' (SEQ ID NO: 93), or a 5' fragment thereof containing 5'-ttggatatattgtggtgctttg-3' (SEQ ID NO: 94).

[0537] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgctttgaagagacaa-3' (SEQ ID NO: 95), or a 5' fragment thereof containing 5'-tatattgtggtgctttg-3' (SEQ ID NO: 96).

[0538] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-agatcggtattgtggtgtaaaccgggaagacgatttc-3' (SEQ ID NO: 97), or a 5' fragment containing 5'-agatcggtattgtggtgtaaac-3' (SEQ ID NO: 98).

[0539] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ggtattgtggtgtaaaccgggaagacgatttc-3' (SEQ ID NO: 99), or a 5' fragment containing 5'-ggtattgtggtgtaaac-3' (SEQ ID NO: 100).

[0540] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-taggatatattgtggttccgtatgatat-3' (SEQ ID NO: 101), or a 5' fragment containing 5'-taggatatattgtggttccgta-3' (SEQ ID NO: 102).

[0541] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggttccgtatgatat-3' (SEQ ID NO: 103), or a 5' fragment thereof containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0542] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aaggatatattgtggttccgtatgatattttcgt-3' (SEQ ID NO: 105), or a 5' fragment containing 5'-aaggatatattgtggttccgta-3' (SEQ ID NO: 106).

[0543] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggttccgtatgatattttcgt-3' (SEQ ID NO: 107), or a 5' fragment of it containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0544] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tcatatatattgtggtgcaaacatatttttggtggaatct-3' (SEQ ID NO: 108), or a 5' fragment containing 5'-tcatatatattgtggtgcaaac-3' (SEQ ID NO: 109).

[0545] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgcaaacatatttttggtggaatct-3' (SEQ ID NO: 110), or a 5' fragment containing 5'-tatattgtggtgcaaac-3' (SEQ ID NO: 111).

[0546] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tgggatatattgtgatgtaactatagcagttgttca-3' (SEQ ID NO: 112), or a 5' fragment of it containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0547] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaactatagcagttgttcact-3' (SEQ ID NO: 114), or a 5' fragment containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0548] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5' fragment of 5'-tggaactatatattgtggtgtaaccagacatccacc-3' (SEQ ID NO: 464), or a 5' fragment of 5'-tggaactatatattgtggtgtaacc-3' (SEQ ID NO: 465), or wherein the 5' t is replaced by c (SEQ ID NO: 466).

[0549] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains 5'-tggtaggatatattgtggtgaaatgacgtgttatt-3' (SEQ ID NO: 467), or a 5' fragment containing 5'-tggtaggatatattgtggtgaaatg-3' (SEQ ID NO: 468), or wherein the 5' t is replaced by c (SEQ ID NO: 469).

[0550] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5'-tggcaggatatattgtttggcaacaaat-3' (SEQ ID NO: 470), or a 5' fragment containing 5'-tggcaggatatattgtttggcaaca-3' (SEQ ID NO: 471), or wherein the 5' t is replaced by c (SEQ ID NO: 472).

[0551] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5'-tggtaatatatattgtggtgtataatattttcctcga-3' (SEQ ID NO: 473), or a 5' fragment containing 5'-tggtaatatatattgtggtgtataa-3' (SEQ ID NO: 474), or wherein the 5' t is replaced by c (SEQ ID NO: 475).

[0552] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5'-tggttggatatattgtggtgctttgaagagacaa-3' (SEQ ID NO: 476), or a 5' fragment containing 5'-tggttggatatattgtggtgctttg-3' (SEQ ID NO: 477), or wherein the 5' t is replaced by c (SEQ ID NO: 478).

[0553] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5'-tggagatcggtattgtggtgtaaaccgggaagacgatttc-3' (SEQ ID NO: 479), or a 5' fragment containing 5'-tggagatcggtattgtggtgtaaac-3' (SEQ ID NO: 480), or wherein the 5' t is replaced by c (SEQ ID NO: 481).

[0554] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 5'-tggtaggatatattgtggttccgtatgatat-3' (SEQ ID NO: 482), or a 5' fragment containing 5'-tggtaggatatattgtggttccgta-3' (SEQ ID NO: 483), or wherein the 5' t is replaced by c (SEQ ID NO: 484).

[0555] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains 5'-tggaaggatatattgtggttccgtatgatattttcgt-3' (SEQ ID NO: 485), or a 5' fragment containing 5'-tggaaggatatattgtggttccgta-3' (SEQ ID NO: 486), or wherein the 5' t is replaced by c (SEQ ID NO: 487).

[0556] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains 5'-tggtcatatatattgtggtgcaaacatatttttggtggaatct-3' (SEQ ID NO: 488), or a 5' fragment containing 5'-tggtcatatatattgtggtgcaaac-3' (SEQ ID NO: 489), or wherein the 5' t is replaced by c (SEQ ID NO: 490).

[0557] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains 5'-tggtgggatatattgtgatgtaactatagcagttgttca-3' (SEQ ID NO: 491), or a 5' fragment containing 5'-tggtgggatatattgtgatgtaact-3' (SEQ ID NO: 492), or wherein the 5' t is replaced by c (SEQ ID NO: 493).

[0558] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the left boundary contains a 3' fragment of 5'-ttaaagccgtattctgcttttgaaactttcagtgtttga-3' (SEQ ID NO: 116), or 5'-gaaactttcagtgtttga-3' (SEQ ID NO: 117) or 5'-ttga-3' (SEQ ID NO: 62).

[0559] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-aatcacaacaatattcactcaactctcagtgtttga-3' (SEQ ID NO: 118), or 5'-tcaactctcagtgtttga-3' (SEQ ID NO: 119) or 5'-ttga-3' (SEQ ID NO: 62).

[0560] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-caatcacgacatgagaactatcagtgcttga-3' (SEQ ID NO:120), or 5'-agaactatcagtgcttga-3' (SEQ ID NO:121) or 5'-ttga-3' (SEQ ID NO:62).

[0561] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the right boundary of the PT-DNA contains a 3' fragment of 5'-ttaaagccgtattctgcttttgaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 494), or a fragment of 5'-gaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 495) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0562] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the right boundary of the PT-DNA contains a 3' fragment of 5'-aatcacaacaatattcactcaactctcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 496), or a fragment of 5'-tcaactctcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 497) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0563] In one embodiment, the plant is rice, preferably the subspecies of japonica rice, and the right boundary of the PT-DNA contains a 3' fragment of 5'-caatcacgacatgagaactatcagtgcttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 498) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0564] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtttggcaacaaatctactt-3' (SEQ ID NO:122), or a 5' fragment containing 5'-caggatatattgtttggcaaca-3' (SEQ ID NO: 86).

[0565] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtttggcaacaaatctactt-3' (SEQ ID NO: 123), or a 5' fragment of it containing 5'-tatattgtttggcaaca-3' (SEQ ID NO: 88).

[0566] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aactatatattgtggtgtaaccagacatccacctgagc-3' (SEQ ID NO: 124), or a 5' fragment containing 5'-aactatatattgtggtgtaacc-3' (SEQ ID NO: 78).

[0567] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and for Indica rice, a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-tatattgtggtgtaaccagacatccacctgagc-3' (SEQ ID NO: 125), or a 5' fragment containing 5'-tatattgtggtgtaacc-3' (SEQ ID NO: 80).

[0568] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-taatatatattgtggtgtataatattttcctcgagact-3' (SEQ ID NO: 126), or a 5' fragment containing 5'-taatatatattgtggtgtataa-3' (SEQ ID NO: 90).

[0569] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtataatattttcctcgagact-3' (SEQ ID NO:127), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0570] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aaggatatattgtggttccgtatgatatttccg-3' (SEQ ID NO: 128), or a 5' fragment containing 5'-aaggatatattgtggttccgta-3' (SEQ ID NO: 106).

[0571] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggttccgtatgatatttccg-3' (SEQ ID NO: 129), or a 5' fragment containing 5'-tatattgtggttccgta-3' (SEQ ID NO: 104).

[0572] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ttggatatattgtggtgctttgaagagacaaaag-3' (SEQ ID NO: 130), or a 5' fragment containing 5'-ttggatatattgtggtgctttg-3' (SEQ ID NO: 94).

[0573] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgctttgaagagacaaaag-3' (SEQ ID NO: 131), or a 5' fragment of it containing 5'-tatattgtggtgctttg-3' (SEQ ID NO: 96).

[0574] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tgggatatattgtgatgtaactatagcagttgttcactg-3' (SEQ ID NO: 132), or a 5' fragment of it containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0575] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaactatagcagttgttcactg-3' (SEQ ID NO: 133), or a 5' fragment of it containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0576] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tcatatatattgtggtgcaaacatatttttggtggaatcttg-3' (SEQ ID NO: 134), or a 5' fragment containing 5'-tcatatatattgtggtgcaaac-3' (SEQ ID NO: 109).

[0577] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgcaaacatatttttggtggaatcttg-3' (SEQ ID NO: 135), or a 5' fragment containing 5'-tatattgtggtgcaaac-3' (SEQ ID NO: 111).

[0578] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tgggatatattgtgatgtaactatagcagatggtcactgat-3' (SEQ ID NO: 136), or a 5' fragment containing 5'-tgggatatattgtgatgtaact-3' (SEQ ID NO: 113).

[0579] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaactatagcagatggtcactgat-3' (SEQ ID NO: 137), or a 5' fragment containing 5'-tatattgtgatgtaact-3' (SEQ ID NO: 115).

[0580] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattggggtgtacacaataaaaattctttcgtct-3' (SEQ ID NO: 138), or a 5' fragment containing 5'-gaggatatattggggtgtacac-3' (SEQ ID NO: 139).

[0581] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattggggtgtacacaataaaaattctttcgtct-3' (SEQ ID NO: 140), or a 5' fragment containing 5'-tatattggggtgtacac-3' (SEQ ID NO: 141).

[0582] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gcttatatattgtggtataaaataaatctgaatcct-3' (SEQ ID NO: 142), or a 5' fragment thereof containing 5'-gcttatatattgtggtataaaa-3' (SEQ ID NO: 143).

[0583] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaaataaatctgaatcct-3' (SEQ ID NO: 144), or a 5' fragment containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 145).

[0584] In one embodiment, the plant is rice, preferably the subspecies of rice, and the left boundary contains a 5' fragment of 5'-tggcaggatatattgtttggcaacaaatctactt-3' (SEQ ID NO: 500), or a 5' fragment of 5'-tggcaggatatattgtttggcaaca-3' (SEQ ID NO: 471), or wherein the 5' t is replaced by c (SEQ ID NO: 501).

[0585] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggaactatatattgtggtgtaacc-3' (SEQ ID NO: 502), or a 5' fragment of 5'-tggaactatatattgtggtgtaaccagacatccacctgagc-3' (SEQ ID NO: 465), or wherein the 5' t is replaced by c (SEQ ID NO: 503).

[0586] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggtaatatatattgtggtgtataatattttcctcgagact-3' (SEQ ID NO: 504), or a 5' fragment containing 5'-tggtaatatatattgtggtgtataa-3' (SEQ ID NO: 474), or wherein the 5' t is replaced by c (SEQ ID NO: 505).

[0587] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggaaggatatattgtggttccgtatgatatttccg-3' (SEQ ID NO: 506), or a 5' fragment containing 5'-tggaaggatatattgtggttccgta-3' (SEQ ID NO: 486), or wherein the 5' t is replaced by c (SEQ ID NO: 507).

[0588] In one embodiment, the plant is rice, preferably the subspecies of rice, and the left boundary contains a 5'-tggttggatatattgtggtgctttgaagagacaaaag-3' (SEQ ID NO: 508), or a 5' fragment containing 5'-tggttggatatattgtggtgctttg-3' (SEQ ID NO: 477), or wherein the 5' t is replaced by c (SEQ ID NO: 509).

[0589] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggtgggatatattgtgatgtaactatagcagttgttcactg-3' (SEQ ID NO: 510), or a 5' fragment containing 5'-tggtgggatatattgtgatgtaact-3' (SEQ ID NO: 492), or wherein the 5' t is replaced by c (SEQ ID NO: 511).

[0590] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggtcatatatattgtggtgcaaacatatttttggtggaatcttg-3' (SEQ ID NO: 512), or a 5' fragment containing 5'-tggtcatatatattgtggtgcaaac-3' (SEQ ID NO: 489), or wherein the 5' t is replaced by c (SEQ ID NO: 513).

[0591] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tggtgggatatattgtgatgtaactatagcagatggtcactgat-3' (SEQ ID NO: 514), or a 5' fragment containing 5'-tggtgggatatattgtgatgtaact-3' (SEQ ID NO: 492), or wherein the 5' t is replaced by c (SEQ ID NO: 515).

[0592] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the left boundary contains 5'-tgggaggatatattggggtgtacacaataaaaattctttcgtct-3' (SEQ ID NO: 516), or a 5' fragment containing 5'-tgggaggatatattggggtgtacac-3' (SEQ ID NO: 517), or wherein the 5' t is replaced by c (SEQ ID NO: 518).

[0593] In one embodiment, the plant is rice, preferably the subspecies of rice, and the left boundary contains a 5' fragment of 5'-tgggcttatatattgtggtataaaataaatctgaatcct-3' (SEQ ID NO: 519), or a 5' fragment of 5'-tgggcttatatattgtggtataaaa-3' (SEQ ID NO: 520), or wherein the 5' t is replaced by c (SEQ ID NO: 521).

[0594] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-aagccgtattctgcttttgaaactttcagtgtttga-3' (SEQ ID NO: 146), or 5'-gaaactttcagtgtttga-3' (SEQ ID NO: 117) or 5'-ttga-3' (SEQ ID NO: 62).

[0595] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-tcacaacaatattcactcaactctcagtgtttga-3' (SEQ ID NO: 147), or 5'-tcaactctcagtgtttga-3' (SEQ ID NO: 119) or 5'-ttga-3' (SEQ ID NO: 62).

[0596] In one embodiment, the plant is rice, preferably the rice subspecies Indica, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-tcaatcacgacatgagaactatcagtgcttga-3' (SEQ ID NO:148), or 5'-agaactatcagtgcttga-3' (SEQ ID NO:121) or 5'-ttga-3' (SEQ ID NO:62).

[0597] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the right boundary contains a 3' fragment of 5'-aagccgtattctgcttttgaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 522), or a fragment of 5'-gaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 495) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0598] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the right boundary contains a 3' fragment of 5'-tcacaacaatattcactcaactctcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 523), or 5'-tcaactctcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 497) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0599] In one embodiment, the plant is rice, preferably the subspecies of Indica rice, and the right boundary contains a 3' fragment of 5'-tcaatcacgacatgagaactatcagtgcttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 524) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 499) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0600] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gcaaatatattgtggtgtaaatctttttctt-3' (SEQ ID NO: 149), or a 5' fragment containing 5'-gcaaatatattgtggtgtaaat-3' (SEQ ID NO: 150).

[0601] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaatctttttctt-3' (SEQ ID NO: 151), or a 5' fragment containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 152).

[0602] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatcgtatattgtggtgtaaatatacacctaa-3' (SEQ ID NO: 153), or a 5' fragment containing 5'-tatcgtatattgtggtgtaaat-3' (SEQ ID NO: 154).

[0603] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaatatacacctaa-3' (SEQ ID NO: 155), or a 5' fragment of it containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 152).

[0604] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aaggatatattgtggtcttcactccctct-3' (SEQ ID NO: 156), or a 5' fragment containing 5'-aaggatatattgtggtcttcac-3' (SEQ ID NO: 157).

[0605] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtcttcactccctct-3' (SEQ ID NO: 158), or a 5' fragment of it containing 5'-tatattgtggtcttcac-3' (SEQ ID NO: 159).

[0606] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgggtcctctcgaaag-3' (SEQ ID NO: 160), or a 5' fragment containing 5'-caggatatattgggtcctctcg-3' (SEQ ID NO: 161).

[0607] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgggtcctctcgaaag-3' (SEQ ID NO: 162), or a 5' fragment thereof containing 5'-tatattgggtcctctcg-3' (SEQ ID NO: 163).

[0608] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgattcctctcaatgag-3' (SEQ ID NO: 164), or a 5' fragment containing 5'-caggatatattgattcctctca-3' (SEQ ID NO: 165).

[0609] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgattcctctcaatgag-3' (SEQ ID NO: 166), or a 5' fragment containing 5'-tatattgattcctctca-3' (SEQ ID NO: 167).

[0610] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgggtcttctcgatggg-3' (SEQ ID NO: 168), or a 5' fragment containing 5'-caggatatattgggtcttctcg-3' (SEQ ID NO: 169).

[0611] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgggtcttctcgatggg-3' (SEQ ID NO: 170), or a 5' fragment of it containing 5'-tatattgggtcttctcg-3' (SEQ ID NO: 171).

[0612] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-cataatattttgtggtgtaaaaatatagtctatgcaaga-3' (SEQ ID NO: 172), or a 5' fragment containing 5'-cataatattttgtggtgtaaaa-3' (SEQ ID NO: 173).

[0613] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tattttgtggtgtaaaaatatagtctatgcaaga-3' (SEQ ID NO: 174), or a 5' fragment containing 5'-tattttgtggtgtaaaa-3' (SEQ ID NO: 175).

[0614] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-atgactatattgtggtggaaactcactaagggttcctta-3' (SEQ ID NO: 176), or a 5' fragment containing 5'-atgactatattgtggtggaaac-3' (SEQ ID NO: 177).

[0615] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtggaaactcactaagggttcctta-3' (SEQ ID NO: 178), or a 5' fragment containing 5'-tatattgtggtggaaac-3' (SEQ ID NO: 179).

[0616] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-acatatatcttgtggtgtaaaattatacataatttta-3' (SEQ ID NO: 180), or a 5' fragment containing 5'-acatatatcttgtggtgtaaaa-3' (SEQ ID NO: 181).

[0617] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatcttgtggtgtaaaattatacataatttta-3' (SEQ ID NO: 182), or a 5' fragment containing 5'-tatcttgtggtgtaaaa-3' (SEQ ID NO: 183).

[0618] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aaggaaatattgtggtgttgatggggatcaaact-3' (SEQ ID NO: 184), or a 5' fragment containing 5'-aaggaaatattgtggtgttgat-3' (SEQ ID NO: 185).

[0619] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aatattgtggtgttgatggggatcaaact-3' (SEQ ID NO: 186), or a 5' fragment containing 5'-aatattgtggtgttgat-3' (SEQ ID NO: 187).

[0620] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-cagtatatattgtggttcatatgtttaagctat-3' (SEQ ID NO: 188), or a 5' fragment containing 5'-cagtatatattgtggttcatat-3' (SEQ ID NO: 189).

[0621] In one embodiment, the plant is a tomato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggttcatatgtttaagctat-3' (SEQ ID NO: 190), or a 5' fragment thereof containing 5'-tatattgtggttcatat-3' (SEQ ID NO: 191).

[0622] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tgggcaaatatattgtggtgtaaatctttttctt-3' (SEQ ID NO: 525), or a 5' fragment of 5'-tgggcaaatatattgtggtgtaaat-3' (SEQ ID NO: 526), ​​or wherein the 5' t is replaced by c (SEQ ID NO: 527).

[0623] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggtatcgtatattgtggtgtaaatatacacctaa-3' (SEQ ID NO: 528), or a 5' fragment of 5'-tggtatcgtatattgtggtgtaaat-3' (SEQ ID NO: 529), or wherein the 5' t is replaced by c (SEQ ID NO: 530).

[0624] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggaaggatatattgtggtcttcactccctct-3' (SEQ ID NO: 531), or a 5' fragment of 5'-tggaaggatatattgtggtcttcac-3' (SEQ ID NO: 532), or wherein the 5' t is replaced by c (SEQ ID NO: 533).

[0625] In one embodiment, the plant is a tomato, and the left boundary contains 5'-tggcaggatatattgggtcctctcgaaag-3' (SEQ ID NO: 534), or a 5' fragment containing 5'-tggcaggatatattgggtcctctcg-3' (SEQ ID NO: 535), or wherein the 5' t is replaced by c (SEQ ID NO: 536).

[0626] In one embodiment, the plant is a tomato, and the left boundary contains 5'-tggcaggatatattgattcctctcaatgag-3' (SEQ ID NO: 537), or a 5' segment containing 5'-tggcaggatatattgattcctctca-3' (SEQ ID NO: 538), or wherein the 5' t is replaced by c (SEQ ID NO: 539).

[0627] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggcaggatatattgggtcttctcgatggg-3' (SEQ ID NO: 540), or a 5' fragment of 5'-tggcaggatatattgggtcttctcg-3' (SEQ ID NO: 541), or wherein the 5' t is replaced by c (SEQ ID NO: 542).

[0628] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggcataatattttgtggtgtaaaaatatagtctatgcaaga-3' (SEQ ID NO: 543), or a 5' fragment of 5'-tggcataatattttgtggtgtaaaa-3' (SEQ ID NO: 544), or wherein the 5' t is replaced by c (SEQ ID NO: 545).

[0629] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggatgactatattgtggtggaaactcactaagggttcctta-3' (SEQ ID NO: 546), or a 5' fragment of 5'-tggatgactatattgtggtggaaac-3' (SEQ ID NO: 547), or wherein the 5' t is replaced by c (SEQ ID NO: 548).

[0630] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggacatatatcttgtggtgtaaaattatacataatttta-3' (SEQ ID NO: 549), or a 5' fragment of 5'-tggacatatatcttgtggtgtaaaa-3' (SEQ ID NO: 550), or wherein the 5' t is replaced by c (SEQ ID NO: 551).

[0631] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggaaggaaatattgtggtgttgatggggatcaaact-3' (SEQ ID NO: 552), or a 5' fragment of 5'-tggaaggaaatattgtggtgttgat-3' (SEQ ID NO: 553), or wherein the 5' t is replaced by c (SEQ ID NO: 554).

[0632] In one embodiment, the plant is a tomato, and the left boundary contains a 5' fragment of 5'-tggcagtatatattgtggttcatatgtttaagctat-3' (SEQ ID NO: 555), or a 5' fragment of 5'-tggcagtatatattgtggttcatat-3' (SEQ ID NO: 556), or wherein the 5' t is replaced by c (SEQ ID NO: 557).

[0633] In one embodiment, the plant is a tomato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-cacgcaaagagaaggaaaaactttcagtgtttga-3' (SEQ ID NO: 192), or 5'-aaaactttcagtgtttga-3' (SEQ ID NO: 193) or 5'-ttga-3' (SEQ ID NO: 62).

[0634] In one embodiment, the plant is a tomato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-aaagaaagacaacaaactatcagtttttga-3' (SEQ ID NO: 194), or 5'-caaactatcagtttttga-3' (SEQ ID NO: 195) or 5'-ttga-3' (SEQ ID NO: 62).

[0635] In one embodiment, the plant is a tomato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ggccatttcaagtccaactatcagtgcttga-3' (SEQ ID NO: 196), or 5'-ccaactatcagtgcttga-3' (SEQ ID NO: 197) or 5'-ttga-3' (SEQ ID NO: 62).

[0636] In one embodiment, the plant is a tomato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-caatgttaggtatgaactatcagtgtttga-3' (SEQ ID NO: 198), or 5'-tgaactatcagtgtttga-3' (SEQ ID NO: 199) or 5'-ttga-3' (SEQ ID NO: 62).

[0637] In one embodiment, the plant is a tomato, and the right boundary contains a 3' fragment of 5'-cacgcaaagagaaggaaaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 558), or a fragment of 5'-aaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 559) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0638] In one embodiment, the plant is a tomato, and the right boundary contains a 3' fragment of 5'-aaagaaagacaacaaactatcagtttttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 560), or a fragment of 5'-caaactatcagtttttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 561) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0639] In one embodiment, the plant is a tomato, and the right boundary contains a 3' fragment of 5'-ggccatttcaagtccaactatcagtgcttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 562), or a fragment of 5'-ccaactatcagtgcttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 563) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0640] In one embodiment, the plant is a tomato, and the right boundary contains a 3' fragment of 5'-caatgttaggtatgaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 564), or a fragment of 5'-tgaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 565) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0641] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caagatatattgtggcacaactatgag-3' (SEQ ID NO: 200), or a 5' fragment thereof containing 5'-caagatatattgtggcacaact-3' (SEQ ID NO: 201).

[0642] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggcacaactatgag-3' (SEQ ID NO: 202), or a 5' fragment thereof containing 5'-tatattgtggcacaact-3' (SEQ ID NO: 203).

[0643] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatatgttggtgtaattgatcttg-3' (SEQ ID NO: 204), or a 5' fragment containing 5'-caggatatatgttggtgtaatt-3' (SEQ ID NO: 205).

[0644] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-tatatgttggtgtaattgatcttg-3' (SEQ ID NO: 206), or a 5' fragment thereof containing 5'-tatatgttggtgtaatt-3' (SEQ ID NO: 207).

[0645] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aagcttatattgtggtttaaaaaccttattaagtggtt-3' (SEQ ID NO: 208), or a 5' fragment containing 5'-aagcttatattgtggtttaaaa-3' (SEQ ID NO: 209).

[0646] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtttaaaaaccttattaagtggtt-3' (SEQ ID NO: 210), or a 5' fragment containing 5'-tatattgtggtttaaaa-3' (SEQ ID NO: 211).

[0647] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-tggtttatattgtggtataaaatttaaact-3' (SEQ ID NO: 212), or a 5' fragment of it containing 5'-tggtttatattgtggtataaaa-3' (SEQ ID NO: 213).

[0648] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaaatttaaact-3' (SEQ ID NO: 214), or a 5' fragment thereof containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 145).

[0649] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tttagcatattgtggtgtaaatgaagatgagctgatg-3' (SEQ ID NO: 215), or a 5' fragment containing 5'-tttagcatattgtggtgtaaat-3' (SEQ ID NO: 215).

[0650] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catattgtggtgtaaatgaagatgagctgatg-3' (SEQ ID NO: 217), or a 5' fragment containing 5'-catattgtggtgtaaat-3' (SEQ ID NO: 218).

[0651] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ggcgatatattgtggtgttcagtgtttagtcagaagtc-3' (SEQ ID NO: 219), or a 5' fragment containing 5'-ggcgatatattgtggtgttcag-3' (SEQ ID NO: 220).

[0652] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgttcagtgtttagtcagaagtc-3' (SEQ ID NO: 221), or a 5' fragment of it containing 5'-tatattgtggtgttcag-3' (SEQ ID NO: 222).

[0653] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-acctctatattgtggtgtaattttcttgtggcaac-3' (SEQ ID NO: 223), or a 5' fragment containing 5'-acctctatattgtggtgtaatt-3' (SEQ ID NO: 224).

[0654] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaattttcttgtggcaac-3' (SEQ ID NO: 225), or a 5' fragment containing 5'-tatattgtggtgtaatt-3' (SEQ ID NO: 226).

[0655] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tgatatatattgtggtgtaccacgcggcatgggt-3' (SEQ ID NO: 227), or a 5' fragment containing 5'-tgatatatattgtggtgtacca-3' (SEQ ID NO: 228).

[0656] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaccacgcggcatgggt-3' (SEQ ID NO: 229), or a 5' fragment containing 5'-tatattgtggtgtacca-3' (SEQ ID NO: 230).

[0657] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-aatatgatattgtggtgtaaataactgaatattgatattt-3' (SEQ ID NO: 231), or a 5' fragment containing 5'-aatatgatattgtggtgtaaat-3' (SEQ ID NO: 232).

[0658] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gatattgtggtgtaaataactgaatattgatattt-3' (SEQ ID NO: 233), or a 5' fragment containing 5'-gatattgtggtgtaaat-3' (SEQ ID NO: 234).

[0659] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tggtatatattgtggtgtataactctgtataaccgaagcgtaattttcaacaccctagtaatggcgcaaactttggtatatattgtggtgtataactccgtataaccgaagcaaga-3' (SEQ ID NO: 235), or a 5' fragment containing 5'-tggtatatattgtggtgtataa-3' (SEQ ID NO: 236).

[0660] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtataactctgtataaccgaagcgtaattttcaacaccctagtaatggcgcaaactttggtatatattgtggtgtataactccgtataaccgaagcaaga-3' (SEQ ID NO: 236), or a 5' fragment containing 5'-tatattgtggtgtataa-3' (SEQ ID NO: 92).

[0661] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gataatatattgtggtgtatatgattagaaaaaaaaaac-3' (SEQ ID NO: 238), or a 5' fragment containing 5'-gataatatattgtggtgtatat-3' (SEQ ID NO: 239).

[0662] In one embodiment, the plant is sorghum, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtatatgattagaaaaaaaaaac-3' (SEQ ID NO: 240), or a 5' fragment containing 5'-tatattgtggtgtatat-3' (SEQ ID NO: 241).

[0663] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains 5'-tggcaagatatattgtggcacaactatgag-3' (SEQ ID NO: 566), or a 5' fragment containing 5'-tggcaagatatattgtggcacaact-3' (SEQ ID NO: 567), or wherein the 5' t is replaced by c (SEQ ID NO: 568).

[0664] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggcaggatatatgttggtgtaattgatcttg-3' (SEQ ID NO: 569), or a 5' fragment containing 5'-tggcaggatatatgttggtgtaatt-3' (SEQ ID NO: 570), or wherein the 5' t is replaced by c (SEQ ID NO: 571).

[0665] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggaagcttatattgtggtttaaaaaccttattaagtggtt-3' (SEQ ID NO: 572), or a 5' fragment containing 5'-tggaagcttatattgtggtttaaaa-3' (SEQ ID NO: 573), or wherein the 5' t is replaced by c (SEQ ID NO: 574).

[0666] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggtggtttatattgtggtataaaatttaaact-3' (SEQ ID NO: 575), or a 5' fragment containing 5'-tggtggtttatattgtggtataaaa-3' (SEQ ID NO: 576), or wherein the 5' t is replaced by c (SEQ ID NO: 577).

[0667] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggtttagcatattgtggtgtaaatgaagatgagctgatg-3' (SEQ ID NO: 578), or a 5' fragment containing 5'-tggtttagcatattgtggtgtaaat-3' (SEQ ID NO: 579), or wherein the 5' t is replaced by c (SEQ ID NO: 580).

[0668] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggggcgatatattgtggtgttcagtgtttagtcagaagtc-3' (SEQ ID NO: 581), or a 5' fragment containing 5'-tggggcgatatattgtggtgttcag-3' (SEQ ID NO: 582), or wherein the 5' t is replaced by c (SEQ ID NO: 583).

[0669] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggacctctatattgtggtgtaattttcttgtggcaac-3' (SEQ ID NO: 584), or a 5' fragment containing 5'-tggacctctatattgtggtgtaatt-3' (SEQ ID NO: 585), or wherein the 5' t is replaced by c (SEQ ID NO: 586).

[0670] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggtgatatatattgtggtgtaccacgcggcatgggt-3' (SEQ ID NO: 587), or a 5' fragment containing 5'-tggtgatatatattgtggtgtacca-3' (SEQ ID NO: 588), or wherein the 5' t is replaced by c (SEQ ID NO: 589).

[0671] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggaatatgatattgtggtgtaaataactgaatattgatattt-3' (SEQ ID NO: 590), or a 5' fragment containing 5'-tggaatatgatattgtggtgtaaat-3' (SEQ ID NO: 591), or wherein the 5' t is replaced by c (SEQ ID NO: 592).

[0672] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tggtggtatatattgtggtgtataactctgtataaccgaagcgtaattttcaacaccctagtaatggcgcaaactttggtatatattgtggtgtataactccgtataaccgaagcaaga-3' (SEQ ID NO: 593), or a 5' fragment containing 5'-tggtggtatatattgtggtgtataa-3' (SEQ ID NO: 594), or wherein the 5' t is replaced by c (SEQ ID NO: 595).

[0673] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 5'-tgggataatatattgtggtgtatatgattagaaaaaaaaaac-3' (SEQ ID NO: 596), or a 5' fragment containing 5'-tgggataatatattgtggtgtatat-3' (SEQ ID NO: 597), or wherein the 5' t is replaced by c (SEQ ID NO: 598).

[0674] In one embodiment, the plant is sorghum, and the left boundary of the PT-DNA contains a 3' fragment of 5'-tggcctgtcttcctccaaggaactgtcagtgtttga-3' (SEQ ID NO: 599), or a fragment of 5'-tggggaactgtcagtgtttga-3' (SEQ ID NO: 600) or 5'-ttga-3' (SEQ ID NO: 62), or wherein the 5' t is replaced by c (SEQ ID NO: 601).

[0675] In one embodiment, the plant is sorghum, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ttaaactaaagttaacactatcagtgtttga-3' (SEQ ID NO: 244), or 5'-aacactatcagtgtttga-3' (SEQ ID NO: 245) or 5'-ttga-3' (SEQ ID NO: 62).

[0676] In one embodiment, the plant is sorghum, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-tttttaataatgcctctatcagtgtttga-3' (SEQ ID NO: 246), or 5'-gcctctatcagtgtttga-3' (SEQ ID NO: 247) or 5'-ttga-3' (SEQ ID NO: 62).

[0677] In one embodiment, the plant is sorghum, and the right boundary of the PT-DNA contains a 3' fragment of 5'-ttaaactaaagttaacactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 602), or a fragment of 5'-aacactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 603) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0678] In one embodiment, the plant is sorghum, and the right boundary of the PT-DNA contains a 3' fragment of 5'-tttttaataatgcctctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 604), or a fragment of 5'-gcctctatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 605) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0679] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gtggatatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 248), or a 5' fragment containing 5'-gtggatatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0680] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 250), or a 5' fragment containing 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 251).

[0681] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gtggatatattgtgatgtaaaccttgtagtaatatgt-3' (SEQ ID NO: 252), or a 5' fragment containing 5'-gtggatatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0682] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaaaccttgtagtaatatgt-3' (SEQ ID NO: 253), or a 5' fragment containing 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0683] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catgatatattgtggtgcatgtctctt-3' (SEQ ID NO: 254), or a 5' fragment containing 5'-catgatatattgtggtgcatgt-3' (SEQ ID NO: 255).

[0684] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgcatgtctctt-3' (SEQ ID NO: 256), or a 5' fragment thereof containing 5'-tatattgtggtgcatgt-3' (SEQ ID NO: 257).

[0685] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gtggatatattgtggcgtaaaccttgcagta-3' (SEQ ID NO: 258), or a 5' fragment containing 5'-gtggatatattgtggcgtaaac-3' (SEQ ID NO: 259).

[0686] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggcgtaaaccttgcagta-3' (SEQ ID NO: 260), or a 5' fragment containing 5'-tatattgtggcgtaaac-3' (SEQ ID NO: 261).

[0687] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattatggtgtagattataaaaacta-3' (SEQ ID NO: 262), or a 5' fragment containing 5'-caggatatattatggtgtagat-3' (SEQ ID NO: 263).

[0688] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattatggtgtagattataaaaacta-3' (SEQ ID NO: 264), or a 5' fragment containing 5'-tatattatggtgtagat-3' (SEQ ID NO: 265).

[0689] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catgatatattgtggtgaaaacatgcaagaaccta-3' (SEQ ID NO: 266), or a 5' fragment containing 5'-catgatatattgtggtgaaaac-3' (SEQ ID NO: 267).

[0690] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgaaaacatgcaagaaccta-3' (SEQ ID NO: 268), or a 5' fragment containing 5'-tatattgtggtgaaaac-3' (SEQ ID NO: 269).

[0691] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gtggatatattgtgatgtaatccttgcagtaata-3' (SEQ ID NO: 270), or a 5' fragment containing 5'-gtggatatattgtgatgtaatc-3' (SEQ ID NO: 271).

[0692] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaatccttgcagtaata-3' (SEQ ID NO: 272), or a 5' fragment containing 5'-tatattgtgatgtaatc-3' (SEQ ID NO: 273).

[0693] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catgatatattgtgttgtatgcctctagtgtc-3' (SEQ ID NO: 274), or a 5' fragment containing 5'-catgatatattgtgttgtatgc-3' (SEQ ID NO: 275).

[0694] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgttgtatgcctctagtgtc-3' (SEQ ID NO: 276), or a 5' fragment containing 5'-tatattgtgttgtatgc-3' (SEQ ID NO: 277).

[0695] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catgatatattgtgttgtatgtttcttgtgatgt-3' (SEQ ID NO: 278), or a 5' fragment containing 5'-catgatatattgtgttgtatgt-3' (SEQ ID NO: 279).

[0696] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgttgtatgtttcttgtgatgt-3' (SEQ ID NO: 280), or a 5' fragment of it containing 5'-tatattgtgttgtatgt-3' (SEQ ID NO: 281).

[0697] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gtggatatattgtgatgtaatccttgcggaaatat-3' (SEQ ID NO: 282), or a 5' fragment containing 5'-gtggatatattgtgatgtaatc-3' (SEQ ID NO: 271).

[0698] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaatccttgcggaaatat-3' (SEQ ID NO: 283), or a 5' fragment containing 5'-tatattgtgatgtaatc-3' (SEQ ID NO: 273).

[0699] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gatcatatattgtggtctaaaccctaatgacgtagacatt-3' (SEQ ID NO: 284), or a 5' fragment containing 5'-gatcatatattgtggtctaaac-3' (SEQ ID NO: 285).

[0700] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtctaaaccctaatgacgtagacatt-3' (SEQ ID NO: 286), or a 5' fragment containing 5'-tatattgtggtctaaac-3' (SEQ ID NO: 287).

[0701] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-caagatatattgtgatgtaaatgccatcgtcact-3' (SEQ ID NO: 288), or a 5' fragment thereof containing 5'-caagatatattgtgatgtaaat-3' (SEQ ID NO: 289).

[0702] In one embodiment, the plant is barley, and a portion of the left boundary of the PT-DNA for integration into the genome contains 5'-tatattgtgatgtaaatgccatcgtcact-3' (SEQ ID NO: 290), or a 5' fragment thereof containing 5'-tatattgtgatgtaaat-3' (SEQ ID NO: 291).

[0703] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggtggatatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 606), or a 5' fragment containing 5'-tgggtggatatattgtgatgtaaac-3' (SEQ ID NO: 607), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 608 and 1474.

[0704] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains 5'-ttggtggatatattgtgatgtaaaccttgcagtaatatgta-3' (SEQ ID NO: 1501), or a 5' fragment containing 5'-ttggtggatatattgtgatgtaaac-3' (SEQ ID NO: 1500).

[0705] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggtggatatattgtgatgtaaaccttgtagtaatatgt-3' (SEQ ID NO: 609), or a 5' fragment containing 5'-tgggtggatatattgtgatgtaaac-3' (SEQ ID NO: 607), or wherein the 5' t is replaced by c (SEQ ID NO: 610).

[0706] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcatgatatattgtggtgcatgtctctt-3' (SEQ ID NO: 611), or a 5' fragment containing 5'-tggcatgatatattgtggtgcatgt-3' (SEQ ID NO: 612), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 613 and 1475.

[0707] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggtggatatattgtggcgtaaaccttgcagta-3' (SEQ ID NO: 614), or a 5' fragment containing 5'-tgggtggatatattgtggcgtaaac-3' (SEQ ID NO: 615), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 616 and 1476.

[0708] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattatggtgtagattataaaaacta-3' (SEQ ID NO: 617), or a 5' fragment containing 5'-tggcaggatatattatggtgtagat-3' (SEQ ID NO: 618), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 619 and 1477.

[0709] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcatgatatattgtggtgaaaacatgcaagaaccta-3' (SEQ ID NO: 620), or a 5' fragment containing 5'-tggcatgatatattgtggtgaaaac-3' (SEQ ID NO: 621), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 622 and 1478.

[0710] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggtggatatattgtgatgtaatccttgcagtaata-3' (SEQ ID NO: 623), or a 5' fragment containing 5'-tgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 624), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 625 and 1479.

[0711] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcatgatatattgtgttgtatgcctctagtgtc-3' (SEQ ID NO: 626), or a 5' fragment containing 5'-tggcatgatatattgtgttgtatgc-3' (SEQ ID NO: 627), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 628 and 1480.

[0712] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcatgatatattgtgttgtatgtttcttgtgatgt-3' (SEQ ID NO: 629), or a 5' fragment containing 5'-tggcatgatatattgtgttgtatgt-3' (SEQ ID NO: 630), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 631 and 1481.

[0713] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggtggatatattgtgatgtaatccttgcggaaatat-3' (SEQ ID NO: 632), or a 5' fragment containing 5'-tgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 624), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 633 and 1479.

[0714] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tgggatcatatattgtggtctaaaccctaatgacgtagacatt-3' (SEQ ID NO: 634), or a 5' fragment containing 5'-tgggatcatatattgtggtctaaac-3' (SEQ ID NO: 635), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 636 and 1483.

[0715] In one embodiment, the plant is barley, and the left boundary of the PT-DNA contains a 5'-tggcaagatatattgtgatgtaaatgccatcgtcact-3' (SEQ ID NO: 637), or a 5' fragment containing 5'-tggcaagatatattgtgatgtaaat-3' (SEQ ID NO: 638), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 639 and 1484.

[0716] In one embodiment, the plant is barley, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ctttgcttatcgcagaaactatcagtgtttga-3' (SEQ ID NO: 292), or 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 293) or 5'-ttga-3' (SEQ ID NO: 62).

[0717] In one embodiment, the plant is barley, and a portion of the right boundary of the PT-DNA for integration into the genome contains a 3' fragment of 5'-ctttgcttatcacagaaactatcagtgtttga-3' (SEQ ID NO: 294), or 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 293) or 5'-ttga-3' (SEQ ID NO: 62).

[0718] In one embodiment, the plant is barley, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ctttgcttatggtagaaactatcagtgtttga-3' (SEQ ID NO: 295), or 5'-gaaactatcagtgtttga-3' (SEQ ID NO: 293) or 5'-ttga-3' (SEQ ID NO: 62).

[0719] In one embodiment, the plant is barley, and a portion of the right boundary of the PT-DNA used for integration into the genome contains 5'-gccgccatagttaccaactatcagtgtttga-3' (SEQ ID NO: 296), or a 3' fragment containing 5'-ccaactatcagtgtttga-3' (SEQ ID NO: 297) or 5'-ttga-3' (SEQ ID NO: 62).

[0720] In one embodiment, the plant is barley, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-gatccccctggcggagaactttcagtgtttga-3' (SEQ ID NO: 298), or 5'-agaactttcagtgtttga-3' (SEQ ID NO: 299) or 5'-ttga-3' (SEQ ID NO: 62).

[0721] In one embodiment, the plant is barley, and the right boundary of the PT-DNA contains a 3' fragment of 5'-ctttgcttatcgcagaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 640), or a fragment of 5'-gaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 641) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0722] In one embodiment, the plant is barley, and the right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-ctttgcttatcacagaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 642), or a fragment of 5'-gaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 641) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0723] In one embodiment, the plant is barley, and the right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-ctttgcttatggtagaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 643), or a fragment of 5'-gaaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 641) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0724] In one embodiment, the plant is barley, and the right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-gccgccatagttaccaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 644) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0725] In one embodiment, the plant is barley, and the right boundary of the PT-DNA in the barley genome contains a 3' fragment of 5'-gatccccctggcggagaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 646) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0726] In one embodiment, the plant is barley, and the left boundary contains 5'-ttggtggatatattgtgatgtaaac-3' (SEQ ID NO: 1500).

[0727] In one embodiment, the plant is barley, and the left boundary contains 5'-tgggtggatatattgtgatgtaaac-3' (SEQ ID NO: 607).

[0728] In one embodiment, the plant is barley, and the left boundary contains 5'-cgggtggatatattgtgatgtaaac-3' (SEQ ID NO: 1474).

[0729] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcatgatatattgtggtgcatgt-3' (SEQ ID NO: 612).

[0730] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcatgatatattgtggtgcatgt-3' (SEQ ID NO: 1475).

[0731] In one embodiment, the plant is barley, and the left boundary contains 5'-tgggtggatatattgtggcgtaaac-3' (SEQ ID NO: 615).

[0732] In one embodiment, the plant is barley, and the left boundary contains 5'-cgggtggatatattgtggcgtaaac-3' (SEQ ID NO: 1476).

[0733] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcaggatatattatggtgtagat-3' (SEQ ID NO: 618).

[0734] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcaggatatattatggtgtagat-3' (SEQ ID NO: 1477).

[0735] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcatgatatattgtggtgaaaac-3' (SEQ ID NO: 621).

[0736] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcatgatatattgtggtgaaaac-3' (SEQ ID NO: 1478).

[0737] In one embodiment, the plant is barley, and the left boundary contains 5'-tgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 624).

[0738] In one embodiment, the plant is barley, and the left boundary contains 5'-cgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 1479).

[0739] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcatgatatattgtgttgtatgc-3' (SEQ ID NO: 627).

[0740] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcatgatatattgtgttgtatgc-3' (SEQ ID NO: 1480).

[0741] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcatgatatattgtgttgtatgt-3' (SEQ ID NO: 630).

[0742] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcatgatatattgtgttgtatgt-3' (SEQ ID NO: 1481).

[0743] In one embodiment, the plant is barley, and the left boundary contains 5'-tgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 624).

[0744] In one embodiment, the plant is barley, and the left boundary contains 5'-cgggtggatatattgtgatgtaatc-3' (SEQ ID NO: 1482).

[0745] In one embodiment, the plant is barley, and the left boundary contains 5'-tgggatcatatattgtggtctaaac-3' (SEQ ID NO: 635).

[0746] In one embodiment, the plant is barley, and the left boundary contains 5'-cgggatcatatattgtggtctaaac-3' (SEQ ID NO: 1483).

[0747] In one embodiment, the plant is barley, and the left boundary contains 5'-tggcaagatatattgtgatgtaaat-3' (SEQ ID NO: 638).

[0748] In one embodiment, the plant is barley, and the left boundary contains 5'-cggcaagatatattgtgatgtaaat-3' (SEQ ID NO: 1484).

[0749] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 251).

[0750] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-gtggatatattgtgatgtaaac-3' (SEQ ID NO: 249).

[0751] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-catgatatattgtggtgcatgt-3' (SEQ ID NO: 255).

[0752] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtgcatgt-3' (SEQ ID NO: 257).

[0753] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-gtggatatattgtggcgtaaac-3' (SEQ ID NO: 259).

[0754] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtggcgtaaac-3' (SEQ ID NO: 261).

[0755] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-caggatatattatggtgtagat-3' (SEQ ID NO: 263).

[0756] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattatggtgtagat-3' (SEQ ID NO: 265).

[0757] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-catgatatattgtggtgaaaac-3' (SEQ ID NO: 267).

[0758] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtgaaaac-3' (SEQ ID NO: 269).

[0759] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-gtggatatattgtgatgtaatc-3' (SEQ ID NO: 271).

[0760] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtgatgtaatc-3' (SEQ ID NO: 273).

[0761] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-catgatatattgtgttgtatgc-3' (SEQ ID NO: 275).

[0762] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtgttgtatgc-3' (SEQ ID NO: 277).

[0763] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-catgatatattgtgttgtatgt-3' (SEQ ID NO: 279).

[0764] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtgttgtatgt-3' (SEQ ID NO: 281).

[0765] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-gatcatatattgtggtctaaac-3' (SEQ ID NO: 285).

[0766] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtctaaac-3' (SEQ ID NO: 287).

[0767] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-caagatatattgtgatgtaaat-3' (SEQ ID NO: 289).

[0768] In one embodiment, the plant is barley, and the PT-DNA has a processed left boundary containing 5'-tatattgtgatgtaaat-3' (SEQ ID NO: 291).

[0769] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-cagcatatattgtggtgtaaaggatgtccacttccaa-3' (SEQ ID NO: 300), or a 5' fragment containing 5'-cagcatatattgtggtgtaaag-3' (SEQ ID NO: 301).

[0770] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaaggatgtccacttccaa-3' (SEQ ID NO: 302), or a 5' fragment containing 5'-tatattgtggtgtaaag-3' (SEQ ID NO: 303).

[0771] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caccttatattgtggtgtaaatgagttgagtgtac-3' (SEQ ID NO: 304), or a 5' fragment containing 5'-caccttatattgtggtgtaaat-3' (SEQ ID NO: 305).

[0772] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaatgagttgagtgtac-3' (SEQ ID NO: 306), or a 5' fragment containing 5'-tatattgtggtgtaaat-3' (SEQ ID NO: 152).

[0773] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtggtttttgtaatcc-3' (SEQ ID NO: 307), or a 5' fragment containing 5'-caggatatattgtggtttttgt-3' (SEQ ID NO: 308).

[0774] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtttttgtaatcc-3' (SEQ ID NO: 309), or a 5' fragment containing 5'-tatattgtggtttttgt-3' (SEQ ID NO: 310).

[0775] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ttgtatatattgtggtgtaacttcattatagaa-3' (SEQ ID NO: 311), or a 5' fragment containing 5'-ttgtatatattgtggtgtaact-3' (SEQ ID NO: 312).

[0776] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaacttcattatagaa-3' (SEQ ID NO: 313), or a 5' fragment of it containing 5'-tatattgtggtgtaact-3' (SEQ ID NO: 314).

[0777] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caagatatattgtgatgtaaaatagactttgacttgccca-3' (SEQ ID NO: 315), or a 5' fragment containing 5'-caagatatattgtgatgtaaaa-3' (SEQ ID NO: 316).

[0778] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtgatgtaaaatagactttgacttgccca-3' (SEQ ID NO: 317), or a 5' fragment containing 5'-tatattgtgatgtaaaa-3' (SEQ ID NO: 318).

[0779] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattctggtgatgctattatgtgctct-3' (SEQ ID NO: 319), or a 5' fragment thereof containing 5'-caggatatattctggtgatgct-3' (SEQ ID NO: 320).

[0780] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattctggtgatgctattatgtgctct-3' (SEQ ID NO: 321), or a 5' fragment thereof containing 5'-tatattctggtgatgct-3' (SEQ ID NO: 322).

[0781] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaatatatattgtggtataaaattggatattaa-3' (SEQ ID NO: 323), or a 5' fragment containing 5'-gaatatatattgtggtataaaa-3' (SEQ ID NO: 324).

[0782] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaaattggatattaa-3' (SEQ ID NO: 325), or a 5' fragment of it containing 5'-tatattgtggtataaaa-3' (SEQ ID NO: 146).

[0783] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatattttgtgttagcactgtgtata-3' (SEQ ID NO: 326), or a 5' fragment containing 5'-caggatattttgtgttagcact-3' (SEQ ID NO: 327).

[0784] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tattttgtgttagcactgtgtata-3' (SEQ ID NO: 328), or a 5' fragment thereof containing 5'-tattttgtgttagcact-3' (SEQ ID NO: 329).

[0785] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattctggtgataacaccacaatggcat-3' (SEQ ID NO: 330), or a 5' fragment containing 5'-caggatatattctggtgataac-3' (SEQ ID NO: 331).

[0786] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattctggtgataacaccacaatggcat-3' (SEQ ID NO: 332), or a 5' fragment containing 5'-tatattctggtgataac-3' (SEQ ID NO: 333).

[0787] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggacatattgtggtgttcatagctagattcttctaaacttattt-3' (SEQ ID NO: 334), or a 5' fragment containing 5'-gaggacatattgtggtgttcat-3' (SEQ ID NO: 335).

[0788] In one embodiment, the plant is a banana, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-catattgtggtgttcatagctagattcttctaaacttattt-3' (SEQ ID NO: 336), or a 5' fragment containing 5'-catattgtggtgttcat-3' (SEQ ID NO: 337).

[0789] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcagcatatattgtggtgtaaaggatgtccacttccaa-3' (SEQ ID NO: 648), or a 5' fragment containing 5'-tggcagcatatattgtggtgtaaag-3' (SEQ ID NO: 649), or wherein the 5' t is replaced by c (SEQ ID NO: 650).

[0790] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaccttatattgtggtgtaaatgagttgagtgtac-3' (SEQ ID NO: 651), or a 5' fragment containing 5'-tggcaccttatattgtggtgtaaat-3' (SEQ ID NO: 652), or wherein the 5' t is replaced by c (SEQ ID NO: 653).

[0791] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattgtggtttttgtaatcc-3' (SEQ ID NO: 654), or a 5' fragment containing 5'-tggcaggatatattgtggtttttgt-3' (SEQ ID NO: 655), or wherein the 5' t is replaced by c (SEQ ID NO: 656).

[0792] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggttgtatatattgtggtgtaacttcattatagaa-3' (SEQ ID NO: 657), or a 5' fragment containing 5'-tggttgtatatattgtggtgtaact-3' (SEQ ID NO: 658), or wherein the 5' t is replaced by c (SEQ ID NO: 659).

[0793] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaagatatattgtgatgtaaaatagactttgacttgccca-3' (SEQ ID NO: 660), or a 5' fragment containing 5'-tggcaagatatattgtgatgtaaaa-3' (SEQ ID NO: 661), or wherein the 5' t is replaced by c (SEQ ID NO: 662).

[0794] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattctggtgatgctattatgtgctct-3' (SEQ ID NO: 663), or a 5' fragment containing 5'-tggcaggatatattctggtgatgct-3' (SEQ ID NO: 664), or wherein the 5' t is replaced by c (SEQ ID NO: 665).

[0795] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tgggaatatatattgtggtataaaattggatattaa-3' (SEQ ID NO: 666), or a 5' fragment containing 5'-tgggaatatatattgtggtataaaa-3' (SEQ ID NO: 667), or wherein the 5' t is replaced by c (SEQ ID NO: 668).

[0796] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaggatattttgtgttagcactgtgtata-3' (SEQ ID NO: 669), or a 5' fragment containing 5'-tggcaggatattttgtgttagcact-3' (SEQ ID NO: 670), or wherein the 5' t is replaced by c (SEQ ID NO: 671).

[0797] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattctggtgataacaccacaatggcat-3' (SEQ ID NO: 672), or a 5' fragment containing 5'-tggcaggatatattctggtgataac-3' (SEQ ID NO: 673), or wherein the 5' t is replaced by c (SEQ ID NO: 674).

[0798] In one embodiment, the plant is a banana, and the left boundary of the PT-DNA contains a 5'-tgggaggacatattgtggtgttcatagctagattcttctaaacttattt-3' (SEQ ID NO: 675), or a 5' fragment containing 5'-tgggaggacatattgtggtgttcat-3' (SEQ ID NO: 676), or wherein the 5' t is replaced by c (SEQ ID NO: 677).

[0799] In one embodiment, the plant is a banana, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-aagatagatttattgataaattatcagtgtttga-3' (SEQ ID NO: 338), or 5'-taaattatcagtgtttga-3' (SEQ ID NO: 76) or 5'-ttga-3' (SEQ ID NO: 62).

[0800] In one embodiment, the plant is a banana, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-tgatcctctcaagggtaaactgtcagtgtttga-3' (SEQ ID NO: 339), or 5'-taaactgtcagtgtttga-3' (SEQ ID NO: 340) or 5'-ttga-3' (SEQ ID NO: 62).

[0801] In one embodiment, the plant is a banana, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-cttcttcagaacaaaaactttcagtgtttga-3' (SEQ ID NO: 341), or 5'-aaaactttcagtgtttga-3' (SEQ ID NO: 193) or 5'-ttga-3' (SEQ ID NO: 62).

[0802] In one embodiment, the plant is a banana, and the right boundary of the PT-DNA contains a 3' fragment of 5'-aagatagatttattgataaattatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 678), or a fragment of 5'-taaattatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 463) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0803] In one embodiment, the plant is a banana, and the right boundary of the PT-DNA contains a 3' fragment of 5'-tgatcctctcaagggtaaactgtcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 679), or a fragment of 5'-taaactgtcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 680) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0804] In one embodiment, the plant is a banana, and the right boundary of the PT-DNA contains a 3' fragment of 5'-cttcttcagaacaaaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 681), or a fragment of 5'-aaaactttcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 559) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0805] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tctgatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 342), or a 5' fragment containing 5'-tctgatatattgtggtgtaaaa-3' (SEQ ID NO: 343).

[0806] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 344), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[0807] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tctaatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 346), or a 5' fragment containing 5'-tctaatatattgtggtgtaaaa-3' (SEQ ID NO: 347).

[0808] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-attgatatattgtggtgtaccacgcggcatgcat-3' (SEQ ID NO: 348), or a 5' fragment containing 5'-attgatatattgtggtgtacca-3' (SEQ ID NO: 349).

[0809] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtgtaccacgcggcatgcat-3' (SEQ ID NO: 350), or a 5' fragment containing 5'-tatattgtggtgtacca-3' (SEQ ID NO: 230).

[0810] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-atggatatattgtggtataaatttcttggtca-3' (SEQ ID NO: 351), or a 5' fragment containing 5'-atggatatattgtggtataaat-3' (SEQ ID NO: 352).

[0811] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaatttcttggtca-3' (SEQ ID NO: 353), or a 5' fragment containing 5'-tatattgtggtataaat-3' (SEQ ID NO: 354).

[0812] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ttggatttattgtggtgtaacctgtcagttcggatttt-3' (SEQ ID NO: 355), or a 5' fragment containing 5'-ttggatttattgtggtgtaacc-3' (SEQ ID NO: 356).

[0813] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tttattgtggtgtaacctgtcagttcggatttt-3' (SEQ ID NO: 357), or a 5' fragment containing 5'-tttattgtggtgtaacc-3' (SEQ ID NO: 358).

[0814] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-agagatatattgtggtttaaaagatcagcata-3' (SEQ ID NO: 359), or a 5' fragment containing 5'-agagatatattgtggtttaaaa-3' (SEQ ID NO: 360).

[0815] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtttaaaagatcagcata-3' (SEQ ID NO: 361), or a 5' fragment of it containing 5'-tatattgtggtttaaaa-3' (SEQ ID NO: 211).

[0816] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgtcgtgtcttcacttcattgat-3' (SEQ ID NO: 362), or a 5' fragment containing 5'-caggatatattgtcgtgtcttc-3' (SEQ ID NO: 1007).

[0817] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtcgtgtcttcacttcattgat-3' (SEQ ID NO: 363), or a 5' fragment containing 5'-tatattgtcgtgtcttc-3' (SEQ ID NO: 1008).

[0818] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-accaatatattgtggtataaactactgcaaatcttgg-3' (SEQ ID NO: 364), or a 5' fragment containing 5'-accaatatattgtggtataaac-3' (SEQ ID NO: 365).

[0819] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaactactgcaaatcttgg-3' (SEQ ID NO: 366), or a 5' fragment containing 5'-tatattgtggtataaac-3' (SEQ ID NO: 367).

[0820] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-ttctatatattgtggtctaaaatatgatggaacatg-3' (SEQ ID NO: 368), or a 5' fragment containing 5'-ttctatatattgtggtctaaaa-3' (SEQ ID NO: 369).

[0821] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtctaaaatatgatggaacatg-3' (SEQ ID NO: 370), or a 5' fragment containing 5'-tatattgtggtctaaaa-3' (SEQ ID NO: 371).

[0822] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-atgaatatattgtggtataaattacatggtcattgct-3' (SEQ ID NO: 372), or a 5' fragment containing 5'-atgaatatattgtggtataaat-3' (SEQ ID NO: 373).

[0823] In one embodiment, the plant is sugarcane, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtataaattacatggtcattgct-3' (SEQ ID NO: 374), or a 5' fragment containing 5'-tatattgtggtataaat-3' (SEQ ID NO: 354).

[0824] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggtctgatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 682), or a 5' fragment containing 5'-tggtctgatatattgtggtgtaaaa-3' (SEQ ID NO: 683), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 684 and 1485.

[0825] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggtctaatatattgtggtgtaaaaaacatttcatcat-3' (SEQ ID NO: 685), or a 5' fragment containing 5'-tggtctaatatattgtggtgtaaaa-3' (SEQ ID NO: 686), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 687 and 1486.

[0826] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggattgatatattgtggtgtaccacgcggcatgcat-3' (SEQ ID NO: 688), or a 5' fragment containing 5'-tggattgatatattgtggtgtacca-3' (SEQ ID NO: 689), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 690 and 1487.

[0827] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggatggatatattgtggtataaatttcttggtca-3' (SEQ ID NO: 691), or a 5' fragment containing 5'-tggatggatatattgtggtataaat-3' (SEQ ID NO: 692), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 693 and 1488.

[0828] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggttggatttattgtggtgtaacctgtcagttcggatttt-3' (SEQ ID NO: 694), or a 5' fragment containing 5'-tggttggatttattgtggtgtaacc-3' (SEQ ID NO: 695), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 696 and 1489.

[0829] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggagagatatattgtggtttaaaagatcagcata-3' (SEQ ID NO: 697), or a 5' fragment containing 5'-tggagagatatattgtggtttaaaa-3' (SEQ ID NO: 698), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 699 and 1490.

[0830] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattgtcgtgtcttcacttcattgat-3' (SEQ ID NO: 700), or a 5' fragment containing 5'-tggcaggatatattgtcgtgtcttc-3' (SEQ ID NO: 1011), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 701 and 1491.

[0831] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggaccaatatattgtggtataaactactgcaaatcttgg-3' (SEQ ID NO: 702), or a 5' fragment containing 5'-tggaccaatatattgtggtataaac-3' (SEQ ID NO: 703), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 704 and 1492.

[0832] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggttctatatattgtggtctaaaatatgatggaacatg-3' (SEQ ID NO: 705), or a 5' fragment containing 5'-tggttctatatattgtggtctaaaa-3' (SEQ ID NO: 706), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 707 and 1493.

[0833] In one embodiment, the plant is sugarcane, and the left boundary of the PT-DNA contains a 5'-tggatgaatatattgtggtataaattacatggtcattgct-3' (SEQ ID NO: 708), or a 5' fragment containing 5'-tggatgaatatattgtggtataaat-3' (SEQ ID NO: 709), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 710 and 1493.

[0834] In one embodiment, the plant is sugarcane, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ttgtgaattttaagtttaaaatatcagtgtttga-3' (SEQ ID NO: 375), or 5'-taaaatatcagtgtttga-3' (SEQ ID NO: 376) or 5'-ttga-3' (SEQ ID NO: 62).

[0835] In one embodiment, the plant is sugarcane, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-ctggtggtccaatgcaactatcagtgtttga-3' (SEQ ID NO: 377), or 5'-gcaactatcagtgtttga-3' (SEQ ID NO: 378) or 5'-ttga-3' (SEQ ID NO: 62).

[0836] In one embodiment, the plant is sugarcane, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-gttcaggtgcatcaactatcagtgtttga-3' (SEQ ID NO: 379), or 5'-tcaactatcagtgtttga-3' (SEQ ID NO: 380) or 5'-ttga-3' (SEQ ID NO: 62).

[0837] In one embodiment, the plant is sugarcane, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-cctacctggcgcgccaactatcagtgtttga-3' (SEQ ID NO: 381), or 5'-ccaactatcagtgtttga-3' (SEQ ID NO: 297) or 5'-ttga-3' (SEQ ID NO: 62).

[0838] In one embodiment, the plant is sugarcane, and the right boundary of the PT-DNA contains a 3' fragment of 5'-ttgtgaattttaagtttaaaatatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 711), or a fragment of 5'-taaaatatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 712) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0839] In one embodiment, the plant is sugarcane, and the right boundary of the PT-DNA contains a 3' fragment of 5'-ctggtggtccaatgcaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 713), or a fragment of 5'-gcaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 714) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0840] In one embodiment, the plant is sugarcane, and the right boundary of the PT-DNA contains a 3' fragment of 5'-gttcaggtgcatcaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 715) or 5'-tcaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 716) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0841] In one embodiment, the plant is sugarcane, and the right boundary of the PT-DNA contains a 3' fragment of 5'-cctacctggcgcgccaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 717), or a fragment of 5'-ccaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 645) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0842] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggtctgatatattgtggtgtaaaa-3' (SEQ ID NO: 683).

[0843] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggtctgatatattgtggtgtaaaa-3' (SEQ ID NO: 1485).

[0844] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggtctaatatattgtggtgtaaaa-3' (SEQ ID NO: 686).

[0845] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggtctaatatattgtggtgtaaaa-3' (SEQ ID NO: 1486).

[0846] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggattgatatattgtggtgtacca-3' (SEQ ID NO: 689).

[0847] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggattgatatattgtggtgtacca-3' (SEQ ID NO: 1487).

[0848] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggatggatatattgtggtataaat-3' (SEQ ID NO: 692).

[0849] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggatggatatattgtggtataaat-3' (SEQ ID NO: 1488).

[0850] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggttggatttattgtggtgtaacc-3' (SEQ ID NO: 695).

[0851] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggttggatttattgtggtgtaacc-3' (SEQ ID NO: 1489).

[0852] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggagagatatattgtggtttaaaa-3' (SEQ ID NO: 698).

[0853] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggagagatatattgtggtttaaaa-3' (SEQ ID NO: 1490).

[0854] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggcaggatatattgtcgtgtcttc-3' (SEQ ID NO: 1011).

[0855] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggcaggatatattgtcgtgtcttc-3' (SEQ ID NO: 1491).

[0856] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggaccaatatattgtggtataaac-3' (SEQ ID NO: 703).

[0857] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggaccaatatattgtggtataaac-3' (SEQ ID NO: 1492).

[0858] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggttctatatattgtggtctaaaa-3' (SEQ ID NO: 706).

[0859] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggttctatatattgtggtctaaaa-3' (SEQ ID NO: 1493).

[0860] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-tggatgaatatattgtggtataaat-3' (SEQ ID NO: 709).

[0861] In one embodiment, the plant is sugarcane, and the left boundary contains 5'-cggatgaatatattgtggtataaat-3' (SEQ ID NO: 1494).

[0862] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tctgatatattgtggtgtaaaa-3' (SEQ ID NO: 343).

[0863] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[0864] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tctaatatattgtggtgtaaaa-3' (SEQ ID NO: 347).

[0865] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-attgatatattgtggtgtacca-3' (SEQ ID NO: 349).

[0866] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtgtacca-3' (SEQ ID NO: 230).

[0867] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-atggatatattgtggtataaat-3' (SEQ ID NO: 352).

[0868] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtataaat-3' (SEQ ID NO: 354).

[0869] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary comprising 5'-ttggatttattgtggtgtaacc-3' (SEQ ID NO: 356).

[0870] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tttattgtggtgtaacc-3' (SEQ ID NO: 358).

[0871] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-agagatatattgtggtttaaaa-3' (SEQ ID NO: 360).

[0872] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtttaaaa-3' (SEQ ID NO: 211).

[0873] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-caggatatattgtcgtgtcttc-3' (SEQ ID NO: 1007).

[0874] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary comprising 5'-tatattgtcgtgtcttc-3' (SEQ ID NO: 1008).

[0875] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-accaatatattgtggtataaac-3' (SEQ ID NO: 365).

[0876] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtataaac-3' (SEQ ID NO: 367).

[0877] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-ttctatatattgtggtctaaaa-3' (SEQ ID NO: 369).

[0878] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-tatattgtggtctaaaa-3' (SEQ ID NO: 371).

[0879] In one embodiment, the plant is sugarcane, and the PT-DNA has a processed left boundary containing 5'-atgaatatattgtggtataaat-3' (SEQ ID NO: 373).

[0880] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains a 5'-ttttgaatattgtggtgtaaacctaaactccttgtgtgagtgttgaaagcttg-3' (SEQ ID NO: 382), or a 5' fragment containing 5'-ttttgaatattgtggtgtaaac-3' (SEQ ID NO: 383).

[0881] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-aatattgtggtgtaaacctaaactccttgtgtgagtgttgaaagcttg-3' (SEQ ID NO: 384), or a 5' fragment containing 5'-aatattgtggtgtaaac-3' (SEQ ID NO: 385).

[0882] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgttataacctatttgcataa-3' (SEQ ID NO: 386), or a 5' fragment of it containing 5'-caggatatattgttataacctattt-3' (SEQ ID NO: 1112).

[0883] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgttataacctatttgcataa-3' (SEQ ID NO: 387), or a 5' fragment containing 5'-tatattgttataacctatttgcat-3' (SEQ ID NO: 1113).

[0884] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattttggggtaggtaaagtctgcttgctg-3' (SEQ ID NO: 388), or a 5' fragment containing 5'-caggatatattttggggtaggt-3' (SEQ ID NO: 389).

[0885] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattttggggtaggtaaagtctgcttgctg-3' (SEQ ID NO: 390), or a 5' fragment containing 5'-tatattttggggtaggt-3' (SEQ ID NO: 391).

[0886] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatatttttgtgtaggggccaataagctacttttctaa-3' (SEQ ID NO: 392), or a 5' fragment containing 5'-caggatatatttttgtgtaggg-3' (SEQ ID NO: 393).

[0887] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatatttttgtgtaggggccaataagctacttttctaa-3' (SEQ ID NO: 394), or a 5' fragment containing 5'-tatatttttgtgtaggg-3' (SEQ ID NO: 395).

[0888] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgtggtggacaggagatg-3' (SEQ ID NO: 396), or a 5' fragment containing 5'-gaggatatattgtggtggacag-3' (SEQ ID NO: 397).

[0889] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtggacaggagatg-3' (SEQ ID NO: 398), or a 5' fragment thereof containing 5'-tatattgtggtggacag-3' (SEQ ID NO: 399).

[0890] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-caggatatattgcagtttaggaactctg-3' (SEQ ID NO: 400), or a 5' fragment of it containing 5'-caggatatattgcagtttagga-3' (SEQ ID NO: 401).

[0891] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgcagtttaggaactctg-3' (SEQ ID NO: 402), or a 5' fragment thereof containing 5'-tatattgcagtttagga-3' (SEQ ID NO: 403).

[0892] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgttgtgttaggatgatatttggatc-3' (SEQ ID NO: 404), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0893] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgttgtgttaggatgatatttggatc-3' (SEQ ID NO: 406), or a 5' fragment containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0894] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-atatctatattgtggtggaaactcttttttgaaactgg-3' (SEQ ID NO: 408), or a 5' fragment containing 5'-atatctatattgtggtggaaac-3' (SEQ ID NO: 409).

[0895] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgtggtggaaactcttttttgaaactgg-3' (SEQ ID NO: 410), or a 5' fragment containing 5'-tatattgtggtggaaac-3' (SEQ ID NO: 179).

[0896] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgttgtgttaggctgatagttggatcatttt-3' (SEQ ID NO: 411), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0897] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgttgtgttaggctgatagttggatcatttt-3' (SEQ ID NO: 412), or a 5' fragment containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0898] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgttgtgttaggctgatatttgga-3' (SEQ ID NO: 413), or a 5' fragment containing 5'-gaggatatattgttgtgttagg-3' (SEQ ID NO: 405).

[0899] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgttgtgttaggctgatatttgga-3' (SEQ ID NO: 414), or a 5' fragment of it containing 5'-tatattgttgtgttagg-3' (SEQ ID NO: 407).

[0900] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-gaggatatattgttgtgttagtctgattgtgg-3' (SEQ ID NO: 415), or a 5' fragment containing 5'-gaggatatattgttgtgttagt-3' (SEQ ID NO: 416).

[0901] In one embodiment, the plant is a potato, and a portion of the left boundary of the PT-DNA used for integration into the genome contains 5'-tatattgttgtgttagtctgattgtgg-3' (SEQ ID NO: 417), or a 5' fragment thereof containing 5'-tatattgttgtgttagt-3' (SEQ ID NO: 418).

[0902] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggttttgaatattgtggtgtaaacctaaactccttgtgtgagtgttgaaagcttg-3' (SEQ ID NO: 718), or a 5' fragment containing 5'-tggttttgaatattgtggtgtaaac-3' (SEQ ID NO: 719), or wherein the 5' t is replaced by c (SEQ ID NO: 720).

[0903] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattgttataacctatttgcataa-3' (SEQ ID NO: 721), or a 5' fragment containing 5'-tggcaggatatattgttataaccta-3' (SEQ ID NO: 1014), or wherein the 5' t is replaced by c (SEQ ID NO: 722).

[0904] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattttggggtaggtaaagtctgcttgctg-3' (SEQ ID NO: 723), or a 5' fragment containing 5'-tggcaggatatattttggggtaggt-3' (SEQ ID NO: 724), or wherein the 5' t is replaced by c (SEQ ID NO: 725).

[0905] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggcaggatatatttttgtgtaggggccaataagctacttttctaa-3' (SEQ ID NO: 726), or a 5' fragment containing 5'-tggcaggatatatttttgtgtaggg-3' (SEQ ID NO: 727), or wherein the 5' t is replaced by c (SEQ ID NO: 728).

[0906] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tgggaggatatattgtggtggacaggagatg-3' (SEQ ID NO: 729), or a 5' fragment containing 5'-tgggaggatatattgtggtggacag-3' (SEQ ID NO: 730), or wherein the 5' t is replaced by c (SEQ ID NO: 731).

[0907] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggcaggatatattgcagtttaggaactctg-3' (SEQ ID NO: 732), or a 5' fragment containing 5'-tggcaggatatattgcagtttagga-3' (SEQ ID NO: 733), or wherein the 5' t is replaced by c (SEQ ID NO: 734).

[0908] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tgggaggatatattgttgtgttaggatgatatttggatc-3' (SEQ ID NO: 735), or a 5' fragment containing 5'-tgggaggatatattgttgtgttagg-3' (SEQ ID NO: 736), or wherein the 5' t is replaced by c (SEQ ID NO: 737).

[0909] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tggatatctatattgtggtggaaactcttttttgaaactgg-3' (SEQ ID NO: 738), or a 5' fragment containing 5'-tggatatctatattgtggtggaaac-3' (SEQ ID NO: 739), or wherein the 5' t is replaced by c (SEQ ID NO: 740).

[0910] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tgggaggatatattgttgtgttaggctgatagttggatcatttt-3' (SEQ ID NO: 741), or a 5' fragment containing 5'-tgggaggatatattgttgtgttagg-3' (SEQ ID NO: 736), or wherein the 5' t is replaced by c (SEQ ID NO: 742).

[0911] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tgggaggatatattgttgtgttaggctgatatttgga-3' (SEQ ID NO: 743), or a 5' fragment containing 5'-tgggaggatatattgttgtgttagg-3' (SEQ ID NO: 736), or wherein the 5' t is replaced by c (SEQ ID NO: 744).

[0912] In one embodiment, the plant is a potato, and the left boundary of the PT-DNA contains a 5'-tgggaggatatattgttgtgttagtctgattgtgg-3' (SEQ ID NO: 745), or a 5' fragment containing 5'-tgggaggatatattgttgtgttagt-3' (SEQ ID NO: 746), or wherein the 5' t is replaced by c (SEQ ID NO: 747).

[0913] In one embodiment, the plant is a potato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-agtatgatgctgtgcataaactatcagtatttga-3' (SEQ ID NO: 419), or 5'-taaactatcagtatttga-3' (SEQ ID NO: 420) or 5'-ttga-3' (SEQ ID NO: 62).

[0914] In one embodiment, the plant is a potato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-gtatgtaatttcttatttgattcaaactatcagtttttga-3' (SEQ ID NO: 748), or 5'-caaactatcagtttttga-3' (SEQ ID NO: 195) or 5'-ttga-3' (SEQ ID NO: 62).

[0915] In one embodiment, the plant is a potato, and a portion of the right boundary of the PT-DNA used for integration into the genome contains a 3' fragment of 5'-gaaaatgtatgaagagaggaaaaacttccagtgtttga-3' (SEQ ID NO: 421), or 5'-aaaacttccagtgtttga-3' (SEQ ID NO: 422) or 5'-ttga-3' (SEQ ID NO: 62).

[0916] In one embodiment, the plant is a potato, and the right boundary of the PT-DNA contains a 3' fragment of 5'-agtatgatgctgtgcataaactatcagtatttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 749), or a fragment of 5'-taaactatcagtatttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 750) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0917] In one embodiment, the plant is a potato, and the right boundary of the PT-DNA contains a 3' fragment of 5'-gtatgtaatttcttatttgattcaaactatcagtttttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 751), or a fragment of 5'-caaactatcagtttttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 561) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0918] In one embodiment, the plant is a potato, and the right boundary of the PT-DNA contains a 3' fragment of 5'-gaaaatgtatgaagagaggaaaaacttccagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 752), or a fragment of 5'-aaaacttccagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 753) or 5'-ttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 449).

[0919] As another example, the present invention provides plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome.

[0920] In one embodiment, the PT-DNA has one or more of the features defined above regarding the Ti plasmid.

[0921] In one embodiment, the 3' end of any left boundary provided herein is replaced by one of the following sequences or any naturally occurring Agrobacterium genus left boundary: 5'-cggcaggatatattgaattgtaaat-3' (SEQ ID NO: 754), 5'-cggcaggatatattcaattgtaaac-3' (SEQ ID NO: 755), 5'-cggcaggatatatttagttgtaaaa-3' (SEQ ID NO: 756), 5'-tggcaggatatattgtgatgtaaac-3' (SEQ ID NO: 767), 5'-tggcaggatatattgtggtgtaaac-3' (SEQ ID NO: 758), 5'-tggcaggatatatcaaagtgtaagt-3' (SEQ ID NO: 759), 5'-tggcaggatatatcgaggtgtaaaa-3' (SEQ ID NO: 759). 760), 5'-tggcaggatgtattgtcatgtaaaa-3' (SEQ ID NO: 761), 5'-tggcaggatatatcgttatgtaatc-3' (SEQ ID NO: 762), 5'-tggcaggatatattggtgtgtaaac-3' (SEQ ID NO: 763), 5'-yggcaggatrtatyndndtgtaadh-3' (SEQ ID NO: 764), where y is t or c, r is g or a, n is a, c, g or t, d is a, g or t, and h is a, c or t.

[0922] In one embodiment, the 3' end or a portion of the left boundary of any processed left boundary herein is replaced by one of the following sequences or any naturally occurring Agrobacterium genus left boundary: 5'-caggatatattgaattgtaaat-3' (SEQ ID NO: 765), 5'-caggatatattcaattgtaaac-3' (SEQ ID NO: 766), 5'-caggatatatttagttgtaaaa-3' (SEQ ID NO: 767), 5'-caggatatattgtgatgtaaac-3' (SEQ ID NO: 768), 5'-caggatatattgtggtgtaaac-3' (SEQ ID NO: 769), 5'-caggatatatcaaagtgtaagt-3' (SEQ ID NO: 770), 5'-caggatatatcgaggtgtaaaa-3' (SEQ ID NO: 770), 5'-caggatatatcgaggtgtaaaa-3' (SEQ ID NO: 769). 771), 5'-caggatgtattgtcatgtaaaa-3' (SEQ ID NO: 772), 5'-caggatatatcgttatgtaatc-3' (SEQ ID NO: 773), 5'-caggatatattggtgtgtaaac-3' (SEQ ID NO: 774), 5'-caggatrtatyndndtgtaadh-3' (SEQ ID NO: 775), where y is t or c, r is g or a, n is a, c, g or t, d is a, g or t, and h is a, c or t.

[0923] In one embodiment, the 3' end or a portion of the left boundary of any processed left boundary herein is replaced by one of the following sequences or any naturally occurring Agrobacterium genus left boundary: 5'-tatattgaattgtaaat-3' (SEQ ID NO: 776), 5'-tatattcaattgtaaac-3' (SEQ ID NO: 777), 5'-tatatttagttgtaaaa-3' (SEQ ID NO: 778), 5'-tatattgtgatgtaaac-3' (SEQ ID NO: 251), 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779), 5'-tatatcaaagtgtaagt-3' (SEQ ID NO: 780), 5'-tatatcgaggtgtaaaa-3' (SEQ ID NO: 781), 5'-tgtattgtcatgtaaaa-3' (SEQ ID NO: 25 ... 782), 5'-tatatcgttatgtaatc-3' (SEQ ID NO: 783), 5'-tatattggtgtgtaaac-3' (SEQ ID NO: 784), 5'-trtatyndndtgtaadh-3' (SEQ ID NO: 785), where y is t or c, r is g or a, n is a, c, g or t, d is a, g or t, and h is a, c or t.

[0924] In one embodiment, the sequence 5'-tgacaggatatattggcgggtaaac-3' (SEQ ID NO: 786) in any right boundary provided herein is replaced by one of the following sequences or any naturally occurring Agrobacterium right boundary: 5'-tgacaggatatataccgttgtaatt-3' (SEQ ID NO: 787), 5'-tggcaggatatataccgttgtaatt-3' (SEQ ID NO: 788), 5'-tggcaggatatatgccgttgtaatt-3' (SEQ ID NO: 789), 5'-tgacaggatatatggtgatgtcacg-3' (SEQ ID NO: 790), 5'-tgacaggatatatgttcctgtcatg-3' (SEQ ID NO: 791), 5'-tgacaggatatatcttgtggtcagg ... 792), 5'-tgacaggatttatcgttatgtcatg-3' (SEQ ID NO: 793), 5'-tggcaggatttattgctaagtcatc-3' (SEQ ID NO: 794), 5'-tggcaggatgtatcagattgtagtg-3' (SEQ ID NO: 795) or 5'-tgrcaggatdtatnnbnndgtmrnb-3' (SEQ ID NO: 796), where r is g or a, d is a, g or t, n is a, c, g or t, b is c, g or t, d is a, g or t, and m is a or c.

[0925] In one embodiment, the PT-DNA of the present invention and / or its left boundary does not have any additional 5' nucleotides beyond those disclosed herein.

[0926] In one embodiment, the 5' fragment or a portion thereof or a processed version of the left boundary provided herein has one, two, three, four, five or more nucleotides at the 3' end corresponding to the nucleotides of the longer version of the fragment provided herein.

[0927] In one embodiment, the 5' tgg or cgg of the PT-DNA of the present invention can be ttg.

[0928] In one embodiment, the T-DNA of the present invention used with Piggybac has a left boundary containing TTAA.

[0929] WT-DNA In one embodiment, PT-DNA is wheat transfer DNA (WT-DNA). WT-DNA may be part of a Ti plasmid or may have been processed and is present in the genome of a wheat plant.

[0930] For example, the present invention provides a wheat plant having wheat transfer DNA (WT-DNA) integrated into the genome of the plant, wherein the integrated WT-DNA has only wheat DNA, and wherein the WT-DNA contains the polynucleotide of interest.

[0931] In one embodiment, the integrated WT-DNA has a processed WT-DNA right boundary, or any portion lacking a WT-DNA right boundary.

[0932] In one embodiment, the integrated WT-DNA has a processed WT-DNA left boundary, or any portion lacking a WT-DNA left boundary.

[0933] In one embodiment, the integrated WT-DNA includes a processed WT-DNA right boundary, a processed WT-DNA left boundary, and the polynucleotide of interest.

[0934] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779).

[0935] In one embodiment, the processed left boundary of WT-DNA in the wheat genome contains 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[0936] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtggtgttggg-3' (SEQ ID NO: 798).

[0937] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gtagttatattgtggtgtaaac-3' (SEQ ID NO: 799).

[0938] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtagacaactc-3' (SEQ ID NO: 800).

[0939] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gaggatatattgtggtgataaa-3' (SEQ ID NO: 801).

[0940] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gatcctatattgtggtgtaaaa-3' (SEQ ID NO: 802).

[0941] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtgccggccta-3' (SEQ ID NO: 803).

[0942] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-aatgatatattgtggtgtatga-3' (SEQ ID NO: 804).

[0943] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gcagatatattgtggtgtatgc-3' (SEQ ID NO: 805).

[0944] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgttggcctact-3' (SEQ ID NO: 806).

[0945] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-cgggatatattgtggtgtgtgc-3' (SEQ ID NO: 807).

[0946] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-atctctatattgtggtgtaaaa-3' (SEQ ID NO: 808).

[0947] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtggttctgta-3' (SEQ ID NO: 809).

[0948] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-atccagatattgtggtgtaaac-3' (SEQ ID NO: 810).

[0949] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-attcagatattgtggtgtaaac-3' (SEQ ID NO: 811).

[0950] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-taggatatattgtgctgtaatt-3' (SEQ ID NO: 812).

[0951] In one embodiment, the processed left border of WT-DNA in the wheat genome comprises 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1281), caggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggcatttggtttcacattcttaagcatgattactccattc-3' (SEQ ID NO: 1282), 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatccacc-3' (SEQ ID NO: 1283), 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatccac-3' (SEQ ID NO: 1284), 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatcca-3' (SEQ ID NO: 1285), 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatcc-3' (SEQ ID NO: 1286), 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatc-3' (SEQ ID NO:1287)、5'-caggatatattgtggtgtaaactctatcaactggtactgtattat-3'(SEQ ID NO: 1288)、5'-caggatatattgtggtgtaaactctatcaactggtactgtatta-3'(SEQ ID NO: 1289)、5'-caggatatattgtggtgtaaactctatcaactggtactgtatt-3'(SEQ ID NO: 1290)、5'-caggatatattgtggtgtaaactctatcaactggtactgtat-3'(SEQ ID NO:1291)、5'-caggatatattgtggtgtaaactctatcaactggtactgta-3'(SEQ ID NO: 1292)、5'-caggatatattgtggtgtaaactctatcaactggtactgt-3'(SEQ ID NO: 1293)、5'-caggatatattgtggtgtaaactctatcaactggtactg-3'(SEQ ID NO: 1294)、5'-caggatatattgtggtgtaaactctatcaactggtact-3'(SEQ ID NO: 1295)、5'-caggatatattgtggtgtaaactctatcaactggtac-3'(SEQ ID NO: 1296)、5'-caggatatattgtggtgtaaactctatcaactggta-3'(SEQ ID NO:1297)、5'-caggatatattgtggtgtaaactctatcaactggt-3'(SEQ ID NO: 1298)、5'-caggatatattgtggtgtaaactctatcaactgg-3'(SEQ ID NO: 1299)、5'-caggatatattgtggtgtaaactctatcaactg-3'(SEQ ID NO: 1300)、5'-caggatatattgtggtgtaaactctatcaact-3'(SEQ ID NO:1301)、5'-caggatatattgtggtgtaaactctatcaac-3'(SEQ ID NO: 1302)、5'-caggatatattgtggtgtaaactctatcaa-3'(SEQ ID NO:1303), 5'-caggatatattgtggtgtaaactctatca-3' (SEQ ID NO: 1304), 5'-caggatatattgtggtgtaaactctatc-3' (SEQ ID NO: 1305), 5'-tggcaggatatattgtggtgtaaactctat-3' (SEQ ID NO: 1306), 5'-caggatatattgtggtgtaaactcta-3' (SEQ ID NO: 1307), 5'-caggatatattgtggtgtaaactct-3' (SEQ ID NO: 1308), 5'-caggatatattgtggtgtaaactc-3' (SEQ ID NO: 1309), 5'-caggatatattgtggtgtaaact-3' (SEQ ID NO: 1310). In one embodiment, the sequence provided above lacks the 5' nucleotide cagga, examples of which include, but are not limited to, 5'-tatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgag-3' (SEQ ID NO: 813), or a 5' fragment comprising 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779) or 5'-tatattgtggtgtaaact-3' (SEQ ID NO: 1495). In one embodiment, the sequence provided above lacks the 5' nucleotide cagg. In one embodiment, the sequence provided above lacks the 5' nucleotide cag. In one embodiment, the sequence provided above lacks the 5' nucleotide ca. In another embodiment, the sequence provided above lacks the 5' nucleotide c.

[0952] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains a 5'-taggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 814), or a 5' fragment containing 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[0953] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains a 5'-tatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 815), or a 5' fragment containing 5'-tatattgtggtgtgatt-3' (SEQ ID NO: 816).

[0954] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtggtgttgggattctctggttct-3' (SEQ ID NO: 817), or a 5' fragment containing 5'-caggatatattgtggtgttggg-3' (SEQ ID NO: 798).

[0955] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgttgggattctctggttct-3' (SEQ ID NO: 818), or a 5' fragment containing 5'-tatattgtggtgttggg-3' (SEQ ID NO: 819).

[0956] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gtagttatattgtggtgtaaactctatc-3' (SEQ ID NO: 820), or a 5' fragment containing 5'-gtagttatattgtggtgtaaac-3' (SEQ ID NO: 799).

[0957] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtaaactctatc-3' (SEQ ID NO: 821), or a 5' fragment containing 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779).

[0958] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtagacaactc-3' (SEQ ID NO: 800).

[0959] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtagacaactc-3' (SEQ ID NO: 822).

[0960] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtagacaactct-3' (SEQ ID NO: 823).

[0961] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtagacaactct-3' (SEQ ID NO: 824).

[0962] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gaggatatattgtggtgataaaagctatctc-3' (SEQ ID NO: 825), or a 5' fragment containing 5'-gaggatatattgtggtgataaa-3' (SEQ ID NO: 801).

[0963] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgataaaagctatctc-3' (SEQ ID NO: 826), or a 5' fragment containing 5'-tatattgtggtgataaa-3' (SEQ ID NO: 827).

[0964] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gatcctatattgtggtgtaaaatatatcgagctagtagtg-3' (SEQ ID NO: 828), or a 5' fragment containing 5'-gatcctatattgtggtgtaaaa-3' (SEQ ID NO: 802).

[0965] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtaaaatatatcgagctagtagtg-3' (SEQ ID NO: 829), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[0966] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtgccggcctaaggaccaagagggtctac-3' (SEQ ID NO: 830), or a 5' fragment containing 5'-caggatatattgtgccggccta-3' (SEQ ID NO: 803).

[0967] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtgccggcctaaggaccaagagggtctac-3' (SEQ ID NO: 831), or a 5' fragment containing 5'-tatattgtgccggccta-3' (SEQ ID NO: 832).

[0968] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-aatgatatattgtggtgtatgagatcatgttcttgt-3' (SEQ ID NO: 833), or a 5' fragment containing 5'-aatgatatattgtggtgtatga-3' (SEQ ID NO: 804).

[0969] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtatgagatcatgttcttgt-3' (SEQ ID NO: 835), or a 5' fragment containing 5'-tatattgtggtgtatga-3' (SEQ ID NO: 836).

[0970] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gcagatatattgtggtgtatgcacacacccttc-3' (SEQ ID NO: 837), or a 5' fragment containing 5'-gcagatatattgtggtgtatgc-3' (SEQ ID NO: 805).

[0971] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtatgcacacacccttc-3' (SEQ ID NO: 838), or a 5' fragment containing 5'-tatattgtggtgtatgc-3' (SEQ ID NO: 839).

[0972] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgttggcctactccagtcat-3' (SEQ ID NO: 840), or a 5' fragment containing 5'-caggatatattgttggcctact-3' (SEQ ID NO: 806).

[0973] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgttggcctactccagtcat-3' (SEQ ID NO: 841), or a 5' fragment containing 5'-tatattgttggcctact-3' (SEQ ID NO: 842).

[0974] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-cgggatatattgtggtgtgtgcgctgtgtctctttc-3' (SEQ ID NO: 843), or a 5' fragment containing 5'-cgggatatattgtggtgtgtgc-3' (SEQ ID NO: 807).

[0975] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtgtgcgctgtgtctctttc-3' (SEQ ID NO: 844), or a 5' fragment containing 5'-tatattgtggtgtgtgc-3' (SEQ ID NO: 845).

[0976] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-atctctatattgtggtgtaaaagcaag-3' (SEQ ID NO: 846), or a 5' fragment containing 5'-atctctatattgtggtgtaaaa-3' (SEQ ID NO: 808).

[0977] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtaaaagcaag-3' (SEQ ID NO: 847), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[0978] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-caggatatattgtggttctgtaatctct-3' (SEQ ID NO: 848), or a 5' fragment containing 5'-caggatatattgtggttctgta-3' (SEQ ID NO: 809).

[0979] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggttctgtaatctct-3' (SEQ ID NO: 849), or a 5' fragment containing 5'-tatattgtggttctgta-3' (SEQ ID NO: 850).

[0980] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-atccagatattgtggtgtaaacatacactgtgaat-3' (SEQ ID NO: 851), or a 5' fragment containing 5'-atccagatattgtggtgtaaac-3' (SEQ ID NO: 810).

[0981] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gatattgtggtgtaaacatacactgtgaat-3' (SEQ ID NO: 852), or a 5' fragment containing 5'-gatattgtggtgtaaac-3' (SEQ ID NO: 853).

[0982] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-attcagatattgtggtgtaaacatacactgtgaatgg-3' (SEQ ID NO: 854), or a 5' fragment containing 5'-attcagatattgtggtgtaaac-3' (SEQ ID NO: 811).

[0983] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-gatattgtggtgtaaacatacactgtgaatgg-3' (SEQ ID NO: 855), or a 5' fragment containing 5'-gatattgtggtgtaaac-3' (SEQ ID NO: 853).

[0984] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-taggatatattgtggtgtgatttgtgggccagctctcatat-3' (SEQ ID NO: 856), or a 5' fragment containing 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[0985] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtggtgtgatttgtgggccagctctcatat-3' (SEQ ID NO: 857), or a 5' fragment containing 5'-tatattgtggtgtgatt-3' (SEQ ID NO: 816).

[0986] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-taggatatattgtgctgtaatttgtgggccaactctcat-3' (SEQ ID NO: 858), or a 5' fragment containing 5'-taggatatattgtgctgtaatt-3' (SEQ ID NO: 812).

[0987] In one embodiment, the processed left boundary of the WT-DNA in the wheat genome contains 5'-tatattgtgctgtaatttgtgggccaactctcat-3' (SEQ ID NO: 859), or a 5' fragment containing 5'-tatattgtgctgtaatt-3' (SEQ ID NO: 860).

[0988] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains 5'-aactatcagtgtgtttga-3' (SEQ ID NO: 861), or a 3' fragment containing 5'-ttga-3' (SEQ ID NO: 62).

[0989] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains a 3' fragment of 5'-atattgctttgcttgtcccaggaactatcagtgtttga-3' (SEQ ID NO: 862) or 5'-ttga-3' (SEQ ID NO: 62).

[0990] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains a 3' fragment of 5'-tattgctttgcttgtcctaggaactatcagtgtttga-3' (SEQ ID NO: 864) or 5'-ggaactatcagtgtttga-3' (SEQ ID NO: 863) or 5'-ttga-3' (SEQ ID NO: 62).

[0991] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains a 3' fragment of 5'-atttgttgtggaaatgtctaaactttcagtgtttga-3' (SEQ ID NO: 865) or 5'-ttga-3' (SEQ ID NO: 62).

[0992] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains 5'-tacaaaaatattcagacctaaaatatcagtgtttga-3' (SEQ ID NO: 867), or a 3' fragment containing 5'-taaaatatcagtgtttga-3' (SEQ ID NO: 376) or 5'-ttga-3' (SEQ ID NO: 62).

[0993] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains a 3' fragment of 5'-tgtttgaccaagttctagaataaactatcagtatttga-3' (SEQ ID NO: 868) or 5'-taaactatcagtatttga-3' (SEQ ID NO: 420) or 5'-ttga-3' (SEQ ID NO: 62).

[0994] In one embodiment, the processed right boundary of the WT-DNA in the wheat genome contains a 3' fragment of 5'-ctggcagagattgctgtggaatgtattaaccttgacgtcgatcaaaggcccacgatgacagatgtcgaggaccgccttctcatgctgaaccgatcttgtaggtcgcaagctgtttagctatatataagttgatgcatattatggtgtggacaacatttatgtattcgaatatgataggcaactatcagtgtttga-3' (SEQ ID NO: 869), or a fragment of 5'-aactatcagtgtgtttga-3' (SEQ ID NO: 861) or 5'-ttga-3' (SEQ ID NO: 62).

[0995] In one embodiment, the processed right boundary of WT-DNA in the wheat genome contains 5'-caactatcagtgtgtttga-3' (SEQ ID NO: 870).

[0996] In one embodiment, the polynucleotide of interest encodes a wheat protein.

[0997] Examples of polynucleotides of interest include, but are not limited to, those encoding wheat proteins that confer enhanced disease resistance, enhanced salt tolerance, increased starch yield, increased yield, increased grain size, drought resistance, or enhanced nutrient content.

[0998] In one embodiment, the disease is a fungal disease. In one embodiment, the fungal disease is mold, wilt, rot, smut, or rust. In one embodiment, the disease is a fungal disease. In one embodiment, the fungal disease is mold, wilt, rot, or rust. In one embodiment, the fungal disease is rust.

[0999] As another example, the present invention provides a tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), wherein the Ti plasmid contains wheat transfer DNA (WT-DNA) for integration into the genome of a wheat plant, wherein the WT-DNA contains the polynucleotide of interest and has only wheat DNA, wherein the 5' end of the WT-DNA contains a portion of the left boundary for integration into the genome, and the 3' end of the WT-DNA contains a portion of the right boundary for integration into the genome.

[1000] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779).

[1001] In one embodiment, the left boundary of the WT-DNA contains a 5' fragment of 5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgag-3' (SEQ ID NO: 871), or a 5' fragment containing 5'-tggcaggatatattgtggtgtaaac-3' (SEQ ID NO: 758), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 872 and 1482. Additional examples of this region of the wheat genome include 5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagag tcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (seq ID NO:1311)、tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtat aaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggcatttggtttcacattcttaagcatgattactccattc-3' (seq ID NO:1312)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccacc-3'(SEQ ID NO: 1313)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccac-3'(SEQ ID NO: 1314)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatcca-3'(SEQ ID NO: 1315)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatcc-3'(SEQ ID NO: 1316)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatc-3'(SEQ ID NO: 1317)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattat-3'(SEQ ID NO: 1318)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtatta-3'(SEQ ID NO: 1319)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtatt-3'(SEQ ID NO: 1320)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtat-3'(SEQ ID NO: 1321)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgta-3'(SEQ ID NO: 1322)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactgt-3'(SEQ ID NO: 1323)、5'-tggcaggatatattgtggtgtaaactctatcaactggtactg-3'(SEQ ID NO: 1324)、5'-tggcaggatatattgtggtgtaaactctatcaactggtact-3'(SEQ IDNO: 1325)、5'-tggcaggatatattgtggtgtaaactctatcaactggtac-3'(SEQ ID NO:1326), 5'-tggcaggatatattgtggtgtaaactctatcaactggta-3' (SEQ ID NO: 1327), 5'-tggcaggatatattgtggtgtaaactctatcaactggt-3' (SEQ ID NO: 1328), 5'-tggcaggatatattgtggtgtaaactctatcaactgg-3' (SEQ ID NO: 1329), 5'-tggcaggatatattgtggtgtaaactctatcaactg-3' (SEQ ID NO: 1330), 5'-tggcaggatatattgtggtgtaaactctatcaact-3' (SEQ ID NO: 1331), 5'-tggcaggatatattgtggtgtaaactctatcaac-3' (SEQ ID NO: 1332), 5'-tggcaggatatattgtggtgtaaactctatcaa-3' (SEQ ID NO: 1333), 5'-tggcaggatatattgtggtgtaaactctatca-3' (SEQ ID NO: 1334), 5'-tggcaggatatattgtggtgtaaactctatc-3' (SEQ ID NO: 1335), 5'-tggcaggatatattgtggtgtaaactctat-3' (SEQ ID NO: 1336), 5'-tggcaggatatattgtggtgtaaactcta-3' (SEQ ID NO: 1337), 5'-tggcaggatatattgtggtgtaaactct-3' (SEQ ID NO: 1338), 5'-tggcaggatatattgtggtgtaaactc-3' (SEQ ID NO: 1339), 5'-tggcaggatatattgtggtgtaaact-3' (SEQ ID NO: 1340), or wherein 5' t is replaced by c. In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains any of the above sequences lacking 5' tgg or cgg.

[1002] In one embodiment, the left boundary includes 5'-tggcaggatatattgtggtgtaaac-3' (SEQ ID NO:758) or 5'-cggcaggatatattgtggtgtaaac-3' (SEQ ID NO: 1450).

[1003] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[1004] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtggtgttggg-3' (SEQ ID NO: 798) or 5'-tatattgtggtgttggg-3' (SEQ ID NO: 819).

[1005] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gtagttatattgtggtgtaaac-3' (SEQ ID NO: 799) or 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779).

[1006] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtagacaactc-3' (SEQ ID NO: 800) or 5'-tatattgtagacaactc-3' (SEQ ID NO: 822).

[1007] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gaggatatattgtggtgataaa-3' (SEQ ID NO: 801) or 5'-tatattgtggtgataaa-3' (SEQ ID NO: 827).

[1008] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gatcctatattgtggtgtaaaa-3' (SEQ ID NO: 802) or 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[1009] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtgccggccta-3' (SEQ ID NO: 803) or 5'-tatattgtgccggccta-3' (SEQ ID NO: 832).

[1010] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-aatgatatattgtggtgtatga-3' (SEQ ID NO: 804) or 5'-tatattgtggtgtatga-3' (SEQ ID NO: 873).

[1011] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gcagatatattgtggtgtatgc-3' (SEQ ID NO: 805) or 5'-gcagatatattgtggtgtatgc-3' (SEQ ID NO: 805).

[1012] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgttggcctact-3' (SEQ ID NO: 806) or 5'-caggatatattgttggcctact-3' (SEQ ID NO: 806).

[1013] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-cgggatatattgtggtgtgtgc-3' (SEQ ID NO: 807) or 5'-cgggatatattgtggtgtgtgc-3' (SEQ ID NO: 807).

[1014] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-atctctatattgtggtgtaaaa-3' (SEQ ID NO: 808) or 5'-atctctatattgtggtgtaaaa-3' (SEQ ID NO: 808).

[1015] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtggttctgta-3' (SEQ ID NO: 809) or 5'-caggatatattgtggttctgta-3' (SEQ ID NO: 809).

[1016] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-atccagatattgtggtgtaaac-3' (SEQ ID NO: 810) or 5'-atccagatattgtggtgtaaac-3' (SEQ ID NO: 810).

[1017] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-attcagatattgtggtgtaaac-3' (SEQ ID NO: 811) or 5'-attcagatattgtggtgtaaac-3' (SEQ ID NO: 811).

[1018] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797) or 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[1019] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-taggatatattgtgctgtaatt-3' (SEQ ID NO: 812) or 5'-taggatatattgtgctgtaatt-3' (SEQ ID NO: 812).

[1020] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains a 5'-taggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 814), or a 5' fragment containing 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[1021] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaagaaataaaagaaagtataaataaaaagaaagtataaataaaaagaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccagcccacgtcggccttccact-3' (SEQ ID NO: 815), or a 5' fragment containing 5'-tatattgtggtgtgatt-3' (SEQ ID NO: 816).

[1022] In one embodiment, the left boundary of the WT-DNA contains 5'-tggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 874) or 5'-cggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 875).

[1023] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtggtgttgggattctctggttct-3' (SEQ ID NO: 817), or a 5' fragment thereof containing 5'-caggatatattgtggtgttggg-3' (SEQ ID NO: 798).

[1024] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgttgggattctctggttct-3' (SEQ ID NO: 818), or a 5' fragment thereof containing 5'-tatattgtggtgttggg-3' (SEQ ID NO: 819).

[1025] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gtagttatattgtggtgtaaactctatc-3' (SEQ ID NO: 820), or a 5' fragment containing 5'-gtagttatattgtggtgtaaac-3' (SEQ ID NO: 799).

[1026] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtaaactctatc-3' (SEQ ID NO: 821), or a 5' fragment thereof containing 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779).

[1027] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtagacaactc-3' (SEQ ID NO: 800).

[1028] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtagacaactc-3' (SEQ ID NO: 822).

[1029] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtagacaactct-3' (SEQ ID NO: 823).

[1030] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtagacaactct-3' (SEQ ID NO: 824).

[1031] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gaggatatattgtggtgataaaagctatctc-3' (SEQ ID NO: 825), or a 5' fragment thereof containing 5'-gaggatatattgtggtgataaa-3' (SEQ ID NO: 801).

[1032] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgataaaagctatctc-3' (SEQ ID NO: 826), or a 5' fragment thereof containing 5'-tatattgtggtgataaa-3' (SEQ ID NO: 827).

[1033] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gatcctatattgtggtgtaaaatatatcgagctagtagtg-3' (SEQ ID NO: 828), or a 5' fragment containing 5'-gatcctatattgtggtgtaaaa-3' (SEQ ID NO: 802).

[1034] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtaaaatatatcgagctagtagtg-3' (SEQ ID NO: 829), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[1035] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtgccggcctaaggaccaagagggtctac-3' (SEQ ID NO: 830), or a 5' fragment containing 5'-caggatatattgtgccggccta-3' (SEQ ID NO: 803).

[1036] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtgccggcctaaggaccaagagggtctac-3' (SEQ ID NO: 831), or a 5' fragment containing 5'-tatattgtgccggccta-3' (SEQ ID NO: 832).

[1037] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-aatgatatattgtggtgtatgagatcatgttcttgt-3' (SEQ ID NO: 833), or a 5' fragment containing 5'-aatgatatattgtggtgtatga-3' (SEQ ID NO: 804).

[1038] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtatgagatcatgttcttgt-3' (SEQ ID NO: 835), or a 5' fragment containing 5'-tatattgtggtgtatga-3' (SEQ ID NO: 836).

[1039] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gcagatatattgtggtgtatgcacacacccttc-3' (SEQ ID NO: 837), or a 5' fragment containing 5'-gcagatatattgtggtgtatgc-3' (SEQ ID NO: 805).

[1040] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtatgcacacacccttc-3' (SEQ ID NO: 838), or a 5' fragment containing 5'-tatattgtggtgtatgc-3' (SEQ ID NO: 839).

[1041] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgttggcctactccagtcat-3' (SEQ ID NO: 840), or a 5' fragment thereof containing 5'-caggatatattgttggcctact-3' (SEQ ID NO: 806).

[1042] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgttggcctactccagtcat-3' (SEQ ID NO: 841), or a 5' fragment thereof containing 5'-tatattgttggcctact-3' (SEQ ID NO: 842).

[1043] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-cgggatatattgtggtgtgtgcgctgtgtctctttc-3' (SEQ ID NO: 843), or a 5' fragment thereof containing 5'-cgggatatattgtggtgtgtgc-3' (SEQ ID NO: 807).

[1044] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtgtgcgctgtgtctctttc-3' (SEQ ID NO: 844), or a 5' fragment thereof containing 5'-tatattgtggtgtgtgc-3' (SEQ ID NO: 845).

[1045] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-atctctatattgtggtgtaaaagcaag-3' (SEQ ID NO: 846), or a 5' fragment thereof containing 5'-atctctatattgtggtgtaaaa-3' (SEQ ID NO: 808).

[1046] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtaaaagcaag-3' (SEQ ID NO: 847), or a 5' fragment containing 5'-tatattgtggtgtaaaa-3' (SEQ ID NO: 345).

[1047] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-caggatatattgtggttctgtaatctct-3' (SEQ ID NO: 848), or a 5' fragment thereof containing 5'-caggatatattgtggttctgta-3' (SEQ ID NO: 809).

[1048] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggttctgtaatctct-3' (SEQ ID NO: 849), or a 5' fragment thereof containing 5'-tatattgtggttctgta-3' (SEQ ID NO: 850).

[1049] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-atccagatattgtggtgtaaacatacactgtgaat-3' (SEQ ID NO: 851), or a 5' fragment containing 5'-atccagatattgtggtgtaaac-3' (SEQ ID NO: 810).

[1050] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gatattgtggtgtaaacatacactgtgaat-3' (SEQ ID NO: 852), or a 5' fragment thereof containing 5'-gatattgtggtgtaaac-3' (SEQ ID NO: 853).

[1051] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-attcagatattgtggtgtaaacatacactgtgaatgg-3' (SEQ ID NO: 854), or a 5' fragment containing 5'-attcagatattgtggtgtaaac-3' (SEQ ID NO: 811).

[1052] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-gatattgtggtgtaaacatacactgtgaatgg-3' (SEQ ID NO: 855), or a 5' fragment containing 5'-gatattgtggtgtaaac-3' (SEQ ID NO: 853).

[1053] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-taggatatattgtggtgtgatttgtgggccagctctcatat-3' (SEQ ID NO: 856), or a 5' fragment containing 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797).

[1054] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtggtgtgatttgtgggccagctctcatat-3' (SEQ ID NO: 857), or a 5' fragment containing 5'-tatattgtggtgtgatt-3' (SEQ ID NO: 816).

[1055] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-taggatatattgtgctgtaatttgtgggccaactctcat-3' (SEQ ID NO: 858), or a 5' fragment containing 5'-taggatatattgtgctgtaatt-3' (SEQ ID NO: 812).

[1056] In one embodiment, a portion of the left boundary of the WT-DNA for integration into the genome contains 5'-tatattgtgctgtaatttgtgggccaactctcat-3' (SEQ ID NO: 859), or a 5' fragment containing 5'-tatattgtgctgtaatt-3' (SEQ ID NO: 860).

[1057] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggcaggatatattgtggtgttgggattctctggttct-3' (SEQ ID NO: 876), or a 5' fragment containing 5'-tggcaggatatattgtggtgttggg-3' (SEQ ID NO: 877), or wherein the 5' t is replaced by c. See, for example, but not limited to, SEQ ID NO: 878 and 1451.

[1058] In one embodiment, the left boundary of the WT-DNA contains a 5'-tgggttatattgtggtgtaaactctatc-3' (SEQ ID NO: 879), or a 5' fragment containing 5'-tgggtagttatattgtggtgtaaac-3' (SEQ ID NO: 880), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 881 and 1452.

[1059] In one embodiment, the left boundary of the WT-DNA contains 5'-tggcaggatatattgtagacaactc-3' (SEQ ID NO: 882), or wherein the 5' t is replaced by c (SEQ ID NO: 883).

[1060] In one embodiment, the left boundary of the WT-DNA contains 5'-tggcaggatatattgtagacaactct-3' (SEQ ID NO: 884), or wherein the 5' t is replaced by c (SEQ ID NO: 885).

[1061] In one embodiment, the left boundary of the WT-DNA contains a 5'-tgggaggatatattgtggtgataaaagctatctc-3' (SEQ ID NO: 886), or a 5' fragment containing 5'-tgggaggatatattgtggtgataaa-3' (SEQ ID NO: 887), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 888 and 1453.

[1062] In one embodiment, the left boundary of the WT-DNA contains a 5'-tgggatcctatattgtggtgtaaaatatatcgagctagtagtg-3' (SEQ ID NO: 889), or a 5' fragment containing 5'-tgggatcctatattgtggtgtaaaa-3' (SEQ ID NO: 890), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 891 and 1454.

[1063] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggcaggatatattgtgccggcctaaggaccaagagggtctac-3' (SEQ ID NO: 892), or a 5' fragment containing 5'-tggcaggatatattgtgccggccta-3' (SEQ ID NO: 893), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 894 and 1455.

[1064] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggaatgatatattgtggtgtatgagatcatgttcttgt-3' (SEQ ID NO: 895), or a 5' fragment containing 5'-tggatgatatattgtggtgtatga-3' (SEQ ID NO: 896), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 897 and 1456.

[1065] In one embodiment, the left boundary of the WT-DNA contains a 5'-tgggcagatatattgtggtgtatgcacacacccttc-3' (SEQ ID NO: 898), or a 5' fragment containing 5'-tgggcagatatattgtggtgtatgc-3' (SEQ ID NO: 899), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 900 and 1457.

[1066] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggcaggatatattgttggcctactccagtcat-3' (SEQ ID NO: 901), or a 5' fragment containing 5'-tggcaggatatattgttggcctact-3' (SEQ ID NO: 902), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 903 and 1458.

[1067] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggcgggatatattgtggtgtgtgcgctgtgtctctttc-3' (SEQ ID NO: 904), or a 5' fragment containing 5'-tggcgggatatattgtggtgtgtgc-3' (SEQ ID NO: 905), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 906 and 1459.

[1068] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggatctctatattgtggtgtaaaagcaag-3' (SEQ ID NO: 907), or a 5' fragment containing 5'-tggatctctatattgtggtgtaaaa-3' (SEQ ID NO: 908), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 909 and 1460.

[1069] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggcaggatatattgtggttctgtaatctct-3' (SEQ ID NO: 910), or a 5' fragment containing 5'-tggcaggatatattgtggttctgta-3' (SEQ ID NO: 911), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 912 and 1461.

[1070] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggatccagatattgtggtgtaaacatacactgtgaat-3' (SEQ ID NO: 913), or a 5' fragment containing 5'-tggatccagatattgtggtgtaaac-3' (SEQ ID NO: 914), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 915 and 1462.

[1071] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggattcagatattgtggtgtaaacatacactgtgaatgg-3' (SEQ ID NO: 916), or a 5' fragment containing 5'-tggattcagatattgtggtgtaaac-3' (SEQ ID NO: 917), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 918 and 1463.

[1072] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggtaggatatattgtggtgtgatttgtgggccagctctcatat-3' (SEQ ID NO: 919), or a 5' fragment containing 5'-tggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 874), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 920 and 1464.

[1073] In one embodiment, the left boundary of the WT-DNA contains a 5'-tggtaggatatattgtgctgtaatttgtgggccaactctcat-3' (SEQ ID NO: 921), or a 5' fragment containing 5'-tggtaggatatattgtgctgtaatt-3' (SEQ ID NO: 922), or wherein the 5' t is replaced by c, see, for example, but not limited to, SEQ ID NO: 923 and 1465.

[1074] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-ctggcagagattgctgtggaatgtattaaccttgacgtcgatcaaaggcccacgatgacagatgtcgaggaccgccttctcatgctgaaccgatcttgtaggtcgcaagctgtttagctatatataagttgatgcatattatggtgtggacaacatttatgtattcgaatatgataggcaactatcagtgtttga-3' (SEQ ID NO: 869), or a fragment of 5'-aactatcagtgtgtttga-3' (SEQ ID NO: 861).

[1075] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains 5'-caactatcagtgtgtttga-3' (SEQ ID NO: 870), or a 3' fragment containing 5'-aactatcagtgtgtttga-3' (SEQ ID NO: 861) or 5'-ttga-3' (SEQ ID NO: 62).

[1076] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-atattgctttgcttgtcccaggaactatcagtgtttga-3' (SEQ ID NO: 862) or 5'-ttga-3' (SEQ ID NO: 62).

[1077] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-tattgctttgcttgtcctaggaactatcagtgtttga-3' (SEQ ID NO: 864) or 5'-ggaactatcagtgtttga-3' (SEQ ID NO: 863) or 5'-ttga-3' (SEQ ID NO: 62).

[1078] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-atttgttgtggaaatgtctaaactttcagtgtttga-3' (SEQ ID NO: 865), or a fragment of 5'-taaactttcagtgtttga-3' (SEQ ID NO: 866) or 5'-ttga-3' (SEQ ID NO: 62).

[1079] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-tacaaaaatattcagacctaaaatatcagtgtttga-3' (SEQ ID NO: 867) or 5'-ttga-3' (SEQ ID NO: 62).

[1080] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-tgtttgaccaagttctagaataaactatcagtatttga-3' (SEQ ID NO: 868) or 5'-taaactatcagtatttga-3' (SEQ ID NO: 420) or 5'-ttga-3' (SEQ ID NO: 62).

[1081] In one embodiment, the right boundary contains 5'-tgacaggatatattggcgggtaaac-3' (SEQ ID NO:786).

[1082] In one embodiment, the right boundary of the WT-DNA contains 5'-aactatcagtgtgtttgatgacaggatatattggcgggtaaac-3' (SEQ ID NO: 924) or 5'-tgacaggatatattggcgggtaaac-3' (SEQ ID NO: 786).

[1083] In one embodiment, a portion of the right boundary of the WT-DNA for integration into the genome contains a 3' fragment of 5'-ctggcagagattgctgtggaatgtattaaccttgacgtcgatcaaaggcccacgatgacagatgtcgaggaccgccttctcatgctgaaccgatcttgtaggtcgcaagctgtttagctatatataagttgatgcatattatggtgtggacaacatttatgtattcgaatatgataggcaactatcagtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 925), or a fragment of 5'-aactatcagtgtgtttgacaggatatattggcgggtaaac-3' (SEQ ID NO: 926).

[1084] In one embodiment, a portion of the right boundary of the WT-DNA for integration ...

Claims

1. A method for use with Agrobacterium spp. ( Agrobacterium )-mediated gene transfer (AMGT) transfer DNA (T-DNA), said T-DNA comprising a first component and a second component, wherein i) The first component is plant transfer DNA (PT-DNA) for integration into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of the left boundary for integration into the genome or has the left boundary, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome, and ii) The second component is within the first component, wherein the second component is a transposable element comprising a polynucleotide encoding an optional marker.

2. The T-DNA according to claim 1, wherein... i) The second component is within or directly adjacent to the left boundary of the PT-DNA, and / or ii) The second component is within 1,000 bp, 500 bp, 250 bp, 200 bp, 150 bp, or 100 bp of the 5' end of the first component.

3. The T-DNA according to claim 1 or claim 2, wherein... i) When present in plant cells, the second component can be excised from the T-DNA by a transposase, leaving only plant DNA, and / or ii) The optional markers are herbicide resistance genes or antibiotic resistance genes.

4. A plant transfer DNA (PT-DNA) for Agrobacterium-mediated gene transfer (AMGT) integrated into the genome of a plant, wherein the PT-DNA contains the polynucleotide of interest and has only DNA from the plant, wherein the 5' end of the PT-DNA contains a portion of or has the left boundary for integration into the genome, and the 3' end of the PT-DNA contains a portion of the right boundary for integration into the genome, and wherein... i) The PT-DNA is wheat transfer DNA (WT-DNA), and the left boundary contains SEQ ID NO: 1340, SEQ ID NO: 1450, SEQ ID NO: 877, SEQ ID NO: 1451, SEQ ID NO: 880, SEQ ID NO: 1452, SEQ ID NO: 882, SEQ ID NO: 883, SEQ ID NO: 884, SEQ ID NO: 885, SEQ ID NO: 887, SEQ ID NO: 1453, SEQ ID NO: 890, SEQ ID NO: 1454, SEQ ID NO: 893, SEQ ID NO: 1455, SEQ ID NO: 896, SEQ ID NO: 1456, SEQ ID NO: 899, SEQ ID NO: 1457, SEQ ID NO: 902, SEQ ID NO: 1458, SEQ ID NO: 905, SEQ ID NO: 1459, SEQ ID NO: 908, SEQ ID NO: 1460, SEQ ID NO: 911, SEQ ID NO: 1461, SEQ ID NO: 914, SEQ ID NO: 1462, SEQ ID NO: 917, SEQ ID NO: 1463, SEQ ID NO: 874, SEQ ID NO: 1464, SEQ ID NO: 922 or SEQ ID NO:1465, or ii) The PT-DNA is soybean transfer DNA (ST-DNA), and the left boundary contains SEQ ID NO: 977, SEQ ID NO: 1466, SEQ ID NO: 974, SEQ ID NO: 1467, SEQ ID NO: 982, SEQ ID NO: 1468, SEQ ID NO: 985, SEQ ID NO: 1469, SEQ ID NO: 988, SEQ ID NO: 1470, SEQ ID NO: 991, SEQ ID NO: 1471, SEQ ID NO: 994, SEQ ID NO: 1472, SEQ ID NO: 997 or SEQ ID NO: 1473, or iii) The plant is barley, and the left boundary comprises SEQ ID NO: 1500, SEQ ID NO: 607, SEQ ID NO: 1474, SEQ ID NO: 612, SEQ ID NO: 1475, SEQ ID NO: 615, SEQ ID NO: 1476, SEQ ID NO: 618, SEQ ID NO: 1477, SEQ ID NO: 621, SEQ ID NO: 1478, SEQ ID NO: 624, SEQ ID NO: 1479, SEQ ID NO: 627, SEQ ID NO: 1480, SEQ ID NO: 630, SEQ ID NO: 1481, SEQ ID NO: 635, SEQ ID NO: 1483, SEQ ID NO: 638, or SEQ ID NO: 1484, or iv) The plant is sugarcane, and the left boundary includes SEQ ID NO: 683, SEQ ID NO: 1485, SEQ ID NO: 686, SEQ ID NO: 1486, SEQ ID NO: 689, SEQ ID NO: 1487, SEQ ID NO: 692, SEQ ID NO: 1488, SEQ ID NO: 695, SEQ ID NO: 1489, SEQ ID NO: 698, SEQ ID NO: 1490, SEQ ID NO: 1011, SEQ ID NO: 1491, SEQ ID NO: 703, SEQ ID NO: 1492, SEQ ID NO: 706, SEQ ID NO: 1493, SEQ ID NO: 709, or SEQ ID NO: 1494.

5. The PT-DNA of claim 4, wherein the left boundary of the WT-DNA comprises i) 5'-tggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1311), or a 5' fragment thereof comprising 5'-tggcaggatatattgtggtgtaaact-3' (SEQ ID NO: 1340), ii) 5'-cggcaggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1496), or a 5' fragment thereof comprising 5'-cggcaggatatattgtggtgtaaac-3' (SEQ ID NO: 1450), iii) 5'-tggtaggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaaagaaa taaaagaaagtataaataaaaagaaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccacgtcggccttccact-3' (seq ID NO: 1497), or a 5' fragment thereof containing 5'-tggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 874), or iv) 5'-cggtaggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaaagaaat aaaagaaagtataaataaaaagaaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccacgtcggccttccact-3' (SEQ ID NO: 1498), or a 5' fragment thereof comprising 5'-cggtaggatatattgtggtgtgatt-3' (SEQ ID NO: 1464).

6. A tumor-inducing (Ti) plasmid for Agrobacterium-mediated gene transfer (AMGT), said Ti plasmid comprising T-DNA according to any one of claims 1 to 3 or PT-DNA according to claim 4 or 5.

7. A plant or a part thereof, said plant or part thereof having T-DNA according to any one of claims 1 to 3.

8. A plant or a part thereof, said plant or part thereof having plant transfer DNA (PT-DNA) integrated into the genome of said plant or part thereof, wherein the integrated PT-DNA has only DNA from the plant, and wherein said PT-DNA contains the polynucleotide of interest, and wherein i) The plant is wheat, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 1310, SEQ ID NO: 797, SEQ ID NO: 798, SEQ ID NO: 799, SEQ ID NO: 800, SEQ ID NO: 801, SEQ ID NO: 802, SEQ ID NO: 803, SEQ ID NO: 804, SEQ ID NO: 805, SEQ ID NO: 806, SEQ ID NO: 807, SEQ ID NO: 808, SEQ ID NO: 809, SEQ ID NO: 810, SEQ ID NO: 811, SEQ ID NO: 1495, SEQ ID NO: 812, SEQ ID NO: 816, SEQ ID NO: 819, SEQ ID NO: 822, SEQ ID NO: 823, SEQ ID NO: 824, SEQ ID NO: 827 ... NO: 345, SEQ ID NO: 832, SEQ ID NO: 836, SEQ ID NO: 839, SEQ ID NO: 842, SEQ ID NO: 845, SEQ ID NO: 850, SEQ ID NO: 853 or SEQ ID NO: 860, or ii) The plant is soybean, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 939, SEQ ID NO: 936, SEQ ID NO: 946, SEQ ID NO: 949, SEQ ID NO: 952, SEQ ID NO: 956, SEQ ID NO: 959, SEQ ID NO: 962, SEQ ID NO: 152, SEQ ID NO: 941, SEQ ID NO: 345, SEQ ID NO: 385, SEQ ID NO: 954, SEQ ID NO: 314 or SEQ ID NO: 303, or iii) The plant is barley, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 251, SEQ ID NO: 249, SEQ ID NO: 255, SEQ ID NO: 257, SEQ ID NO: 259, SEQ ID NO: 261, SEQ ID NO: 263, SEQ ID NO: 265, SEQ ID NO: 267, SEQ ID NO: 269, SEQ ID NO: 271, SEQ ID NO: 273, SEQ ID NO: 275, SEQ ID NO: 277, SEQ ID NO: 279, SEQ ID NO: 281, SEQ ID NO: 285, SEQ ID NO: 287, SEQ ID NO: 289 or SEQ ID NO: 291, or iv) The plant is sugarcane, and the PT-DNA has a processed left boundary, said processed left boundary comprising SEQ ID NO: 343, SEQ ID NO: 345, SEQ ID NO: 347, SEQ ID NO: 349, SEQ ID NO: 230, SEQ ID NO: 352, SEQ ID NO: 354, SEQ ID NO: 356, SEQ ID NO: 358, SEQ ID NO: 360, SEQ ID NO: 211, SEQ ID NO: 1007, SEQ ID NO: 1008, SEQ ID NO: 365, SEQ ID NO: 367, SEQ ID NO: 369, SEQ ID NO: 371 or SEQ ID NO:

373.

9. The plant according to claim 7 or claim 8, wherein the PT-DNA integrated into the genome of the plant or a portion thereof comprises i) 5'-caggatatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1281), or a 5' fragment thereof comprising 5'-caggatatattgtggtgtaaact-3' (SEQ ID NO: 1310), ii) 5'-tatattgtggtgtaaactctatcaactggtactgtattatccaccttatacgcgtcatcatttgtgccaacattggtgtggtctagggtataaataagacagacatatgccctccatcagttaatttcagtcaaccaattcctgaatcaaccaggctctgcaagagaagagtcgcggctcggggtgacttttgtttctaagctgcatgtggttctgagattgagaattcctcatttggtttcacattcttaagcatgattactccattcttaattgggcctataactcatagcagagcatacacatttgaatttctttattatcttcttgaacaattactttttgtcaattcatattccatag-3' (SEQ ID NO: 1499), or a 5' fragment thereof comprising 5'-tatattgtggtgtaaac-3' (SEQ ID NO: 779), iii) 5'-taggatatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaaagaaata aaagaaagtataaataaaaagaaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccacgtcggccttccact-3' (SEQ ID NO: 814), or a 5' fragment thereof containing 5'-taggatatattgtggtgtgatt-3' (SEQ ID NO: 797), or iv) 5'-tatattgtggtgtgatttgtgggccagctctcatattttacaaaactcatttggtgcccaaacaattagccaaaacagaaaagaaaagaaataaaa gaaagtataaataaaaagaaaggcctggcctttactgtgccaccgggcctaagtgctacagtgcacaaaggcccagcccacgtcggccttccact-3' (seq ID NO: 815), or a 5' fragment thereof comprising 5'-tatattgtggtgtgatt-3' (SEQ ID NO: 816).

10. The plant according to any one of claims 7 to 9, wherein the integrated PT-DNA has a processed right boundary comprising SEQ ID NO:

870.

11. The plant according to any one of claims 7 to 10, wherein the polynucleotide of interest comes from the same plant genus or species.

12. The plant according to any one of claims 7 to 11, wherein the polynucleotide of interest encodes a protein that confers enhanced disease resistance, preferably resistance to fungal diseases.

13. The plant according to claim 12, wherein the fungal disease is mold, wilt, rot, smut, or rust.

14. A method for producing genetically modified plants, said method comprising infecting plant cells with Agrobacterium (… Agrobacterium sp.) contact, wherein the Agrobacterium contains the Ti plasmid according to claim 6.

15. The method of claim 14, wherein the cells are cells of an injured plant tissue explant.

16. The method of claim 15, wherein the explant is cultured to generate callus after contact with the Agrobacterium.

17. A plant produced by the method according to any one of claims 14 to 16.

18. A method for producing genetically modified plants, the method comprising the steps of: i) Hybridizing two parent plants, wherein at least one of the plants is a plant according to any one of claims 7 to 13 or 17. ii) Screening for the presence or absence of integrated PT-DNA in one or more progeny plants from the hybridization described in i), and iii) Select progeny plants containing the integrated PT-DNA. This produces the plant.

19. The method of claim 18, wherein one parent plant is the plant of claim 7, and the other parent plant is a transgenic plant expressing a transposase, and step ii) comprises screening for the presence or absence of the second component from the one or more progeny plants of the hybridization, and step iii) comprises selecting progeny plants lacking the second component.

20. A plant produced by the method according to claim 18 or claim 19.

21. A method for identifying a plant according to any one of claims 7 to 13, 17 or 20, the method comprising: i) Obtain samples from plants containing genomic DNA. ii) Screen the sample for the presence or absence of integrated PT-DNA.

22. The method of claim 21, wherein the plant is the plant of claim 7, and the method further comprises screening the sample for the absence of the second component.

23. A method for generating the left boundary of T-DNA for Agrobacterium-mediated gene transfer (AMGT), the method comprising: i) Search the genome of the plant species of interest for polynucleotides of 22 to 25 bases in length that share at least 16 nucleotides with the left boundary of the Agrobacterium Ti plasmid, among which... a) If the polynucleotide is 22 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 22 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. b) If the polynucleotide is 23 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 23 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. c) If the polynucleotide is 24 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 24 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. ii) Generate T-DNA with a left boundary sequence, wherein a) The left boundary of the T-DNA contains the polynucleotide, wherein the polynucleotide is 25 bases in length, or b) If the polynucleotide does not have 5'-tgg or 5'-cgg and / or is not 25 bases in length, the polynucleotide is modified to have a length of 25 bases and have 5'-tgg or 5'-cgg to produce the left boundary sequence, and iii) Use AMGT to determine whether the T-DNA can be used to transform the plant species of interest.

24. A method for generating the left boundary of T-DNA for Agrobacterium-mediated gene transfer (AMGT), the method comprising: i) Search the genome of the plant species of interest for polynucleotides of 22 to 25 bases in length that share at least 16 nucleotides with the left boundary of the Agrobacterium Ti plasmid, among which... a) If the polynucleotide is 22 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 22 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. b) If the polynucleotide is 23 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 23 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. c) If the polynucleotide is 24 bases in length, then search the genome for polynucleotides that share at least 16 nucleotides with the 24 3' nucleotides at the left boundary of the Agrobacterium Ti plasmid. ii) Generate T-DNA with a left boundary sequence, wherein if the polynucleotide does not have 5'-tggcagga or 5'-cggcagga and / or is not 25 bases in length, the polynucleotide is modified such that it is 25 bases in length and has 5'-tggcagga or 5'-cggcagga to generate the left boundary, and iii) Use AMGT to determine whether the T-DNA can be used to transform the plant species of interest.

25. A method for producing plant parts, the method comprising: a) to cause the plant to grow according to any one of claims 7 to 13, 17 or 20, and b) Collect the plant parts.

26. A method for producing flour, whole wheat flour, starch, seed flour, oil, or other products derived from seeds, the method comprising: a) Obtaining seeds from the plant according to any one of claims 7 to 13, 17 or 20, and b) Extract the flour, the whole wheat flour, the starch, the seed flour, the oil, or the other product.

27. A product produced from a plant and / or a portion thereof according to any one of claims 7 to 13, 17 or 20, wherein the product comprises integrated PT-DNA.

28. A method for preparing a food, the method comprising mixing the seeds of a plant according to any one of claims 7 to 13, 17 or 20, or flour, whole wheat flour, starch, seed flour or oil obtained from said seeds, with another food ingredient.

29. Use of a plant or a portion thereof according to any one of claims 7 to 13, 17 or 20, for use as animal feed or for producing feed for animals or food for human consumption.

30. Use of the plant according to claim 12 or claim 13 for controlling or limiting one or more fungal pathogens in crop production.

Images