MEAT PRODUCTION IN VITRO

Description

[0001] The present invention relates to a method for producing a composition containing animal protein. The present invention further relates to the use of a culture medium having a reduced methionine content of at most 5 µM compared to the standard medium, for differentiating mesenchymal stem cells from an umbilical cord of a farm animal, and to a method for in vitro Production of a meat-like composition.

[0002] By 2050, the world's population will increase to approximately 10 billion. One of the most significant challenges in this context is ensuring food security on a global scale, and specifically the supply of high-quality protein. Conventional meat production using farm animals plays a crucial role in this; it has already tripled in the last 50 years. Since negative environmental and climate impacts must be avoided despite the rising demand, and sustainable meat production requires a reduction in livestock numbers, alternative production methods must be found. One option is so-called "in-vitro meat," which is considered an environmentally friendly and resource-conserving alternative to conventional meat (Stephens et al., 2018; Thorrez & Vandenburgh, 2019). Gaydhane et al. discuss the advantages and disadvantages of cultured meat versus in-vitro meat (Mrunalini K. Gaydhane, Urbashi Mahanta, Chandra S.Sharma, Mudrika Khandelwal, Seeram Ramakrishna, Biomanufacturing Reviews, Vol. 3, No. 1, March 19, 2018).

[0003] Although the basic method for producing meat from animal cells (beef, chicken, seafood) is known, it is currently only produced on a laboratory scale, i.e., in small quantities, and is therefore still very expensive. To date, muscle tissue from slaughtered animals is mostly used to obtain the source cells, or muscle biopsies are performed on live animals, so ethical problems persist. The cells obtained are adult stem cells, so-called satellite cells, whose proliferation and differentiation capacity is already significantly limited. They also exhibit a high degree of heterogeneity, and cell quality is subject to strong fluctuations depending on the donor animal, due, for example, to differences in age and genetics, as well as environmental influences.

[0004] Alternatively, the company "Meatable" primarily uses bovine hematopoietic stem cells derived from umbilical cord blood. However, hematopoietic stem cells must be genetically modified (reprogrammed) to form muscle and fat cells.

[0005] WO 2006 / 041429 A1 describes the use of embryonic stem cells from fertilized oocytes for the production of meat products. The isolation of cells from umbilical cord tissue has been described for various species, most frequently for humans (Ishige et al., 2009; Corotchi et al., 2013), but also for ruminants (e.g., Cardoso et al., 2012) and horses (Hoynowski et al., 2007). The isolation of mesenchymal stem cells (MSCs) from the umbilical cord matrix of pigs was described by Carlin et al. (Carlin et al., 2006).

[0006] Mesenchymal stem cells (MSCs) can generally be obtained by growing cells from tissue explants or by enzymatic digestion of the tissue (Moretti et al., 2010). Enzymatic digestion utilizes, among other things, collagenases, trypsin, dispase, and hyaluronidase, which are derived from animal materials and therefore carry a risk of contamination (Marcus-Sekura et al., 2011). Furthermore, it has been demonstrated that the efficiency of isolation (yield of viable cells) is higher when using the explant method, as cell damage is avoided (e.g., Arutyunyan et al., 2016).

[0007] Since MSCs derived from umbilical cord tissue (UC-MSCs) migrate into the umbilical cord at an early stage of embryogenesis, they are characterized by a unique blend of prenatal (embryonic) and postnatal (adult) stem cell properties (Wang et al., 2004; Arutyunyan et al., 2016). For example, UC-MSCs exhibit high biosafety because they lack inflammatory and tumorigenic potential. Another advantage of UC-MSCs is their high and long-lasting bioavailability. in vitro-Proliferation rate (short doubling time: 21–45 h, 7 to approximately 25 serial passages with a >300-fold increase in cell count) with a stable stem cell phenotype, because the production of large, homogeneous cell quantities while maintaining stem cell properties (Moretti et al., 2010; Pham et al., 2016; Arutyunyan et al., 2016) is a crucial requirement for the production of cell-based meat. The positive properties of UC-MSCs in this respect result, among other things, from the fact that they still express marker proteins of embryonic SCs (e.g., Okt4, SOX2, Nanog) (Beeravolu et al., 2016; Pham et al., 2016), which inhibit differentiation. Under differentiating conditions, they can also form a variety of cell types, such as fat cells, muscle cells, cartilage cells, bone cells, bone marrow stromal cells, but also nerve cells, vascular wall cells, cardiac muscle cells, liver-like cells and β-cells of the pancreas (Ishige et al., 2009; Wang et al., 2011; Corotchi, 2013; Pham et al., 2016; Shivakumar et al., 2016). It is also a positive aspect that UC-MSCs are derived from newborns and therefore have not yet been altered by aging and environmental influences.

[0008] The conversion of UC-MSCs into myogenic cells, or the formation of muscle fibers, is the key step in the production of cell-based meat. However, the differentiation of UC-MSCs into muscle cells has been little studied to date. Cultivation in myogenic medium with serum deprivation and the addition of 5-azacytidine (Conconi et al., 2006) has been described as a method for inducing myogenic differentiation; alternatively, cells have been transfected with myogenic genes (MyoD: Kocaefe et al., 2010). Thus far, the differentiation of MSCs into muscle cells has been achieved chemically or through genetic manipulation. In adult muscle stem cells, induction is achieved by the removal or reduction of fetal bovine serum (FBS), a key component of cell culture media.

[0009] Despite existing knowledge, there is a high demand for improved means and methods for the in vitro production of meat-like products, especially on a large scale. This problem is solved by the subject matter of the independent claims, optionally supplemented by the features of the dependent claims and the present description.

[0010] Therefore, the present invention relates to a method for producing a composition containing animal protein, comprising (a) Isolation of mesenchymal stem cells from an umbilical cord of a farm animal, preferably from the family Suidae; (b) Incubation of the mesenchymal stem cells under conditions that lead to myogenic differentiation of the mesenchymal stem cells; and (c) Harvesting of the myogenically differentiated cells.

[0011] In this description, the terms "contain," "encompass," or "include," and any grammatical variations thereof, are used in a non-exclusive sense. These terms can refer, on the one hand, to a situation in which, apart from the features introduced by the terms, no further features are present in the described object, but also to a situation in which one or more further features are present. For example, the expressions "A encompasses B," "A contains B," and "A includes B" can indicate both a situation in which no other element is present in A besides B (i.e., a situation in which A consists exclusively of B), and a situation in which, besides B, one or more further elements are present in A, such as element C, elements C and D, or even other elements.Accordingly, the expressions "comprising a" and "containing a" preferably refer to "comprising one or more"; i.e., they are equivalent to "comprising at least one".

[0012] Furthermore, the terms "preferred," "more preferred," "even more preferred," "most preferred," "in particular," "specific," or similar terms are used in the following in connection with optional features, without excluding further possibilities. Features introduced by these terms are therefore to be understood as optional features and do not limit the scope of the claims in any way. As the person skilled in the art will understand, the invention can be carried out using alternative features. Likewise, features introduced by an expression such as "in one embodiment" or similar formulations are to be understood as optional features, without limiting the possibility of developing further embodiments, without limiting the invention, and without restricting the possibility of providing further combinations of features with other optional or non-optional features.

[0013] Unless otherwise specified, the term "standard conditions" refers to IUPAC Standard Ambient Temperature and Pressure (SATP), i.e., preferably a temperature of 25 °C and an absolute pressure of 100 kilopascals; more preferably, standard conditions also include a pH of 7. Unless otherwise specified, the term "approximately" refers to the stated value with the generally accepted engineering accuracy in the relevant field; preferably, the term refers to the stated value ± 20%, preferably ± 10%, more preferably ± 5%. Furthermore, the term "essentially" refers to the absence of deviations that affect the stated result; that is, any disturbances result in a deviation of no more than ± 20%, preferably ± 10%, more preferably ± 5% from the stated value.The term "essentially consisting of" therefore refers to the specified components to the exclusion of other components, except for those present as impurities, components that are unavoidable byproducts of the manufacturing process, and components added for a purpose different from the technical effect of the invention. For example, a composition described as "essentially consisting of" may additionally contain ordinary additives, excipients, diluents, carriers, or the like. Preferably, a composition consisting essentially of a set of components contains less than 5% (w / w), more preferably less than 3% (w / w), more preferably less than 1% (w / w), and even more preferably less than 0.1% (w / w) of unspecified components.

[0014] The method for producing a composition containing animal protein is a in In vitro method. The method according to the invention may include additional steps beyond those expressly mentioned; for example, further steps may relate to the provision of umbilical cord or to further incubation and / or propagation steps with the obtained myogenically differentiated cells, e.g., comprising one or more steps of propagation of the mesenchymal stem cells and / or the obtained myogenically differentiated cells, and / or comprising a step of three-dimensional arrangement of the cells and preferably further propagation. One or more of the aforementioned steps may also be carried out in an automated manner.

[0015] In the context of the present invention, the term "animal" refers to a heterotrophic member of the domain Eukarya that forms an organism containing muscle cells. The term "farm animal" is used herein exclusively for farm animals that are mammals. Within the scope of the present invention, mesenchymal stem cells from an umbilical cord of a farm animal, preferably a member of the family Suidae, more preferably a member of the genus Sus, and most preferably a member of the species Sus scrofa, are used.

[0016] The term "animal protein" is used herein to refer to any protein of animal origin. The animal protein is therefore at least one polypeptide whose amino acid sequence corresponds to, or is preferably substantially identical to, the amino acid sequence of a protein from at least one animal. The term "protein" is used here in accordance with the usual usage of the term, both for a single polypeptide species and for a mixture of several, preferably many, different polypeptide species. The animal protein thus preferably contains a mixture of different polypeptide species. Preferably, the animal protein is contained in an animal cell and / or was produced by an animal cell.

[0017] The term "composition" is used herein for any preparation containing the specified component(s). The term "composition containing animal protein" therefore encompasses all preparations containing animal protein, regardless of the presence and / or proportion of other components, and regardless of the protein and / or water content of the composition. Preferably, the composition contains at least 5% (w / w), more preferably at least 10% (w / w), and even more preferably at least 25% (w / w) protein. Also preferably, the composition contains at least 1% (w / w) lipids, more preferably at least 5% (w / w) lipids. Preferably, the composition contains 1% (w / w) to 25% (w / w) lipids, and more preferably 5% (w / w) to 15% (w / w) lipids. Methods for determining the protein and fat content are known to those skilled in the art from general textbooks, e.g.AOAC International Official Methods for Analysis 17th Edition, AOAC International, Gaithersburg, MD, 2000; preferred are the Kjeldahl method for protein determination (Simonne et al., (1997), Journal of the Science of Food and Agriculture 73(1):39-45) and the Soxhlet method for determining fat content (Bastian et al. (1985), J Assoc Off Anal Chem 68(5):876-880). Preferably, the composition contains animal cells, preferably animal muscle cells; more preferably, the composition consists essentially of animal cells, preferably animal muscle cells. Preferably, the composition contains muscle fibers, thus preferably being a meat-like composition, preferably with a meat-like texture; accordingly, the composition preferably has a water content of 40% (w / w) to 75% (w / w), preferably 50% (w / w) to 65% (w / w).The composition can also be a dried composition with a water content of less than 10% (w / w), preferably less than 5% (w / w).

[0018] The term "precursor cells" herein refers to cells that have the capacity to differentiate into myocytes or myocyte-like cells. Preferably, the precursor cells do not produce desmin, F-actin, MyoD, MyoG, and / or myosin; accordingly, precursor cells are preferably not myocytes or myocyte-like cells. Preferably, the precursor cells express at least one marker selected from CD73, CD90, CD105, Oct4, Nanog, and Sox2. In the context of the present invention, mesenchymal stem cells are used, preferably perinatal mesenchymal stem cells. Preferably, the precursor cells can differentiate into at least myocytes and adipocytes.

[0019] The term "perinatal tissue" is used herein to refer to all tissues that are at least partially formed by the fetus of a mammal but are not part of the fetus itself. In particular, the term refers to all tissues or organs that are part of the afterbirth of a mammal, including, in particular, the umbilical cord, placenta, and / or amniotic membrane. Within the scope of the present invention, the umbilical cord of a farm animal or a part thereof is used. Such perinatal tissue is preferably obtained non-invasively during birth, preferably after excretion of the perinatal tissue from the maternal organism.

[0020] The term "proliferation of mesenchymal stem cells" is used herein in its usual, familiar meaning. The term therefore preferably refers to the incubation of mesenchymal stem cells under conditions that permit cell division of at least some of the mesenchymal stem cells, thus preferably leading to an increase in the total number of mesenchymal stem cells. Preferably, the proliferation of mesenchymal stem cells comprises introducing the mesenchymal stem cells into a culture medium, preferably a culture medium free of bovine serum, more preferably a culture medium free of serum from a farm animal, even more preferably a culture medium free of mammalian serum, and most preferably a serum-free culture medium. The culture medium preferably contains a portion of conditioned culture medium, preferably one of the serum-free culture media described above.Preferably, the proportion of conditioned medium is 5% (v / v) to 50% (v / v), more preferably 10% (v / v) to 40% (v / v), even more preferably 15% (v / v) to 30% (v / v), and most preferably approximately 20% (v / v) of the total volume of the medium. The term "conditioned medium" preferably refers to a medium obtained by incubating precursor cells, preferably from passages 1 or 2 after isolation, in the medium for at least one, more preferably at least two, and even more preferably at least three days. The serum-free medium may also preferably contain components obtained from the aforementioned conditioned medium. Preferred serum-free media are described herein in the exemplary embodiments.

[0021] The term "myogenic differentiation" is generally known to those skilled in the art. In the context of this description, the term refers to the development of mesenchymal stem cells into myocytes or myocyte-like cells, and in a preferred embodiment, into muscle fibers. This development can be verified by determining a decrease in the expression of mesenchymal stem cell markers, in particular those described elsewhere herein, and / or preferably by determining an increase in the expression of myocyte markers, in particular desmin, F-actin, MyoD, MyoG, and / or myosin. Corresponding methods are known to those skilled in the art and are shown herein in the exemplary embodiments.

[0022] Conditions that induce myogenic differentiation of precursor cells are generally known to experts. Mesenchymal stem cells can be genetically or chemically manipulated to undergo myogenic differentiation, for example, by overexpression of the factor MyoD, reducing the serum concentration in the culture medium from 10–20% to usually 2%, and / or by incubation in a medium containing 5-azacytosine. According to the invention, conditions leading to myogenic differentiation of mesenchymal stem cells include incubation in a nutrient medium, preferably serum-free, which has a reduced methionine content of at most 5 µM, preferably at most 4 µM, more preferably at most 3 µM, and even more preferably at most 2.5 µM, compared to the standard medium (preferably Dulbecco's modified Eagle medium; DMEM: 30 mg / l methionine, corresponding to 200 µM methionine).Most preferably, conditions leading to myogenic differentiation of mesenchymal stem cells include incubation in a culture medium without added methionine. In a preferred embodiment, conditions leading to myogenic differentiation of mesenchymal stem cells include incubation in a culture medium, preferably serum-free, which does not contain methionine (i.e., a concentration of 0 µM methionine as a free amino acid).

[0023] Preferably, contact between the mesenchymal stem cells and a solid surface is avoided during myogenic differentiation; in particular, adhesion of the mesenchymal stem cells to a solid or semi-solid substrate is preferably avoided. Also preferably, cell aggregation is promoted during differentiation to encourage the formation of a 3D structure. Therefore, the mesenchymal stem cells are preferably incubated in a suspended drop; corresponding methods are known to those skilled in the art.

[0024] In the experiments underlying the present invention, it was surprisingly found that mesenchymal stem cells capable of undergoing myogenic differentiation can be isolated from perinatal tissues, according to the invention from the umbilical cord of a farm animal. Surprisingly, it was found that such differentiation can be advantageously induced by incubation in a medium with a reduced methionine content of at most 5 µM. Furthermore, it was surprisingly found that all steps from the isolation of mesenchymal stem cells to their proliferation and the formation of myogenically differentiated cells can be carried out in serum-free medium and do not require any genetic manipulation of the cells.

[0025] The above definitions apply mutatis mutandis to the following. Additional definitions applied below also apply mutatis mutandis to all embodiments described herein.

[0026] Step (a) of the method of the present invention preferably comprises: (A) Providing at least one perinatal tissue from an umbilical cord of a farm animal; (B) crushing the perinatal tissue to obtain pieces of it; (C) incubating the pieces of perinatal tissue in a nutrient medium; (D) thereby obtaining mesenchymal stem cells.

[0027] This is a in vitro-Procedure. The method may include additional steps beyond those explicitly mentioned; for example, further steps may relate to cleaning and / or disinfecting the perinatal tissue prior to step B). One or more of the steps mentioned may also be performed automatically.

[0028] The step of fragmenting the perinatal tissue preferably includes cutting the tissue. Preferably, tissue pieces with a volume of 1 mm³ to 500 mm³, more preferably 2 mm³ to 100 mm³, are produced. The tissue pieces are preferably placed in an incubation device with at least one solid surface, preferably a container with a plastic surface, e.g., a Petri dish. Preferably, cells and / or tissues that adhere to the aforementioned solid surface during incubation are used as a basis for isolating precursor cells. The medium used for incubating the perinatal tissue is preferably serum-free.

[0029] The myogenically differentiated cells produced using the method according to the invention can be used to produce muscle, fat and / or connective tissue cells.

[0030] The method for myogenic differentiation of mesenchymal stem cells is a inIn vitro methods. The method may include additional steps beyond those explicitly mentioned; for example, further steps may relate to the provision of V mesenchymal stem cells and / or the use of the resulting myogenically differentiated cells. One or more of the aforementioned steps may also be performed in an automated manner.

[0031] The present invention also relates to the use of a culture medium having a reduced methionine content of at most 5 µM compared to the standard medium, for differentiating mesenchymal stem cells from the umbilical cord of a farm animal. As described above, the culture medium contains methionine at a concentration of at most 5 µM, preferably at most 4 µM, more preferably at most 3 µM, and even more preferably at most 2.5 µM. Most preferably, the culture medium contains no added methionine. A serum-free culture medium is also preferably used.

[0032] The present invention also relates to a method for producing a meat-like composition, comprising I) Myogenic differentiation of mesenchymal stem cells according to the inventive method for the myogenic differentiation of mesenchymal stem cells; II) Three-dimensional arrangement of the differentiated myogenically differentiated cells obtained in step I), in particular by using incubation in the "hanging drop" or similar methods; and III) Multiplication of the cells in the three-dimensional arrangement obtained in step II).

[0033] The method for producing a meat-like composition is a in vitro -Method. The method may include additional steps beyond those expressly mentioned; for example, further steps may relate to the provision of mesenchymal stem cells, preferably according to the inventive method for producing mesenchymal stem cells, or to further processing of the meat-like composition. One or more of the aforementioned steps may also be carried out in an automated manner.

[0034] The term "meat-like composition" is used broadly for compositions that resemble animal meat in composition, texture, and / or taste and that are suitable for use as meat substitutes in at least one application in the food industry or pharmaceuticals. Preferred applications in the food industry include sausage making and the production of minced meat, particularly burger patties. A preferred application in pharmaceuticals is muscle regeneration.

[0035] The term "three-dimensional arrangement" is familiar to those skilled in the art. Preferably, myogenically differentiated cells and / or microtissues derived therefrom are arranged in space, preferably embedded in a solid or, more preferably, semi-solid matrix. Suitable matrix materials are known to those skilled in the art; preferably biocompatible matrix materials are preferred, in particular protein-containing matrices such as gelatin and fibrin, and polysaccharide-containing matrices such as alginates, chitosans, hyaluronates, and agar-agar. The three-dimensional arrangement can be obtained using known methods, e.g., mixing myogenically differentiated cells, preferably aggregates thereof, into liquefied matrix material, pouring the mixture into the desired shape, and subsequently solidifying the matrix. Alternatively or additionally, myogenically differentiated cells can also be placed on and / or embedded in a solid matrix, the solid matrix being preferably porous.Preferably, the three-dimensional arrangement is produced by 3D printing a mixture of myogenically differentiated cells or myogenically differentiated microtissues and a suitable matrix material ("bioprinting").

[0036] Preferably, adipogenically differentiated cells / microtissues are additionally included in the three-dimensional arrangement, the term "adipogenically differentiated" referring to cells that are adipocytes or adipocyte-like cells. Adipocytes and adipocyte-like cells can be identified by the formation of intracellular lipid droplets, as illustrated in the exemplary embodiments. Methods for the adipogenic differentiation of cells are known to those skilled in the art and are described in the exemplary embodiments. Preferably, the adipogenically differentiated cells are produced from the precursor cells of the present invention. Figures

[0037] Fig. 1: Explant culture of mesenchymal stem cells from porcine umbilical cord tissue: Explant culture (A); typical change in morphology over time (B). Fig. 2 : Expression of markers by UC-MSC, detection via qRT-PCR; (A) CD73, (B) CD90, (C) CD105; muscle cell cDNA was used as a negative control ("muscle cDNA"). Fig. 3 UC-MSCs from the umbilical cord of newborn piglets differentiate into fat (A) and muscle cells (B). Fig. 4 : Time course of myogenic differentiation of C2C12 mouse cells in different media, staining with an antibody against myosin (MF 20) on days 2 to 5 after introduction into the respective medium (d2-d5). Fig. 5 : Myogenic differentiation of UC-MSC in methionine-free medium; (A) transmitted light uptake of myogenically differentiated cells; (B) spontaneous formation of microtissues. Fig. 6 : Myogenically differentiated microtissues produced using the "hanging drop" method (transmitted light microscopic image). Example 1: Harvesting umbilical cords

[0038] Umbilical cords from pigs were only removed after the natural weaning process from the mother was complete. For this purpose, after cleaning and disinfecting with 70% ethanol, the cords were tied or clamped approximately 2 cm from the navel and cut with sharp scissors. The cords were then repeatedly rinsed with sterile, ice-cold Dulbecco's phosphate-buffered saline solution containing 1% penicillin and 1% amphotericin B (DPBS rinse solution) until all traces of blood were removed and the tissue appeared white and clean. The umbilical cords were then stored on ice in fresh DPBS rinse solution for transport and until further use.

[0039] Explant cultures were prepared in the sterile laboratory. Fresh umbilical cords were decontaminated in three steps after transfer to the sterile area and subsequently kept moist with DPBS irrigation solution.

[0040] Umbilical cord decontamination: Rinse the umbilical cord several times (3-5 times) with DPBS irrigation solution. Immerse the umbilical cord in 70% EtOH (max. 1 min to avoid tissue damage). Rinse the umbilical cord several times (3-5 times) with DPBS irrigation solution. Example 2: Establishing explant cultures

[0041] To prepare the explant cultures, pieces of umbilical cord were placed in a small Petri dish containing DPBS rinsing solution, then longitudinally incised and opened; the tissue was cut into approximately 4x4 mm pieces or punched out with a tissue cutter. Twenty segments each were placed in a 10 cm CellCoat dish.

[0042] Each explant culture (culture dish) was then incubated with 10 ml of nutrient medium at 37°C and 5% CO2. Variations in the procedure (e.g., removal of umbilical cord vessels, isolation of Wharton's jelly) did not result in a significant improvement in the outcome. Example 3: Testing the effect of serum in explant medium

[0043] Explant experiments were performed using standard culture medium (DMEM low glucose with 10% FCS, 1% PenStrep, 1% amphotericin) or with commercially available special medium for mesenchymal stem cells (MesenCult ACF-Plus, 1% PenStrep, 1% amphotericin, 2 mM L-glutamine, 1x ACF supplement (MC Stemcell Technologies, Cologne; with attachment factor: #05448)). MesenCult ACF-Plus contains no animal-derived additives or xenobiotics.

[0044] With all approaches and regardless of the type of medium used, migrated cells (umbilical cord mesenchymal stem cells, UC-MSC) were clearly visible after 4-5 days ( Fig. 1 After 6 to 8 days, the tissue samples were removed and the first medium change was performed. It was demonstrated that the presence of FBS had no influence on the establishment of the parent cell bank. Example 4: Determining the identity of UC-MSC

[0045] UC-MSC identity has been demonstrated by the presence of various surface markers (Arutyunyan et al., 2016). MSC marker expression is heterogeneous, but CD73 (Wang et al., 2004; Corotchi, 2013), CD90 (Corotchi, 2013), and CD105 (Wang et al., 2004; Corotchi, 2013) are particularly characteristic and are reported to be present in ≥ 98% of cells.

[0046] For typing, qRT-PCR was additionally used according to standard methods. The results for the markers CD73, CD90, and CD105 are presented in Fig. 2 The pluripotency genes Okt4, SOX2, and Nanog are also investigated, likewise using qR-PCR. Suitable primers are shown in Table 1. Example 5: Tests for differentiation ability

[0047] To test whether UC-MSCs can differentiate into muscle and fat cells, the cells obtained on day 6 of culture were enzymatically detached and seeded into 6 wells (2 wells per culture) of a 24-well primary plate. After 13 days in culture, the wells were almost confluently colonized, and the cell count had increased from 1.9 x 10⁵ to 3.4 x 10⁵. To test the differentiation capacity (multipotency), a portion of the cells were placed in culture media that promote differentiation into fat or muscle cells: Adipogenic differentiation was induced by culture in DMEM / F12 medium containing 10% FBS, 2% glutamine, supplemented with 1 mM dexamethasone, 500 µM IBMX (3-isobutyl-1-methylxanthine), 100 µM troglitazone, and 1 µM / ml insulin for 48 hours. The induction medium was then replaced with differentiation medium (DMEM / F12 medium containing 10% FBS, 2% glutamine, and 1 µM / ml insulin).After 3 days the first fat droplets were visible and after 5 days the cells were fixed and stained with the dye Oil red to detect fat (. Fig. 3A ).

[0048] Myogenic differentiation was induced by culture in DMEM with 4.5 g / l glucose (high glucose concentration) using 2% instead of 10% FBS. After 4 days, the cells were fixed and differentiation was confirmed using fluorescently labeled antibodies against the muscle proteins desmin and F-actin, respectively. Fig. 3B ).

[0049] The results of these experiments show that the isolated precursor cells are capable of myogenic and adipogenic differentiation. Example 6: Optimization of myogenic differentiation

[0050] The known methods for myogenic differentiation use serum-containing culture media and are often characterized by low efficiency. The aim was therefore to achieve high differentiation efficiency by exclusively utilizing natural, physiological processes, i.e., without chemical or genetic manipulation.

[0051] For the induction of differentiation, methionine-reduced or -free medium was used, which, without being bound to theoretical considerations, probably leads to the expression of myogenic genes (MyoD and MyoG) via DNA demethylation.

[0052] The following media were used in the differentiation experiments: "FCS": DMEM high Glucose, 2% FCS (fetales Kälberserum), 0.1% P / S (Penicillin / Streptomycin) "HS": DMEM high Glucose, 10% HS (Horse Serum), 0.1% P / S "HS+AZA": DMEM high Glucose, 5% HS, 0.1% P / S, 10 µM Azacytidin "-Met+Glu": DMEM high Glucose -MQC (DMEM high Glucose ohne Methionin, Glutamin, Cystin, Gibco, 21013-024), 5% HS, 0.1% P / S, 4 mM L-Glutamin "2,5 µM Met": DMEM high Glucose -MQC, 5% HS, 0.1% P / S, 2 mM L-Glutamin, 2,5 µM L-Methionin "5 µM Met": DMEM high Glucose -MQC, 5% HS, 0.1% P / S, 2 mM L-Glutamin, 5 µM L-Methionin

[0053] Die verwendete Zellinie war die Mauszelllinie C2C12. Die Ergebnisse sind in Fig. 4The results show a comparison of the standard medium (with reduced serum concentration = FCS), chemical induction (medium with 10 µM 5-azacytidine = HS+AZA), and media without methionine (but supplemented with 4 mM glutamine = -Met+Glutamine) or with reduced methionine concentration (2.5 µM supplemented with 2 mM glutamine = 2.5 µM Met). The efficacy of discontinuing the differentiation medium after 48 hours was also investigated. Since no optimization effect was observed, the differentiation medium was maintained for 5 days.

[0054] To demonstrate myogenic differentiation, antibodies against the muscle protein desmin (mouse anti-Desmin, clone D-33, DAKO) and an antibody against myosin (MF 20, anti-sarcomere (MHC), produced in-house with hybridoma cultures and provided by Dr. Julia v. Maltzahn, Leibniz Institute for Age Research, Jena) were used. Fig. 4shows staining with MF 20, since the expression of sarcomeric myosin is particularly relevant for differentiation success.

[0055] The time course of the different approaches ( Fig. 4 The results clearly show that the medium we developed exhibits even greater differentiation success than the standard medium. Differentiation begins earlier, the muscle fibers are denser, and they appear visually thicker.

[0056] The methods using methionine-free or methionine-reduced medium yield significantly better results than the standard method (FCS reduction) or the chemical method, even in normal 2D culture. In particular, the fusion rate is higher (see also: more nuclei in myotubes), the myotubes are larger, and they occupy a greater overall surface area. Table 2 shows corresponding measurement results on day 4. Table 2: Quantification of the differentiation results (Day 4) FCS HS+Aza -met +Glu 2.5µm met Total cell nuclei* 2020±148 A< 2991±246 B< 2856±148 B< 2870±95 B< Cell nuclei in myotubes** 90±14 A< 136±5 A,B< 466±72 C< 427±55 C< Percentage of cell nuclei in myotubes (%) = fusion rate 4±0,5 A< 5±0.4 A,B< 16±3 C< 15±2 C< Area of ​​myotubes (µm 2< ) 20±2 A< 16±1 A,B< 29±2 C< 34±3 C< Number of myotubes 75±4 74±6 57±9*** 86±7 Myotubes total area (%) 12±1 A< 9±1 A,B< 18±1 C< 21±2 C< Average myotube size (µm 2< ) 0,3±0,03 A< 0.2±0.006 A,B< 0.5±0.07 C,D< 0.4±0.005 A, C, D<

[0057] Different capital letters (AD) mark significant (P<0.05) differences between the respective differentiation conditions. *Here: Myonuclei; **Myotubes possess at least 2 nuclei / myonuclei; ***The lower value results from the detachment of formed myotubes due to an excessively high myotube density in the culture vessel, which is related to the faster differentiation process in methionine-free medium.

[0058] Differentiation was also achieved with UC-MSC in methionine-free medium ( Fig. 5A ). Furthermore, it was shown that UC-MSC spontaneously form microtissue in methionine-free medium even under the conditions of a conventional 2D culture ( Fig. 5B ). Example 7: Culture in "hanging drops"

[0059] To further support the differentiation process, give the final product structure and depth, and achieve a meat-like texture, the new differentiation medium was used in combination with the "hanging drop" culture technique to generate complex, three-dimensional microtissues. These microtissues can form the basis for the production of cell-based meat products. These can include not only formed meat (steak- or schnitzel-like), but also unformed meat products (e.g., similar to minced meat or burger patties) or sausages.

[0060] Cells were suspended in differentiation medium and then pipetted onto the lids of culture vessels filled with phosphate-buffered saline. The lids were then placed on the vessels to prevent the cultures from drying out. The procedure was again tested using C2C12 cells at two cell densities and with different differentiation media. Differentiation protocol: Gravity

[0061] 1. Preparation of a suspension culture: Wash C2C12 cells (80% confluent) twice with PBS. Briefly rinse cells with trypsin-EDTA solution (0.25% trypsin, 0.53 mM EDTA) to remove medium / FCS residues. Add 2–3 ml of the trypsin-EDTA solution (0.25% trypsin, 0.53 mM EDTA) to a 10 cm dish and observe under a microscope until the cells detach (approximately 5–15 minutes at room temperature). If the cells are difficult to detach, incubate at 37°C. Add fresh, complete (with FCS) growth medium (6-8 ml), carefully resuspend cells, transfer cells to 15 ml tubes, add 40 µl of a 10 mg / ml DNase stock solution and incubate for 5 min at room temperature. Briefly vortex and then centrifuge (200 x G, 5 min). Remove and discard the supernatant, wash cells twice with 1 ml of growth medium, centrifuge, and refill with 2 ml of medium, count, and adjust each half to (1) 5 x 10⁵ cells / ml or (2) 2.5 x 10⁶ cells / ml.To establish a hanging drop culture, fill the bottom of a 6 cm culture dish with 5 ml of PBS. Turn the lid of the culture dish upside down and pipette 20 µl drops (1; 10,000 cells / drop) or 10 µl drops (2; 25,000 cells / drop) into the lid. For example, at cell density (1), add 10 x 20 µl drops per dish; at cell density (2), add 20 x 10 µl drops per dish. Place the lid on the PBS-filled dishes and transfer them to the incubator. Incubate until cell layers or aggregates form, usually after approximately 24–72 hours.

[0062] The formation of differentiating, three-dimensional microaggregates occurred within 2–3 days, driven solely by cell aggregation and interaction (self-organization) due to gravity and, in the case of our new differentiation medium, by naturally induced demethylation. Since the cells were stimulated to form their own extracellular matrix structures, no artificial scaffold materials were required. Examples of the results are presented in Fig. 6 shown. Literature:

[0063] AOAC International Official Methods for Analysis 17th Edition, AOAC International, Gaithersburg, MD, 2000 Arutyunyan et al., 2016. Stem Cells Internat Vol. 2016, dx.doi.org / 10.1155 / 2016 / 6901286 Bastian et al. (1985), J Assoc Off Anal Chem 68(5):876-880 Beeravolu et al.(2016), Stem Cell Res 16: 696-711 Cardoso et al. (2012), BMC Biotechnology 12:18; www.biomedcentral.com / 1472-6750 / 12 / 18 Carlin et al., 2006. Reprod Biol Endocrinol 4: 8; DOI: 10.1186 / 1477-7827-4-8 Conconi et al., 2006. Int J Mol Med 18:1089-1096 Corotchi et al., 2013. Stem Cell Res Ther 4:81; DOI: 10.1186 / scrt232 Hoynowski et al., 2007. Biochem Biophysic Res Comm 362:347-353; DOI:10.1016 / j.bbrc.2007.07.182 Ishige et al., 2009. Int J Hematol 90:261-269 Kocaefe et al., 2010. Stem Cell Rev & Rep 6:512-522 Marcus-Sekura et al., 2011. Biologicals 39:359-369. Moretti et al. 2010, AdvBiochem Engin / Biotechnol 123: 29-54 Pham et al., (2016). Cell Tissue Bank 17: 289-302 Shivakumar et al., 2016. J Cell Biochem 117: 2397-2412.Simonne et al., (1997), Journal of the Science of Food and Agriculture 73(1):39-45 Stephens et al. 2018. Trends in Food Science & Technology 78: 155-166. Thorrez & Vandenburgh. 2019. Nat Biotechnol 37: 215-226. Wang et al., 2004. Stem Cells 22:1330-1337 Mrunalini K. Gaydhane, Urbashi Mahanta, Chandra S. Sharma, Mudrika Khandelwal, Seeram Ramakrishna, Biomanufacturing Reviews, Bd. 3, Nr. 1, 19. März 2018 WO 2006 / 041429 A1 . Table 1: Primers for the detection of gene expression; all primers are derived from Sus scrofa sequences. gene Sequence (SEQ ID NO:) Product length Reference sequence comment NT5E (CD73) fwd:CGTGGCGCGACTTTCTACCA (1) 167 XM_001927095.4 - rev-Primer at the exon 2-3 junction rev: CCAGGGCCATGGCATCGTAA (2) THY-1 (CD90) fwd: TCGCTCTCTTGCTAACAGTCTTGC (3) 128 NM_001146129.1 - fwd-Primer am Übergang Exon 1-2 rev: CTGAATGGGCAGGTTGGTGGT (4) ENG (CD105) fwd: TCAGCAACGAGGTGGTCGTC (5) 243 NM_214031.1 - fwd-Primer am Übergang Exon 9-10, rev-Primer in Exon 12 rev: CCACGTCAGGCCCCAGATTC (6) Nanog fwd: TCGACACCGAGACTGTCTCTCC (7) 188 ENSSSCT 00000062427.1 - fwd-Primer am Übergang Exon 1-2 rev: ACAGAGCTGGGTCTGCGAGA (8) POU5F1 (Oct-4) fwd: CCCGCCCTATGACTTCTGCG (9) 220 NM_001113060.1 - rev-Primer am Exon- Übergang rev: CTGGGACTCCTCGGGGTTCG (10) Sox2 fwd: CAGTGGTCAAGTCCGAGGCG (11) 209 NM_001123197.1 - nur ein Exon known, keine Exon-überspannenden Primer rev: TGTACCGTTGATGGCCGTGC (12) CD14 fwd: TGCCAAATAGACGACGAAGA (13) 385 NM_001097445.2 - no exon spanning primer available since last 3 bases of exon one are CDS' start codon rev: ACGACACATTACGGAGTCTGA (14) CD34 fwd: TGAAACCTCACTGCCTGCTGC (15) 272 NM_214086.1 - fwd primer is exon spanning, primer pair also covers two introns rev: AGGGTCTTCGCCCAGCCTTTCT (16)

Claims

1. Method for producing a composition which contains animal protein, comprising (a) isolating mesenchymal stem cells from an umbilical cord of an agricultural animal, preferably from the family Suidae, more preferably from the genus Sus, most preferably from the species Sus scrofa; (b) incubating the mesenchymal stem cells under conditions which lead to a myogenic differentiation of the mesenchymal stem cells, wherein the conditions which lead to a myogenic differentiation comprise incubation in a nutrient medium, which in comparison to the standard medium has a reduced content of methionine of at most 5 µM; and (c) harvesting the myogenically differentiated cells.

2. Method according to Claim 1, wherein the mesenchymal stem cells are perinatal mesenchymal stem cells.

3. Method according to Claim 1 or 2, wherein the growth of the mesenchymal stem cells comprises introduction of the mesenchymal stem cells into a serum-free nutrient medium, which preferably contains a proportion of conditioned serum-free medium.

4. Method according to one of Claims 1 to 3, wherein the conditions which lead to a myogenic differentiation comprise incubation in a nutrient medium with a concentration of methionine of at most 4 µM, preferably at most 3 µM, still more preferably at most 2.5 µM, and most preferably incubation in a nutrient medium without added methionine (0 µM methionine).

5. Method according to one of Claims 1 to 4, wherein during the myogenic differentiation contact of the mesenchymal stem cells with a solid surface is avoided, whereby microtissues of myogenically differentiated mesenchymal stem cells are preferentially produced.

6. Method according to Claim 1, wherein step (a) comprises the following steps: (A) providing at least one perinatal tissue of an umbilical cord of an agricultural animal; (B) chopping the perinatal tissue, so that pieces thereof are obtained, (C) incubating the pieces of the perinatal tissue in a nutrient medium; (D) whereby mesenchymal stem cells are obtained.

7. Method according to Claim 6, wherein the nutrient medium in step (C) is a nutrient medium which is free from serum of an agricultural animal, and is preferably a serum-free medium.

8. Use of a nutrient medium which in comparison to the standard medium has a reduced content of methionine of at most 5 µM for the differentiation of mesenchymal stem cells from an umbilical cord of an agricultural animal.

9. Method for producing a meat-like composition, comprising I) myogenic differentiation of mesenchymal stem cells according to the method of the invention for the myogenic differentiation of mesenchymal stem cells according to one of Claims 1 to 7; II) three-dimensional structuring of the differentiated mesenchymal stem cells obtained in step I), and III) growth of the cells in the three-dimensional structure obtained in step II).

10. Method according to Claim 9, wherein the three-dimensional structure in step II) is obtained by bioprinting of differentiated mesenchymal stem cells, preferably by bioprinting of microtissues containing differentiated mesenchymal stem cells.