Identification of allele-specific target sequences for c9orf72

EP4569116A4Pending Publication Date: 2026-09-02UNIV OF MASSACHUSETTS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023853497
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-08-09
Filing Date
2023-08-09
Publication Date
2026-09-02

AI Technical Summary

Technical Problem

Current therapeutic approaches for Amyotrophic Lateral Sclerosis (ALS) and frontotemporal dementia (FTD) associated with C9ORF72 repeat expansions often target both mutant and wild-type alleles, leading to potential deleterious effects on wild-type allele expression, and lack specificity in targeting genetic mutations.

Method used

Development of allele-specific antisense oligonucleotides (ASOs) that target a two-base pair deletion in the C9ORF72 gene, which is in linkage disequilibrium with the repeat expansion, to selectively inhibit the expression of the mutant allele while sparing the wild-type allele, using gapmer and LNA chemistries for enhanced specificity and efficacy.

Benefits of technology

The ASOs demonstrate significant reduction in C9ORF72 expression in cells homozygous for the two-base pair deletion, with minimal impact on wild-type allele expression, potentially treating approximately 80% of C9ORF72 patients with ALS or FTD, as shown by luciferase assays and qRT-PCR experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

In some embodiments, described herein are antisense oligonucleotides that target a C90rf72 sequence comprising a two-base pair deletion and G4C2 repeat expansions; and methods of using same to inhibit C90rf72 expression. In some embodiments, described herein are methods of treating amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD).
Need to check novelty before this filing date? Find Prior Art

Description

2TIDENTIFICATION OF ALLELE-SPECIFIC TARGET SEQUENCES FOR C9ORF72CROSS-REFERENCE TO RELATED APPLICATIONSThis application claims priority to U.S. Provisional Application 63 / 396,545 filed on August 9, 2022, which is incorporated herein by reference in its entirety.SEQUENCE LISTING

[0001] The Instant Application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 9, 2023, is named “UM3OOO3PCT” and is 64,834 bytes in size. The Sequence Listing does not go beyond the disclosure in the application as filed.BACKGROUND

[0002] Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that is characterized by progressive loss of motor neurons, both in the brain (upper motor neurons) and the spinal cord (lower motor neurons). The average age of onset is in the late 50s-60s and the patients succumb to death in 3-5 years. The current estimated prevalence in the United States is 1 in 50,000 people. ALS is grouped into two categories depending on whether the disease is inherited or not; about 5-10% of cases are familial ALS and the remaining percentage falls under sporadic ALS. A repeat expansion within the first intron of C9ORF72 represents the most common genetic cause of ALS and is also implicated as a common genetic cause of frontotemporal dementia (FTD). There is need for therapeutics that inactivate the effects of this repeat expansion.SUMMARY

[0003] Some aspects of the disclosure provide a method of inhibiting expression of a C90rf72 gene comprising a two-base pair deletion in a cell. In some embodiments, a method of inhibiting expression of a C90rf72 gene comprising a two-base pair deletion in a cell comprises delivering to the cell an antisense oligonucleotide (ASO) that targets a C90rf72 allele comprising the two-base pair deletion. In some embodiments, the cell is in vitro. In some embodiments, the cell is in vivo. In some embodiments, the cell is heterozygous for the two-base pair deletion in C90rf72. In some embodiments, the cell is a human cell. In some embodiments, the cell is a cell of the central nervous system, optionally a neuron.

[0004] In some embodiments, the cell is from a subject having one or more symptoms of ALS and / or FTD. In some embodiments, the cell is from a subject having or suspected of having ALS and / or FTD.

[0005] Some aspects of the disclosure comprise a method of inhibiting expression of a C90rf72 gene comprising a two-base pair deletion in the central nervous system (CNS) of a subject. In some embodiments, a method of inhibiting expression of a C90rf72 gene comprising a two-base pair deletion in the CNS of a subject comprises administering to the subject an ASO that targets a C90rf72 allele comprising the two-base pair deletion.

[0006] Some aspects of the disclosure provide a method of treating a subject having or suspected of having ALS and / or FTD. In some embodiments, a method of treating a subject having or suspected of having ALS and / or FTD comprises administering to the subject an ASO that targets a C90rf72 allele comprising a two-base pair deletion.

[0007] Specifically, described herein is an ASO comprising a nucleic acid sequence 10 to 25 nucleotides in length that is complementary with at least 8 contiguous nucleotides of any one of SEQ ID NOs: 2-22. In an aspect, the ASO comprises the nucleic acid sequence of any one of SEQ ID NOs: 23-57.BRIEF DESCRIPTION OF DRAWINGS

[0008] FIG. 1 provides a schematic showing the sequence of the two-base pair deletion (C9-deletion, C9-del) that is in linkage disequilibrium with the C90rf72 repeat expansion relative to the wild-type sequence (See, SEQ ID NOs. 1 (WT) and 2 (C9-deletion)). Provided below the sequences are representative ASOs designed by 1-base pair tiling over the C9-deletion site.

[0009] FIG. 2 provides a graph showing the ability of ASOs that target the two-base pair deletion site to inhibit expression of C90rf72 in fibroblasts that are homozygous for an allele hosting the two-base pair deletion (C9-del / C9-del) compared to cells that are homozygous for the wild-type allele (WT / WT).

[0010] FIG. 3A provides a schematic for a dual luciferase assay.

[0011] FIG. 3B provides a schematic for the vector used in a dual luciferase assay.

[0012] FIGs. 4A-4C provide graphs showing the ability of MOE gapmer ASOs to inhibit expression of a C90rf72 target region in HEK cells. ASOs were tested on cells expressing just the luciferase assay vector (no target region expressed), the luciferase vector carrying the wildtype sequence of the indel resistant to the ASOs (Normal Allele), and the luciferase vector carrying the C9-deletion sequence susceptible to the ASOs (Mutant Allele). Desired ASOsshould repress expression of the C9-deletion target sequence and have little to no effect on the WT target sequence.

[0013] FIG. 5 provides a graph showing the ability of a MOE gapmer ASO to inhibit expression of C90rf72 in an allele- specific manner in fibroblasts.

[0014] FIGs. 6A-6C provide graphs showing the ability of LNA gapmer ASOs to inhibit expression of a C90rf72 target region in HEK cells. ASOs were tested on cells expressing just the luciferase assay vector (no target region expressed), the luciferase vector carrying the wildtype sequence of the indel resistant to the ASOs (Normal Allele), and the luciferase vector carrying the C9-deletion sequence susceptible to the ASOs (Mutant Allele). Desired ASOs should repress expression of the C9-deletion target sequence and have little to no effect on the WT target sequence.

[0015] FIG. 7 provides a graph showing the ability of an LNA gapmer ASO to inhibit expression of C90rf72 in an allele- specific manner in fibroblasts.

[0016] FIG. 8 shows the location of the C9 Deletion Variant and a second variant located within the C90rf72 transcribed region.

[0017] FIG. 9A-9B provide graphs showing partial rescue of C90rf72 RNA foci formation in heterozygous patient C90rf72 fibroblasts treated with the allele specific LNA gapmer ASO #9.DETAILED DESCRIPTION

[0018] Aspects of the disclosure relate to methods for altering RNA splicing and / or inhibiting gene or protein expression in a cell or subject, particularly gene or protein expression of alleles comprising a genetic mutation. Some embodiments of the disclosure provide mutantspecific knockdown / inhibition techniques that are designed to preferentially reduce expression (e.g., gene and / or protein expression) of a mutant allele relative to a wild-type allele. The techniques of the disclosure described herein directly target the mutant allele comprising the genetic mutation instead of targeting both the mutant and the wild-type alleles, which is the strategy utilized by previous approaches in the art. This is important because it means that the techniques described herein do not significantly impact expression of wild-type alleles. It is shown that decreased expression of wild-type alleles can be deleterious to cells and subjects. As an example of the approaches in the art, others have targeted cis mutant variants indirectly (e.g., instead of directly targeting the genetic mutation). In some embodiments, these approaches are successful in targeting repeat expansions.

[0019] In some embodiments, the disclosure provides compositions and methods for inhibiting gene or protein expression of C90rf72. In some embodiments, dysregulated C90rf722T expression is associated with ALS or FTD. Aspects of the disclosure relate to improved gene therapy compositions and related methods for treating ALS or FTD using antisense oligonucleotides that target a C90rf72 mutant allele (e.g., a mutant allele comprising a two-base pair deletion and a G4C2 repeat expansion).

[0020] The inventors of the disclosure have discovered that directly targeting indels (genetic insertions or deletions) can achieve the highest level of allele discrimination, which eliminates need for directly targeting repeat expansions or single point mutations / variants. For example, the inventors identified that a two-base pair deletion (see, e.g., FIG. 1; termed “C9- deletion”) is in linkage disequilibrium with the C90rf72 G4C2 repeat expansion. In some embodiments, the C90rf72 sequence variation comprising a two-base pair C9-deletion comprises SEQ ID NO: 2. The inventors identified that the heterozygosity frequency of this indel (two-base pair deletion shown in FIG. 1) is 79% of C90rf72 patients (from a sample of 204 C90rf72 patients). Accordingly, targeting this single indel allele could treat approximately 80% of C90rf72 patients (e.g., patients having a C90rf72 repeat and having or suspected of having ALS or FTD).

[0021] The C9-deletion polymorphism indel is located within the transcribed region of the C90rf72 gene. In some embodiments, an allele from the indel is often located on the same haplotype of the repeat expansion of C90rf72 (e.g., in linkage disequilibrium with G4C2 repeats). Further, the variant sequences of each indel are often present in a heterozygous state within C90rf72 patients. As such, the allele of each indel represents a target for allele- specific ASOs or similar knockdown technology. Further, indels are advantageous in developing allelespecific ASO due to difference of the targeted allele and the non-targeted allele.

[0022] In addition to the two base pair C9-deletion, the inventors have identified 10 single nucleotide polymorphisms (SNPs) within the C9ORF72 gene region which contain an allele that is commonly found on the same haplotype as the repeat expansion. These SNPs are located at r positions as follows: rs2453565, rs700828, rs774356, rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, and rs3849945. The two base pair C9-deletion is named rs 142843265. In some embodiments, the RS position naming convention is as described in Smith, B.N. et al., The C9ORF72 expansion mutation is a common cause of ALS + / - FTD in Europe and has a single founder. European Journal of Human Genetics (2013) 21, 102-108.Inhibitory Nucleic Acids

[0023] In some embodiments, the disclosure provides inhibitory nucleic acids (e.g., ASOs) that inhibit expression of a C90rf72 gene comprising a mutated C90rf72 allele comprising a two-base pair deletion. In some embodiments, a mutated C90rf72 allele2T comprises a mutated C90rf72 sequence having a two-base pair deletion. In some embodiments, the novel, mutated C90rf72 allele comprising a two-base pair deletion comprises SEQ ID NO: 2. The inhibitory nucleic acids such as ASOs may, in some embodiments, preferentially inhibit (e.g., reduce expression of) a C90rf72 allele comprising a two-base pair C9-deletion relative to a wild-type C90rf72 allele. In some embodiments, the C90rf72 allele comprises G4C2 repeat expansions of up to 50, up to 90, up to 160, or up to 200 repeats. In some embodiments, the two-base pair C9-deletion is in linkage disequilibrium with G4C2 repeats. In some embodiments, the C90rf72 allele (e.g., comprising a two-base pair C9-deletion) comprises greater than 30, greater than 50, greater than 90, greater than 160, greater than 200, greater than 500 or greater than 1000 G4C2 repeats. In some embodiments, the two-base pair C9-deletion is in linkage disequilibrium with the G4C2 repeat expansions.

[0024] In some embodiments, an inhibitory nucleic acid is an AS). As used herein, the term “antisense oligonucleotide (ASO)” or “antisense nucleic acid,” refers to a nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence. An ASO is specifically hybridizable when binding of the ASO to the target nucleic acid is sufficient to produce complementary based pairing between the ASO and the target nucleic acid, and there is a sufficient degree of complementarity to avoid non-specific binding of the ASO to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, an ASO is a single-stranded oligonucleotide.

[0025] In some embodiments, the inhibitory nucleic acid is complementary to a segment of the mutated C90rf72 sequence having a two-base pair deletion comprising or consisting of the nucleic acid sequence of any one of SEQ ID NOs: 2-22. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of nucleobases that are at least 80%, 90%, or 100% complementary to the nucleic acid sequence of any one of SEQ ID NOs: 2-22. In some embodiments, the ASO comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 23-57.

[0026] In some embodiments, the inhibitory nucleic acid has a stronger binding affinity for a mutated C90rf72 sequence comprising a two-base pair deletion and a G4C2 repeat expansion relative to a wild-type C90rf72 sequence. The inhibitory nucleic acid may have a stronger binding affinity for a nucleic acid comprising SEQ ID NO: 2 relative to a nucleic acid comprising SEQ ID NO: 1. In some embodiments, the inhibitory nucleic acid has a binding affinity for a mutated C90rf72 sequence comprising a two-base pair deletion and a G4C2 repeat2T expansion that is at least two-fold, three-fold, four-fold, or five-fold stronger than its binding affinity for a wild-type sequence without the two-base pair deletion. In some embodiments, the inhibitory nucleic acid has a binding affinity for a mutated C90rf72 sequence comprising a two- base pair deletion and a G4C2 repeat expansion that is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% stronger than its binding affinity for a wild-type sequence without the two-base pair deletion. A binding affinity may be measured using fluorescencebased methods, single-molecule kinetic methods, or any other binding assay known to a person of skill in the art.

[0027] In some embodiments, the inhibitory nucleic acid inhibits or reduces expression levels (e.g., protein expression, gene expression, RNA expression, and the like) of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) in a cell (e.g., a cell of the central nervous system) or a subject. In some embodiments, the inhibitory nucleic acid inhibits or reduces expression levels (e.g., protein expression, gene expression, RNA expression, etc.) of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, relative to a control (e.g., a baseline measurement or a control subject that is not administered the inhibitory nucleic acid). In some embodiments, the inhibitory nucleic acid inhibits or reduces expression levels of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) but does not substantially inhibit or reduce expression levels of wild-type C90rf72. In some embodiments, the inhibitory nucleic acid inhibits or reduces expression levels of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, relative to a control (e.g., a baseline measurement or a control subject that is not administered the inhibitory nucleic acid). In some embodiments, the inhibitory nucleic acid inhibits or reduces expression levels of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, relative to wild-type C90rf72.

[0028] In some embodiments, the inhibitory nucleic acid is 5 to 30 bases in length (e.g., 10-30, 15-25, 19-22). The inhibitory nucleic acid may also be 10-50, or 5-50 bases length. For example, the inhibitory nucleic acid may be one of any of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of, the target nucleic acid, or2T comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target nucleic acid.

[0029] In some embodiments, any one or more thymidine (T) nucleotides or uridine (U) nucleotides in a sequence provided herein may be replaced with any other nucleotide suitable for base pairing (e.g., via a Watson-Crick base pair) with an adenosine nucleotide. For example, T may be replaced with U, and U may be replaced with T. In some embodiments, inhibitory nucleic acids are provided that inhibit expression of genes in a cell of the central nervous system. In some embodiments, the cell is a neuron, astrocyte, or oligodendrocyte.

[0030] In some embodiments, the cell expresses a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) having G4C2 repeat expansions of up to 50, up to 90, up to 160, up to 200, up to 300, up to 400, up to 500 repeats, up to 600 repeats or more. In some embodiments, the cell expresses a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) having G4C2 repeat expansions of 30 to 50 G4C2 repeats, 30 to 100 G4C2 repeats, 30 to 150 G4C2 repeats, 30 to 200 G4C2 repeats, 50 to 200 G4C2 repeats, 100 to 300 G4C2 repeats, 100 to 500 G4C2 repeats, 250 to 1000 G4C2 repeats, or more than 1000 G4C2 repeats. In some embodiments, the cell contains detectable levels of intranuclear G4C2 foci. In some embodiments, the cell contains detectable levels of C9 RAN proteins.

[0031] In some embodiments, an ASO has a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., target RNA). However, it should be appreciated that in some embodiments, an ASO may be used that has less than 100% sequence complementarity with a target nucleic acid. The region of complementarity of the ASO may be complementary with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid. In addition, to minimize the likelihood of off- target effects, an ASO may be designed to ensure that it does not have a sequence (e.g., of 5 or more consecutive nucleotides) that has high complementary with an off-target nucleic acid (e.g., a wild-type C9orf72 allele).

[0032] Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position. The antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “complementary” is a term that is used to indicate a sufficient degree of2T complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 940%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid.

[0033] Thus, it is understood in the art that a complementary nucleotide sequence need not be 100% complementary to that of its target to be specifically hybridizable. In some embodiments, a complementary nucleic acid sequence for purposes of the present disclosure is specifically hybridizable when binding of the sequence to the target nucleic acid produces the desired alterations in splicing to occur and there is a sufficient degree of complementarity to avoid non-specific binding to non-target nucleic acids under conditions in which avoidance of non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency.

[0034] Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. In some embodiments, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., % homology=number of identical positions / total number of positionsxlOO), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0035] In some embodiments, ASOs are provided that comprise a region of complementarity that is complementary with at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or more contiguous nucleotides of a sequence complementary to the nucleic acid sequence of any one of SEQ ID NOs: 2-22.

[0036] In some embodiments, ASOs of the disclosure have a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, oligonucleotides have a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more.2T

[0037] In some embodiments, antisense nucleic acids (ASOs) are provided in a homogeneous preparation, e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides are identical. For example, in some embodiments, homogeneous preparations of oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides of any one of SEQ ID NOs: 2-22.

[0038] Antisense nucleic acids of the disclosure may be modified to achieve one or more desired properties, such as, for example, improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains a human C90rf72 allele having a two-base pair deletion and a G4C2 repeat expansion as described herein, it is capable of hybridizing with RNA expressed from the human C90rf72 allele without inducing cleavage of the RNA by an RNase. Antisense nucleic acids can be modified at a base moiety, sugar moiety and / or phosphate backbone. Accordingly, antisense nucleic acids may have one or more modified nucleotides (e.g., a nucleotide analog) and / or one or more backbone modifications (e.g., a modified internucleotide linkage). Antisense nucleic acids may have a combination of modified and unmodified nucleotides. Antisense nucleic acids may also have a combination of modified and unmodified intemucleotide linkages.

[0039] Antisense nucleic acids may include ribonucleotides, deoxyribonucleotides, and combinations thereof. Examples of modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5 -bromo uracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2- thiouracil, beta-D-mannosylqueosine, 5 '-methoxycarboxymethyluracil, 5-methoxyuracil, 2- methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5 -methyluracil, uracil- 5-oxyacetic acid methylester, uracil-5 -oxy acetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3- N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

[0040] In some embodiments, the ASO is a gapmer oligonucleotide. As used herein, a gapmer oligonucleotide has the formula 5’-A-B-C-3', wherein B is a central segment of2T nucleotides flanked by ‘A’ and ‘C’ segments. In some embodiments, the central ‘B’ segment comprises contiguous deoxynucleotides. The central segment may comprise 6-15 contiguous deoxynucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous deoxynucleotides). In some embodiments, the ‘A’ and / or ‘C’ flanking segments comprise contiguous ribonucleotides. The flanking segments may comprise 3-10 contiguous ribonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 contiguous ribonucleotides). In some embodiments, the central segment is capable of recruiting an RNAse (e.g., RNAse H). In some embodiments, the gapmer binds to the target nucleic acid to recruit an RNAse. In some embodiments, the flanking segments comprise modified nucleotides. In some embodiments, each of the nucleotides in a flanking segment are modifed nucleotides (e.g., modified ribonucleotides). In some embodiments, a modified nucleotide is a 2’ methoxy ethyl modified nucleotide, a 2’ o-methyl modified nucleotide, or a locked nucleic acid. In some embodiments, the two flanking segments comprise the same number of nucleotides. In other embodiments, the two flanking segments comprise different numbers of nucleotides. In some embodiments, a gapmer is a 5-10-5 gapmer (e.g., comprising a central segment of ten 2’ deoxynucleotides flanked by five ribonucleotides, e.g., five 2’ methoxyethyl (MOE) ribonucleotides). In some embodiments, a gapmer is a 4-8-4 gapmer (e.g., comprising a central segment of eight 2’ deoxynucleotides flanked by four nucleotides, e.g., four locked nucleic acid (LN A) nucleotides).

[0041] In some embodiments, a modified nucleotide is a 2’-modified nucleotide. For example, the 2’-modified nucleotide may be a 2’-deoxy, 2’-fluoro, 2’-O-methyl, 2’-O- methoxyethyl, 2’-amino and 2’ -aminoalkoxy modified nucleotides. In some embodiments, the 2’-modified nucleotide comprises a 2’-O-4’-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of a 2’ modified nucleotide the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. In such embodiments, the linkage may be a methelyne ( — CH2 — )ngroup bridging the 2' oxygen atom and the 3' or 4' carbon atom wherein n is 1 or 2.

[0042] Antisense nucleic acids may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations of LNA and RNA nucleotides. Antisense nucleic acids may include combinations of LNA and DNA nucleotides. A further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2 '-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.

[0043] Antisense nucleotide acids may also include nucleobase-modified nucleotides, e.g. , nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase, for example.2TExamples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza- adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine are suitable. It should be noted that the above modifications may be combined.

[0044] Within antisense nucleic acids (e.g., oligonucleotides) of the disclosures, as few as one and as many as all nucleotides can be modified. For example, an oligonucleotide (e.g., an oligonucleotide of 20 nucleotides in length) may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 modified nucleotides. In some embodiments, a modified oligonucleotide will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired property.

[0045] Certain antisense nucleic acids may include nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or a pyrimidine-purine dinucleotide.

[0046] In some embodiments, antisense nucleic acids (e.g., oligonucleotides) may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3'3'-linkage may be a phosphodiester, phosphorothioate or any other modified internucleoside bridge. Additionally, 3 '3 '-linked oligonucleotides where the linkage between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety.

[0047] A phosphodiester internucleotide linkage of an antisense nucleic acid can be replaced with a modified linkage. The modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NRlR2-phosphoramidate, boranophosphate, a- hydroxybenzyl phosphonate, phosphate-(Cl-C21) — O-alkyl ester, phosphate-[(C6-C12)aryl- (C1-C21) — O-alkyl]ester, (Cl-C8)alkylphosphonate and / or (C6-C12)arylphosphonate bridges, and (C7-C12)-a-hydroxymethyl-aryl.

[0048] A phosphate backbone of the antisense nucleic acid can be modified to generate peptide nucleic acid molecules. As used herein, the terms “peptide nucleic acids” or “PNAs”2T refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, for example.

[0049] Antisense nucleic acids can also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. Morpholinos may also be modified, for example, as a peptide conjugated morpholino, a phosphorodiamidate morpholino, and the like.

[0050] In other embodiments, the antisense nucleic acid can be linked to functional groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier. Oligonucleotide reagents of the disclosure also may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the oligonucleotide reagents.Methods of Use

[0051] Methods are provided herein for inhibiting the expression of genes that are associated with FTD and / or ALS, such as C90rf72. In some embodiments, methods are provided for inhibiting the expression of C90rf72 (e.g., mutated C90rf72 allele comprising a two-base pair deletion and a G4C2 repeat expansion, e.g., mutated C90rf72 allele comprising a nucleic acid sequence of SEQ ID NO: 2 and a G4C2 repeat expansion) in a cell that involve delivering to the cell an inhibitory nucleic acid (e.g., an ASO) that targets a C90rf72 allele. The cell may be in vitro or in vivo. The cell may be a human cell, such as a cell from a subject having one or more symptoms of ALS and / or FTD, or from a subject having or suspected of having ALS and / or (FTD. In some embodiments, methods are provided for inhibiting the expression of a mutated C90rf72 allele (e.g., comprising a two-base pair deletion and a G4C2 repeat expansion) in a cell that involve administering to the central nervous system (CNS) of the subject an ASO that targets an RNA encoded by the mutated C90rf72 allele, wherein the ASO is complementary to a mutated C90rf72 allele comprising a two-base pair C9-deletion (e.g., mutated C90rf72 allele comprising a nucleic acid sequence of SEQ ID NO: 2 and a G4C2 repeat expansion).

[0052] In some embodiments, methods are provided for inhibiting C90rf72 expression in the CNS of a subject. In some embodiments, the methods involve administering to the CNS of the subject an inhibitory nucleic acid that targets both pre-mRNA and mRNA encoded by a2TC90rf72 gene. In some embodiments, the subject has or is suspected of having FTD or ALS. In some embodiments, the inhibitory nucleic acid comprises a sequence complementary to a segment of the mutated C90rf72 sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 2-22.

[0053] In accordance with the foregoing, certain methods provided herein involve administering to a subject an effective amount of any of the inhibitory nucleic acids (e.g., any of the ASOs) disclosed herein. In general, the “effective amount” of an inhibitory nucleic acid (e.g., an ASO) refers to an amount sufficient to elicit the desired biological response. In an aspect, the ASO reduces levels of C90rf72 expression in the cell by at least 10%. In some embodiments, an effective amount is the maximum amount that is considered to be safe for the patient. In some embodiments, an effective amount is the lowest possible concentration that provides maximum efficacy. An effective amount may be 1-10, 1-50, 5-50, 10-75, 50-100 mg / kg, or more, depending on the factors described herein and known to a person of skill in the art. In other embodiments, the effective amount refers to the amount effective for direct administration of an inhibitory nucleic acid (e.g., an ASO) to a subject. As will be appreciated by those of ordinary skill in this art, the effective amount of the inhibitory nucleic acid (e.g., an ASO) of the invention varies depending on such factors as the desired biological endpoint, the pharmacokinetics of the expression products, the condition being treated, the mode of administration, and the subject. Typically, the inhibitory nucleic acid (e.g., an ASO) is administered with a pharmaceutically acceptable carrier.

[0054] In some instances, after administration of the inhibitory nucleic acid (e.g., ASO) at least one clinical outcome parameter or biomarker (e.g., intranuclear G4C2 RNA foci, RAN- protein expression, and the like) associated with the FTD or ALS is evaluated in the subject. Typically, the clinical outcome parameter or biomarker evaluated after administration of the inhibitory nucleic acid (e.g., ASO) is compared with the clinical outcome parameter or biomarker determined at a time prior to administration of the inhibitory nucleic acid (e.g., ASO) to determine effectiveness of the inhibitory nucleic acid (e.g., ASO). Often an improvement in the clinical outcome parameter or biomarker after administration of the inhibitory nucleic acid (e.g., ASO) indicates effectiveness of the inhibitory nucleic acid (e.g., ASO). Any appropriate clinical outcome parameter or biomarker may be used. Typically, the clinical outcome parameter or biomarker is indicative of the one or more symptoms of an FTD or ALS. For example, the clinical outcome parameter or biomarker may be selected from the group consisting of: intranuclear G4C2 RNA foci, C90rf72 expression, memory loss, and presence or absence of movement disorders such as unsteadiness, rigidity, slowness, twitches, muscle2T weakness or difficulty swallowing, speech and language difficulties, twitching (fasciculation) and cramping of muscles, including those in the hands and feet.Treatment Methods

[0055] In some aspects, the disclosure provides methods for treating a subject having amyotrophic lateral sclerosis (ALS) or at risk of having ALS. In some aspects, the disclosure provides methods for treating a subject having frontotemporal dementia (FTD) or at risk of having FTD. A subject can be a human, non-human primate, rat, mouse, cat, dog, or other mammal.

[0056] As used herein, the terms “treatment”, “treating”, and “therapy” refer to therapeutic treatment and prophylactic or preventative manipulations. The terms further include ameliorating existing symptoms, preventing additional symptoms, ameliorating or preventing the underlying causes of symptoms, preventing or reversing causes of symptoms, for example, symptoms associated with ALS and / or FTD. Thus, the terms denote that a beneficial result has been conferred on a subject having ALS and / or FTD, or with the potential to develop such a disorder. Furthermore, treatment may include the application or administration of an inhibitory nucleic acid (e.g., a therapeutic ASO or a pharmaceutical composition comprising an ASO) to a subject, or an isolated tissue or cell line from a subject, who may have a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease.

[0057] Any appropriate inhibitory nucleic acid (e.g., ASO) disclosed herein may be administered. For example, the inhibitory nucleic acid may be an antisense oligonucleotide (e.g. , of 10 to 25 nucleotides in length) comprising a sequence complementary to a nucleic acid sequence of any one of SEQ ID NOs: 2-22, specifically complementary with at least 8 contiguous nucleotides of any one of SEQ ID NOs: 2-22.

[0058] As disclosed herein antisense nucleic acids may be administered by any suitable route. For use in therapy, an effective amount of the antisense nucleic acid and / or other therapeutic agent can be administered to a subject by any mode that delivers the agent to the desired tissue, e.g., neuronal tissue. In some embodiments, agents (e.g., ASOs) are administered intravenously. Other suitable routes of administration include but are not limited to oral, parenteral, intravenous, intraperitoneal, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal. Systemic routes include oral and parenteral. Several types of devices are regularly used for administration by inhalation. These types of devices2T include metered dose inhalers (MDI), breath-actuated MDI, dry powder inhaler (DPI), spacer / holding chambers in combination with MDI, and nebulizers.

[0059] For oral administration, the agents can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the agents of the disclosure to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl cellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.

[0060] Delivery of certain inhibitory nucleic acids (e.g., ASOs) to a subject may be, for example, by administration into the bloodstream of the subject. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. Moreover, in certain instances, it may be desirable to deliver the inhibitory nucleic acids (e.g., ASOs) to brain tissue, meninges, neuronal cells, glial cells, astrocytes, oligodendrocytes, cereobro spinal fluid (CSF), interstitial spaces and the like. In some embodiments, inhibitory nucleic acids (e.g., ASOs) may be delivered directly to the spinal cord or brain (e.g., prefrontal cortex) by injection into the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).

[0061] Pharmaceutical preparations that can be used orally include push fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active agents may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.2TIn addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. Formulations for oral administration are typically in dosages suitable for such administration.

[0062] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0063] For administration by inhalation, agents (e.g., antisense nucleic acids) for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro tetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of gelatin, for example, for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0064] The agents (e.g., ASOs), when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0065] Pharmaceutical formulations for parenteral administration include aqueous solutions of agents (e.g., ASOs) in water-soluble form. Additionally, suspensions of agents may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the agents to allow for the preparation of highly concentrated solutions. Alternatively, agents (e.g., ASOs) may be in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use. Agents (e.g., ASOs) may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, for example, containing conventional suppository bases such as cocoa butter or other glycerides.

[0066] Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the agents (e.g., ASOs), increasing convenience to the subject and the physician. Many types of release delivery systems are available. They include polymer base systems such as poly(lactide glycolide),2T copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono, di, and tri glycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and others disclosed herein.Pharmaceutical Compositions

[0067] According to some aspects of the disclosure, compositions are provided that comprise an agent (e.g., an ASO or vector comprising the same) and a carrier. As used herein, the term, “carrier” refers to an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate an intended use. For example, pharmaceutical compositions are provided that comprise an antisense nucleic acid and a pharmaceutically- acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” refers to a carrier that is suitable for pharmaceutical administration. The term pharmaceutically-acceptable carrier includes compatible solid or liquid fillers, diluents or encapsulating substances that are suitable for administration to a human or other vertebrate animal.

[0068] Components of pharmaceutical compositions also are capable of being commingled with the agents of the present disclosure, and with each other, in a manner such that there is no interaction that would substantially impair the desired pharmaceutical efficiency. Pharmaceutical compositions may include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and other suitable components compatible with pharmaceutical administration. Supplementary active agents can also be incorporated into the compositions. Active ingredients (e.g., ASOs) may be admixed or compounded with any conventional, pharmaceutically acceptable carrier or excipient. Pharmaceutical compositions are generally sterile and prepared using aseptic technique. A sterile phosphate-buffered saline is one example of a pharmaceutically acceptable carrier. Other suitable carriers may be used. Pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.

[0069] Inhibitory nucleic acids may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts are generally pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited2T to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.

[0070] Exemplary buffering agents include: acetic acid and a salt (1-2% w / v); citric acid and a salt (1-3% w / v); boric acid and a salt (0.5-2.5% w / v); and phosphoric acid and a salt (0.8- 2% w / v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w / v); chlorobutanol (0.3-0.9% w / v); parabens (0.01-0.25% w / v) and thimerosal (0.004-0.02% w / v).

[0071] The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the agents into association with a carrier that constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the agents into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.

[0072] An effective amount, also referred to as a therapeutically effective amount, of an ASO capable of inhibiting a mutated C90rf72 allele comprising a C9-deletion (e.g., a mutated C90rf72 allele comprising SEQ ID NO: 2 and a G4C2 repeat expansion) is expressed is an amount sufficient to ameliorate at least one adverse effect associated with expression, or reduced expression, of the gene in a cell or in an individual in need of such modulation. The therapeutically effective amount to be included in pharmaceutical compositions may be selected based upon several factors, for example, the type, size and condition of the patient to be treated, the intended mode of administration, the capacity of the patient to incorporate the intended dosage form, and the like.

[0073] In some cases, inhibitory nucleic acids may be prepared in a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An example of a colloidal system that may be used in methods provided herein is a liposome. Liposomes are artificial membrane vessels that are useful for delivering antisense nucleic acids in vivo or in vitro. It has been shown that large unilamellar vesicles can encapsulate large macromolecules. Nucleic acids and other components (e.g., viral vectors) can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein. Ligands which may be useful for targeting a liposome to, for example, a smooth muscle2T cell or skeletal muscle cell include, but are not limited to: intact or fragments of molecules that interact with muscle cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers. Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE™ (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECT™ (a dendrimeric technology). Liposomes are commercially available from Invitrogen, Life Technologies, for example, as LIPOFECTIN™, which is formed of cationic lipids such as N-[l-(2, 3 dioley loxy)-propyl]-N, N, N- trimethylammonium chloride (DOTMA) and dioleoyl phophotidylethanolamine (DOPE), as well as other lipid-based reagents including Lipofectamine and Oligofectamine. Certain cationic lipids, including in particular N-[l-(2, 3 dioleoyloxy)-propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAP), may be advantageous when combined with the ASO analogs of the disclosure.

[0074] In one embodiment, inhibitory nucleic acids may be formulated with a biocompatible microparticle or implant that is suitable for implantation or administration to a recipient. Bioerodible implants may include a biodegradable polymeric matrix, for example, for containing an exogenous expression construct engineered to express an antisense nucleic acid under the control of an appropriate promoter. The polymeric matrix can be used to achieve sustained release of the therapeutic agent in the subject. A polymeric matrix may be in the form of a microparticle such as a microsphere, in which an antisense nucleic acid and / or other therapeutic agent is dispersed throughout a solid polymeric matrix, or a microcapsule, in which antisense nucleic acid and / or other therapeutic agent is stored in the core of a polymeric shell. Other forms of the polymeric matrix for containing a therapeutic agent include films, coatings, gels, implants, and stents. The matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time. In some embodiments, inhibitory nucleic acids are administered to the subject via an implant while the other therapeutic agent is administered.

[0075] Both non-biodegradable and biodegradable polymeric matrices can be used to deliver ASOs and / or the other therapeutic agent to a subject. Biodegradable matrices are preferred. Such polymers may be natural or synthetic polymers. The polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months may be used. A polymer may be in the form of a hydrogel, for example, a hydrogel that can absorb up to about 90% of its weight in water and which is optionally cross-linked with multi-valent ions or other components, for example, polymers.2T

[0076] Other exemplary compositions that can be used to facilitate uptake of a nucleic acid include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and homologous recombination compositions (e.g., for integrating a nucleic acid into a preselected location within the target cell chromosome).

[0077] In addition to the formulations described previously, the agents may also be formulated as a depot preparation. Such long-acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0078] Other suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and / or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the inhibitory nucleic acid (e.g., ASO) is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. Still others will be apparent to the skilled artisan.

[0079] Optionally, the compositions of the invention may contain, in addition to the ASO and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0080] The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells.

[0081] The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations2T as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

[0082] Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.

[0083] Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 pm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 angstroms, containing an aqueous solution in the core.

[0084] Alternatively, nanocapsule formulations of the inhibitory nucleic acid (e.g., ASO) may be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 pm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0085] In addition to the methods of delivery described above, the following techniques are also contemplated as alternative methods of delivering the inhibitory nucleic acid (e.g., ASO) compositions to a host. Sonophoresis (e.g., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations, transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and feedback-controlled delivery (U.S. Pat. No. 5,697,899).Kits and Related Compositions

[0086] The inhibitory nucleic acids such as antisense oligonucleotides and compositions described herein may, in some embodiments, be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit may include one or more containers housing the components of the invention and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In certain embodiments2T agents in a kit may be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes may contain the components in appropriate concentrations or quantities for running various experiments.

[0087] The kit may be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, “instructions” can define a component of instruction and / or promotion, and typically involve written instructions on or associated with packaging of the invention. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, and the like.), Internet, and / or web-based communications, and the like. The written instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflects approval by the agency of manufacture, use or sale for animal administration.

[0088] The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and / or isolating and mixing a sample and applying to a subject. The kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively it may be housed in a vial or other container for storage. A second container may have other agents prepared sterilely. Alternatively the kit may include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the components required to administer the agents to a subject, such as a syringe, topical application devices, or IV needle tubing and bag.

[0089] Exemplary embodiments of the invention are described in more detail by the following examples. These embodiments are exemplary of the invention, which one skilled in the art will recognize is not limited to the exemplary embodiments.Example 1. Identification of C90rf72 indels and SNPs

[0090] Variants of C90rf72 that could be used as targets for allele specific antisense technologies were identified using whole genome sequencing (WGS) data from 204 C90rf722T patients that were reported to have a repeat expansion. Two insertion / deletion (indel) variants and ten single nucleotide polymorphisms (SNPs) showing a high rate of heterozygosity in the C90rf72 patients (around 80%) were identified and evaluated.

[0091] The RS number for the two indels were RS 142843265 and RS34620383. Variant alleles in linkage disequilibrium (LD) were consistently present on the same chromosome (travelled together). A two base pair deletion in C9orf72 (C9-deletion or C9-del), as shown in FIG. 1, was identified as being in linkage disequilibrium with G4C2 repeat expansions. The heterozygosity frequency of the C9-deletion indel was 79% of C90rf72 patients.

[0092] The RS number for the ten SNPS were: rs2453565, rs700828, rs774356, rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, and rs3849945.Example 2. ASOs Target Indels Display Allele-Specific Knockdown

[0093] Antisense oligonucleotides (ASOs) for targeting mutated C90rf72 genes comprising the C9-deletion were designed using 1-base pair tiling over the indel site (see, bottom of FIG. 1). ASOs were synthesized using two different chemistries - (1) 5-10-5 MOE gapmer technology (central segment of ten 2’ deoxynucleotides flanked by five 2’ methoxy ethyl (MOE) ribonucleotides); and (2) 4-8 / 9-4 LNA gapmer technology (central segment of eight or nine 2’ deoxynucleotides flanked by four locked nucleic acid (LNA) nucleotides). Provided in Table 1 are the specific antisense oligonucleotides that were synthesized and tested.

[0094] In distinct experiments, either cells that were homozygous for the minor allele of rs 142843265 (a C90rf72 C9-deletion (C9-del / C9-del)) and cells having wild-type C90rf72 (WT / WT) were contacted with the synthesized ASOs (100 nM concentration). As shown in FIG. 2, the ASOs preferentially targeted the cells that were homozygous for the minor allele of rs 142843265 (C9-del / C9-del) for inhibition of C90rf72 expression. It was found that positioning the segment of the ASO that was complementary to the C9-deletion indel in the center of the ASO often resulted in the best discrimination of C9-deletion inhibition relative to wild-type inhibition. For example, an ASO comprising a sequence that was complementary to SEQ ID NO: 12 or 13 resulted in approximately 80% inhibition of C90rf72 expression in C9- del / C9-del cells, and approximately 5-10% inhibition of C90rf72 expression in wild-type cells.

[0095] A dual luciferase assay was also performed to evaluate the allele-specific ASOs of this Example. In brief, as shown in FIG. 3A, the dual luciferase assay utilized two luciferase genes, wherein the first gene comprised a portion of the C90rf72 gene at its 3’ end. Binding of an ASO to C90rf72 gene at the 3’ end of the first luciferase gene resulted in lowered expression from the first luciferase gene. The second luciferase gene functioned as an internal control for normalization purposes. Candidate target regions were cloned into luciferase expression vectors2T(pmirGLO vector, as shown in FIG. 3B). These expression vectors were subsequently transfected into HEK293 cells in a 96-well plate format. Cells were exposed to an antisense oligonucleotide (ASOs) and luciferase expression was measured. Non-treated cells, cells treated with a scrambled ASO (z.e., not specific for C90rf72), and a non-discriminatory ASO were used as controls. The average percent inhibition data obtained using this luciferase screening assay is provided in Table 1 and FIGs. 4A (MOE gapmers) and 6A (LNA gapmers).Table 1. Antisense Oligonucleotides of Example 22T

[0096] Several tested MOE gapmer ASOs (FIG. 4A) as provided in Table 1 were shown to be effective in reducing gene expression in this luciferase assay in an allele- specific manner (i.e., greater reduction in expression of the mutant C9-del allele relative to the normal allele). In particular, it was found that the MOE gapmer of SEQ ID NO: 30 (ASO 8) demonstrated potent allele- specific reduction in gene expression (FIG. 4B). It was further shown that the MOE gapmer of SEQ ID NO: 30 (ASO 8) was capable of reducing gene expression in a dosedependent manner (FIG. 4C).

[0097] Several tested LNA gapmer ASOs (FIG. 6A) as provided in Table 1 were shown to be effective in reducing gene expression in this luciferase assay in an allele- specific manner (i.e., greater reduction in expression of the mutant C9-del allele relative to the normal allele). In particular, it was found that the LNA gapmers of SEQ ID NO: 51 (LNA 9) and SEQ ID NO: 52 (LNA 10) demonstrated potent allele- specific reduction in gene expression (FIG. 6B). It was further shown that the LNA gapmer of SEQ ID NO: 52 (LNA 10) was capable of reducing gene expression in a dose-dependent manner, while LNA gamper of SEQ ID NO: 51 (LNA9) had a robust knockdown ability even at the lowest concentrations tested(FIG. 6C).Example 3. Additional cellular experiments showing efficacy of the ASOs

[0098] The efficacy of ASOs synthesized in Example 2 were further evaluated in additional cellular experiments. A qRT-PCR assay was also used to directly measure allelespecific C90rf72 knockdown. Fibroblasts were plated in 24 well plates, grown overnight, then treated with lOOnM ASOs for 48hrs. RNA was isolated from the cells, converted to cDNA, and used an input material for qRT-PCR. 100 ng of each sample was used to probe RPP30 (Ctrl) and C90rf72. Each sample was run in duplicate and C9 levels were normalized to RPP30 and nontreated controls.2T

[0099] It was found that the MOE gapmer of SEQ ID NO: 30 (C9_GM_9; ASO 8) and the LNA gapmer of SEQ ID NO: 51 (C9_LNA_9; ASO 9) were capable of allele- specific reduction in gene expression in fibroblasts. See FIG. 5 (MOE gapmer) and FIG. 7 (LNA gapmer). Control experiments did not demonstrate an allele-specific reduction in gene expression. Notably, a control ASO from Lagier-Tourenne, C et al. “Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration”. PNAS 2013 Nov 19;110(47):E4530-9 was unable to provide allele- specific reduction in gene expression (FIG. 7)Example 4: Location of C9 deletion variant and a second variant within the C90rf72 gene

[0100] In FIG. 8, the position of theC9 deletion variant (rs 142843265), that is the target of the C90rf72 ASOs ) and a second variant within the C90rf72 transcribed region (rsl0757668) which can be used to assess allele- specific transcript knockdown in a sample that is heterozygous for both variants.Example 5: Experiment confirming reduction of individual allelic expression in cells

[0101] The reduction of expression from a specific allele was evaluated in fibroblasts using targeted sequencing. Fibroblasts were plated in 6 well plates, grown overnight, then treated with lOOnM ASOs for 48hrs. RNA was isolated from the cells, converted to cDNA, and used as a template for targeted amplification of desired regions. 400 ng of each sample was used to amplify the C90rf72 ASP region and a region of HPRT1 (Ctrl) using the primers described below in a linear amplification / low cycle PCR. Successive rounds of sample clean up, PCR to add flanking adaptors, clean up, then PCR to add the final index sequences was performed. Sample libraries were sequences using Imillion 150bp reads. From this analysis and as shown in Table 2, it was observed that treatment with the LNA gapmer of SEQ ID NO: 51 (C9_LNA_9; ASO 9) were capable of mutant allele- specific reduction of gene expression in fibroblasts resulting in a higher portion of gene expression resulting from the WT allele.Notably, a nondiscriminating control ASO from Lagier-Tourenne, C et al. “Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration”. PNAS 2013 Nov 19;110(47):E4530-9 was able to reduce overall C90rf72 expression, but did not change the ratio of WT to mutant allele expression (Table below)

[0102] The primers used were:Forward Primer5’ACACTCTTTCCCTACACGACGCTCTTCCGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGATATCTCCGGAGCATT-3’; SEQ ID NO: 582TReverse Primer 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN3’; SEQ ID NO: 59C9 ASP target primer ForwardACACTCTTTCCCTACACGACGCTCTTCCGATCTGATATCTCCGGAGCATT; SEQ ID NO: 60C9 ASP target primer ReverseGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNTGAAACAATAATCACTCCC; SEQ ID NO: 61HPRT target primer ForwardACACTCTTTCCCTACACGACGCTCTTCCGATCTCATTGTAGCCCTCTGTGTGC; SEQ ID NO: 62HPRT target primer ReverseGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAAGGGCATATC CTACAACAAAC; SEQ ID NO: 63Table 2: Reduction of individual allelic expression in fibroblastsExample 6: Experiment showing allele specific ASO treatment of patient cells partially rescues a patient phenotype

[0103] The ability of ASOs synthesized in Example 2 to alter known disease phenotypes was evaluated in heterozygous patient C90rf72 fibroblasts carrying the TED and ASP SNP. additional cellular experiments. Fibroblasts were plated in 24 well plates in duplicate - one set on coverslips and one directly on the plate, then treated with lOOnM ASOs for 48hrs. A reduction in C90rf72 expression was confirmed in ASO treated cells using the qRT-PCR assay mentioned in example 3. The duplicate cells on coverslips were processed for RNA foci staining as described in Almeida A, et al “Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons.” Acta Neuropathol2T(2013) 126:385-399, using the probes described in the same paper. As shown in FIG. 9, those cells treated with the LNA gapmer of SEQ ID NO: 51 (C9_LNA_9; ASO 9) was capable of reducing both the number of foci present in cells and the overall number of cells that had RNA foci presentExample 7. Optimization of AS Os

[0104] Phosphorothioate (PS) positions and additional DNA chemistries of ASOs are optimized based on the findings and results of the additional cellular experiments. These additional chemistries are used to improve nuclease stability of the ASO(s), improve affinity for plasma and cell surface proteins promoting tissue distribution and cellular uptake, and improve cellular efficacy.

[0105] Functional effects of the original and optimized ASOs are evaluated using a C9 iPSc-derived motor neuron to evaluate effect on RNA foci and dipeptide repeat formation. RNA-Seq is used to establish level of rescue of gene expression.

[0106] BAC mouse models comprising a mutated C90rf72 gene (homozygous and / or heterozygous populations for the C9-deletion) are generated to evaluate ASOs in vivo. ASOs are then dosed into mice using an intravenous administration.Selected SequencesWild-type C90rf72 allele (SEQ ID NO: 1)AATTGCATGAGTCTTAACGATACAACATAAGACTTAGAAGAAATATTGTGTGGACC TGGGCCTACACCCCAGACAGATACCTCAGGGGTACATATGCTCTCCTTCTGTTACAG CTACTTCTAGGGAAAGGTTCGAGAAGTAGTACCTTAAAGAACATATCAGAGACAATTTTTTTTATTTTTACTATGAACAAGTTATCCAAAATTTATTCTGGGCAAACAGAAAAAAAAAGGGAGCAAATATTAATTTGTAGATGCAATTACTATTTTCCTTTGTTTACTGA TTTAACTCTTTGGGTTTAAGC90rf72 allele comprising a two-base pair deletion (C9-deletion) (SEQ ID NO: 2)AATTGCATGAGTCTTAACGATACAACATAAGACTTAGAAGAAATATTGTGTGGACC TGGGCCTACACCCCAGACAGATACCTCAGGGGTACATATGCTCTCCTTCTGTTACAG CTACTTCTAGGGAAAGGTTCGAGAAGTAGTACCTTAAAACATATCAGAGACAATTT TTTTTATTTTTACTATGAACAAGTTATCCAAAATTTATTCTGGGCAAACAGAAAAAA AAAGGGAGCAAATATTAATTTGTAGATGCAATTACTATTTTCCTTTGTTTACTGATTT AACTCTTTGGGTTTAAG2TAntisense oligonucleotide target (Indel +10) (SEQ ID NO: 3)TCGAGAAGTAGTACCTTAAAAntisense oligonucleotide target (Indel +9) (SEQ ID NO: 4)CGAGAAGTAGTACCTTAAAAAntisense oligonucleotide target (Indel +8) (SEQ ID NO: 5)GAGAAGTAGTACCTTAAAACAntisense oligonucleotide target (Indel +7) (SEQ ID NO: 6)AGAAGTAGTACCTTAAAACAAntisense oligonucleotide target (Indel +6) (SEQ ID NO: 7)GAAGTAGTACCTTAAAACATAntisense oligonucleotide target (Indel +5) (SEQ ID NO: 8)AAGTAGTACCTTAAAACATAAntisense oligonucleotide target (Indel +4) (SEQ ID NO: 9)AGTAGTACCTTAAAACATATAntisense oligonucleotide target (Indel +3) (SEQ ID NO: 10)GTAGTACCTTAAAACATATCAntisense oligonucleotide target (Indel +2) (SEQ ID NO: 11)TAGTACCTTAAAACATATCAAntisense oligonucleotide target (Indel +1) (SEQ ID NO: 12)AGTACCTTAAAACATATCAGAntisense oligonucleotide target (Indel +0) (SEQ ID NO: 13)GTACCTTAAAACATATCAGAAntisense oligonucleotide target (Indel -1) (SEQ ID NO: 14)TACCTTAAAACATATCAGAG2TAntisense oligonucleotide target (Indel -2) (SEQ ID NO: 15)ACCTTAAAACATATCAGAGAAntisense oligonucleotide target (Indel -3) (SEQ ID NO: 16)CCTTAAAACATATCAGAGACAntisense oligonucleotide target (Indel -4) (SEQ ID NO: 17)CTTAAAACATATCAGAGACAAntisense oligonucleotide target (Indel -5) (SEQ ID NO: 18)TTAAAACATATCAGAGACAAAntisense oligonucleotide target (Indel -6) (SEQ ID NO: 19)TAAAACATATCAGAGACAATAntisense oligonucleotide target (Indel -7) (SEQ ID NO: 20)AAAACATATCAGAGACAATTAntisense oligonucleotide target (Indel -8) (SEQ ID NO: 21)AAACATATCAGAGACAATTTAntisense oligonucleotide target (Indel -9) (SEQ ID NO: 22)AACATATCAGAGACAATTTT

Claims

2TCLAIMSWhat is claimed is:

1. A method of inhibiting expression of a C90rf72 gene comprising a two-base pair deletion in a cell, comprising delivering to the cell an antisense oligonucleotide (ASO) that targets a C90rf72 allele comprising the two-base pair deletion, wherein the ASO is an oligonucleotide of 10 to 25 nucleotides in length that is complementary with at least 8 contiguous nucleotides of any one of SEQ ID NOs: 2-22.

2. The method of claim 1, wherein the cell is in vitro.

3. The method of claim 2, wherein the cell is a human cell of the central nervous system.

4. The method of claim 3, wherein the cell is from a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD), or from a subject having or suspected of having amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD).

5. The method of claim 1, wherein a subject has the C90rf72 gene comprising the two- base pair deletion, and the method comprises administering the ASO to the subject.

6. The method of claim 5, wherein the subject has or is suspected of having ALS and / or FTD.

7. The method of any preceding claim, wherein the ASO reduces levels of C90rf72 expression in the cell by at least 10%.

8. The method of any preceding claim, wherein the cell is heterozygous for the two-base pair deletion in C90rf72.

9. The method of any preceding claim, wherein the C9orf72 gene comprises a G4C2 repeat expansion comprising 30 or more G4C2 repeats.

10. The method of claim, wherein the two-base pair deletion is in linkage disequilibrium with the G4C2 repeat expansions.

11. The method of claim, wherein the ASO comprises the nucleic acid sequence of any one of SEQ ID NOs: 23-57.

12. The method of any preceding claim, wherein the ASO comprises at least one modified nucleotide.

13. The method of claim 12, wherein the at least one modified nucleotide is a 2’-modified nucleotide.

14. The method of claim 13, wherein the 2’-modified nucleotide is a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'-amino, or 2'-aminoalkoxy modified nucleotide.

15. The method of any preceding claim, wherein the ASO comprises a phosphorothioate modified linkage, is a morpholino, comprises alternating LNA and RNA nucleotides, comprises alternating LNA and DNA nucleotides, comprises alternating RNA and DNA nucleotides, is a gapmer, or a combination thereof.

16. An antisense oligonucleotide (ASO) comprising a nucleic acid sequence 10 to 25 nucleotides in length that is complementary with at least 8 contiguous nucleotides of any one of SEQ ID NOs: 2-22.

17. The ASO of claim 16, wherein the ASO comprises the nucleic acid sequence of any one of SEQ ID NOs: 23-57.

18. The ASO of claim 16 or 17, wherein the ASO comprises at least one modified nucleotide.

19. The ASO of any of claims 16-18, wherein the at least one modified nucleotide is a 2’- modified nucleotide.

20. The ASO of claim 19, wherein the 2’ -modified nucleotide is a 2'-deoxy, 2'-fluoro, 2'- O-methyl, 2'-O-methoxyethyl, 2'-amino and 2'-aminoalkoxy modified nucleotides.

21. The ASO of any of claims 16-20, wherein the ASO comprises a phosphorothioate modified linkage, is a morpholino, comprises alternating LNA and RNA nucleotides, comprises alternating LNA and DNA nucleotides, comprises alternating RNA and DNA nucleotides, is a gapmer, or a combination thereof.

22. A pharmaceutical composition comprising the ASO of any of claims 16-21 and a pharmaceutically-acceptable carrier.

23. A method of treating a subject who has or is suspected of having ALS and / or FTD, comprising administering to the subject an antisense oligonucleotide (ASO) that targets a C90rf72 allele comprising the two-base pair deletion, wherein the ASO is an oligonucleotide of 10 to 25 nucleotides in length that is complementary with at least 8 contiguous nucleotides of any one of SEQ ID NOs: 2-22, and wherein the subject is heterozygous for the two-base pair deletion in C90rf72.

24. A method of inhibiting expression of a C90rf72 gene comprising a single nucleotide polymorphism (SNP) in a cell, comprising delivering to the cell an antisense oligonucleotide (ASO) that targets a C90rf72 SNP, wherein the ASO is an oligonucleotide of 10 to 25 nucleotides in length that is complementary with at least 8 contiguous nucleotides of any one of rs2453565, rs700828, rs774356, rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, and rs3849945 comprising the SNP.