Efficient transgene-free genome editing in plants in the t0 generation based on a co-editing strategy

Abstract

Transgene-free genome editing of plants in T0 generation is highly desirable but challenging, especially in perennials and vegetatively propagated plants. Here is provided a co-editing strategy for generating transgene-free, gene-edited plants via Agrobacterium-mediated transient expression of cytosine base editor (CBE) / gRNA-Cas 12a / crRNA-GFP in plants. Specifically, CBE / gRNA was used to base edit the AES gene to confer resistance to herbicide chlorsulfuron as a selection marker, which has no negative effects on plant phenotypes; Casl2a / crRNA was used for editing genes(s) of interest; GFP was used for selecting transgene-free transformants. Using this approach, transgene- free genome-edited plants were efficiently generated for various genes (either individual or multiplex) in tomato, tobacco, potato, and citrus in the T0 generation. The biallelic / homozygous transgene-free mutation rates for target genes among herbicide-resistant transformants ranged from 8% to 50%. Whole genome sequencing further confirmed transgene-free and absence of off- target mutations in the edited plants. The co-editing strategy is efficient for generating transgene- free, genome-edited plants in the T0 generation, thus being a potent tool for plant genetic improvement.

Description

[0001] EFFICIENT TRANSGENE-FREE GENOME EDITING IN PLANTS IN THE TO

[0002] GENERATION BASED ON A CO-EDITING STRATEGY

[0003] GOVERNMENT SUPPORT CLAUSE

[0004] This invention was made with government support under Grant No. 2022-70029-38471 awarded The United States Department of Agriculture, National Institutes of Food & Agriculture. The government has certain rights in the invention.

[0005] BACKGROUND

[0006] Transgene-free genome editing is highly desirable for plant genetic improvement. Cas9 and Cas12a DNA, mRNA or ribonucleoprotein complex (RNP) were successfully used to generate transgene-free plants1, 2, which often require the transformation of embryogenic protoplasts. However, the regeneration of plants from protoplasts remains technically challenging and / or limited to specific plant species / genotypes3. Until now, most genome-edited plants were generated through Agrobacterium-mediated transformation and are transgenic. Genome editing via transgenic approaches not only causes regulatory and public concerns4, but also can generate new and off-target mutations in the next generation5"7. For annual crops such as rice, it is relatively easy to obtain transgene-free, gene-edited plants by genetic segregation via backcrossing or selfing8. However, for perennials and vegetatively propagated plants, it is laborious and time-consuming to remove transgenes. Many crops lose traits of the parental cultivars via backcrossing, owing to their heterozygous nature as hybrids. Furthermore, in some plants, such as citrus and apple, the transgene cannot be removed through seed segregation once it is integrated into the plant genome because of their asexual reproduction nature through apomixis91 10.

[0007] Even though genome editing via Agrobacterium results in transgenic plants, most T-DNAs used for carrying the Cas / gRNA do not integrate into the host chromosome, but are present in the nucleus, where they will be transcribed, leading to transient expression of the carried genes11, 12. The Agrobacterium-mediated transient expression was used for genome editing without transgene integration into plant genomes on several occasions13"16. The main drawback of this approach identified in previous studies is that the majority of transformants are wild type, and most edited plants are mosaic / chimera or heterozygous and additional generations are needed to identify transgene-free and homozygous / biallelic mutants. In addition, previous genome editing through transient expression of Cas / gRNA constructs is usually performed without selection pressure, making it difficult, laborious and time-consuming to differentiate edited plants from unedited ones17.

[0008] SUMMARY

[0009] Disclosed herein are embodiments related to the generation of transgene-free genome- edited plants by employing T-DNA carrying CBE / gRNA-Cas12a / crRNA-GFP to co-edit the ALS gene, which encodes acetolactate synthase, and gene(s) of interest. Herbicides, such as chlorsulfuron, kills plants by acting as the inhibitors of acetolactate synthase. Mutation in the ALS genes using CBE (i.e., a fusion protein of inactive Cas9 or nickase Cas9 and cytosine base editor) / gRNA confers resistance to herbicides such as chlorsulfuron in diverse plant species10, 15’18-25, thus providing a useful selection marker. The gene(s) of interest can be edited via Cas12a / crRNA, whereas GFP enables screening of putative transgene-free (GFP-negative) transformants. As presented herein, this co-editing strategy has been successfully used to efficiently generate transgene-free tomato, tobacco, potato, and citrus in the TO generation for various genes. This strategy has broad applications in plant genetic improvements.

[0010] BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The present embodiments are illustrated by way of example, and not by way of limitation, in the figures of the accompanying drawings.

[0012] The following figures are illustrative only, and are not intended to be limiting

[0013] Figure 1 shows the establishment of herbicide-assisted transgene-free genome editing system. FIG. 1A, The CBE-Cas12a-GFP-S1ALS1 construct used in the generation of transgene- free, SIALS1 -edited tomato. The gRNA for SIALS1 is boxed. The targeted nucleotides (CC) are highlighted in yellow. CsVMV, Cassava vein mosaic vims promoter; U6, citrus U6 promoter; CmYLCV, Cestrum yellow leaf curling virus promoter; CBE, cytosine base editor; T, terminator. For GFP, Nos terminator; for SIALS gRNA, poly (T) terminator; for CBE and Cas12a, HSP 18.2 terminator. RB, T-DNA right border; LB, T-DNA left border. FIG. IB, PCR amplification of GFP in the regenerated chlorsulfuron-resistant tomato lines with or without green fluorescence. FIG. 1C, SIALS1 gene genotyping of chlorsulfuron-resistant tomato regenerants through restriction enzyme digestion of PCR amplicons with StyI. PCR amplicons spanning the SIALS 1 gRNA region were subjected to restriction enzyme digestion with Styl. Editing of the targeted nucleotides abolishes the Styl recognition site, resulting in resistance to Styl digestion. Bottom text: SIALS1 genotypes in the edited lines were confirmed by Sanger sequencing.

[0014] Figure 2 shows transgcnc-frcc gene editing in the first generation (TO) in tomato. FIG. 2A, CBE-Cas12a-GFP-S1ALS1-S1ER construct used in the generation of transgene-free, SIALS1- edited, S / ER-edited tomato. CsVMV, Cassava vein mosaic virus promoter; U6, U6 promoter; CmYLCV, Cestrum yellow leaf curling virus promoter; HH, ribozyme Hammerhead; DR, direct repeat; HDV, ribozyme hepatitis delta virus, CBE, cytosine base editor; T, terminator. For GFP, Nos terminator; for SIALS gRNA, poly (T) terminator, for SIER crRNA, poly (T) terminator followed by HSP 18.2 terminator; for CBE and Cas12a, HSP 18.2 terminator. RB, T-DNA right border; LB, T-DNA left border. FIG. 2B, The SIER genotypes of the edited lines without green fluorescence. FIG. 2C, PCR amplification of GFP and Cas12a from the biallelic mutants in b. d, e, Phenotypes of a representative transgene-free, SlER-edited line sler-4.

[0015] Figure 3 shows efficient transgene-free gene editing of tomato in the TO generation with 2 crRNAs. FIG. 3A, Construct scheme showing 1 crRNA targeting SIRbohD. Other parts of the construct are not shown. FIG. 3B, Construct scheme showing 2 crRNAs targeting SIRbohD. FIG. 3C, The SIRbohD genotypes of the transgene-free, homozygous / biallelic edited lines without green fluorescence. FIG. 3D, Comparison of rate of transgene-free, homozygous / biallelic mutants using 1 crRNA and 2 crRNAs. e, PCR amplification of GFP and Cas12a in the lines shown in c.

[0016] Figure 4 shows transgene-free, multiplex gene editing of tomato in the first generation. FIG. 4A, Generation of transgene-free, biallelic / homozygous double mutants of tomato for SIEDS1 and SIPAD4. FIG. 4B, PCR amplification of GFP and Cas12a from the edited sleds l / slpad4 mutant lines from a. FIG. 4C, Generation of transgene-free, biallelic / homozygous double mutants for SIDMR6 and SIINVINH1. FIG. 4D, PCR amplification of GFP and Cas12a from the edited sldmr6 / slinvinhl mutant lines from c.

[0017] Figure 5 shows transgene-free gene editing in the first generation (TO) in tobacco and potato, a-c, Co-editing of NtALS and NtPDS in Nicotiana tabacum. FIG. 5A, Albino phenotype with or without green fluorescence. Regenerants were selected on herbicide chlorsulfuron- containing media. Upper: transgenic albino tobacco plant; lower: transgene-free albino tobacco plant. FIG. 5B, Confirmation of transgene-free gene editing. PCR amplification of GFP and Cas12a in WT, non-transgcnic (NT), and transgenic (T) plants. FIG. 5C, Genotypes of NtALS, NtPDS genes in a transgene-free, albino tobacco line from a. d & e, Transgene-free gene editing in potato. FIG. 5D, PCR amplification of GFP and Cas12a from a regenerated potato line 9 and control transgenic plant. FIG. 5E, Genotype of line 9 at StDMR6. crRNAs are underlined. 1 crRNA was used for StDMR6 editing.

[0018] Figure 6 shows transgene-free gene editing in the first generation (TO) in pummelo (Citrus maxima). FIG. 6A, GFP fluorescence was observed in transgenic Pummelo plants, whereas wild type and transgene-free plants did not exhibit any GFP signal. FIG. 6B, Using a pair of primers Npt-Seq-5 and 35T-3PCR, wild type, transgenic and transgene-free Pummelo plants were analyzed. The wild type Pummelo and plasmid GFP-pl380N-ttLbCas12a:LOBPl-EBE:ALS were used as controls. M, Ikb DNA ladder. FIG. 6C, Sanger sequencing analysis of GFP-negative lines by PCR amplification and cloning of LOB1 promoter. FIG. 6D, Canker-resistance in the transgenic and transgene-free Pummelo plants. Five days post Xanthomonas citri subsp. citri (Xcc) inoculation, citrus canker symptoms were observed on wild type Pummelo, transgenic PUHIGFPS, transgene-free PUHINOGFPI and PUHINOGFPS, whereas no canker symptoms were observed on other LOBP-edited Pummelo plants, which could be attributed to 100% mutation rates in Pumoppl, PumGFp2, PuniGFp4, PUITINOGFP2 and PumNoGFp4. As expected, Xccpr / tA4;7>i5(dCsLOB1.5) caused canker symptoms on all plants. dCsLOBl.5 induces LOB1 to cause canker symptoms by recognizing a different region from EBEp*A4-TII LOBP. GFP-positive lines: Pumoppl to PumoFp4. GFP-negative lines: PUHINOGFPI to PuniNoGFp4.

[0019] Figure 7. Generation of transgene-free, gene-edited plants in the first generation using the CBE-Cas12a-GFP construct. The CBE-Cas12a-GFP construct consists of CBE, Cas12a, and GFP, each driven by its own promoter. CBE and its gRNA are used to base edit the ALS gene to confer resistance to herbicide chlorsulfuron; Cas12a and its crRNA are used for target gene editing; GPF is used for selecting transgene-free transformants. The construct is introduced into plants through Agrobacterium-mcdiatcd transient expression. Transformants arc screened on media containing chlorsulfuron. Putative transgene-free, gene-edited plants are kept if they lack green fluorescence. Plants with fluorescence are discarded. Regenerants without GFP are subjected to genotyping and further analysis. Figure 8. Shows tomato calli and shoots selected on media containing chlorsulfuron herbicide. FIG. 8 A, Tomato calli were grown on the medium containing 110 nM chlorsulfuron. FIG. 8B, Close-up view of calli from the selection medium shown in a. FiG. 8C, Tomato calli and shoots selected on medium containing 110 nM chlorsulfuron.

[0020] Figure 9 shows SIALS1 gene genotyping of chlorsulfuron-rcsistant, non-GFP tomato regenerants generated after CBE-Cas12a-GFP-S1ALS1-S1ER construct transformation. PCR amplicons spanning the SIALS1 gRNA region were subjected to restriction enzyme digestion with StyI. Editing of the targeted nucleotides abolishes the Styl recognition site, resulting in resistance to Styl digestion.

[0021] Figure 10 shows heritability test. PCR amplification of GFP and Cas12a for lines listed in a. At least 16 clones for each gene from each plant were subjected to Sanger sequencing.

[0022] Figure 11 shows detection of green fluorescence in sler-4 and transgenic control seeds under a GFP filter.

[0023] Figure 12 shows transgene-free editing of SIRBL2 in the TO generation.Detection of GFP and Cas12a by PCR. Transgenic lines were used as a positive control.

[0024] Figure 13 shows confirmation of transgene-free, albino tobacco lines. The result is detection of transgenes (GFP and Cas12a) in albino tobacco lines.

[0025] Figure 14 is a schematic representation of the binary vector GFP-pl38ON- ttLbCas12a:LOBPl-PBE:ALS. LB and RB, the left and right borders of the T-DNA region; CsVMV, the cassava vein mosaic virus promoter; GFP, green fluorescent protein; 35T, the cauliflower mosaic virus 35S terminator; CmYLCV, the cestrum yellow leaf curling virus promoter; NosP and NosT, the nopaline synthase gene promoter and its terminator; ttLbCas12a, temperature-tolerant LbCas12a containing the single mutation D156R; A1U6-26, Arabidopsis U6- 26 promoter, targetl, the 23 nucleotides of Type II LOBP highlighted by blue, is located downstream of protospacer-adjacent motif (PAM); HH, the coding sequence of hammerhead ribozyme; HDV, the coding sequence of hepatitis delta virus ribozyme; nCas9-PBE, a plant base editor composed of rat cytidine deaminase APOBEC1, Cas9-D10A nickase (nCas9) and uracil glycosylase inhibitor (UGI); AtU6-26, Arabidopsis U6-26 promoter; target2, the 20 nucleotides of CsALS highlighted by blue, is located upstream of protospacer-adjacent motif (PAM); Nptll, the coding sequence of neomycin phosphotransferase II.

[0026] Figure 15 shows PUC57-mini-crRNA and PUC57-HDV-HH-DR sequences.

[0027] DETAILED DESCRIPTION

[0028] Definitions

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference.

[0030] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein, and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed through the present specification unless otherwise indicated.

[0031] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, + / -5% or less, + / -!% or less, and 0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.

[0032] Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.

[0033] The term "plant" includes whole plants, plant organs (c.g., leaves, stems, roots, etc.), seeds and plant cells and progeny of same. The class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. A non-limiting list of plants for which the embodiments described herein may be implemented include monocots, such as, barley, maize, oat, rice, wheat, rye, Sorghum, millet, Tripsacum, Triticale, forage grass and turf grass or dicots such as Berry, Blueberry, Blackberry, Raspberry, Loganberry, Huckleberry, Cranberry, Gooseberry, Elderberry, Currant, Caneberry, Bushbeny, Strawberry, Brassica Vegetables, Broccoli, Cabbage, Cauliflower, Brussels Sprouts, Collards, Kale, Mustard Greens, Kohlrabi, Cucurbit Vegetables, Cucumber, Cantaloupe, Melon, Muskmelon, Squash, Watermelon, Pumpkin, Eggplant, Bulb Vegetables, Onion, Garlic, Shallots, Fruiting Vegetables, Pepper, Tomato, Ground Cherry, Tomatillo, Okra, Grape, Herbs / Spices, Leafy Vegetables, Lettuce, Celery, Spinach, Parsley, Radicchio, Legumes / Vegetables (succulent and dried beans and peas), Sunflower, Root / Tuber and Corm Vegetables, Carrot, Potato, Sweet Potato, Cassave, Beets, Ginger, Horseradish, Radish, Ginseng, Turnip, Kiwi, Banana, herbs, Rosemary, Thyme, Cilantro, Oregano, Parsley, Sage, Mint, Lemon grass, Ornamental plants, Annuals, Poinsettia, Helichrysum, Geranium, Begonia, Bacopa, Chrysocephalum, Calibrachoa, Coleus, Cleome, Evolvulus, Angelonia, Argyranthemum, Nemesia, Osteospermum, Petunia, Pansiola, Pelargonium, Cyperus, Dalina, Dahlia, Dichondra, Ipomoea, Lantana, Lobularia, Lobelia, Euphorbia, Impatiens, Verbena, Scacvola, Scdum, Scirpus, Sctaccum, Ncmcsia, Phlox, Torcnia, Mccardonia, Perennials, Hydrangea, Clematis, Rosa, Buddleia, Salvia, Sedum, Sambucus, Hybiscus, Weigelia, Hardwood cuttings, Chestnuts, Oak, Maple, Stone Fruit, Apricot, Cherry, Nectarine, Peach, Plum, Prune, Citrus, Orange, Grapefruit, Lemon, Tangerine, Tangelo, or Pummelo.

[0034] The term “genome editing” or “gene editing” refers to modifying a gene or genes with techniques that employ targeted mutagenesis to activate DNA repair pathways. These techniques include, but are not limited to, those that utilize endonucleases to generate single-strand and double-strand DNA breaks that activate DNA repair pathways. Genome editing techniques may also comprise systems that enable targeted editing at any genomic locus. These targeting systems include, but are not limited to, polypeptides, such as, Transcription Activator-Like Effectors (TALEs) and zinc fingers (ZFs), or nucleic acids, such as, Clustered Regularly Interspaced Short Palindromic Repeats / Cas (CRISPR / CAS) single guide RNAs or NgAgo (Argonaute) single strand DNAs. As used herein, "genome editing" or "gene editing" are interchangeable.

[0035] The term “genetic modification” refers to a DNA sequence difference, epigenetic difference, or combination thereof between two genomes of the same species in which one genome is identified as the modified genome and the other is identified as the unmodified genome and the DNA sequence or epigenetic difference is the result of applying genome modifying techniques to the unmodified genome to yield the modified genome. A genetic modification, as used herein, encompasses any insertion, deletion, or substitution of a nucleotide sequence of any size and nucleotide content, any epigenetic modification to any number of nucleotides, or a combination thereof. A genetic modification, as used herein, may also encompass introduction of one or more exogenous coding nucleic acids that do not integrate into the unmodified genome, yet are capable of autonomous replication. In certain embodiments, a modification to an endogenous gene or regulatory element thereof may be a deletion, a substitution, or an insertion that reduces expression of the endogenous gene or the polypeptide for which it encodes. In specific embodiments, the modification may be an indel, wherein the indel may cause a frameshift mutation, a missense mutation, a nonsense mutation, a neutral mutation, or a silent mutation. In specific embodiments, a modification to a regulatory element of an endogenous gene may alter or eliminate a function of the regulatory element. In further contemplated embodiments, the modification may comprise a nucleic acid sequence that provides exogenous control of endogenous gene, mRNA, or polypeptide expression levels. In specific embodiments, the modification may also disrupt a post-translational process of a polypeptide encoded by an endogenous gene. Post-translational processes in certain embodiments may be post-translational modification, protein sorting, or proteasomal degradation.

[0036] As used herein, the “CRISPR / Cas system” refers to a genetic engineering technique in molecular biology by which the genomes of living organisms may be edited / modified. It is based on simplified versions of the bacterial CRISPR-Cas9 or CRISPR-Cas12a or other CRIRSPR-Cas antiviral defense systems. Briefly, by delivering the Cas nucleases (such as Cas9 and Cas12a) complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and / or new ones added in vivo.

[0037] CRISPR / Cas systems are part of the adaptive immune system of bacteria and archaea, protecting them against invading DNA, such as viral DNA, by cleaving the foreign DNA in a sequence-dependent manner. The immunity is acquired by the integration of short fragments of the invading DNA known as spacers between two adjacent repeats at the proximal end of a CRISPR locus. The CRISPR arrays, including the spacers, are transcribed during subsequent encounters with invasive DNA and are processed into small interfering CRISPR RNAs (crRNAs) approximately 40 nt in length, which combine with the frans-activating CRISPR RNA (tracrRNA) to activate and guide the Cas9 nuclease, Cas12a or other Cas nucleases. This cleaves homologous double-stranded DNA sequences known as protospacers in the invading DNA.

[0038] In some embodiments, a tracrRNA and crRNA are linked and form a chimeric crRNA- tracrRNA hybrid where a mature crRNA is fused to a partial tracrRNA via a synthetic stem loop to mimic the natural crRNA:tracrRNA duplex as described in Cong et al. (Science (2013) 15:339(6121):819-823) and Jinek, et al. (Science (2012) 337(6096):816-21). A single fused crRNA-tracrRNA construct can also be referred to as a guide RNA or gRNA (or single-guide RNA (sgRNA)). Within a sgRNA, the crRNA portion can be identified as the 'target sequence' and the tracrRNA is often referred to as the 'scaffold' RNA (scRNA).

[0039] While the specifics can be varied in different engineered CRISPR systems, the overall methodology is similar. For example, a practitioner interested in using CRISPR technology to target a DNA sequence can insert a short DNA fragment containing the target sequence into a guide RNA expression plasmid. The sgRNA expression plasmid therefore contains the target sequence (about 20 nucleotides), a form of the tracrRNA sequence (i.e., the scRNA) as well as a suitable promoter and necessary elements for proper processing in eukaryotic cells. Such vectors are commercially available (see, for example, Addgene). Many of the systems rely on custom, complementary oligos that are annealed to form a double stranded DNA and then cloned into the sgRNA expression plasmid. Co-expression of the sgRNA and the appropriate Cas enzyme from the same or separate plasmids in transfected cells results in a single or double strand break (depending of the activity of the Cas enzyme) at the desired target site.

[0040] Typically, as used in accordance with the present disclosure, the CRISPR complex is introduced into a cell, and creates a break (e.g., a single or a double strand break) in the target DNA sequence. For example, the method can be used to cleave a target viral gene of a DNA virus that has infected a cell. The break created by the CRISPR complex can be repaired by repair processes such as the error prone nonhomologous end joining (NHEJ) pathway or the high fidelity homology-directed repair (HDR). During these repair processes, an exogenous polynucleotide template can be introduced into the genome sequence. In some methods, the HDR process is used to modify a genome sequence. For example, an exogenous polynucleotide template comprising a sequence to be integrated flanked by an upstream sequence and a downstream sequence is introduced into a cell. The upstream and downstream sequences share sequence similarity with either side of the site of integration in the DNA viral genome. Where desired, a donor polynucleotide can be DNA, e.g., a plasmid DNA (pDNA), a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), a viral vector, a linear piece of DNA, a PCR fragment, a naked nucleic acid, or a nucleic acid complexed with a delivery vehicle such as a exosome, liposome or poloxamer. Thus, the modifications of the target DNA due to NHEJ and / or homology-directed repair can be used to induce transgene insertion, nucleotide deletion, gene disruption, gene mutation, etc.

[0041] A prerequisite for cleavage is the presence of a conserved protospacer-adjacent motif (PAM) downstream of the target DNA, which usually has the sequence 5'-NGG-3' in the case of

[0042] Cas9, but less frequently NAG. Specificity is provided by the so-called "seed sequence" approximately 12 bases upstream of the PAM, which must match between the RNA and target DNA. Cas 12a (previously known as Cpfl) acts in a similar manner to Cas9, but Cas 12a does not require a tracrRNA. Specificity of the CRISPR / Cas system is based on an RNA-guide that use complementary base pairing to recognize target DNA sequences. In some embodiments, the sitespecific genome modification enzyme is a CRISPR / Cas system. In an aspect, a site-specific genome modification enzyme provided herein can comprise any RNA-guided Cas endonuclease (non-limiting examples of RNA-guided nucleases include Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Cas 10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, homologs thereof, or modified versions thereof); and, optionally, the guide RNA necessary for targeting the respective nucleases. The term "gene of interest" as used herein refers to any nucleotide sequence, which is to be edited in the genome of a plant cell to produce genetically transformed / modified cells.

[0043] The term “targeting” as used herein refers to base-pairing or hybridization of crRNA to a genes or genes of a plant cell to be modified by the method and constructs disclosed herein, and is definitely not limited to gene regions, i.c., regions which carry the information for transcription of a mRNA region. These base-pairing or hybridization regions can be regulatory regions of a gene to be modified.

[0044] The term “fused” as used herein refers to joining parts of two different genes and / or proteins. Here a nucleotide sequence encoding cytosine deaminase is linked to a nucleotide sequence encoding dCas9 or nCas9 endonuclease.

[0045] The term “nucleotide” as used herein refers to a sub-unit of a nucleic acid (whether DNA or RNA or an analogue thereof) which may include, but is not limited to, a phosphate group, a 5- carbon sugar group and a nitrogen containing base, as well as analogs of such sub-units. Other groups (e.g., protecting groups) can be attached to the sugar group and nitrogen containing base group. It will be appreciated that, as used herein, the terms “nucleotide" and “nucleoside" will include those moieties which contain not only the naturally occurring purine and pyrimidine bases, e.g., adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U), but also modified purine and pyrimidine bases and other heterocyclic bases which have been modified (these moieties are sometimes referred to herein, collectively, as “purine and pyrimidine bases and analogs thereof’). Such modifications include, e.g., diaminopurine and its derivatives, inosine and its derivatives, alkylated purines or pyrimidines, acylated purines or pyrimidines thiolated purines or pyrimidines, and the like, or the addition of a protecting group such as acetyl, difluoroacetyl, trifluoroacetyl, isobutyryl, benzoyl, 9-fluorenylmethoxycarbonyl, phenoxyacetyl, dimethylformamidine, N,N- diphenyl carbamate, or the like. The purine or pyrimidine base may also be an analog of the foregoing; suitable analogs will be known to those skilled in the ait and are described in pertinent texts and literature. Common analogs include, but are not limited to, 1 -methyladenine, 2- methyladenine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentyladenine, N,N-dimethyladenine, 8-bromoadenine, 2-thiocytosine, 3-methylcytosine, 5-methylcytosine, 5- ethylcytosine, 4-acetylcytosine, 1-methylguanine, 2-methylguanine, 7-methylguanine, 2,2- dimethylguanine, 8-bromoguanine, 8-chloroguanine, 8-aminoguanine, 8-methylguanine, 8- thioguanine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-ethyluracil, 5- propyluracil, 5-mcthoxyuracil, 5-hydroxymcthyluracil, 5-(carboxyhydroxymcthyl)uracil, 5- (methylaminomethyl)uracil, 5-(carboxymethylaminomethyl)-uracil, 2-thiouracil, 5-methyl-2- thiouracil, 5-(2-bromovinyl)uracil, uracil-5-oxyacetic acid, uracil-5-oxyacetic acid methyl ester, pseudouracil, 1-methylpseudouracil, queuosine, inosine, 1 -methylinosine, hypoxanthine, xanthine, 2-aminopurine, 6-hydroxyaminopurine, 6-thiopurine, and 2,6-diaminopurine.

[0046] The terms “oligonucleotide,” “nucleotide sequence,” and “nucleic acid sequence” as used herein refer to any polyribonucleotide or polydeoxyribonucleotide that may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, oligonucleotides as used herein refers to, among others, single- and double-stranded DNA, DNA that is a mixture of single- and doublestranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.

[0047] The term “vector" as used herein refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked, usually a DNA molecule that is used as a vehicle to carry a particular foreign nucleic acid sequence - usually DNA - into a host / recipient cell where it can be replicated and / or expressed. The vector typically includes features to facilitate the manipulation of DNA as well as a genetic marker for their selective recognition. The most common vectors are DNA plasmids, viruses and artificial chromosomes. Certain vectors are capable of autonomous replication in a host cell into which they are introduced. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, “plasmid" and “vector” may be used interchangeably as the plasmid is the most commonly used form of vector.

[0048] The term “plasmid” as used herein refers to a double-stranded, covalently closed, circular DNA that can be isolated from bacterial cells, which exists in its bacterial hosts as extrachromosomal pieces of DNA that vary in size from 1 kb to >200 kb. Most of the plasmids used in molecular cloning have a multiple cloning site (MCS), also called a polylinker, which is a short segment of DNA which contains various restriction sites - a standard feature of engineered plasmids - for the insertion of the foreign DNA. In addition, the plasmid should have an origin of replication (ori) site - usually bacterial origin - where DNA replication is initiated, marker genes - antibiotics resistance gene - for selection and / or screening with antibiotics, and promoters - usually viral origin- for gene expression. It should be small in size so that it can easily delivered into the host cell. Plasmids do not generally replicate in the host mammalian cells. By performing a process of DNA transfection or transformation, a plasmid which contains a gene of interest is efficiently delivered to the cells of interest. Numerous plasmid vectors are commercially available, and the modification thereof for specific cloning strategies is well known to the skilled person in the field.

[0049] As used herein, a "promoter1* is defined as a regulatory DNA sequence that is generally located upstream of a gene and mediates the initiation of transcription by directing RNA polymerase to bind to DNA and initiating RNA synthesis. In some embodiments, the plasmid may comprise more than one RNA polymerase II (pol II) promoters and / or RNA polymerase III (pel III) promoters. A promoter can be a constitutively active promoter (i.e., a promoter that is constitutively in an active / "ON" state), it may be an inducible promoter (i.e., a promoter whose state, active / "ON" or inactive / "OFF", is controlled by an external stimulus, e.g., the presence of a particular compound or protein), it may be a spatially restricted promoter (i.e., transcriptional control element, enhancer, etc.) (e.g., tissue specific promoter, cell type specific promoter, etc.), and it may be a temporally restricted promoter (i.e., the promoter is in the "ON" state or "OFF" state during specific stages of embryonic development or during specific stages of a biological process.

[0050] The term “ribozyme" as used herein refers to an RNA enzyme that catalyzes a chemical reaction. Enzymatic nucleic acids (ribozymes) act by first binding to a target RNA. Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Ribozyme possesses hairpin or hammerheads like center and a secondary structure which allow it to cleave RNA, DNA molecules. Ribozymes arc two types, self-cleaving RNAs and self-splicing ribozymes. Selfcleaving ribozymes are involved in hairpin ribozymes, hepatitis delta virus, hammerhead ribozymes, etc. The term “transformation” or “transform” refers to genetic transformation that is a process that involves the introduction and expression of foreign genes in a host organism. This expression can result from the extrachromosomal, or episomal presence of genes in nuclei that may persist if the introduced DNA has a mechanism for replication. Bacterial transformation is a process of horizontal gene transfer by which some bacteria take up foreign genetic material (naked DNA) from the environment. For example, in some embodiments, the Agrobacterium is transformed with plasmids or T-DNA, using heat and thaw methods. Plant genetic transformation (PGT) is a process where DNA is introduced into plant cells, tissues, or organs using molecular and cellular biology methods. PGT comprises steps of delivery of the DNA into a single cell and regeneration into entire fertile plants. In some embodiments, explants of tomato, tobacco, potato or citrus are genetically ‘transformed’ to have a specific gene modified and express altered phenotypes using Agrobacterium ‘transformed’ with plasmids encoding CRISPR / Cas gene editing systems.

[0051] The term “transgenic plant” as used herein refers to the plant that have been genetically modified by the insertion of a foreign genetic material (gene(s), DNA sequence(s), etc.) into the chromosome of the cell, while a “transformed plant” is the one whose genome has been genetically modified but not necessarily through insertion of a foreign genetic material. A transgenic plant may have an altered genome containing a DNA sequence or gene from a different species, which expresses a protein that is not native to the plant. The protein encoded by the gene will confer a particular trait or characteristic to that plant.

[0052] As used herein, “explant” or “plant explant” refers to a fragment of plant tissue obtained from any part of the plant and used as a starting material to grow a plant in tissue culture. Some examples of explants are root fragments, shoot fragments, leaf sections, petals, apical buds, or seeds. From there, the explant can be used for regeneration or non-regeneration techniques.

[0053] As used herein, “genotyping” refers to the experimental procedure that determines the differences in DNA sequence among individuals or populations by examining the individual's DNA sequence using biological assays and comparing it to another individual's sequence or a reference sequence. It reveals the alleles an individual has inherited from their parents. Current methods of genotyping include restriction fragment length polymorphism identification (RFLPI) of genomic DNA, random amplified polymorphic detection (RAPD) of genomic DNA, amplified fragment length polymorphism detection (AFLPD), polymerase chain reaction (PCR), DNA sequencing, allele specific oligonucleotide (ASO) probes, and hybridization to DNA microarrays or beads. Due to current technological limitations, almost all genotyping is partial. That is, only a small fraction of an individual’s genotype is determined.

[0054] As used herein, “biallelic” refers to the presence of both alleles of a single gene (paternal and maternal). For example, biallelic mutation carriers have a mutation (not necessarily the same mutation) in both copies of a particular gene (a paternal and a maternal mutation).

[0055] As used herein, “homozygous” refers to the presence of two identical alleles at a particular gene locus. A homozygous genotype may include two normal alleles or two alleles that have the same variant. In contrast, “heterozygous”, as related to genetics, refers to having inherited different versions (alleles) of a genomic marker from each biological parent. Thus, an individual who is heterozygous for a genomic marker has two different versions of that marker. By contrast, an individual who is homozygous for a marker has identical versions of that marker.

[0056] As used herein, the term “variants” refers to nucleic acid- or polypeptide sequences having substantial similarity with a sequence disclosed herein. A variant comprises a deletion and / or addition of one or more nucleotides or peptides at one or more internal sites within the native polynucleotide or polypeptide and / or a substitution of one or more nucleotides or peptides at one or more sites in the native polynucleotide or polypeptide. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis. Generally, variants of a nucleotide sequence disclosed herein will have at least 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, to 95%, 96%, 97%, 98%, 99% or more sequence identity to that nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters. Biologically active variants of a nucleotide sequence disclosed herein are also encompassed. Biological activity may be measured by using techniques such as Northern blot analysis, reporter activity measurements taken from transcriptional fusions, and the like. See, for example, Sambrook, el al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), hereinafter “Sambrook”, herein incorporated by reference in its entirety. Alternatively, levels of a marker gene such as green fluorescent protein (GFP) or yellow fluorescent protein (YFP) or the like produced under the control of a promoter operably linked to a nucleotide fragment or variant can be measured. See, for example, Matz et al. (1999) Nature Biotechnology 17:969-973; U.S. Pat. No. 6,072,050, herein incorporated by reference in its entirety; Nagai, ct al., (2002) Nature Biotechnology 20(l):87-90. Variant nucleotide sequences also encompass sequences derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different nucleotide sequences can be manipulated to create a new nucleotide sequence. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art. See, for example, Slemmer, (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389 391; Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al., (1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature 391:288-291 and U.S. Pat. Nos. 5,605,793 and 5,837,458, herein incorporated by reference in their entirety.

[0057] As used herein, “sequence identity” or “identity” in the context of two nucleic acid- or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity”. Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of one and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and one. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC / GENE (Intelligenetics, Mountain View, Calif.).

[0058] Overview In this disclosure, a potent genome editing toolkit was developed to generate transgene- frcc genome-edited plants in the TO generation by co-editing the ALS gene and gcnc(s) of interest through Agrobacterium-mediated transient expression. It was successfully used for genome editing of tomato and tobacco (annuals), citrus (a perennial tree crop), and potato (a vegetatively propagated tetrapioid crop). The biallelic / homozygous mutation rates for target genes among herbicide-resistant transformants in our study ranged from 8% to 50%, which is comparable to the genome editing efficacy using Cas / gRNA DNA, mRNA, or ribonucleoproteins1, 2. The efficient identification of biallelic / homozygous mutants resulted from co-editing of the ALS gene, which provides a useful and practical selection marker as a gain-of-function against sulfonylurea herbicides. Importantly, precise editing by CBE targets the proline residue, for instance, Pro 186 in tomato or Prol88 in citrus, which probably disrupts the recognition and binding of the herbicides without affecting ALS function44. Consistently, ALS mutants at the proline residue did not show any phenotypical changes in our study. Natural mutations of the ALS gene are prevalent in plant species without affecting plant phenotypes (except herbicide resistance) and fitness45-49. Thus, editing of the ALS gene as a selection marker will not negatively affect genetic improvement of crops and their commercialization.

[0059] The co-editing strategy has multiple advantages in generating transgene-free genome- edited plants:

[0060] 1) The co-editing strategy ensures transgene-free genome editing by transient expression of Cas / gRNA and removing of stable transformants using GFP as an indicator. Transiently expressed Cas / gRNA eventually degrades, thus mimicking the approaches that use Cas / gRNA DNA in transgene-free genome editing via transformation of protoplasts50. Genotyping of construct components such as GFP, Cas12a, or nptll genes and whole genome sequencing of putative transgene-free lines indeed confirm the absence of foreign genes in 87.5% (7 of 8) putative transgene-free lines. Intriguingly, the sleds l / slpad4 line 8 contained 281 reads matching construct sequences whereas the two transgenic lines contained 1830 and 2716 construct reads| Consequently, whole genome sequencing is required to verify the edited lines to be transgcnc-frcc. “Transgene-free” is a prerequisite for commercialization of genetically modified organisms. Transgenic crops are under robust and strict regulations in different countries and regions,4and cause negative public reception, which impedes their commercialization despite superior traits. 2) Transgene-free lines without T-DNA eliminate the potential disruption of gene functions at the insertion site caused by T-DNA in Agrobacterium-mcdiated stable transformation52. Thus, this approach is not only suitable for crop genetic improvements, but also provides advantages in genetic studies.

[0061] 3) Off-target mutations arc another critical factor for consideration during genetic improvement by genome editing. No off-target mutations were identified in our genome-edited lines. This probably results from the short functional time of Cas / gRNA during transient expression, as suggested by previous studies10, 53. Similarly, transient expression of Cas / gRNA DNA, mRNA, and RNP in embryogenic protoplasts, calli, or immature embryo cells has been reported to generate transgene-free plants without causing off-target mutations1, 2, 54.

[0062] 4) This co-editing strategy can produce transgene-free, gene-edited plants in the TO generation. Generation of transgene-free genome-edited plants in the TO generation bypasses the need to remove transgenes in future generations by genetic separation via backcrossing or selfing. The removal of transgenes is not feasible for many crops which are asexually propagated, or highly heterozygous, or have long juvenility, such as grape, citrus, potato and banana. Generation of transgene-free plants in the TO generation significantly expedites the genetic improvement of crops. For example, transgene-free citrus was generated within 6 months using our approach. However, it takes approximately 20 years to generate new citrus varieties using traditional breeding approach55.

[0063] 5) Lastly, our strategy is based on Agrobacterium-mediated delivery of CRISPR / Cas components into recipient plant tissues such as cotyledons, leaves, and epicotyls. Hence, it can be easily adopted because Agrobacterium-mediated transformation is one of the most widely used and convenient methods. Transformation of embryogenic protoplasts with Cas / gRNA RNP56, or DNA50has successfully generated transgene-free, genome-edited plants. However, plant regeneration from protoplasts is technically challenging. Noticeably, the regenerated plants from protoplasts are prone to somaclonal variations and genome instability57, 58. In addition, regeneration from protoplasts is not accessible to many plant species, especially monocots. Another method to generate transgene-free edits is to transiently deliver plasmids, mRNA, or RNPs directly into callus cells or immature embryos through biolistic particle bombardment3, 59,60. However, due to low efficiency and no selection, a huge amount of work must be done on tissue culture, regeneration, genotyping, and selection of edited plants from unedited plants. It is not surprising that the co-cditing strategy may also aid in the enrichment and selection of edited protoplasts, callus cells or immature embryos achieved through means other than Agrobacterium.

[0064] In summary, an efficient transgene-free genome editing methodology based on Agrobacterium-mcdiated transient expression for plants is developed. As Agrobacterium-mcdiated transformation works for many plant species, it is anticipated that this approach has broad applications in genetic improvements and genetic studies of plants. It is particularly useful for perennials and vegetatively propagated plants to generate transgene-free, gene-edited plants in the TO generation.

[0065] Description of Embodiments

[0066] According to one embodiment, provided is a vector for transgene-free genome editing in an explant in the first generation (TO) using a co-editing strategy. The vector includes;

[0067] (a) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor is a fusion protein comprising a cytosine deaminase fused at its either N-terminus or C-terminus to dCas9 or nCas9,

[0068] (b) an oligonucleotide encoding a guide RNA comprising tracrRNA for Cas9 and crRNA targeting acetolactate synthase (ALS) gene to be base-edited,

[0069] (c) an oligonucleotide encoding a Cas endonuclease selected from Class 2 Cas endonucleases, in particular Cas 12a,

[0070] (d) an oligonucleotide encoding at least one crRNA of gene of interest to be edited, and

[0071] (e) an oligonucleotide encoding a fluorescent protein as a selection marker.

[0072] In one aspect, the oligonucleotide encoding the cytosine base editor comprises a nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence comprising at least 95% sequence identity therewith, and wherein the oligonucleotide has a strong RNA Pol II promoter, in particular CmYLCV promoter, at its 5* upstream region and a terminator, in particular HSP 18.2 terminator, at its 3* downstream region. The oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA may involve a nucleic acid sequence of SEQ ID NO:3 as the tracrRNA. The oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA may include a nucleic acid sequence of crRNA targeting acetolactate synthase (aZs) gene, wherein the sequence of crRNA is one selected from SEQ ID NO:6 for SIALS1, SEQ ID NO: 14 for NtALS, SEQ ID NO: 16 for StALS, or SEQ ID NO: 18 for CsALS, and wherein the oligonucleotide has an RNA polymerase in promoter, in particular U6 promoter, at its 5’ upstream region and a terminator, in particular poly (T) terminator, at its 3* downstream region. The guide RNA may be flanked by tRNA between the promoter and the guide RNA, and between the guide RNA and the terminator. The oligonucleotide encoding Cas12a may pertain to a nucleic acid sequence of SEQ ID NO:4, and wherein the oligonucleotide has a strong RNA Pol II promoter, in particular CmYLCV promoter, at its 5* upstream region and a terminator, in particular HSP 18.2 terminator, at its 3’ downstream region.

[0073] In specific examples, the oligonucleotide encoding the crRNA for a gene of interest to be edited by Cas12a may include at least one nucleic acid sequence selected from SEQ ID NO:7 for SIER; SEQ ID NO:8 for SIRB12; SEQ ID NO:9 for SIRbohD; SEQ ID NO: 10; for SIEDS1, SEQ ID NO:11 for SIPAD4, SEQ ID NO:12 for SIDMR6, SEQ ID NO:13 for SIINVINH1; SEQ ID NO:15 for NtPDS, SEQ ID NO:17 for StDMR6 or SEQ ID NO:19 for CsLOBl, wherein the oligonucleotide has a strong RNA Pol II promoter, in particular CmYLCV promoter, at its 5’ upstream region and a terminator, in particular poly (T) terminator followed by HSP 18.2 terminator, at its 3* downstream region. In one specific example, the crRNA for a gene of interest to be edited by Cas12a is inserted into a ribozyme-gRNA-ribozyme (RGR) cassette, in which the crRNA is flanked by hammerhead (HH) ribozyme sequence of SEQ ID NO:21 between the promoter and the crRNA, and by hepatitis delta virus (HDV) ribozyme sequence of SEQ ID NO:20 between the crRNA and the terminator.

[0074] In certain examples, the vector may have at least one ribozyme-gRNA-ribozyme (RGR) cassette between the promoter for the oligonucleotide coding the crRNA and the terminator.

[0075] When the vector comprises a fluorescent protein as a selection marker, the selection marker may be one selected from a group comprising fluorescent proteins having blue emission range (424 - 467 nm) selected from Sirius, azurite, BFP, EBFP, EBFP2, and mTagBFP; a group of fluorescent proteins having cyan emission range (474 - 492 nm) selected from CFP, ECFP, cerulean, CyPet, SCFP, TagCFP, AmCyan, Midoriishi Cyan, and mTFPl; a group of fluorescent proteins having green emission range (499 - 519 nm) selected from EGFP, emerald, superfolder avGFP, T-sapphire, Azami Green, mWasabi, ZsGreen, TagGFP, TagGFP2, TurboGFP, CopGFP, and AceGFP; a group of fluorescent proteins having yellow emission range (524 - 538 nm) selected from YFP, EYFP, topaz, Venus, citrine, YPct, SYFP, mAmctrinc, Tag YEP, Turbo YEP, Zs Yellow, and PhiYFP; a group of fluorescent proteins having orange emission range (559 - 572 nm) selected from Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato- Tandem, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, and TagRFP-T; and a group of fluorescent proteins having red emission range (574 - 610 nm) selected from REP, mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, eqFP611, ldRFP611, HcRedl, and mRaspberry, and in particular GFP of a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith. Also, the oligonucleotide comprising the nucleic acid sequence encoding the fluorescent protein may have an RNA polymerase II promoter, in particular CsVMV promoter, at its 5* upstream region, and a terminator, in particular Nos terminator, at its 3’ downstream region.

[0076] In another embodiment, provided is an Agrobacterium that the vectors described herein.

[0077] A further embodiment, pertains to a method for transgene-free genome editing in an explant in the first generation (TO) using a co-editing strategy. In a specific example, the method may include:

[0078] (a) infecting an explant with Agrobacterium comprising;

[0079] (i) an oligonucleotide encoding a cytosine base editor (CBE), wherein the cytosine base editor is a fusion protein comprising a cytidine deaminase fused at its either N-terminus or C-terminus to deactivated Cas9 (dCas9) or nickase Cas9 (nCas9),

[0080] (ii) an oligonucleotide encoding a guide RNA comprising tracrRNA for Cas9 and crRNA targeting acetolactate synthase (als) gene to be base-edited,

[0081] (iii) an oligonucleotide encoding a Cas endonuclease selected from Class 2 Cas endonucleases, in particular Cas 12a,

[0082] (iv) an oligonucleotide encoding at least one crRNA of a gene of interest, and

[0083] (v) an oligonucleotide encoding a fluorescence protein as a selection marker, wherein the infection of the explant with Agrobacterium is conducted under conditions that allow for the transgcncs to be introduced into the cxplant,

[0084] (b) co-cultivating the explant with Agrobacterium,

[0085] (c) subculturing the explant in (i) a first regeneration medium comprising at least one anti-Agrobacterium antibiotic selected from ticarcillin / clavulanic acid, kanamycin, carbenicillin, cefotaxime, vancomycin or combination thereof, in particular ticarcillin / clavulanic acid, to remove the Agrobacterium, and then in (ii) a second regeneration medium further comprising a sulfonylurea compound, in particular chlorsulfuron, to select explants expressing base-edited ALS enzyme,

[0086] (d) observing fluorescence emitted by the shoots grown from the explant of (b), and

[0087] (e) selecting the shoots without fluorescence to screen out the explant shoots having transgenes integrated into the plant genome.

[0088] In certain embodiments, the Agrobacterium is Agrobacterium tumefaciens. The explant may be from an annual plant, a biennial plant, or a perennial plant comprising herbaceous, evergreen or woody plants, in particular tomato, tobacco, potato, and citrus. The explant may be cotyledons, epicotyls, leaves, stems, roots, flowers, anthers, and seeds.

[0089] In a specific example, the cxplant is tomato cotyledons. In this example, the regeneration medium for tomato cotyledon explant subculture may include Murashige and Skoog (MS) salts, zeatin riboside and ticarcillin / clavulanic acid.

[0090] In another specific example the explant is tobacco leaf discs. In this example, the regeneration medium for tobacco leaf disc explant subculture may include MS salts, 6- benzylaminopurine, naphthalene acetic acid, and ticarcillin / clavulanic acid.

[0091] In yet another example, the explant is potato leaves. In this example, the regeneration medium for leaf explant subculture may include MS salts, zeatin, gibberellic acid, and ticarcillin / clavulanic acid.

[0092] In certain method embodiments, the oligonucleotide encoding the cytosine base editor pertains to a nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence comprising at least 95% sequence identity therewith. In addition, the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA may include the nucleic acid sequence of SEQ ID NO:3 as the tracrRNA. In further examples, the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA may include a nucleic acid sequence of crRNA targeting acetolactate synthase (als) gene, wherein the sequence of crRNA is one selected from SEQ ID NO:6 for SIALS1, SEQ ID NO: 14 for NtALS, SEQ ID NO: 16 for StALS, SEQ ID NO: 18 for CsALS or SEQ ID NO: 26 for CsALS. In other specific examples, the oligonucleotide encoding a crRNA for a gene of interest includes at least one nucleic acid sequence selected from SEQ ID NO:7 for SIER; SEQ ID NO:8 for SIRBL2; SEQ ID NO:9 for SIRbohD; SEQ ID NO:10; for SIEDS1, SEQ ID NO:11 for SI PAM, SEQ ID NO:12 for SIDMR6, SEQ ID NO: 13 for SIINVINH1; SEQ ID NO: 15 for NtPDS, SEQ ID NO: 17 for StDMR6 or SEQ ID NO: 19 for CsLOBl.

[0093] In other certain examples, the oligonucleotide encoding Cas12a includes a nucleic acid sequence of SEQ ID NO:4 or a nucleic acid sequence comprising at least 95% sequence identity therewith.

[0094] In other method embodiments disclosed herein, the fluorescent protein as a selection marker may be selected from a group comprising fluorescent proteins having blue emission range (424 - 467 nm) selected from Sirius, azurite, BFP, EBFP, EBFP2, and mTagBFP; a group of fluorescent proteins having cyan emission range (474 - 492 nm) selected from CFP, ECFP, cerulean, CyPet, SCFP, TagCFP, AmCyan, Midoriishi Cyan, and mTFPl; a group of fluorescent proteins having green emission range (499 - 519 nm) selected from EGFP, emerald, superfolder avGFP, T-sapphire, Azami Green, m Wasabi, ZsGreen, TagGFP, TagGFP2, TurboGFP, CopGFP, and AceGFP; a group of fluorescent proteins having yellow emission range (524 - 538 nm) selected from YFP, EYFP, topaz, Venus, citrine, YPet, SYFP, mAmetrine, Tag YFP, Turbo YFP, Zs Yellow, and PhiYFP; a group of fluorescent proteins having orange emission range (559 - 572 nm) selected from Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, and TagRFP-T; and a group of fluorescent proteins having red emission range (574 - 610 nm) selected from RFP, mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, eqFP611, tdRFP611, HcRedl, and mRaspberry, in particular GFP of a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith. According to another vector embodiment, disclosed is a vector for transgene-free genome editing using a co-editing strategy in order to generate canker resistant citrus in the first generation (TO). The vector may include:

[0095] (a) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor (PBE) is a fusion protein comprising a cytosine deaminase fused at its either N- terminus or C-terminus to dCas9 or nCas9,

[0096] (b) an oligonucleotide encoding a guide RNA comprising tracrRNA (sgRNA scaffold) for Cas9 and crRNA targeting acetolactate synthase (CsALS) gene to be baseedited,

[0097] (c) an oligonucleotide encoding Cas12a,

[0098] (d) an oligonucleotide encoding a crRNA targeting Effector Binding Element (EBE) region in the promoter of the citrus canker susceptibility gene LOB1,

[0099] (e) an oligonucleotide encoding a green fluorescent protein as a selection marker, and

[0100] (f) an oligonucleotide encoding NPTII.

[0101] The oligonucleotide encoding the cytosine base editor (PBE) may pertain to a nucleic acid sequence of SEQ ID NO:2 or a nucleic acid sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has a strong RNA Pol II promoter, in particular CmYLCV promoter, at its 5* upstream region and a terminator, in particular Nos T terminator, at its 3* downstream region. The oligonucleotide encoding the tracrRNA (sgRNA scaffold) in the Cas9 guide RNA may include a nucleic acid sequence of SEQ ID NO:23. The oligonucleotide encoding the crRNA in the Cas9 guide RNA targeting acetolactate synthase (CsALS) gene may include SEQ ID NO:18 (5’-G-CAGGTCCCGCGGAGGATGAT(target seq.)-CGG (PAM)-3’) and / or SEQ ID NO: 26 CAGGTCCCTCGGAGGATGAT (target seq.)-CGG (PAM), wherein the oligonucleotide has an RNA polymerase HI promoter, in particular Arabidopsis U6 (AtU6-26) promoter, at its 5* upstream region and a terminator, in particular NosT terminator, on its 3’ downstream region. In certain specific examples, the guide RNA may be optionally flanked by tRNA between the promoter and the guide RNA, and between the guide RNA and the terminator. Moreover, the oligonucleotide encoding Cas12a may include a nucleic acid sequence of SEQ ID NO: 4 or a nucleic acid sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has a strong RNA Pol II promoter, in particular CmYLCV promoter, at its 5’ upstream region and a terminator, in particular NosT terminator, at its 3’ downstream region.

[0102] In a specific vector embodiment, the oligonucleotide encoding the crRNA targeting the EBE region in the promoter of the LOB1 gene to be edited by Cas12a includes a nucleic acid sequence of SEQ ID NO: 19 (S’-TTTC (PAM)-TCTATATAAACCCCTTTTGCCTT (target seq.)- 3’), wherein the oligonucleotide has an RNA polymerase III promoter, in particular AtU6-26 promoter, at its 5* upstream region and a terminator, in particular NosT terminator, at its 3* downstream region.

[0103] The crRNA may be inserted into a ribozyme-gRNA-ribozyme (RGR) cassette, in which the crRNA is flanked by hammerhead (HH) ribozyme sequence of SEQ ID NO:21 between the promoter and the crRNA, and by hepatitis delta virus (HDV) ribozyme sequence of SEQ ID NO:20 between the crRNA and the terminator. The oligonucleotide encoding the green fluorescent protein comprises a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has an RNA polymerase II promoter, in particular CsVMV promoter, at its 5* upstream region and a terminator, in particular 35T terminator, at its 3* downstream region. The oligonucleotide encoding NPTH may include a nucleic acid sequence of SEQ ID NO:25, wherein the oligonucleotide has a promoter, in particular NOS promoter, at its 5* upstream region and a terminator, in particular 35T terminator, at its 3* downstream region. In another embodiment, provided is an Agrobacterium that includes the vector described above.

[0104] According to another method embodiment, provided is a method for transgene-free genome editing using a co-editing strategy that generates canker resistant citrus in the first generation (TO) using Agrobacterium of claim 38. According to this method embodiment, the method involves:

[0105] (a) infecting an explant of citrus epicotyl with Agrobacterium,

[0106] (b) co-cultivating the citrus epicotyl with Agrobacterium,

[0107] (c) subculturing the citrus epicotyl segments in kanamycin-containing selection medium such as at (100 mg / L) for 1 week under dark at room temperature or around 30°C, (d) subculturing the citrus epicotyl segments in chlorsulfuron-containing medium (e.g.,150 nM) without kanamycin under light at room temperature,

[0108] (e) transferring the citrus epicotyl segments to new chlorsulfuron-containing medium every, such as for 3 weeks, to select chlorsulfuron-resistant shoots,

[0109] (f) after at least 1-3 rounds of subculture with chlorsulfuron selection, select shoots without green fluorescence emission,

[0110] (g) optionally culturing the plants, such as at room temperature (22 °C - 25 °C) with a 16- hour light / 8-hour dark cycle,

[0111] (h) optionally, after rooting, transfer the plants to a glasshouse.

[0112] (1) CRISPR / Cas-gene editing system

[0113] CRISPR / Cas gene editing system is one of the most powerful biotechnology tools for plant gene modification, and it has been widely applied to various plant species for trait improvement. CRISPR / Cas system uses two pieces of RNAs, CRISPR RNA (crRNA or spacer) and transactivating CRISPR RNA (tracrRNA) as well as a Cas endonuclease. The nucleotide sequence of tracrRNA forms hairpin structures for binding to a Cas endonuclease to form an RNP complex, and the nucleotide sequence of crRNA spacer directs the RNP complex to a matching target DNA sequence to be edited.

[0114] Collectively 93 Cas genes have been reported so far, and they are grouped into 35 families based on sequence similarity of the encoded proteins. (Koonin EV, Makarova KS (2019) Origins and evolution of CRISPR-Cas systems, Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 374 (1772): 20180087) Overall, CRISPR / Cas systems fall into two classes. Class 1 systems use a complex of multiple Cas proteins to degrade target nucleic acids. Class 2 systems use a single large Cas protein for the same purpose. Class 1 is divided into types I, in, and IV; and Class 2 is divided into types n, V, and VI. (Wright AV, Nunez JK, Doudna JA (2016) Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering, Cell. 164 (1-2): 29-44) The 6 system types are further divided into 19 subtypes. (Westra ER, Dowling AJ, Broniewski JM, van Houte S (2016) Evolution and Ecology of CRISPR, Annual Review of Ecology, Evolution, and Systematics 47 (1): 307-331)

[0115] Cas9 is the most well-known Cas DNA endonuclease in Class 2, type II CRISPR / Cas system, which has two active domains, cleaving each of the two DNA strands three nucleotides upstream of the PAM. The five nucleotides upstream of the PAM arc defined as the seed region for target recognition. Like other members of the Class 2 CRISPR / Cas systems, including all subtypes of type II and subtype V-B but not subtype V-A or type VI, Cas9 requires a small RNA molecule, i.e., trans-activating crRNA (tracrRNA). TracrRNA is required for the maturation of the pre-crRNA. The tracrRNA is partially complementary to and base pairs with a pre-crRNA forming an RNA duplex. This is cleaved by RNase in, an RNA-specific ribonuclease, to form a crRNA / tracrRNA hybrid. This hybrid acts as a guide for the Cas9 endonuclease. Once the tracrRNA and crRNA form a complex, they bind to die Cas9 endonuclease and direct it to the target sequence via the crRNA.

[0116] CRISPR / Cas system can be re-engineered into a more manageable two-component system by fusing the crRNA and tracrRNA molecules into a single-guide RNA (sgRNA) or guide RNA (gRNA) that, when combined with a Cas endonuclease, it can find and cut the target DNA specified by the crRNA portion of the guide RNA. Thus, one can change the target gene using the Cas endonuclease by simply changing the sequence of crRNA in the gRNA.

[0117] The endonuclease Cas 12a (formerly known as Cpfl, Class 2, type V) showed several key differences from Cas9, including causing a 'staggered' cut in double stranded DNA as opposed to the *blunt' cut produced by Cas9 (Class 2, type II). The Cas 12a endonuclease recognizes a unique PAM sequence of 5’-TTTV-3’ (where V is A, C, or G), and cuts the strand which contains the PAM at a location 18-19 bases from the 3' end of the PAM, whereas the Cas9’s PAM sequence is 5'- NGG-3' (where “N” can be any nucleotide base), and cuts 3-4 bp upstream of the PAM sequence. The cut by Cas12a on the opposite strand of the DNA is 23 bases from the PAM, resulting in a 5' overhang of 4—5 bases. In addition, unlike type II CRISPR system, in which the maturation of crRNA is done by host housekeeping protein RNase HI together with the tracrRNA, which is partially base paired with the pre-crRNA in presence of Cas9, Cas 12a has been shown that Cas 12a processes its own pre-crRNA into mature crRNAs, without the requirement of a tracrRNA. These differences may give Cas 12a some advantages over Cas9. For example, Cas12a's crRNAs are ideal for multiplexed genome editing, as more of them can be packaged in one vector than Cas9’s gRNAs. Further, Cas 12a cleaves DNA 18-23 base pairs downstream from the PAM site. This means there is no disruption to the recognition sequence after repair, and so Cas 12a enables multiple rounds of DNA cleavage, in contrast to Cas9 that cuts only 3 base pairs upstream of the PAM site and causes the NHEJ pathway resulting in indel mutations that destroy the recognition sequence, thereby preventing further rounds of cutting.

[0118] (2) Agrobacterium mediated plant transformation

[0119] In order to edit or modify a plant gene using CRISPR / Cas system, a Cas endonuclease and guide RNA need to be delivered into a plant cell. To this end, Agrobacterium tumefaciens is currently most widely used for plant cell transformation. In this method, plant samples such as protoplasts, explants or whole plants are incubated with Agrobacterium transformed with plasmids comprising oligonucleotides coding the Cas endonuclease and guide RNA in plant tissue culture.

[0120] Agrobacterium is a genus of Gram-negative bacteria that uses horizontal gene transfer to cause tumors in plants. Agrobacterium tumefaciens is a soil phytopathogen and the most commonly studied species in this genus, which naturally infects plant wound sites and causes crown gall disease via transfer of a portion of the tumor-inducing (Ti) plasmid, the transfer-DNA (T-DNA), from bacterial cells into host plant cells through a bacterial type IV secretion system (T4SS). (Hwang HH, Yu M, Lai EM. Agrobacterium-mediated plant transformation: biology and applications. Arabidopsis Book. 2017 Oct 20;15:e0186).

[0121] Ti plasmid is an extrachromosomal molecule of DNA found commonly in the plant pathogen, including Agrobacterium tumefaciens and other species of Agrobacterium such as A. rubi, A. vitis and A. rhizo genes. In the Ti-plasmid, T-DNA is flanked by two repeated sequences of 25-bp length, each, Left and Right Border repeats. These sequences are recognized and nicked by the endonucleolytic proteins VirDl and VirD2, resulting in a single-stranded form of T-DNA. The VirD2 protein remains covalently linked to the single-stranded T-DNA, and guides it to enter the nucleus. The single-stranded T-DNA is subsequently converted to double-stranded DNA in the nucleus, which may transiently stay in the nucleus to transiently express the genes in the T-DNA or is randomly integrated into the plant genome. (Gelvin SB (2021) Plant DNA Repair and Agrobacterium T-DNA Integration. Int J Mol Sci 22 (16). doi:ARTN 845810.3390 / ijms22168458) Transformed explants or plant cells can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and / or herbicide marker or reporter marker genes (such as GFP or GUS gene) which have been introduced together with the desired nucleotide sequences.

[0122] In this disclosure, for plant gene editing using a CRISPR / Cas system, Agrobacterium is transformed with a Ti-plasmid comprising T-DNA referred to herein as cargo(s), which encodes dCas9 or nCas9 with a guide RNA for Cas9, and Cas12a and crRNA for Cas12a as well as a fluorescent protein as a selection marker. Next, with the Ti-plasmid comprising cargo(s)- transformed Agrobacterium, explants are infected. In this step, most of cargo(s) stays in the nucleus without being integrated into the plant genome, however some of the cargo(s) may be integrated into the plant genome, resulting in a transgenic plant, which may concern the general public and is strictly regulated by different legislation.

[0123] Seed segregation of plant is a method predominantly used for eliminating transgene in seeded annual plant species. The transgene in the host plant genome can be easily removed by screening the progenies segregated from TO transgenic plants. This method is relatively simple and easy with the assistance of PCR detection for transgene presence. To minimize the effort for detecting the transgene-free progenies, screening methods were advanced by simultaneous induction of other phenotypic markers along with the gene-editing cassettes. Although seed segregation has been successfully employed to eliminate the transgene in many seeded annual crops, one or more generations may be required for achieving this goal. More importantly, it is difficult to apply this strategy to clonal / asexually reproducing plants or trees having a long juvenile phase. Therefore, transgene-free genome editing of plants in the TO generation is highly desirable, but it is still challenging, especially in perennials such as citrus and vegetatively propagated plants such as potato. The methods in this disclosure have advantages over the old methods, particularly for non-seeded perennial plants.

[0124] (3) Construction of a plasmid comprising CBE-Cas12a-GFP-S1ALS1 genes

[0125] In this disclosure, it was aimed to generate transgene-free genome-edited plants by employing T-DNA carrying CBE / gRNA-Cas12a / crRNA-GFP cargos to co-edit the acetolactate synthase (ALS) gene that encodes acetolactate synthase, with a gene or genes of interest. Mutation in the ALS genes using cytosine base editor (CBE) / gRNA confers resistance to herbicides such as chlorsulfuron in diverse plant species10, 15, 18-25. Chlorsulfuron is a sulfonylurea compound, and like many other ALS inhibitors such as imidazolinone, sulfonylamino carbonyltriazolinone, and triazolopyrimidine herbicides, inhibits ALS so as to prevent the production of three essential branched-chain amino acids (leucine, isoleucine, and valine) and kill plants, thus providing a useful selection marker. For the same purpose, other herbicides comprising sulfonylurea compounds can be used. The gene(s) of interest is edited by Cas12a / crRNA, whereas GFP enables screening of putative transgene-free (GFP-negative) transformants. In this study, this co-editing strategy was successfully used to efficiently generate transgene-free tomato, tobacco, potato, and citrus in TO generation for various genes. It is anticipated that this strategy will have broad applications in plant genetic improvements.

[0126] In one embodiment, to demonstrate that transgene-free, gene-edited tomato can be obtained in the TO generation, tomato ALS gene, SIALS1 gene (Solyc03g044330), was base-edited without a gene of interest being edited, using CBE-Cas12a-GFP-S1ALS1 construct (Figure la).

[0127] For base editing of ALS, oligonucleotides coding a cytosine base editor (CBE) and a guide RNA were cloned into a plasmid vector to be introduced into Agrobacterium. Usually, CBEs are created by fusing Cas9 nickase (nCas9), which generates single-strand nicks in DNA, or catalytically inactive “dead” Cas9 (dCas9), which binds to its DNA target but does not cleave it, to a cytidine deaminase like APOBEC. The base editor is targeted to a specific locus by gRNA, and it can convert cytidine to uridine within a small editing window near the PAM site. Uridine is subsequently converted to thymidine through base excision repair, creating a C to T change (or a G to A on the opposite strand.). Here, CBE fusion protein comprising nCas9 and cytidine deaminase was expressed along with guide RNA comprising tracrRNA for binding to nCas9 and crRNA for targeting S1SLA1 gene, from the T-DNA comprising CBE-Cas12a-GFP-S1ALS1 transgene construct, and performed cytosine base editing on the proline residue at position 186 (Prol 86) of SIALS 1 gene (Figure la). The targeted nucleotides of SIALS 1 gene by CBE were within the digestion site of the restriction enzyme Styl, which enables identification of edited sequences by digestion.

[0128] Although CBE comprising dCas9 is used here, for the same purpose of base editing, nCas9 or adenine base editor can also be used (ABE), which comprises two TadA, one laboratory-evolved TadA (TadA*) and the other wild type (TadA), along with other “dead” Class 2 type II Cas endonucleases and other guide RNAs comprising proper tracrRNA for the selected Cas endonuclease.

[0129] CBE-Cas12a-GFP-S1ALS1 construct also contains a nucleic acid sequence coding green fluorescence protein (GFP) for the purpose of screening out transgenic cxplants having the cargos integrated into the plant genome among the explants and shoots resistant to chlorsulfuron. For the same purpose, a nucleic acid sequence coding another fluorescence protein can be used. For example, fluorescent proteins can be a fluorescent protein having blue emission range (424 - 467 nm) selected from Sirius, azurite, BFP, EBFP, EBFP2, and mTagBFP; a fluorescent protein having cyan emission range (474 - 492 nm) selected from CFP, ECFP, cerulean, CyPet, SCFP, TagCFP, AmCyan, Midoriishi Cyan, and mTFPl; a fluorescent protein having green emission range (499 - 519 nm) selected from EGFP, emerald, superfolder avGFP, T-sapphire, Azami Green, mWasabi, ZsGreen, TagGFP, TagGFP2, TurboGFP, CopGFP, and AceGFP; a fluorescent protein having yellow emission range (524 - 538 nm) selected from YFP, EYFP, topaz, Venus, citrine, YPet, SYFP, mAmetrine, Tag YFP, Turbo YFP, Zs Yellow, and PhiYFP; a fluorescent protein having orange emission range (559 - 572 nm) selected from Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, and TagRFP-T, and a fluorescent protein having red emission range (574 - 610 nm) selected from RFP, mRuby, inApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, eqFP611, tdRFP611, HcRedl, and mRaspbeny. (Day RN, Davidson MW. The fluorescent protein palette: tools for cellular imaging. Chem Soc Rev. 2009 Oct;38(10):2887-921.)

[0130] CBE-Cas12a-GFP-S1ALS1 construct also contains a nucleic acid sequence coding Cas 12a, for example, the highly efficient, temperature-tolerant ttLbCas 12a29(temperature-tolerant version of Lachnospiraceae bacterium Cas12a) for editing a gene of interest (Figure la; Figure 7). For the same purpose, a nucleic acid sequence coding for another Cas gene recognizing a PAM sequence different from the one recognized by Cas9 can be used.

[0131] Next, with plasmids comprising CBE-Cas12a-GFP-S1ALS1 transgenes, Agrobacterium (Agrobacterium tumefaciens strain AGL1) was transformed. Then, with the transformed Agrobacterium comprising transgenes, cotyledon explants of tomato were infected and cultured under condition described in Sun et al. (2006)64with modifications. Briefly, cotyledons were sectioned into two halves at the mid- vein region. The end of each cotyledon was cut off to allow it to adsorb the bacterial suspension. The explants were dipped in the bacterial suspension for 10 min and blotted dry on a sterilized paper towel. The explants were placed on co-cultivation medium with the abaxial surface of the leaf in contact with the medium. The co-cultivation medium contained Murashige and Skoog (MS) salts, 30 g / L sucrose, 100 uM acetosyringone, 3 g / L Gelrite and 1.5 mg / L zeatin, at pH 5.8. The plate was wrapped with aluminum foil and incubated for 3-4 d at 25°C.

[0132] After co-cultivating the cotyledon explants with Agrobacterium on co-cultivation medium for three days, the explants were subcultured on a MS regeneration medium with zeatin riboside (for promoting growth of lateral buds) and Timentin (ticarcillin disodium and clavulanate potassium, a combination of a penicillin antibiotic and a form of clavulanic acid) for removing Agrobacterium at 30°C for 6 to 10 days. The explants were then subcultured on the same regeneration medium with zeatin riboside, Timentin, and herbicide chlorsulfuron to select chlorsulfuron-resistant calli and shoots. The calli showing green fluorescence were discarded, while the non-fluorescent calli were kept as potential transgene-free, gene-edited transformants for further culture on chlorsulfuron-containing regeneration media.

[0133] Using this method, more than 20 chlorsulfuron-resistant lines without green fluorescence were obtained, suggesting putative transgene-free genome editing. The absence of GFP sequence in the plant genome, which is an indicator of transgene insertion into the plant genome, was confirmed using PCR with the purified genomes from 5 randomly selected GFP-negative lines, (Figure lb).

[0134] Next, the base-editing of ALS gene was confirmed using the restriction enzyme Styl (Figure la). Styl digestion site is within the target nucleotide sequence of the guide RNA for SIALS 1 gene to be base-edited by CBE, and completely or partially abolished by editing the targeted nucleotides (Figure 1c), which was further confirmed by Sanger sequencing. The results showed that the base-editing of Pro 186 was done in either one or two SIALS 1 alleles to enable herbicide resistance.

[0135] The base-editing of ALS Pro 186 residue probably disrupts the recognition and binding of the herbicides without affecting ALS function44, but it did not show any phenotypical changes in tomato (except herbicide resistance) and fitness45-49. Thus, editing of the ALS gene as a selection marker will not negatively affect genetic improvement of crops and their commercialization.

[0136] In addition, the sequence of the CBE-Cas I2a-GFP-S1ALS1 construct was not found in the genome of GFP-negative and chlorsulfuron-resistant tomato plant. Further, 20 potential off-target genes were also analyzed, and none of them were edited, confirming the specificity of the base editing. These results show that transgene-free, gene-edited plants can be obtained in the first generation through base-editing of the ALS gene and selecting for chlorsulfuron-resistant and GFP-negative plants.

[0137] (4) Transgene-free co-editing of a gene of interest in tomato in the TO generation

[0138] In other embodiments, transgene-free co-editing of a gene of interest with ALS base-editing was demonstrated. As a gene of interest, SIER (Solyc08g061560) gene was edited by Cas12a in tomato by inserting a gene coding SIER crRNA between the genes coding GFP-SLALS1 gRNA and CBE-Cas 12a (Figure 2a, Figure 7). The crRNA array is flanked by ribozymes, hammerhead (HH) and hepatitis delta virus (HDV).61Five of 12 GFP-negative and herbicide-resistant plants were edited in SIER gene, with 3 being biallelic mutants and 2 being heterozygous mutants (Figure 2b). The absence of GFP sequence as well as the absence Cas12a sequence was confirmed using PCR with the genomes extracted from the 3 biallelic lines, indicating transgene-free (Figure 2c). The heritability of the mutation in SIER gene was confirmed in the resulting seedlings by genotyping. Additionally, PCR analysis of representative edited lines confirmed that the seedlings did not contain Cas12a or GFP genes (Figure 10 and Figure 11).

[0139] In other embodiments, transgene-free co-editing of other genes of interest, SIRBL2 (Solyc09g010880) and SIRbohD (Solyc03gl 17980) genes, with ALS base-editing was demonstrated. For co-editing of SIRBL2 with SIALS 1, in 5 biallelic / homozygous mutants obtained among 12 genotyped plants, the absence of GFP gene and Cas12a gene was confirmed using PCR (Figure 12), indicating that these 5 lines were transgene-free. For co-editing of SIRbohD with SLALS1, a gene coding crRNA or genes coding two crRNAs was / were inserted into the CBE- Cas 12a-GFP construct (Figures 3a and 3b). As a result, it was shown that two crRNAs were more effective than one. In the edited lines showing herbicide resistance and no green fluorescence, the absence of GFP sequence and Cas12a sequence was confirmed using PCR, and indicated transgene-free (Figure 3e). (5) Transgene-free, co-editing of multiplex gene co-editing in tomato in the TO generation

[0140] In other embodiments, multiplex gene editing was demonstrated by co-editing SIEDS1 (Solyc06g071280) and SIPAD4 (Solyc02g032850) with SIALS1 (Figure 4a, Supplementary Information File 1) and by co-editing SIDMR6 (Solyc03g080190)36and SIINVINH1

[0141] (Solycl2g099200) with SIALS1 (Figure 4c, Supplementary Information File 2). Those chlorsulfuron-resistant lines without green fluorescence were confirmed transgene-free based PCR analysis of the GFP and Cas12a genes (Figures 4b & 4d). Taken together, it was concluded that transgene-free, multiplex gene editing of tomato in the TO generation was achieved efficiently.

[0142] (6) Transgene-free genome editing of tobacco in the TO generation

[0143] In other embodiments, co-editing strategy was applied to generate a transgene-free tobacco (Nicotiana tabacum) by co-editing NtPDS, which was responsible for the albino phenotype, with NtALS (Figure 5a). The final constructs were transformed into the Agrobacterium tumefaciens strain EHA105. A similar protocol described above was used for tobacco transformation, using young sterile tobacco leaf discs as explants, and a regeneration medium containing 6- benzylaminopurine (BAP), naphthalene acetic acid (NAA), Timentin, and herbicide chlorsulfuron.

[0144] Using one crRNA targeting a conserved region of two PDS genes, NtPDS 1 and NtPDS2, 7 albino phenotype lines were obtained among 20 chlorsulfuron-resistant and GFP negative tobacco plants (Figure 5a). The absence of GFP and Cas12a were confirmed in 3 chlorsulfuron-resistant, non-fluorescent, and albino lines by PCR (Figure 5b, Figure 13). Genotyping confirmed NtALS gene base-editing as well as NtPDS gene editing in both NtPDSl and NtPDS2 genes (Figure 5c, Extended Data Figures S12a and b).

[0145] (7) Transgene-free genome editing of potato in the TO generation

[0146] In other embodiments, the feasibility of achieving transgene-free genome editing in potato, a vegetatively propagated crop having a tetrapioid genome was tested, by co-editing StDMR6, a disease susceptibility gene36, 37, together with StALS, with a single crRNA that targets a conserved region in the first exon of four StDMR6 alleles. The final constructs were transformed into the Agrobacterium tumefaciens strain AGL1 potato. For potato transformation, a similar protocol was used as described above. As explants for transformation, potato leaves were used. The regeneration medium for potato transformation contains zeatin, gibberellic acid (GA), Timentin, and herbicide chlorsulfuron.

[0147] Of a total of 15 chlorsulfuron-resistant and GFP-negative shoots, 5 carried StDMR6 heterozygous edits, but no tetra-allelic StDMR6 mutants were observed, even in transgenic lines. The genotyping of a representative edited line revealed that it was transgcnc-frcc with 2 of the 4 StDMR6 alleles edited (Figure 5d, e). These results suggest that this strategy can generate transgene-free, gene-edited potato in the TO generation, but the generation of tetra-allelic mutants needs further optimization.

[0148] (8) Transgene-free genome editing of citrus in the TO generation

[0149] In other embodiments, transgene-free genome editing of citrus was achieved in the TO generation, using GFP-pl380N-ttLbCas12a:LOBPl-PBE:ALS construct. Here, citrus was used as an example for many other tree plants that have a long juvenile period, which makes it challenging to remove foreign DNA fragments when transgenic approaches are used for genome editing.

[0150] Citrus faces many disease challenges, and one of them is citrus canker. Citrus canker is caused by Xanthomonas citri subsp. citri (Xcc), a Gram negative bacterium. Most commercial citrus varieties, including grapefruit and sweet orange varieties, are susceptible to canker disease. Xcc causes the characteristic hypertrophy and hyperplasia symptoms on citrus tissues via secretion of PthA4, a transcriptional activator-like (TAL) effector, through the type in secretion system (Swarup, S., Yang, Y. N., Kingsley, M. T., and Gabriel, D. W. (1992). An Xanthomonas citri Pathogenicity Gene, pthA, Pleiotropically Encodes Gratuitous Avirulence on Nonhosts. Mpmi 5, 204—213). PthA4 enters the nucleus and activates the expression of the canker susceptibility (S) gene Lateral Organ Boundaries 1 (LOB1) via binding to the effector binding elements (EBE) in the promoter region.38

[0151] Here, the TAL Effector Binding Element (EBE) region in the promoter of the citrus canker susceptibility gene LOB I38-41was edited with crRNA having a sequence of S’-TTTC (PAM)- TCTATATAAACCCCT T T T GCCTT (target seq.)-3’, along with citrus ALS (CsALS) gene using PBE-Cas12a-GFP-LOBP construct (Figure 14). PBE is a variant of CBE comprising Cas9 nickase (nCas9), which has a unique 5 nucleotide editing window. PBE base-edited the proline residue at position 188 (Pro 188) of CsALS, which is equivalent to the proline residue at position 186 (Pro 186) of SIALSl42with crRNA having a sequence of SEQ ID NO: 18 5’-G- CAGGTCCCGCGGAGGATGAT (target scq.)-CGG (PAM)-3’ and / or SEQ ID NO: 26 CAGGTCCCTCGGAGGATGAT CGG (PAM), in the guide RNA for CsALS base-editing.

[0152] Agrobacterium tumefaciens strain EHA 105 was transformed with the construct, and then Agrobacterium-mcdiatcd transformation of citrus epicotyl was performed as described previously3841. For the selection of herbicide chlorsulfuron resistant citrus, citrus epicotyl segments were cultured on kanamycin-containing selection media (100 mg / L) for 1 week under dark at room temperature or around 30°C. After 1 week, the citrus epicotyl segments were transferred to chlorsulfuron (Fisher Scientific, Catalog No.50-255-082) containing media (150 nM) without kanamycin under light at room temperature. Every 3 weeks, the citrus epicotyl segments were transferred to new chlorsulfuron-containing media to select chlorsulfuron-resistant shoots. After three rounds of subculture with chlorsulfuron selection, chlorsulfuron-resistant shoots were visible on the media.

[0153] Plants were grown at room temperature (22 °C - 25 °C) with a 16-hour light / 8-hour dark cycle. After rooting, the plants were transferred to a glasshouse.

[0154] As a result, among 103 chlorsulfuron resistant and GFP negative pummelo (Citrus maxima) shoots (Figure 6a), based on genotyping of the CsALS and EBEpthA4-LOBP, and PCR analysis of the nptll gene (Figure 6b) that codes a type of aminoglycoside phosphotransferase that inactivates aminoglycoside antibiotics, including kanamycin and neomycin, 4 transgene-free, EBEpthA4- LOBP-edited citrus lines were generated. As expected, 1 biallelic- and 1 homozygous mutants in the EBEpihA4-LOBP site demonstrated canker resistance and did not show any canker symptoms after inoculation with Xcc (Figure 6d).

[0155] (9) Transgene-free genome editing without off-target mutations confirmed by whole genome sequencing analysis of the edited lines

[0156] Potential off-target sites of the crRNA targeting SIRbohD, SIER, SIEDS1, SIPAD4, SUNVINH1, and SIRBL2 genes were searched for, using the CRISPR P v2.0 program and Cas- OFFinder program. Whole genome sequencing analyses or Sanger sequencing of PCR amplicons of the homologous sites showed no off-target mutations. Similarly, whole genome sequencing analysis of the GFP-negative, LOB 1 -edited citrus line PUHINOGFP3 found no construct DNA in its genome. In addition, off-taigets were analyzed in PumNoGFp3 based on whole genome sequencing data. In the case of mismatch numbcr<=5 for crRNA, there were eight potential off-targets and no off-taiget mutations were identified.

[0157] Based on the results described above, disclosed are plasmid vectors comprising cargos for transgene-free genome editing in plants using a co-editing strategy, and methods of use thereof.

[0158] The vector comprises;

[0159] (f) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor is a fusion protein comprising a cytosine deaminase fused at its either N-terminus or C-terminus to dCas9 or nCas9,

[0160] (g) an oligonucleotide encoding a guide RNA comprising tracrRNA for Cas9 and crRNA targeting acetolactate synthase (ALS) gene to be base-edited,

[0161] (h) an oligonucleotide encoding a Cas endonuclease other than Cas9, in particular Cas12a,

[0162] (i) an oligonucleotide encoding at least one crRNA of gene of interest to be edited, and

[0163] (j) an oligonucleotide encoding a fluorescent protein as a selection marker.

[0164] Further, agrobacterium, in particular Agrobacterium tumefaciens transformed with the vector described above is also provided.

[0165] In addition, a method of use of the co-editing strategy comprises steps of;

[0166] (f) infecting an explant with Agrobacterium described above, wherein the infection of the explant with Agrobacterium is conducted under conditions that allow for the cargos to be introduced into the explant,

[0167] (g) co-cultivating the cxplant with Agrobacterium,

[0168] (h) subculturing the explant in (i) a first regeneration medium comprising at least one anti-Agrobacterium antibiotic selected from ticarcillin / clavulanic acid, kanamycin, carbenicillin, cefotaxime, vancomycin or combination thereof, in particular ticarcillin / clavulanic acid, to remove the Agrobacterium, and then in (ii) a second regeneration medium further comprising a sulfonylurea compound, in particular chlorsulfuron, to select explants expressing base-edited ALS enzyme,

[0169] (i) observing fluorescence emitted by the shoots grown from the explant of (b), and (j) selecting the shoots without fluorescence to screen out the explant shoots having transgcncs integrated into the plant genome, wherein the Agrobacterium is Agrobacterium tumefaciens.

[0170] Here, the explant is from an annual plant, a biennial plant or a perennial plant comprising herbaceous, evergreen or woody plants, optionally tomato, tobacco, potato, and citrus, and the explant can be a cotyledons, epicotyls, leaves, stems, roots, flowers, anthers, and seeds, optionally tomato cotyledons, tobacco leaf discs or potato leaves.

[0171] Further, in some embodiments, a vector for transgene-free genome editing using a co-editing strategy in order to generate canker resistant citrus in the first generation (TO), and a use method thereof are provided, and the vector comprises;

[0172] (a) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor (PBE) is a fusion protein comprising a cytosine deaminase fused at its either N- terminus or C-terminus to dCas9 or nCas9,

[0173] (b) an oligonucleotide encoding a guide RNA comprising tracrRNA (sgRNA scaffold) for Cas9 and crRNA targeting acetolactate synthase (CsALST) gene to be base-edited,

[0174] (c) an oligonucleotide encoding Cas12a,

[0175] (d) an oligonucleotide encoding a crRNA targeting Effector Binding Element (EBE) region in the promoter of the citrus canker susceptibility gene LOB1,

[0176] (e) an oligonucleotide encoding a green fluorescent protein as a selection marker; and

[0177] (f) an oligonucleotide encoding NPTIL

[0178] In a specific embodiment, the method for transgene-free genome editing using a co-editing strategy in order to generate canker resistant citrus in the first generation (TO) using Agrobacterium comprising the vector described above comprises steps of;

[0179] (a) infecting citrus epicotyl explants with recombinant Agrobacterium cells carrying binary vector containing gene-edting components.

[0180] (b) co-cultivating the citrus epicotyl with the Agrobacterium cells

[0181] (c)

[0182] (d) subculturing the citrus epicotyl segments in kanamycin-containing selection medium (optionally at 100 mg / L) for optionally 1 week under dark at 30°C, (e) subculturing the citrus epicotyl segments in chlorsulfuron-containing medium (optionally at 150 nM) without kanamycin under light at room temperature,

[0183] (f) transferring the citrus epicotyl segments to new chlorsulfuron-containing medium (e.g. every 3 weeks) to select chlorsulfuron-resistant shoots,

[0184] (g) after three rounds of subculture with chlorsulfuron selection, select shoots without green fluorescence emission,

[0185] (h) culturing the plants at room temperature (e.g. 22 °C - 25 °C) with a 16-hour light / 8- hour dark cycle,

[0186] (i) after rooting, transfer the plants to a glasshouse.

[0187] EXAMPLES

[0188] Example 1, Methods

[0189] (1) Making the CBE-Cas12a-GFP construct

[0190] The CBE plasmid with GFP10was digested with PmeURsrH., and the vector backbone was retained. The Cas12a-D156RMfragment was recovered by digesting Hybrid-D156R-PDS-LOB1- A containing ttLbCas^a29with Pmel / RsrlL These two fragments were then ligated to form CBE- Cas12a-partial. CBE-Cas12a-partial was then digested with BsrIL The other half of Cas12a was PCR-amplified using primers Casl2half-Fl / Casl2half-Rl (Table 1) with ttLbCas^a29as the template. The amplicon was then In-fusion cloned with the Bsrll-digested CBE-Cas12a-partial to create CBE-Cas12a-GFP. The final construct was confirmed through Sanger sequencing.

[0191] (2) Making CBE-gRNA-Cas 12a-crRNA-GFP constructs

[0192] CBE-Cas12a-GFP was digested with Aarl and ligated with annealed primers for NtALS or CsNLS or SIALS1 or StALS (Table 1) with compatible ends. A construct named PUC57-mini- crRNA was synthesized to drive crRNA expression (Figure 15). The crRNA array is flanked by ribozymes, Hammerhead (HH) and hepatitis delta virus (HDV), for precise processing61. Primers for single crRNA were annealed and ligated to BsmBI-digested PUC57-mini-crRNA. For multiplexing, multiple HH-DR-HDV units were PCR amplified from the synthesized plasmid PUC57-HDV-HH-DR (Figure 15). The PCR products were ligated and cloned into BsmBI- digested PUC57-mini-crRNA through GoldenGate cloning. The whole crRNA cassette, including the promoter and terminator, was PCR amplified using primers Mini-Fl / Mini-Rl and cloned into the Sb / I-digcstcd CBE-Cas12a-GFP-ALS constructs using In-Fusion cloning (Takara Bio). All constructs were confirmed by sequencing.

[0193] (3) Making the GFP-pl380N-ttLbCas12a:LOBPl-PBE:ALS construct

[0194] Using pUC-NosT-crRNA:LOBP as template43, the fragment containing AtU6-26 promoter, the coding sequence of hammerhead ribozyme (HH) and crRNA-LOBPl was PCR-amplified using primers AtU6-5-X / wI (5 - AGGTCTCGAGTCGTTGAACA ACGGAAACTCGA CTTGCC-39 and CrRNA-LBDPl-phos (5 '-phosphorylated- AAGGCAAAAGGGGTTTATAT AGAATCTACACTTAGTAGAAATTAga -3'), and the fragment containing the coding sequence of hepatitis delta virus ribozyme (HDV) and NosT was PCR-amplified using primers HDV-5-Phos (5 '-phosphorylated- GGCCGGCATGGTCCCAGCCTCCTCGCT - 39 and NosT-3-AscI (5'- ACCTGGGCCCGGCGCGCCGATCTAGTAACATAGATGA-3'Y XAoI-cut AtU6-26-HH- crRNA-LOBPl and Ascl-cut HDV-NosT were inserted into XAoI-AscI-cut pUC-NosT-MCS to build pUC-NosT-crRNA:LOBPl through three-way ligation, in which the vector and two DNA fragments were ligated together in one step. pUC-NosT-MCS contained EcoRI-NosT-XAoI-AscI- Xbal-Pmel for cloning, as described before62. Subsequently, the EcoRI-NosT-crRNA:LOBPl- NosTAscI-Xbal-Pmel fragment was cloned into EcoRI-Pmel-cut GFP-pl380N-ttLbCas12a to generate GFP-pl380N- ttLbCas12a:LOBPl-A5cI-XbaI-PmeI (Figure 14). GFP-pl380N- ttLbCas12a was constructed previously63.

[0195] From vector CmYLCV- A3A-RAD51-nCas910, the CmYLCV promoter was amplified using primer CmYLCV-5-HindIH-Sb^-AscI (5 -AGGTAAGCTTCCTGCAGGCGCG CCAGATTTGCCTTTTCAATTTCAGAAAGA-3') and CmYLCV-3-BamHI (5'-AGGTGGAT CCAGCTTAGCTCTTACCTGTTTTCGTCGT-3'). Hzndni-BamHI-cut CmYLCV was cloned into Z / nzdlll-fianzHI-cut pnCas9-PBE vector from Addgene (Addgene plasmid #98164) to build pCmYLCV-nCas9-PBE. To produce GFP-pl380N-CmYLCV-nCas9-PBE, the SbjI-EcdRI-cut CmYLCV-nCas9-PBE fragment was ligated with the SbjI-EcdRI-cut GFP-pl380N-Cas9 construct40.

[0196] From 35S-SpCas9p:DunLOBP43, the AtU6-26 promoter was amplified again using AtU6- 26-5-Xhol and AtU6-26-3-phos (5 '-phosphorylated- A ATCACTACTTCGACTCTAGCTGT- 3'), and the sgRNA-ALSBE-NosT was PCR-amplified using sgRNA-ALSBE-P (5'-phosphorylated- GcaggtcccgcggaggatgatGTTTTAGAGCTAGAAATAGCAAGT-3') and NosT-3-SpeI. Through three-way ligation, XAoI-cut AtU6-26 and Spel-digcstcd sgRNA-ALSBE-NosT were inserted into XhoI-Xbal-treated pUC-NosT-MCS to construct pUC-NosT-AtU6-26-sgRNA-ALSBE. Finally, the EcoRI-NosT-AtU6-26-sgRNA-ALSBE-NosT-PmeI fragment from pUC-NosT-AtU6-26- sgRNA-ALSBE were cloned into EcoRI-Pmel-cut GFP-pl380N-CmYLCV-nCas9-PBE to build GFP-pl380N-PBE:ALS (Figure 14). The Ascl-Pmel-cut CmYLCV-nCas9-PBE:ALS fragment from GFP-pl380N-PBE:ALS wwaass cloned into AscI-Pmel-cut vector GFP-pl38ON- ttLbCas12a:LOBPl-Ai’cI-XhaI-P>neI to form GFP-pl380N-ttLbCas12a:LOBPl-PBE:ALS (Figure 14). All constructs were confirmed by sequencing.

[0197] (4) Plant transformation

[0198] The final constructs were transformed into either the Agrobacterium strain AGL1 (for tomato and potato) or EHA105 (for tobacco and citrus).

[0199] For tomato transformation (cultivar Moneymaker), the described protocol64was followed with modifications. After co-cultivating the cotyledon explants on co-cultivation medium for three days, the explants were subcultured on a Murashige and Skoog (MS) regeneration medium with 2 mg / L zeatin riboside and 350 mg / L Timentin (for Agrobacterium elimination) at 30°C for 6 to 10 days. The explants were then subcultured on the same regeneration medium with 2 mg / L zeatin riboside, 350 mg / L Timentin, and 110 nM herbicide chlorsulfuron to select chlorsulfuron-resistant calli and shoots. The calli showing green fluorescence were discarded, while the non-fluorescent calli were kept as potential transgene-free, gene-edited transformants for further culture on chlorsulfuron-containing regeneration media.

[0200] A similar protocol was used for tobacco transformation, using young sterile tobacco leaf discs as explants, and a regeneration medium containing 1 mg / L 6-benzylaminopurine (BAP), 0.1 mg / L naphthalene acetic acid (NAA), 350 mg / L Timentin, and 250 nM herbicide chlorsulfuron.

[0201] For potato transformation, the tetrapioid cultivar Atlanta plandets were purchased from the University of Wisconsin and the University of Idaho. A similar protocol was used for potato transformation. Potato leaves were used as explants for transformation. The regeneration medium for potato transformation contains 1 mg / L zeatin, 2 mg / L gibberellic acid (GA), 350 mg / L Timentin, 100 nM herbicide chlorsulfuron. For citrus transformation, we followed the protocol we developed previously10. Plants were grown at room temperature (22 °C - 25 °C) with a 16-hour light / 8-hour dark cycle. After rooting, the plants were transferred to a glasshouse.

[0202] (5) Canker symptom assay in citrus

[0203] Wild type, transgenic and transgene-free Pummelo plants were grown in a greenhouse at the Citrus Research and Education Center, University of Florida. Prior to Xcc treatment, all plants were trimmed to generate new shoots. Leaves of similar age were infiltrated with either Xcc or XccΔpthA4:dLOB1.5 (5 x 108CFU / mL) using needleless syringes. At five days post inoculation (DPI), canker symptoms were observed and photographed.

[0204] (6) Microscopy analysis

[0205] An Omax camera was installed to a Zeiss Stemi SV 11 dissecting microscope for photographing GFP fluorescence. Under illumination of the Stereo Microscope Fluorescence Adapter (NIGHTSEA), GFP fluorescence was visualized. Subsequently, the samples were photographed with the Omax Toupview software connected to the Omax camera.

[0206] (7) Genomic DNA extraction and genotyping

[0207] Genomic DNA was extracted from plant leaves with a cetyltrimethylammonium bromide (CTAB)-based genomic DNA extraction protocol we described previously39, 65. Detection of edits in the target genes was performed via PCR amplification of fragments spanning gRNAs or crRNAs, followed by cloning of PCR products into a cloning vector (Zero Blunt™ TOPO™ PCR Cloning Kit, Invitrogen) and Sanger sequencing. At least 10 clones for each gene from each plant were subjected to Sanger sequencing. Primers were designed for the detection of GFP fragment near the T-DNA right border, and Cas12a fragment near the T-DNA left border in the edited plant lines.

[0208] (8) Whole genome sequencing and data analysis

[0209] The 150-bp paired-end reads whole genome sequencing data were generated using the Illumina NovaSeq 6000 platform by Novogene. The raw reads were filtered using Fastp version 0.22.0 to remove low-quality reads. On average, more than 20.6 and 48.4Gb of high-quality data were generated for each citrus Pummelo and tomato plant sample, respectively. The high-quality paired-end short genomic reads were mapped to the reference genomes of citrus Pummelo (C. maxima) or tomato using Bowtic2 software version 2.2.666. The mutations (single nucleotide polymorphisms, deletions, and insertions) in the gene-edited plant genomes were generated using the SAMtools package version 1.267and Deepvariant program version 1.4.068. The mutations were filtered based on quality and sequence depth, and the target site mutations were visualized using IGV software version 2.15.4to. The off-target sites were predicted using CRISPR-P 2.070and the Cas-OFFinder program71and aligning target sequence with whole genome using blast program. Based on the mapping results, mutations of off-target sites were detected using the SAMtools package version 1.2 and deepvariant program version 1.4.0.

[0210] Example 2. Transgene-free genome editing of tomato in the first generation (TO) by coediting of the ALS gene and gene of interest

[0211] To test whether we can achieve transgene-free genome editing in the TO generation by coediting of the ALS gene and gene of interest, the model plant tomato (Solatium lycopersicum) was employed owing to its high efficacy in plant transformation and genome editing26, availability of high-quality genome sequences27. It was first investigated if transgene-free, gene-edited tomato could be obtained in the TO generation by base-editing SIALS1 (Solyc03g044330) alone. Previous studies suggested such a possibility, but the putative transgene-free plants were not confirmed by whole genome sequencing10, 15128. Here, the CBE-Cas12a-GFP-S1ALS1 construct was constructed to edit the SIALS 1 gene using CBE to target the proline residue at position 186 (Pro 186) (Figure la). The CBE-Cas12a-GFP construct also contains a GFP expression cassette for screening putative transgene-free regenerants, and the highly efficient, temperature-tolerant ttLbCaslla8for editing gene of interest in downstream studies (Figure la; Figure 7). In accordance with the results reported by Veillet et al.15, base editing of SIALS1 enabled the generation of herbicide-resistant tomato transformants (Figure 8). More than 20 chlorsulfuron-resistant lines without green fluorescence were obtained, suggesting putative transgene-free genome editing. Consistently, the GFP gene was not detected in 5 randomly selected GFP-negative lines with PCR (Figure lb). The targeted nucleotides of SIALS1 gene by CBE were within the digestion site of the restriction enzyme Styl (Figure la), which enables identification of edited sequences by digestion. Editing of the targeted nucleotides completely abolished digestion by Styl in one line, but partially abolished the digestion in four of the five tested lines (Figure 1c), indicating homozygous / biallelic mutations in both alleles of SIALS 1 in line L2 and mutations in one allele only in the other four lines (LI , L3, L4, and L5). The mutations were confirmed by Sanger sequencing. These results showed that editing Pro 186 in either one or two SIALS 1 alleles enables herbicide resistance. To further confirm if the SIALS1 -edited GFP-negative plants were indeed transgene-free, whole genome sequencing of the edited line 2 was conducted and the homozygous mutation of the SIALS 1 gene was confirmed. The sequence of the CBE-Cas12a-GFP-S1ALS1 construct was not found in the genome of the SIALS1 -edited, GFP-negative tomato plant.

[0212] Potential off-target genes were also analyzed. A total of 20 potential off-target sites with up to 4 mismatches to the target site were identified and none of them were edited, confirming the specificity of the base editing. These results show that transgene-free, gene-edited plants can be obtained in the first generation through base-editing of the ALS gene and selecting for chlorsulfiiron-resistant and GFP-negative plants. This prompted us to further explore herbicide- assisted transgene-free genome editing in the TO generation for gene(s) of interest.

[0213] Co-editing of the ALS gene and gene(s) of interest has been suggested as a feasible approach to generate transgene-free plants10, 1S. Next, this hypothesis was tested by co-editing SIALS1 by CBE and SIER (Solyc08g061560)30by Cas12a in tomato using our CBE-Cas12a-GFP construct (Figure 2a, Figure 7). A total of 12 herbicide-resistant transformants without green fluorescence were selected for genotyping. Of the 12 herbicide-resistant transformants, the SIALS1 gene was edited in all lines (Figure 9). Five of these 12 herbicide-resistant plants were edited in SIER, with 3 being biallelic mutants and 2 being heterozygous mutants (Figure 2b). Consistent with the absence of green fluorescence, the 3 biallelic lines did not contain the GFP gene, as indicated by PCR, suggesting transgene-free (Fib. 2c). The 3 biallelic lines were further confirmed to be transgene-free by the absence of the ttLbCas12a sequence (Figure 2c). The phenotypes of the SIER biallelic mutants included compact architecture, short petiole, densely clustered inflorescence, and enlarged SAM (Figure 2d, e), in agreement with a previous report30. To test the heritability of the mutation, seeds of the sler-4 TO plant were germinated, and the resulting seedlings were genotyped. The genotyping analysis found that mutation in the SIER gene was indeed heritable, with the progeny being either homozygous (inheriting one of two edited alleles) or biallelic (the same as their parent). Additionally, PCR analysis confirmed that the seedlings did not contain ttlbCas12a or GFP (Figure 10), which was consistent with the absence of green fluorescence in the sler-4 seeds (Figure 11).

[0214] The co-editing strategy was also successful in generating transgene-free mutant lines for SIRBL2 (Solyc09g010880) and SIRbohD (Solyc03gll7980). Five biallelic / homozygous mutants were obtained among 12 genotyped plants for SIRBL2. GFP observation and PCR analysis of the GFP gene and Cas12a gene (Figure 12) demonstrated that these 5 lines were transgene-free. For co-editing of SIRbohD with SIALS 7, one or two crRNAs (Figure 3a, b) were tested. When one crRNA was used to target SIRbohD, only 1 biallelic mutant was generated (line 1) (Figure 3c) among 12 non-GFP transformants. When two crRNAs targeting two different sites of SIRbohD were used (1 of these 2 crRNAs was the same as aforementioned), 25% biallelic / homozygous mutations were achieved (Figure 3c, d,), suggesting that two crRNAs are more effective than one as reported previously31, 32. GFP observation and PCR analysis of the GFP or Cas12a gene revealed that 3 lines, generated using either one or two crRNAs, were transgene-free (Figure 3e).

[0215] Example 3. Transgene-free, multiplex genome editing of tomato in the TO generation

[0216] Next, it was investigated whether transgene-free, multiplex genome editing of tomato could be achieved in the first generation. Co-editing of SIEDS1 (Solyc06g071280) and SIPAD4 (Solyc02g032850), with SIALS1 was performed. EDS1 and PAD4 are required for plant immunity33"35. Among 18 non-GFP regenerants, 6 lines contained biallelic / homozygous edits for both SIEDS1 and SIPAD4, and 2 lines were biallelically edited in only SIEDS1 but not SIPAD4 (Figure 4a, Supplementary Information File 1). The edited lines were transgene-free based on GFP observation and PCR analysis of the GFP and Cas12a genes (Figure 4b). Similarly, multiplex gene editing of SIDMR6 (Solyc03g080190)36and SIINVINH1 (Solycl2g099200) with SIALS 1 was conducted. Three biallelic / homozygous S1DMR6 / SIINVINH1 double mutants were obtained from 17 non-GFP transformants (Figure 4c, Supplementary Information File 2). Four homozygous / biallelic slinvinhl single mutants were also obtained (Supplementary Information File 2). These edited lines were transgene-free based on GFP observation and PCR analysis of the GFP and Cas12a genes (Figure 4d). Taken together, we can achieve transgene-free, multiplex gene editing of tomato in the TO generation efficiently.

[0217] Example 4. Transgene-free genome editing of tobacco in the TO generation Next, it was tested whether the co-editing strategy could be used to generate transgene-free plants in other plant species. The model plant tobacco (Nicotiana tabacum) was first investigated by co-editing NtPDS with NtALS (Figure 5a). It is noteworthy that N. tabacum contains two PDS genes, NtPDS 1 and NtPDS2. Thus, one crRNA targeting a conserved region of both genes was designed. Over 20 chlorsulfuron-resistant tobacco plants showing albino phenotype were obtained (Figure 5a). Among them, 7 albino plants did not display obvious green fluorescence (Figure 5a). The absence of GFP and Cas12a was further confirmed in three albino, non-fluorescent lines by PCR (Figure 5b, Figure 13). As expected, the chlorsulfuron-resistant tobacco plant contained mutation in the NtALS gene, while the wild type N. tabacum did not contain the mutation in the NtALS gene (Figure 5c). Genotyping of NtPDS in this line confirmed editing of both NtPDS 1 and NtPDS2 genes, which was responsible for the albino phenotype (Figure 5c).

[0218] Example 5. Transgene-free genome editing of potato in the TO generation

[0219] Furthermore, we investigated the feasibility of achieving transgene-free genome editing in potato, a vegetatively propagated crop with a tetrapioid genome, using the co-editing strategy. It was aimed to co-edit StDMR6, a disease susceptibility gene36137, together with StALS, with a single crRNA that targets a conserved region in the first exon of four StDMR6 alleles. A total of 15 GFP- negative shoots regenerated from chlorsulfuron-containing media were genotyped, and 10 were found to be wild-type (WT) at StDMR6, while 5 carried heterozygous edits. However, no tetra- allelic StDMR6 mutants were observed, even in transgenic lines. The genotyping of a representative edited line revealed that it was transgene-free with 2 of the 4 StDMR6 alleles edited (Figure 5d, e). These results suggest that this strategy can generate transgene-free, gene-edited potato in the TO generation, but the generation of tetra-allelic mutants needs further optimization.

[0220] Example 6. Transgene-free genome editing of citrus in the TO generation

[0221] Lastly, it was aimed to achieve transgene-free genome editing of citrus in the TO generation. Many tree plants, like citrus, have a long juvenile period, which makes it challenging to remove foreign DNA fragments when transgenic approaches are used for genome editing. Previously transgene-free ALS-edited citrus was successfully obtained through transient expression of CBE10. Here, the TAL Effector Binding Element (EBE) region in the promoter of the citrus canker susceptibility gene LOB I38"41was co-edited with citrus ALS using our PBE-Cas12a-GFP-LOBP construct (Figure 14). nCas9-PBE, a variant of CBE that has a unique 5 nucleotide editing window, was utilized, resulting in targeting the proline residue at position 188 (Pro 188) of CsALS only, which is equivalent to the proline residue at position 186 (Pro 186) of SIALS*2. In the presence of chlorsulfuron, 107 pummelo (Citrus maxima) shoots were generated. Among them, 4 shoots were GFP-positive (Figure 6a), and 103 shoots were GFP-negative (Figure 6a). Based on genotyping of the CsALS and EBEpthA4-LOBP, and PCR analysis of the nptll gene (Figure 6b), four transgene- free, EBEpthA4-LOBP-edited citrus lines were generated and subjected to downstream analyses. For the CsALS site, the four transgenic genome-edited and four transgene-free genome-edited lines contained homozygous / biallelic mutations (Extended Data Figures. S15 and S16). Intriguingly, among the four transgenic citrus genome-edited lines, for the EBEp*A4-LOBP site, Pumoppl, PUHIGFP2 and PumoFp4 were chimeric, but without wild type sequences, and PUITIGFP3 was wild type. Among the four transgene-free genome-edited lines, for the EBEpthA4-LOBP site, PumNoCFpl, PumNoGFp2, PumNoGFp3 and Pum.NoGFp4 contained biallelic, heterozygous, homozygous, and heterozygous mutations, respectively (Figure 6c). As expected, biallelic / homozygous mutants and chimeric mutants without wild type sequence in the EBEpthA4-LOBP site demonstrated canker resistance and did not show any canker symptoms after inoculation with Xcc, regardless of being transgenic or transgene-free (Figure 6d). Wild type pummelo showed typical canker symptoms, such as hyperplasia and hypertrophy (Figure 6d). As a positive control, wild type and genome- edited lines were inoculated with XccApthA4:dLOB 1.5. dLOB 1.5 is a designed TALE, which binds to a different region from the target EBEpthA4-LOBP site in the promoter region of CsLOBl, thus activating LOB1 expression to cause canker symptoms41. Sanger sequencing results indicated that the dLOB 1.5 binding sites were intact among the tested Pummelo plants. Consequently, XccApthA4:dLOB1.5 caused typical canker symptoms in wild type and all EBEPthA4-LOBP- edited lines (Figure 6d). Taken together, the mutation of EBEpthA4-LOBP conferred Pummelo canker resistance, consistent with previous studies39, 41, 43. Importantly, two transgene-free plants, PumNoGFPl and PumNoGFP3, were resistant to Xcc infection (Figure 6).

[0222] Example 7. Whole genome sequencing analysis of edited lines confirms transgene-free genome editing without off-target mutations

[0223] To further confirm whether the putative transgene-free genome-edited lines were indeed transgene-free, we conducted whole genome sequencing. For tomato, we sequenced six transgene- free lines that were edited for SIRbohD (#1, #2, #8), SIER (#4), SIEDS1 / SIPAD4 (#8, #18), as well as two transgenic control lines, EPGFP and SIRbohD (#6). The sequencing coverage ranged from 28 x to 59 x. Genomic analysis confirmed that the construct DNA was integrated into the genome of the transgenic control lines EPGFP and SIRbohD (#6), as evidenced by the presence of construct reads. In contrast, genomic analysis of the SIRbohD (#1, #2, #8), SIER (#4), SIEDS1 / SIPAD4 (#18) lines found no construct DNA. Intriguingly, SIEDS1 / SIPAD4 line 8 contained 281 reads matching construct sequences despite being GFP-negative and PCR-negative for GFP and Cas12a (Figure 4b). Genomic analysis of the edited lines confirmed genome editing, as demonstrated by Sanger sequencing results. For instance, SIRbohD edited line #1 contained biallelic mutations of -4 / -8, whereas #8 contained homozygous mutations of 7 bp deletion at SIRbohD, consistent with previous Sanger sequencing results (Figure 3c). We searched for potential off-target sites of the crRNA targeting SIRbohD, SIER, SIEDS1, SIPAD4, SIINVINH1, and SIRBL2 genes using the CRISPR P v2.0 program and Cas-OFFinder program. Whole genome sequencing analyses or Sanger sequencing of PCR amplicons of the homologous sites showed no off-target mutations. Similarly, whole genome sequencing analysis of the GFP-negative, LOS7-edited citrus line PumNoGFp3 found no construct DNA in its genome. Furthermore, whole genome sequencing analysis indicated that PUHINOGFP3 harbored heterozygous CsALS and homozygous mutant EBEpthA4-LOBP, which was consistent with Sanger sequencing results (Figure 6c). In addition, off-targets were analyzed in PUITINOGFPS based on whole genome sequencing data. In the case of mismatch number<=5 for crRNA, there were eight potential off-targets. The off-target sites were visualized using IGV software version 2.15.4 (Robinson et al., 2011), and no off-target mutations were identified.

[0224] Table 1. Primers Table 5. List of transgenes. REFERENCES

[0225] 1. Zhang, Y. et al. Efficient and transgene-free genome editing in wheat through transient expression of CR1SPR / Cas9 DNA or RNA. Nat Common 7, 12617 (2016).

[0226] 2. Woo, J.W. et al. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33, 1162-1164 (2015).

[0227] 3. Svitashev, S., Schwartz, C., Lenderts, B., Young, J.K. & Cigan, A.M. Genome editing in maize directed by CRISPR-Cas9 ribonucleoprotein complexes. Nature Communications 1 (2016).

[0228] 4. Turnbull, C., Lillemo, M. & Hvoslef-Eide, T.A.K. Global Regulation of Genetically Modified Crops Amid the Gene Edited Crop Boom - A Review. Frontiers in Plant Science 12 (2021).

[0229] Zhang, H. et al. The CRISPR / Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnology Journal 12, 797-807 (2014).

[0230] 6. Zhang, Q. et al. Potential high-frequency off-target mutagenesis induced by CRISPR / Cas9 in Arabidopsis and its prevention. Plant Molecular Biology 96, 445-456 (2018).

[0231] 7. Qin, R.Y. et al. SpCas9-NG self-targets the sgRNA sequence in plant genome editing. Nature Plants 6, 197-+ (2020).

[0232] 8. He, Y.B. & Zhao, Y.D. Technological breakthroughs in generating transgene-free and genetically stable CRISPR-edited plants. Abiotech 1, 88-96 (2020).

[0233] 9. Wang, X. et al. Genomic analyses of primitive, wild and cultivated citrus provide insights into asexual reproduction. Nature Genetics 49, 765-+ (2017).

[0234] 10. Huang, X., Wang, Y. & Wang, N. Base Editors for Citrus Gene Editing. Frontiers in Genome Editing 4 (2022).

[0235] 11. Tyurin, A. A., Suhorukova, A.V., Kabardaeva, K.V. & Goldenkova-Pavlova, I.V. Transient Gene Expression is an Effective Experimental Tool for the Research into the Fine Mechanisms of Plant Gene Function: Advantages, Limitations, and Solutions. Plants (Basel) 9QXX2XJ).

[0236] 12. Kapila, J., De Rycke, R., Van Montagu, M. & Angenon, G. An Agrobacterium-mediated. transient gene expression system for intact leaves. Plant Science 122, 101-108 (1997).

[0237] 13. Chen, L.Z. et al. A method for the production and expedient screening of CRISPR / Cas9- mediated non-transgenic mutant plants. Horticulture Research 5 (2018). 14. Danilo, B. et al. Efficient and transgene-free gene targeting using Agrobacterium-mediated delivery of the CRISPR / Cas9 system in tomato. Plant Cell Reports 38, 459-462 (2019).

[0238] 15. Veillet, F. et al. Transgene-Free Genome Editing in Tomato and Potato Plants Using Agrobacterium-Mediated Delivery of a CRISPR / Cas9 Cytidine Base Editor. International Journal of Molecular Sciences 20 (2019).

[0239] 16. Banfalvi, Z., Csakvari, E., Villanyi, V. & Kondrak, M. Generation of transgene-free PDS mutants in potato by Agrobacterium-mediated transformation. Bmc Biotechnology 20 (2020).

[0240] 17. He, ¥., Mudgett, M. & Zhao, Y. Advances in gene editing without residual transgenes in plants. Plant Physiology 188, 1757-1768 (2022).

[0241] 18. Kuang, YJ. et al. Base-Editing-Mediated Artificial Evolution of OsALSl In Planta to Develop Novel Herbicide-Tolerant Rice Germplasms. Molecular Plant 13, 565-572 (2020).

[0242] 19. Malabarba, J. et al. New Strategies to Overcome Present CRISPR / Cas9 Limitations in Apple and Pear: Efficient Dechimerization and Base Editing. International Journal of Molecular Sciences 22 (2021).

[0243] 20. Wu, J. et al. Engineering herbicide-resistant oilseed rape by CRISPR / Cas9-mediated cytosine base-editing. Plant Biotechnology Journal 18, 1857-1859 (2020).

[0244] 21. Zhang, R. et al. Generating broad-spectrum tolerance to ALS-inhibiting herbicides in rice by base editing. Science China-Life Sciences.

[0245] 22. Liang, Z., Wu, Y.Q., Ma, L.L., Guo, YJ. & Ran, Y.D. Efficient Genome Editing in Setaria italica Using CRISPR / Cas9 and Base Editors. Frontiers in Plant Science 12 (2022).

[0246] 23. Zhang, R. et al. Generation of herbicide tolerance traits and a new selectable marker in wheat using base editing. Nature Plants 5, 480-485 (2019).

[0247] 24. Bottero, E. et al. Generation of a multi-herbicide-tolerant alfalfa by using base editing. Plant Cell Reports 41, 493-495 (2022).

[0248] 25. Cheng, H.T. et al. Base editing with high efficiency in allotetraploid oilseed rape by A3A- PBE system. Plant Biotechnology Journal 19, 87-97 (2021).

[0249] 26. Brooks, C., Nekrasov, V., Lippman, Z.B. & Van Eck, J. Efficient Gene Editing in Tomato in the First Generation Using the Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-Associated9 System. Plant Physiology 166, 1292-1297 (2014). 27. Sato, S. et al. The tomato genome sequence provides insights into fleshy fruit evolution. Nature 485, 635-641 (2012).

[0250] 28. Alquezar, B„ Bennici, S„ Carmona, L„ Gentile, A. & Pena, L. Generation of Transfer- DNA-Free Base-Edited Citrus Plants. Frontiers in Plant Science 13 (2022).

[0251] 29. Schindele, P. & Puchta, H. Engineering CRISPR / LbCas12a for highly efficient, temperature-tolerant plant gene editing. Plant Biotechnology Journal 18, 1118-1120 (2020).

[0252] 30. Kwon, C.T. el al. Rapid customization of Solanaceae fruit crops for urban agriculture. Nature Biotechnology 38, 182-+ (2020).

[0253] 31. Cermak, T. et al. A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Plant Cell 29, 1196-1217 (2017).

[0254] 32. Xie, K.B., Minkenberg, B. & Yang, Y.N. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences of the United States of America 112, 3570-3575 (2015).

[0255] 33. Rusterucci, C., Aviv, D.H., Holt, B.F., Dangl, J.L. & Parker, J.E. The disease resistance signaling components EDS1 and PAD4 are essential regulators of the cell death pathway controlled by LSD1 in arabidopsis. Plant Cell 13, 2211-2224 (2001).

[0256] 34. Cui, H.T. et al. A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity. New Phytologist 213, 1802-1817 (2017).

[0257] 35. Pruitt, R.N. et al. The EDS 1-PAD4- ADRI node mediates Arabidopsis pattern-triggered immunity. Nature 598, 495-+ (2021).

[0258] 36. Thomazella, D.P.D. et al. Loss of function of a DMR6 ortholog in tomato confers broadspectrum disease resistance. Proceedings of the National Academy of Sciences of the United States of America 118 (2021).

[0259] 37. Sun, K.L. et al. Silencing susceptibility genes in potato hinders primary infection with Phytophthora infestans at different stages. Horticulture Research 9 (2022).

[0260] 38. Hu, Y. et al. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease. Proceedings of the National Academy of Sciences of the United States of America 111, E521-E529 (2014). 39. Huang, X., Wang, Y. & Wang, N. Highly Efficient Generation ofCanker-Resistant Sweet Orange Enabled by an Improved CRISPR / Cas9 System. Front. Plant Sci. 12:769907 (2022).

[0261] 40. Jia, H.G. et al. Genome editing of the disease susceptibility gene CsLOBl in citrus confers resistance to citrus canker. Plant Biotechnology Journal 15, 817-823 (2017).

[0262] 41. Jia, H. & Wang, N. (Plant Biotechnology Journal; 2020).

[0263] 42. Zong, Y. et al. Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A. Nature Biotechnology 36, 950-+ (2018).

[0264] 43. Hongge, J., Ahmad, O., Vladimir, O. & Nian, W. Biallelic Editing of the LOB1 Promoter via CRISPR / Cas9 Creates Canker-Resistant 'Duncan' Grapefruit. Phytopathology 112, 308-314 (2022).

[0265] 44. Shimizu, M. et al. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco. Plant Physiology 147, 1976-1983 (2008).

[0266] 45. Li, J. et al. A novel naturally Phe206Tyr mutation confers tolerance to ALS-inhibiting herbicides in Alopecurus myosuroides. Pesticide Biochemistry and Physiology 186 (2022).

[0267] 46. Powles, S.B. & Yu, Q. Evolution in Action: Plants Resistant to Herbicides. Annual Review of Plant Biology, Vol 61 61, 317-347 (2010).

[0268] 47. Tranel, P.J. & Wright, T.R. Resistance of weeds to ALS-inhibiting herbicides: what have we learned? Weed Science 50, 700-712 (2002).

[0269] 48. Kreiner, J.M. et al. Repeated origins, widespread gene flow, and allelic interactions of target-site herbicide resistance mutations. Elife 11 (2022).

[0270] 49. Babineau, M., Mathiassen, S.K., Kristensen, M. & Kudsk, P. Fitness of ALS-Inhibitors Herbicide Resistant Population of Loose Silky Bentgrass (Apera spica-venti). Frontiers in Plant Science 8 (2017).

[0271] 50. Wu, S. et al. Establishment of a PEG-mediated protoplast transformation system based on DNA and CRISPR / Cas9 ribonucleoprotein complexes for banana. BMC Plant Biology 20, 425 (2020).

[0272] 51. Kim, S., Kim, D., Cho, S.W., Kim, J. & Kim, J.S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research 2A, 1012-1019 (2014). 52. O'Malley, R.C. & Ecker, J.R. Linking genotype to phenotype using the Arabidopsis unimutant collection. Plant Journal 61, 928-940 (2010).

[0273] 53. Randall, L.B. et al. Genome- and transcriptome- wide off-target analyses of an improved cytosine base editor. Plant Physiology 187, 73-87 (2021).

[0274] 54. Liang, Z. et al. Efficient DNA-free genome editing of bread wheat using CRISPR / Cas9 ribonucleoprotein complexes. Nat Common 8, 14261 (2017).

[0275] 55. Omura, M. & Shimada, T. Citrus breeding, genetics and genomics in Japan. Breeding Science 66, 3-17 (2016).

[0276] 56. Woo, J.W. et al. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nature Biotechnology 33, 1162-U1156 (2015).

[0277] 57. Fossi, M., Amundson, K., Kuppu, S„ Britt, A. & Comai, L. Regeneration of Solanum tuberosum Plants from Protoplasts Induces Widespread Genome Instability. Plant Physiology 180, 78-86 (2019).

[0278] 58. Pucker, B. et al. Twenty-Five Years of Propagation in Suspension Cell Culture Results in Substantial Alterations of the Arabidopsis Thaliana Genome. Genes 10 (2019).

[0279] 59. Zhang, Y. et al. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR / Cas9 DNA or RNA. Nature Communications 7 (2016).

[0280] 60. Liang, Z. et al. Efficient DNA-free genome editing of bread wheat using CRISPR / Cas9 ribonucleoprotein complexes. Nature Communications 8 (2017).

[0281] 61. Zhang, Y.X. et al. Expanding the scope of plant genome engineering with Cas12a orthologs and highly multiplexable editing systems. Nature Communications 12 (2021).

[0282] 62. Jia, H.G., Orbovic, V. & Wang, N. CRIS PR- LbCas 12a- mediated modification of citrus.

[0283] Plant Biotechnology Journal 17, 1928-1937 (2019).

[0284] 63. Jia, H.G., Wang, Y.C., Su, H„ Huang, X.E. & Wang, N. LbCas 12a-D156R Efficiently Edits LOB1 Effector Binding Elements to Generate Canker-Resistant Citrus Plants. Cells 11 (2022).

[0285] 64. Sun, H.J., Uchii, S., Watanabe, S. & Ezura, H. A highly efficient transformation protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant and Cell Physiology 47, 426-431 (2006). 65. Huang, X.E., Wang, Y.C., Xu, J. & Wang, N. Development of multiplex genome editing toolkits for citrus with high efficacy in biallclic and homozygous mutations. Plant Molecular Biology 104, 297-307 (2020).

[0286] 66. Langmead, B. & Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nature Methods 9, 357-U354 (2012).

[0287] 67. Li, H. et al. The Sequence Alignment / Map format and SAMtools. Bioinformatics 25, 2078- 2079 (2009).

[0288] 68. Poplin, R. et al. A universal SNP and small-indel variant caller using deep neural networks. Nature Biotechnology 36, 983-+ (2018).

[0289] 69. Robinson, J.T. et al. Integrative genomics viewer. Nature Biotechnology 29, 24-26 (2011).

[0290] 70. Liu, H. et al. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Molecular Plant 10, 530-532 (2017).

[0291] 71. Bae, S., Park, J. & Kim, J.S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473- 1475 (2014).

Claims

CLAIMSCLAIMSWhat is claimed is:

1. A vector for transgene-free genome editing in an explant in the first generation (TO) using a co-editing strategy, the vector comprising;(k) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor is a fusion protein comprising a cytosine deaminase fused at its either N-terminus or C-terminus to dCas9 or nCas9,0) an oligonucleotide encoding a guide RNA comprising tracrRNA for Cas9 and crRNA targeting acetolactate synthase (ALS) gene to be base-edited,(m) an oligonucleotide encoding a Cas endonuclease selected from Class 2 Cas endonucleases, optionally Cas 12a,(n) an oligonucleotide encoding at least one crRNA of gene of interest to be edited, and(o) an oligonucleotide encoding a fluorescent protein as a selection marker.

2. The vector of claim 1, wherein the oligonucleotide encoding the cytosine base editor comprises a nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence comprising at least 95% sequence identity therewith, and wherein the oligonucleotide has a strong RNA Pol II promoter, optionally CmYLCV promoter, at its 5* upstream region and a terminator, optionally HSP 18.2 terminator, at its 3’ downstream region.

3. The vector of claims 1 or 2, wherein the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA comprises a nucleic acid sequence of SEQ ID NO:3 as the tracrRNA.

4. The vector of claims 1 or 2, wherein the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA comprises a nucleic acid sequence of crRNA targeting acetolactate synthase (als) gene, wherein the sequence of crRNA is one selected from SEQ ID NO:6 for SIALS1, SEQ ID NO: 14 for NtALS, SEQ ID NO: 16 for StALS, or SEQ ID NO: 18 for CsALS, and wherein the oligonucleotide has an RNA polymerase HI promoter, optionally U6 promoter, at its 5’ upstream region and a terminator, optionally poly (T) terminator, at its 3* downstream region.

5. The vector of any of claims 1-4, wherein the guide RNA is flanked by tRNA between the promoter and the guide RNA, and between the guide RNA and the terminator.

6. The vector of any of claims 1-5, wherein the oligonucleotide encoding Cas12a comprises a nucleic acid sequence of SEQ ID NO:4, and wherein the oligonucleotide has a strong RNA Pol II promoter, optionally CmYLCV promoter, at its 5* upstream region and a terminator, optionally HSP 18.2 terminator, at its 3* downstream region.

7. The vector of claim 1, wherein the oligonucleotide encoding the crRNA for a gene of interest to be edited by Cas12a comprises at least one nucleic acid sequence selected from SEQ ID NO:7 for SIER; SEQ ID NO:8 for SIRBL2; SEQ ID NO:9 for SIRbohD; SEQ ID NO: 10; for SIEDS1, SEQ ID NO: 11 for SIPAD4, SEQ ID NO: 12 for SIDMR6, SEQ ID NO: 13 for SIINVINH1; SEQ ID NO:15 for NtPDS, SEQ ID NO:17 for StDMR6 or SEQ ID NO:19 for CsLOBl, wherein the oligonucleotide has a strong RNA Pol 11 promoter, optionally CmYLCV promoter, at its 5* upstream region and a terminator, optionally poly (T) terminator followed by HSP 18.2 terminator, at its 3* downstream region.

8. The vector of claims 1 and 7, wherein the crRNA for a gene of interest to be edited by Cas12a is inserted into a ribozyme-gRNA-ribozyme (RGR) cassette, in which the crRNA is flanked by hammerhead (HH) ribozyme sequence of SEQ ID NO:21 between the promoter and the crRNA, and by hepatitis delta virus (HDV) ribozyme sequence of SEQ ID NO:20 between the crRNA and the terminator.

9. The vector of claims 1, 7 and 8, wherein the vector has at least one ribozyme-gRNA- ribozyme (RGR) cassette between the promoter for the oligonucleotide coding the crRNA and the terminator.

10. The vector of any of claims 1-9, wherein the fluorescent protein as a selection marker can be selected from a group comprising fluorescent proteins having blue emission range (424 - 467 nm) selected from Sirius, azurite, BFP, EBFP, EBFP2, and mTagBFP; a group of fluorescent proteins having cyan emission range (474 - 492 nm) selected from CFP, ECFP, cerulean, CyPet, SCFP, TagCFP, AmCyan, Midoriishi Cyan, and mTFPl; a group of fluorescent proteins having green emission range (499 - 519 nm) selected from EGFP, emerald, superfolder avGFP, T-sapphire, Azami Green, mWasabi, ZsGreen, TagGFP,TagGFP2, TurboGFP, CopGFP, and AceGFP; a group of fluorescent proteins having yellow emission range (524 - 538 nm) selected from YFP, EYFP, topaz, Venus, citrine, YPct, SYFP, mAmetrine, Tag YFP, Turbo YFP, Zs Yellow, and PhiYFP; a group of fluorescent proteins having orange emission range (559 - 572 nm) selected from Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed- Express (Tl), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, and TagRFP-T; and a group of fluorescent proteins having red emission range (574 - 610 nm) selected from RFP, mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, eqFP611, tdRFP611, HcRedl, and mRaspberry, and optionally GFP of a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith, and wherein the oligonucleotide comprising the nucleic acid sequence encoding the fluorescent protein has an RNA polymerase II promoter, optionally CsVMV promoter, at its 5* upstream region, and a terminator, optionally Nos terminator, at its 3* downstream region.

11. An Agrobacterium that comprises the vector of any of claims 1-10.

12. A method for transgene-free genome editing in an explant in the first generation (TO) using a co-editing strategy, the method comprising,(k) infecting an explant with Agrobacterium comprising;(vi) an oligonucleotide encoding a cytosine base editor (CBE), wherein the cytosine base editor is a fusion protein comprising a cytidine deaminase fused al its either N-terminus or C-terminus to deactivated Cas9 (dCas9) or nickase Cas9 (nCas9),(Vii) an oligonucleotide encoding a guide RNA comprising tracrRNA for Cas9 and crRNA targeting acetolactate synthase (als) gene to be base-edited,(viii) an oligonucleotide encoding a Cas endonuclease selected from Class 2 Cas endonucleases, optionally Cas 12a,(ix) an oligonucleotide encoding at least one crRNA of a gene of interest, and(x) an oligonucleotide encoding a fluorescence protein as a selection marker,wherein the infection of the explant with Agrobacterium is conducted under conditions that allow for the transgcncs to be introduced into the cxplant,(1) co-cultivating the explant with Agrobacterium,(m) subculturing the explant in (i) a first regeneration medium comprising at least one anti-Agrobacterium antibiotic selected from ticarcillin / clavulanic acid, kanamycin, carbenicillin, cefotaxime, vancomycin or combination thereof, optionally ticarcillin / clavulanic acid, to remove the Agrobacterium, and then in (ii) a second regeneration medium further comprising a sulfonylurea compound, optionally chlorsulfuron, to select explants expressing base-edited ALS enzyme,(n) observing fluorescence emitted by the shoots grown from the explant of (b), and(o) selecting the shoots without fluorescence to screen out the explant shoots having transgenes integrated into the plant genome.

13. The method of claim 12, wherein the Agrobacterium is Agrobacterium tumefaciens.

14. The method of claims 12 or 13, wherein the explant is from an annual plant, a biennial plant, or a perennial plant comprising herbaceous, evergreen or woody plants, optionally tomato, tobacco, potato, and citrus.

15. The method of any of claims 12-14, wherein the explant can be a cotyledons, epicotyls, leaves, stems, roots, flowers, anthers, and seeds.

16. The method of claim 12, wherein the explant is tomato cotyledons.

17. The method of claims 12 and 16, wherein the regeneration medium for tomato cotyledon explant subculture comprises Murashige and Skoog (MS) salts, zeatin riboside and ticarcillin / clavulanic acid.

18. The method of claim 12, wherein the explant is tobacco leaf discs.

19. The method of claims 12 and 18, wherein the regeneration medium for tobacco leaf disc explant subculture comprises MS salts, 6-benzylaminopurine, naphthalene acetic acid, and ticarcillin / clavulanic acid.

20. The method of claim 12, wherein the explant is potato leaves.

21. The method of claims 12 and 20, wherein the regeneration medium for leaf explant subculture comprises MS salts, zeatin, gibberellic acid, and ticarcillin / clavulanic acid.

22. The method of any of claims 12-21, wherein the oligonucleotide encoding the cytosine base editor comprises a nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence comprising at least 95% sequence identity therewith.

23. The method of claim 12, wherein the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA comprises a nucleic acid sequence of SEQ ID NO:3 as the tracrRNA.

24. The method of claim 12, wherein the oligonucleotide encoding the guide RNA comprising tracrRNA and crRNA comprises a nucleic acid sequence of crRNA targeting acetolactate synthase (afc) gene, wherein the sequence of crRNA is one selected from SEQ ID NO:6 for SIALS1, SEQ ID NO: 14 for NtALS, SEQ ID NO: 16 for StALS, SEQ ID NO: 18 for CsALS or SEQ ID NO: 26 for CsALS.

25. The method of claim 12, wherein the oligonucleotide encoding Cas12a comprises a nucleic acid sequence of SEQ ID NO:4 or a nucleic acid sequence comprising at least 95% sequence identity therewith.

26. The method of claim 12, wherein the oligonucleotide encoding a crRNA for a gene of interest comprises at least one nucleic acid sequence selected from SEQ ID NO:7 for SIER; SEQ ID NO:8 for SIRBL2; SEQ ID NO:9 for SIRbohD; SEQ ID NO: 10; for SIEDS1, SEQ ID NO: 11 for SIPAD4, SEQ ID NO: 12 for SIDMR6, SEQ ID NO: 13 for SIINVINH1; SEQ ID NO: 15 for NtPDS, SEQ ID NO: 17 for S1DMR6 or SEQ ID NO: 19 for CsLOBl.

27. The method of any of claims 12-27, wherein the fluorescent protein as a selection marker can be selected from a group comprising fluorescent proteins having blue emission range (424 - 467 nm) selected from Sirius, azurite, BFP, EBFP, EBFP2, and mTagBFP; a group of fluorescent proteins having cyan emission range (474 - 492 nm) selected from CFP, ECFP, cerulean, CyPet, SCFP, TagCFP, AmCyan, Midoriishi Cyan, and mTFPl; a group of fluorescent proteins having green emission range (499 - 519 nm) selected from EGFP, emerald, superfolder avGFP, T-sapphire, Azami Green, mWasabi, ZsGreen, TagGFP, TagGFP2, TuiboGFP, CopGFP, and AceGFP; a group of fluorescent proteins having yellowemission range (524 - 538 nm) selected from YEP, EYFP, topaz, Venus, citrine, YPet, SYFP, mAmctrinc, Tag YEP, Turbo YEP, Zs Yellow, and PhiYFP; a group of fluorescent proteins having orange emission range (559 - 572 nm) selected from Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed- Express (Tl), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, and TagRFP-T; and a group of fluorescent proteins having red emission range (574 - 610 nm) selected from REP, mRuby, mApple, mStra wherry, AsRed2, mRFPl, JRed, mCherry, eqFP611, ldRFP611, HcRedl, and mRaspberry, optionally GFP of a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith.

28. A vector for transgene-free genome editing using a co-editing strategy in order to generate canker resistant citrus in the first generation (TO), the vector comprising;(g) an oligonucleotide encoding a cytosine base editor, wherein the cytosine base editor (PBE) is a fusion protein comprising a cytosine deaminase fused at its either N- terminus or C-terminus to dCas9 or nCas9,(h) an oligonucleotide encoding a guide RNA comprising tracrRNA (sgRNA scaffold) for Cas9 and crRNA targeting acetolactate synthase (CsALS) gene to be baseedited,(i) an oligonucleotide encoding Cas12a,(j) an oligonucleotide encoding a crRNA targeting Effector Binding Element (EBE) region in the promoter of the citrus canker susceptibility gene LOB1,(k) an oligonucleotide encoding a green fluorescent protein as a selection marker, and(l) an oligonucleotide encoding NPTII.

29. The vector of claim 28, wherein the oligonucleotide encoding the cytosine base editor (PBE) comprises a nucleic acid sequence of SEQ ID NO:2 or a nucleic acid sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has a strong RNA Pol II promoter, optionally CmYLCV promoter, at its 5* upstream region and a terminator, optionally Nos T terminator, at its 3’ downstream region.

30. The vector of claims 28 and 29, wherein the oligonucleotide encoding the tracrRNA (sgRNA scaffold) in the Cas9 guide RNA comprises a nucleic acid sequence of SEQ ID NO:23.

31. The vector of any of claims 28-30, wherein the oligonucleotide encoding the crRNA in the Cas9 guide RNA targeting acctolactatc synthase (CsALS) gene comprises SEQ ID NO: 18 (5’-G-CAGGTCCCGCGGAGGATGAT(target seq.)-CGG (PAM)-3’) and / or SEQ ID NO: 26 CAGGTCCCTCGGAGGATGAT (target seq.)-CGG (PAM), wherein the oligonucleotide has an RNA polymerase HI promoter, optionally Arabidopsis U6 (AtU6-26) promoter, at its 5* upstream region and a terminator, optionally NosT terminator, on its 3* downstream region.

32. The vector of any of claims 28-31, wherein the guide RNA can be optionally flanked by tRNA between the promoter and the guide RNA, and between the guide RNA and the terminator.

33. The vector of any of claims 28-32, wherein the oligonucleotide encoding Cas12a comprises a nucleic acid sequence of SEQ ID NO: 4 or a nucleic acid sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has a strong RNA Pol II promoter, optionally CmYLCV promoter, at its 5’ upstream region and a terminator, optionally NosT terminator, at its 3’ downstream region.

34. The vector of any of claims 28-30, 32, and 33, wherein the oligonucleotide encoding the crRNA targeting the EBE region in the promoter of the LOB1 gene to be edited by Cas12a comprises a nucleic acid sequence of SEQ ID NO: 19 (S’-TTTC (PAM)- TCTATATAAACCCCTTTTGCCTT (target scq.)-3’), wherein the oligonucleotide has an RNA polymerase III promoter, optionally AtU6-26 promoter, at its 5’ upstream region and a terminator, optionally NosT terminator, at its 3* downstream region.

35. The vector of claims 28 and 34, wherein the crRNA is inserted into a ribozymc-gRNA- ribozyme (RGR) cassette, in which the crRNA is flanked by hammerhead (HH) ribozyme sequence of SEQ ID NO:21 between the promoter and the crRNA, and by hepatitis delta virus (HDV) ribozyme sequence of SEQ ID NO:20 between the crRNA and the terminator.

36. The vector of any of claims 28-35, wherein the oligonucleotide encoding the green fluorescent protein comprises a nucleic acid sequence of SEQ ID NO:5 or a sequence comprising at least 95% sequence identity therewith, wherein the oligonucleotide has an RNA polymerase II promoter, optionally CsVMV promoter, at its 5* upstream region and a terminator, optionally 35T terminator, at its 3* downstream region.

37. The vector of any of claims 28-36, wherein the oligonucleotide encoding NPTII comprises a nucleic acid sequence of SEQ ID NO:25, wherein the oligonucleotide has a promoter, optionally NOS promoter, at its 5* upstream region and a terminator, optionally 35T terminator, at its 3* downstream region.

38. An Agrobacterium that comprises the vector of any of claims 28-37.

39. A method for transgene-free genome editing using a co-editing strategy in order to generate canker resistant citrus in the first generation (TO) using Agrobacterium of claim 38, the method comprising steps of;(i) infecting an explant of citrus epicotyl with Agrobacterium,(j) co-cultivating the citrus epicotyl with Agrobacterium,(k) subculturing the citrus epicotyl segments in kanamycin-containing selection medium,(l) subculturing the citrus epicotyl segments in chlorsulfuron-containing medium without kanamycin under light at room temperature,(m) transferring the citrus epicotyl segments to new chlorsulfuron-containing medium after a predetermined time to select chlorsulfuron-resistant shoots, and(n) after at least one, two or three rounds of subculture with chlorsulfuron selection, select shoots without green fluorescence emission, and(o) optionally culturing plants from the selected shoots; and(p) optionally, after rooting, transfer the plants to a glasshouse.

Images