Gene augmentation therapy for usher syndrome 1b

Abstract

The invention provides compositions and methods for ameliorating defects in myosin VIIa (MYO7A) expression and / or function, including providing vectors for myosin VIIa expression and formulations comprising them, and methods of using them, for treating human retinitis pigmentosa (or retinal degeneration), and blindness and deafness such as that found in Usher syndrome. The invention provides in vivo gene therapy for ameliorating defects in myosin VIIa (MYO7A) expression and / or function, including compositions and methods for gene transfer of a human myosin VIIa (MYO7A) polynucleotide sequence that expresses multiple polypeptide isoforms of human myosin VIIa.

Description

[0001] GENE AUGMENTATION THERAPY FOR USHER SYNDROME IB

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] This application claims the benefit under 35 U.S.C. Section 119(e) of co- pending and commonly-assigned U.S. Provisional Patent Application No. 63 / 515,778, filed July 26, 2023, entitled “GENE AUGMENTATION THERAPY FOR USHER SYNDROME IB”, the contents of which is incorporated by reference herein.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0005] This invention was made with government support under EY027442 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] This invention relates to molecular and cellular biology, biochemistry, molecular genetics, gene therapy, and pharmacology.

[0008] BACKGROUND OF THE INVENTION

[0009] Usher syndrome, or Usher's syndrome, is an inherited condition that is a leading cause of deaf-blindness. People bom with this syndrome gradually become blind and deaf, usually by the age of thirty. In more severe cases, children and even infants may have significant impairment of their vision and hearing, as well as difficulties maintaining their balance, due to problems in the vestibular system. Usher syndrome is an autosomal recessive disorder of combined deafness and blindness resulting in one of the most debilitating forms of retinal degeneration, since it affects patients who already suffer from deafness. Usher type IB is due to mutations in the myosin Vila (MY07A) gene that encodes an unconventional myosin expressed in the RPE (retinal pigment epithelium) and photoreceptor cells, within the retina, plus other cells of the body, including the cochlear hair cells. Myo7a-null mice have mutant retinal phenoty pes, including defects in phagosome and melanosome transport.

[0010] Mutations in the MY07A gene account for approximately 60% of cases with a clinical diagnosis of Usher Syndrome Type I. Mutations in the USH2A gene account for approximately 80% of cases with a clinical diagnosis of Usher Syndrome Type II. There is a need in the art for vectors designed to optimize the expression of MY07A polypeptides in cells such as retinal cells in patients suffering from Usher syndrome IB. The compositions and methods described herein satisfy this need.

[0011] SUMMARY OF THE INVENTION

[0012] Gene augmentation therapy for the treatment of Usher syndrome IB disorder typically involves delivering a wild-type copy of the MY07A gene to the photoreceptors and the retinal pigment epithelium (RPE). using, for example, a subretinal injection of a virus that carries the gene to the cells. The conventional approach for gene augmentation is to deliver a MY07A cDNA. However, we have discovered that two polypeptide isoforms of MY07A (termed herein IF1 and IF2) are expressed in both the photoreceptors and the RPE, so that a single cDNA is unlikely to be optimally efficacious in therapeutic regimens for the treatment of Usher syndrome IB. In this situation, an enhanced strategy' for gene augmentation therapy of retinal degeneration in Usher sy ndrome IB was developed, one which introduces a construct designed to contain the cDNA of the larger isoform, together with the preceding intron of the exon that is alternatively spliced. Using MY07A polynucleotides selected to have the preceding intron of the exon, alternative splicing occurs so as to generate two MY07A polypeptide isoforms in cells transduced with such MY07A polynucleotides, thereby mimicking functional retinal expression profiles.

[0013] Embodiments of the invention disclosed herein include compositions and methods for ameliorating defects in myosin Vila (MY07A) expression and / or function, including ameliorating defects in myosin Vila (MY07A) expression and / or function due to genetic defects in MY07A sequence. In one aspect, the invention provides exogenous nucleic acids designed to express multiple polypeptide isoforms of MY07A, to cells, tissues, organs and / or individuals. Thus, the invention provides compositions and methods for ameliorating diseases and conditions caused or exacerbated by defects in MY07A expression and / or function, including human retinitis pigmentosa (or retinal degeneration), and blindness and deafness such as that found in Usher syndrome.

[0014] In one aspect, the invention provides expression vehicles, such as nanoparticles and vectors, for the expression of multiple myosin Vila polypeptide isoforms in a cell, tissue, organ and / or individual, and formulations comprising them, and methods of using them, for ameliorating (e.g., treating) diseases and conditions caused or exacerbated by a defect in myosin Vila (MY07A) expression and / or function. Thus, the invention provides expression vehicles, such as vectors, for ameliorating (e.g., treating) human retinitis pigmentosa (or retinal degeneration), and blindness and deafness such as that found in Usher syndrome. In another aspect, the invention provides compositions and methods for in vivo gene therapy for ameliorating defects in myosin Vila (MY07A) expression and / or function, including compositions and methods for gene transfer of the human myosin Vila gene (the MY07A gene).

[0015] The invention provides expression vehicles, e.g., vectors, expression cassettes, recombinant viruses and / or promoters, for inserting a myosin Vila (MY07A) nucleic acid selected for its ability to express multiple myosin Vila polypeptide isoforms into a cell, tissue, organ and / or individual. In one aspect of the invention, target sequences are inserted into a genome to facilitate stable integration of a construction of the invention into a genome; for example, target sequences encoding at least two retinal isoforms of MY07A (e.g.. IF1 and IF2) can be inserted into a genome using a vector for the transduction process.

[0016] Thus, the invention provides compositions and methods for gene therapy of retinitis pigmentosa (or retinal degeneration), and blindness and deafness such as that found in Usher syndrome. In one aspect, the invention provides expression vehicles, e.g., vectors, expression cassettes, recombinant viruses and / or promoters, formulations comprising the same, and methods for the gene transfer of selected MY07A gene sequences, e.g.. the human MY07A gene sequence of SEQ ID NO: 1. Exemplary expression vehicles, e.g., vectors, expression cassettes, recombinant viruses and / or promoters, are described and illustrated herein.

[0017] The invention also provides methods of ameliorating or preventing blindness due to Usher IB syndrome by inducing, upregulating or inserting a MY07A activity in a photoreceptor cell or a retinal cell, comprising: (a) providing a AAV, lentiviral or other vector comprising: a human MYO7A-encoding nucleic acid selected to express at least two retinal polypeptide isoforms of MY07A, IF1 and IF2; a promoter active in RPE cells, photoreceptor cells, and / or both RPE and photoreceptor cells; and, a chromatin insulator; and (b) inserting the vector into the cell. The invention also provides methods for the treatment or amelioration of an ocular disease, comprising delivering to target cells in an eye of a subject in need of said treatment, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding a multiple MY07A protein isoforms, wherein the MY07A protein isoforms are expressed in said target cells, thereby treating ocular disease in said subject. In addition, the invention also provides methods method for treatment or amelioration of blindness due to Usher IB syndrome in a subject, comprising delivering to target cells in the eye of the subject, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding multiple MY07A protein isoforms, wherein the MY07A protein isoforms are expressed in said target cells thereby treating blindness in said subject.

[0018] Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention, are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications.

[0019] BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figures 1A-1D provide illustrative structural and sequence information on two retinal isoforms of MY07A. (A) Schematic of MY07A, illustrating the major domains of the polypeptide and the difference between the two retinal isoforms, which consists of the presence or absence of a 38 amino acid sequence within the FERMI domain. (B) Depiction of the two putative IF1 / IF2 splice acceptors that are associated with exon 35 (SEQ ID NO: 2). The end of each putative splice acceptor sequence (YnNCAGGG) is underlined, and the first 6 nucleotides of each isoform coding region is marked with a directional arrow. (C) Amino acids of the 38 amino acid sequence that is unique to IF1 (SEQ ID NO: 3), with certain amino acids underlined and identified by chemical class. (D) 3D modeling of the FERMI domain of human MY07A IF1 and IF2. The additional 38 amino acids at the C lobe of the FERMI domain of IF1 are marked in red. and the location where they are missing in IF2 is marked with an arrow.

[0021] Figures 2A-2B provide data from quantitative PCR measurements of the expression of the two retinal Myo7a / MYO7A isoforms in different neural retina (NR) and RPE samples. (A) Graph comparing IF1 and IF2 expression for each tissue sample. Because HPRT expression likely varies among the different tissues, quantitative comparisons should not be made among the tissue samples. Mean values of biological replicates (Table 1) are plotted with error bars representing + SEM. (B) Measurements of the expression of each isoform shown as a percentage of the expression for each tissue sample.

[0022] Figure 3 provides one illustrative embodiment of a IF1 / IF2 construct that can be used to generate both IF1 and IF2 MY07A isoforms in gene augmentation therapy (e.g. when disposed in a suitable expression vector). Figures 4A-4B show data from Sanger sequencing chromatograms of Myo7a and MY07A in the retina. (A) Sequencing of PCR amplicons of mouse, pig, and human RPE from full-length Myo7a or MY07A at the splice site junction. The splice junction between IF1 and IF2 is indicated by a red arrow. Double peaks seen after the splice junction are indicative of the presence of two isoforms. The sequence of the higher peaks matches that of IF2 (the more highly expressed isoform in these samples) and the sequence of the lower peaks matches that of IF1 (the lower expressing isoform in these samples). (B) Sequencing results of full length Myo7a or MY07A PCR amplicons from topoisomerase-based cloned products, highlighting isoform ratios detected in human and mouse RPE samples.

[0023] Figure 5 provides data showing standard curves for qPCR isoform-specific primers. To ensure that our relative Ct (cycle threshold) values represent differences in RNA expression and not differences in amplification between the isoform primer sets, standard curves for human an mouse IF1 and IF2 were performed. Top row: standard curves for mouse IF1 and IF2 primers, using cDNA generated from mouse tissues. Middle row: standard curves for mouse IF1 and IF2 primers, using mouse isoform-specific plasmids. Bottom row: standard curves for human IF1 and IF2 primers, using human isoform-specific plasmids. Calculated amplification efficiencies (Eff= 10(-l / slope) - 1), despite being outside of the optimal 90-110% range for PCR primer sets, were similar between IF1 and IF2 for each species (noted at the right bottom of each graph).

[0024] DETAILED DESCRIPTION OF THE INVENTION

[0025] In the description of embodiments, reference may be made to the accompanying figures which form a part hereof, and in which is shown by way of illustration a specific embodiment in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the present invention. Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those skilled in the art. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0026] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation or by an Arabic numeral, the full citation of which is found preceding the claims. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure in their entirety to more fully describe the state of the art to which this invention pertains. Aspects and embodiments of the invention are also disclosed in Gilmore et al.. Vision Research Volume 212, November 2023, 108311, the contents of which are hereby incorporated by reference. In addition, this application is related to US Patent 7,786,091, the entire contents of which are incorporated herein by reference.

[0027] The practice of the present technology will employ, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual. 2nd edition (1989); Current Protocols In Molecular Biology (F. M. Ausubel, et al. eds., (1987)); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (R. I. Freshney. ed. (1987)).

[0028] As used in the specification and claims, the singular form "a." '‘an’’ and '‘the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof. As used herein, the term “comprising” is intended to mean that the compounds, compositions and methods include the recited elements, but not exclude others. “Consisting essentially of' when used to define compounds, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. “Consisting of' shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology.

[0029] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 1. 5, or 10%. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term “about.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary' and that equivalents of such are known in the art.

[0030] A “composition” typically intends a combination of the active agent, e.g., compound or composition, and a naturally-occurring or non-naturally-occurring carrier, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra- oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1- 99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. It is to be understood that the terms ‘‘subject” and “patient” are interchangeable. An animal, subject or patient for diagnosis or treatment refers to an animal such as a mammal, or a human, ovine, bovine, feline, canine, equine, simian, etc. Non-human animals subject to diagnosis or treatment include, for example, simians, murine, such as, rat, mice, canine, leporid, livestock, sport animals, and pets. In one aspect, the subject is a human.

[0031] An “effective amount” is an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations or applications. Such delivery is dependent on a number of variables including the time period for which the individual composition is to be used, the bioavail ability’ of the therapeutic agents included with the composition, the route of administration, etc. It is understood, however, that specific dose levels of the additional therapeutic agents disclosed herein for any particular subject depends upon a variety of factors including the activity of the specific compound employed, bioavailability of the compound, the route of administration, the age of the animal / subject and its body weight, general health, sex, the diet of the animal / subject, the time of administration, the rate of excretion, the drug combination, and the severity of the particular disorder being treated and form of administration. These considerations, as well as effective formulations and administration procedures are well known in the art and are described in standard textbooks. Consistent with this definition and as used herein, the term “therapeutically effective amount” is an amount sufficient to treat a specified disorder or disease or alternatively to obtain a pharmacological response such as immunosuppression, osteogenesis, bone resorption or mineralization.

[0032] As used herein, “treating” or “treatment” of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease or trauma), stabilized (i.e., not worsening) state of a condition (including disease or trauma), delay or slowing of condition (including disease or trauma), progression, amelioration or palliation of the condition (including disease or trauma), states and remission (whether partial or total), whether detectable or undetectable. In one aspect, the term ‘‘treatment’' excludes prevention or prophylaxis.

[0033] As used herein, the terms “nucleic acid sequence” and “polynucleotide” are used interchangeably to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA. DNA- RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0034] The terms “protein,” “peptide” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise a protein's or peptide's sequence. As used herein the term “amino acid” refers to either natural and / or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.

[0035] It is to be inferred without explicit recitation and unless otherwise intended, that when the present disclosure relates to a polypeptide, protein, polynucleotide or antibody, an equivalent or a biologically equivalent of such is intended within the scope of this disclosure. As used herein, the term “biological equivalent thereof’ is intended to be synonymous with “equivalent thereof’ when referring to a reference protein, antibody, polypeptide or nucleic acid, intends those having minimal homology while still maintaining desired structure or functionality similar to the reference protein, antibody, polypeptide or nucleic acid. Unless specifically recited herein, it is contemplated that any polynucleotide, polypeptide or protein mentioned herein also includes equivalents thereof. For example, an equivalent intends at least about 70% homology or sequence identity, or at least 80% homology or sequence identity and alternatively, or at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%. or alternatively 98% percent homology or sequence identity and exhibits substantially equivalent biological activity’ to the reference protein, antibody, polypeptide or nucleic acid. Alternatively, when referring to polynucleotides, an equivalent thereof is a polynucleotide that hybridizes under stringent conditions to the reference polynucleotide or its complement.

[0036] A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) having a certain percentage (for example, 80%. 85%, 90%. or 95%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutofl=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR.

[0037] As used herein, “homology” or “identical”, percent “identity” “sequence identity” or “similarity ”, when used in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, e.g., at least 60% identity, preferably at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence encoding an antibody described herein or amino acid sequence of an antibody described herein). Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology’ between sequences is a function of the number of matching or homologous positions shared by the sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology' (Ausubel et al., eds. 1987) Supplement 30. section 7.7.18. Table 7.7.1. Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant,

[0038] GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. The terms ‘’homology” or “identical”, percent “identity” “sequence identity” or “similarity” also refer to, or can be applied to, the complement of a test sequence. The terms also include sequences that have deletions and / or additions, as well as those that have substitutions. As described herein, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is at least 50-100 amino acids or nucleotides in length. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences disclosed herein.

[0039] “Exogenous,” “exogenously” and the like are intended to describe a material that is present and active in an organism or cell but that originated outside that organism or cell. “Endogenous,” “endogenously” and the like, as used herein, describes a protein that originates from the present cell or organism.

[0040] As used herein in reference to a polynucleotide, the term “operatively linked” refers to an association between the polynucleotide and the polynucleotide sequence to which it is linked such that, when a specific protein binds to the polynucleotide, the linked polynucleotide is transcribed.

[0041] “Expression,” “expressing,” “expresses” and the like as used herein, refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample. In one aspect, the expression level of a gene from one sample may be directly compared to the expression level of that gene from a control or reference sample. In another aspect, the expression level of a gene from one sample may be directly compared to the expression level of that gene from the same sample following administration of a compound.

[0042] “Recombinant” as used herein, refers to a polypeptide or protein which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.

[0043] As used herein, the term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified nucleic acid, peptide, protein, biological complexes or other active compound is one that is isolated in whole or in part from proteins or other contaminants. Generally, substantially purified peptides, proteins, biological complexes, or other active compounds for use within the disclosure comprise more than 80% of all macromolecular species present in a preparation prior to admixture or formulation of the peptide, protein, biological complex or other active compound with a pharmaceutical carrier, excipient, buffer, absorption enhancing agent, stabilizer, preservative, adjuvant or other co-ingredient in a complete pharmaceutical formulation for therapeutic administration. More ty pically, the peptide, protein, biological complex or other active compound is purified to represent greater than 90%. often greater than 95% of all macromolecular species present in a purified preparation prior to admixture with other formulation ingredients. In other cases, the purified preparation may be essentially homogeneous, wherein other macromolecular species are not detectable by conventional techniques.

[0044] The term "‘isolated” as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials. In one aspect, the term “isolated” refers to nucleic acid, such as DNA or RNA, or protein or polypeptide (e.g., an antibody or derivative thereof), or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source. The term “isolated” also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term “isolated” is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term “isolated” is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.

[0045] The term “transduce” or “transduction” and the like, refers to the process whereby a foreign nucleotide sequence is introduced into a cell. In some embodiments, this transduction is done via a vector.

[0046] As used herein, the term “vector” refers to a nucleic acid construct designed for transfer between different hosts, including but not limited to a plasmid, a virus, a cosmid. a phage, a BAC, a YAC, etc. In some embodiments, plasmid vectors may be prepared from commercially available vectors. In other embodiments, viral vectors may be produced from baculoviruses, retroviruses, adenoviruses, adeno-associated viruses (AAVs), etc. according to techniques known in the art. In one embodiment, the viral vector is a lentiviral vector.

[0047] The term '‘culturing” refers to the in vitro propagation of cells or organisms on or in media of various kinds. It is understood that the descendants of a cell grown in culture may not be completely identical (i.e., morphologically, genetically, or phenotypically) to the parent cell. By “expanded” is meant any proliferation or division of cells.

[0048] Usher syndrome type IB (USH1B) is a deaf-blindness disorder, caused by mutations in the MY07A gene, which encodes the heavy chain of an unconventional actin-based motor protein. Here, we characterized the two retinal isoforms of MY07A. 1F1 and IF2. We compared 3D models of the two isoforms and noted that the 38-amino acid region that is present in IF1 but absent from IF2 affects the C lobe of the FERMI domain and the opening of a cleft in this potentially important protein binding domain. Relative expression of the two isoforms in the RPE and neural retina (NR) of human, pig, and mouse was quantified by qPCR. In human and pig, the relative expression was similar in the RPE and neural retina, with IF2 expression ~7- fold greater than that of IF 1. The relative expression of the isoforms in mouse RPE, and especially mouse NR, differed from human and pig in that IF1 was relatively greater. We discuss the implications of these discoveries for any USH1B gene therapy strategy, arguing that both isoforms should be considered for targeting both the RPE and photoreceptors. We further provice an explanation for the difference in relative expression of IF1 and IF2 in mouse retina.

[0049] Embodiments of the invention disclosed herein include vectors (e.g. a lentiviral vector or an adeno associated viral vector) comprising a promoter (e.g. a CMV promoter) in operable linkage with a polynucleotide sequence encoding human MY07A polypeptides, wherein when transduced into human retinal cells, the polynucleotide sequence expresses multiple polypeptide isoforms of myosin Vila. In typical embodiments of the invention, the vector comprises a cDNA encoding a polypeptide isoform of myosin Vila, in combination with a preceding intron of an exon encoding the isoform. In certain embodiments, the MY07A polypeptide isoforms comprise IF land IF2. In one illustrative embodiment of the invention, the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms comprises SEQ ID NO: 1. In certain embodiments of the invention, the vector is disposed within a human retinal cell.

[0050] Embodiments of the invention disclosed herein also include methods of making a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding MY07A, the method comprising disposing a polynucleotide sequence encoding MY07A within the vector, wherein the polynucleotide sequence encoding MY07A is selected so that when transduced into human retinal cells, the polynucleotide sequence expresses multiple polypeptide isoforms of myosin Vila. In certain embodiments of the invention, the vector is formed to comprise a cDNA encoding a polypeptide isoform of myosin Vila, in combination with a preceding intron of an exon encoding the isoform. In typical embodiments of the invention, the vector is formed to comprise the MY07A polypeptide isoforms comprise IF1 and IF2. In illustrative working embodiments of the invention, the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms is selected to comprise SEQ ID NO: 1.

[0051] Embodiments of the invention disclosed herein also include methods for the treatment or amelioration of an ocular disease, comprising delivering to target cells in at least one eye of a subject in need of said treatment, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding a plurality of human myosin Vila (MY07A) polypeptide isoforms, wherein the plurality of MY07A polypeptide isoforms are expressed in said target cells, thereby treating ocular disease in said subject. Typically in these methods, the polynucleotide sequence comprises intron 34 of the myosin Vila gene and the MY07A polypeptide isoforms comprise IF land IF2. In illustrative working embodiments of the invention, the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms is selected to comprise SEQ ID NO: 1.

[0052] Embodiments of the invention disclosed herein also include methods for the treatment or amelioration of blindness due to Usher IB syndrome in a subject, comprising delivering to target cells in at least one eye of the subject, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding a plurality of myosin Vila (MY07A) polypeptide isoforms, wherein the plurality of MY07A polypeptide isoforms are expressed in said target cells thereby treating blindness in said subject. Typically in these methods, the MY07A polypeptide isoforms comprise IF land IF2. In illustrative working embodiments of the invention, the polynucleotide sequence encoding a plurality7of MY 07A polypeptide isoforms is selected to comprise SEQ ID NO: 1.

[0053] As noted above, the invention provides compositions and methods comprising use of a MY07A- nucleic acid that expresses multiple isoforms of MY07A (e.g., IF1 and IF2), such as a MY07A gene or MYO7A-encoding message that can express these isoforms. The invention provides expression constructs, including expression cassettes, vectors, recombinant viruses such as adenoviruses and / or lentiviruses; and / or promoters operatively linked to a MYO7A-expressing nucleic acid, such as a MY07A gene. In one aspect, the invention provides expression constructs operably linked to a myo7a coding sequence, e.g., the MY07A gene. See, e.g., US Patent 7.786,091, the entire contents of which are incorporated herein by reference

[0054] In one aspect, nucleic acids or nucleic acid sequences used to practice this invention include oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA (e.g., mRNA, rRNA, tRNA) of genomic or synthetic origin which may be single-stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin. In one aspect, nucleic acids or nucleic acid sequences used to practice this invention include oligonucleotides containing known analogues of natural nucleotides, naturally occurring nucleic acids, synthetic nucleic acids and / or recombinant nucleic acids. In one aspect, nucleic acids or nucleic acid sequences used to practice this invention encompass nucleic-acid-like structures with synthetic backbones, see e.g., Mata (1997) Toxicol. Appl. Pharmacol. 144:189-197; Strauss-Soukup (1997) Biochemistry 36:8692-8698; Samstag (1996) Antisense Nucleic Acid Drug Dev 6: 153-156.

[0055] In one aspect, the invention provides a MY07A gene, and in one aspect the term "gene" can refer to any segment of nucleic acid associated with a biological function, e.g., MY07A function. Thus, genes used to practice this invention include coding sequences and / or the regulatory sequences required for their expression. For example, a MY07A gene can comprise a nucleic acid fragment that expresses mRNA, functional RNA, or specific proteins (e.g., isoforms of MY07A termed herein IF1 and IF2), including regulatory sequences. Alternatively, genes used to practice this invention can also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. Genes used to practice this invention can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters. Genes used to practice this invention include nucleic acid sequences comprising a segment of DNA involved in producing a transcription product (e.g., a message), which in turn is translated to produce a polypeptide chain, or regulates gene transcription, reproduction or stability'. Genes used to practice this invention can include regions preceding and following the coding region, such as leader and trailer, promoters and enhancers, as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).

[0056] In one aspect, nucleic acids used to practice this invention are operably linked to a promoter, e.g.. there is a functional relationship between two or more nucleic acid (e.g., DNA) segments, e.g., a transcriptional regulator and a protein coding sequence. In one aspect, this comprises a functional relationship of transcriptional regulatory sequence to a transcribed myo7a sequence. In one aspect, a promoter is operably linked to a myo7a coding sequence, such as a human myo7a, and the promoter can stimulate or modulate the transcription of the coding sequence in an appropriate host cell or other expression system. In one aspect, a promoter transcriptional regulatory sequence that is operably linked to a transcribed myo7a sequence is physically contiguous to the transcribed sequence, i.e., they are cis-acting. In one aspect, some transcriptional regulatory sequences, such as enhancers, are not physically contiguous or located in close proximity to the MYO7A-coding sequences whose transcription they enhance.

[0057] Nucleic acids used to practice this invention can be operably linked to any promoter, which includes all sequences capable of driving transcription of a coding sequence in a cell, e.g., a plant cell or animal cell. Nucleic acids used to practice this invention can be operably linked to any control elements and / or regulatory sequences that are involved in regulating or modulating the timing and / or rate of transcnption of a gene. For example, in one aspect a promoter is a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences can interact with proteins or other biomolecules to carry out (turn on / off, regulate, modulate, etc.) transcription. Nucleic acids used to practice this invention can be operably linked to any constitutive promoter, including those that drive expression continuously under most environmental conditions and states of development or cell differentiation; or, to any inducible or regulatable promoter, e.g., those that can direct expression of a nucleic acid, e.g., MY07a, under the influence of environmental conditions or developmental conditions; examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, or the presence of light.

[0058] Nucleic acids used to practice this invention can be operably linked to any tissue-specific promoters, e.g., those that are transcriptional control elements that are only active in particular cells or tissues or organs, e.g., in plants or animals. Tissue- specific regulation may be achieved by certain intrinsic factors which ensure that genes encoding proteins specific to a given tissue are expressed. Such factors are known to exist in mammals and plants so as to allow for specific tissues to develop.

[0059] Nucleic acids used to practice this invention can be operably linked to transcriptional control elements that overexpress a nucleic acid, e.g., a MY07A sequence that expresses multiple isoforms of MY07A (e.g., IF1 and IF2), e.g., overexpress the level of expression in a transfected or transgenic cell, or transgenic organism, that exceeds levels of expression in normal or untransformed cells or organisms.

[0060] Nucleic acids used to practice the invention, including the human MY07A gene, and vectors comprising this or other nucleic acids can be made, isolated and / or manipulated by, e.g., cloning and expression of cDNA libraries, amplification of message or genomic DNA by PCR, and the like. In practicing the methods of the invention, homologous genes (e.g., MY07A genes) can be modified by manipulating a template nucleic acid, as described herein. The invention can be practiced in conjunction with any method or protocol or device known in the art, which are well described in the scientific and patent literature.

[0061] The nucleic acids used to practice this invention, whether RNA, miRNA, siRNA, antisense nucleic acid, cDNA, genomic DNA, vectors, viruses or hybrids thereof, may be isolated from a variety7of sources, genetically engineered, amplified, and / or expressed / generated recombinantly. Recombinant polypeptides or gene products (or nucleic acid molecules) generated from these nucleic acids can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including bacterial, mammalian, yeast, insect or plant cell expression systems.

[0062] Alternatively, these nucleic acids can be synthesized in vitro by several well- known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886- 7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth, Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066. Alternatively, nucleic acids can be obtained from commercial sources.

[0063] Techniques for the manipulation of nucleic acids, such as, e.g., subcloning, labeling probes (e g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e g., Sambrook, ed., Molecular Cloning: A Laboratory Manual (2. sup. nd 10 ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989); Current Protocols in Molecular Biology, AusubeL ed. John Wiley & Sons, Inc., New York (1997); Laboratory Techniques in Biochemistry and Molecular Biolog: Hybridization with Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N. Y. (1993).

[0064] Another useful means of obtaining and manipulating nucleic acids used to practice this invention is to clone from genomic samples, and, if desired, screen and re-clone inserts isolated or amplified from, e.g., genomic clones or cDNA clones. Sources of nucleic acid used in the methods of the invention include genomic or cDNA libraries contained in, e.g.. mammalian artificial chromosomes (MACS), see, e.g., U.S. Pat. Nos. 5,721,118; 6,025,155; human artificial chromosomes, see, e.g., Rosenfeld (1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC); bacterial artificial chromosomes (BAC); Pl artificial chromosomes, see, e.g., Woon (1998) Genomics 50:306-316; Pl-derived vectors (PACs). see, e.g., Kem (1997) Biotechniques 23: 120-124; cosmids, recombinant viruses, phages or plasmids.

[0065] In practicing the invention, nucleic acids of the invention or modified nucleic acids of the invention, can be reproduced by amplification. Amplification can also be used to clone or modify the nucleic acids of the invention. Thus, the invention provides amplification primer sequence pairs for amplifying nucleic acids of the invention. One of skill in the art can design amplification primer sequence pairs for any part of or the full length of these sequences. In one aspect of the invention, a construct of the invention comprises a reporter or marker gene. The reporter or marker gene is used to monitor gene (e.g., MY07A gene) expression. In one aspect, the reporter or marker gene is used to monitor gene suppression or silencing. In one aspect of the invention, the reporter gene is green fluorescent protein. Any compound, label, or gene that has a reporting or marking function can be used.

[0066] The invention provides cells comprising a myosin Vila (MYO7A)-expressing nucleic acid for ex vivo and / or in vivo gene therapy for ameliorating defects in myosin Vila (MY07A) expression and / or function, e.g., for gene transfer of the human myosin Vila gene (the MY07A gene) to the cells. These cells can also be used in drug screening studies or for research. In one aspect, cells of the invention are made by transformation, which can be the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. A host cell used to practice this invention can be a cell that has been transformed by an exogenous nucleic acid molecule. Host cells used to practice this invention containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms".

[0067] A host cell used to practice this invention can be "transformed", "transduced", "transgenic", and / or a "recombinant" host cell or organism into which a heterologous nucleic acid molecule (e.g., a MY07A gene) has been introduced. The nucleic acid molecule used to practice this invention can be stably integrated into the genome, e.g., as described in Sambrook and Russell. For example, "transformed," "transformant," and "transgenic" cells have been through the transformation process and contain a foreign gene integrated into their chromosome. A host cell used to practice this invention can be untransformed, or a normal cell that has not been through the transformation process, but contains a myosin Vila (MYO7A)-expressing nucleic acid.

[0068] In one aspect, the invention provides transfection of cells, i.e., the acquisition by a cell of new nucleic acid material by incorporation of added DNA, e g., a MY07A gene. Thus, transfection used to practice this invention can include the insertion of nucleic acid into a cell using physical or chemical methods. Any transfection techniques known to those of ordinary skill in the art can be used, including: calcium phosphate DNA co-precipitation; DEAE-dextran; electroporation; cationic liposome-mediated transfection; and tungsten particle-facilitated microparticle bombardment (Johnston (1990). Strontium phosphate DNA co- precipitation is also a transfection method.

[0069] In one aspect, the transduction of cells to practice this invention includes the process of transferring nucleic acid into a cell using a DNA or RNA virus. In one aspect, an RNA virus (i.e., a retrovirus) used to practice this invention for transferring a nucleic acid into a cell is a transducing chimeric retrovirus. Exogenous nucleic acid material contained within the retrovirus can be incorporated into the genome of the transduced cell. In one aspect, a cell that has been transduced with a chimeric DNA virus (e.g., an adenovirus carrying a cDNA encoding a therapeutic agent), will not have the exogenous nucleic acid material incorporated into its genome but will be capable of expressing the exogenous nucleic acid material that is retained extrachromosomally within the cell.

[0070] The invention provides nucleic acid constructs comprising a MY07A- expressing sequence, e.g., a MYO7A-expressing message RNA or a MY07A gene, e.g., a MY07A nucleic acid sequence, including, for example Homo sapiens MYOVIIA sequence as set forth in GenBank nos. U39226, U34227, AAB03679, 055208, and U55209; and / or the Mus MYOVIIa sequences as set forth in GenBank no. U81453; and / or the hsEST sequence as set forth in GenBank no. BE780659. In one aspect, MYO7A-expressing nucleic acids used to practice this invention include MY07A genomic sequences, or fragments thereof, including coding or non-coding sequences, e.g., including introns, 5' or 3' non-coding sequences, and the like. An illustrative MYO7A sequence of the invention is found below.

[0071] The following examples are provided to illustrate but not limit the invention. EXAMPLE 1: EXPRESSION OF TWO MAJOR ISOFORMS OF MYO7A IN THE RETINA: CONSIDERATIONS FOR GENE AUGMENTATION THERAPY OF USHER SYNDROME TYPE IB

[0072] Certain aspects of this Example are found in the manuscript in the Appendix that is included herewith and incorporated herein by reference.

[0073] Retinal degenerations (RDs) due to monogenic mutations occur at a frequency of approximately, 1 in 2000, worldwide (Berger et al., 2010). Most of these degenerations (70%) are recessively inherited, caused by loss of gene function, so that the disease can potentially be treated by the introduction of a wild-type copy of the mutant gene. Such gene augmentation therapies have now been attempted for numerous genes, with one FDA-approved product so far; in 2017, approval was given for treating a form of Leber congenital amaurosis (LCA2), which is caused by biallelic mutations in RPE65, by delivering wild-type RPE65 to the RPE with adeno- associated virus (AAV) (doi.org / 10.1038 / nbt0118-6a). Similar approaches for several other inherited RDs are in clinical trials (Rakoczy et al., 2019; Cehajic-Kapetanovic et al., 2020; Fischer et al., 2020; Yu-Wai-Man et al., 2020).

[0074] A limitation of gene augmentation is that the retinal cells need to be treated before there is too much degeneration, as it is dependent on the presence of healthy cells to start expressing the introduced WT copy of the gene. In LCA2 cases, administration of treatment in older patients has been found to be less efficacious in the long term (Cideciyan et al., 2013). This limitation means that patients should be identified before manifestation of retinal degeneration. LCA2 patients are bom blind due to disruption of the visual cycle, so that young patients can be potentially identified before the onset of RD. However, for many other inherited RDs, patients are only detected due to their loss of their peripheral vision, which may not occur until a significant portion of photoreceptor cells have been lost.

[0075] Usher syndrome (USH) is a deaf-blindness disorder, caused by mutations in any one of nine identified genes (Castiglione and Moller, 2022). The deafness precedes visual impairment and is more obvious in USH1 patients, who are bom profoundly deaf. Most of these patients are now treated with cochlear implants to address their deafness. The early identification of these patients, before the onset of RD, means that USH patients represent a highly suitable population for gene augmentation therapy.

[0076] Commonly, gene augmentation approaches involve the delivery of a single cDNA of the WT gene. Despite the successes of this approach, it is potentially limited in cases where the mutant gene normally expresses more than one isoform. Previously, we noted that most of the USH genes might express more than one isoform (Williams et al., 2017).

[0077] Here, we focused on retinal isoform expression of the most common USH1 gene, MYO7A, which underlies USH1B (Weil et al., 1995). MYO7A encodes the heavy chain of an actin-based motor protein (Udovichenko et al., 2002). Our results show that the neural retina and RPE from human, pig. and mouse all express two isoforms of MYO7A. We discuss the relevance of our findings to USH1B gene augmentation therapies.

[0078] Materials and Methods

[0079] Human and animal tissues

[0080] C57BL6 mice carrying wild-type Myo7a on both alleles were maintained and genotyped as described (Gibbs, et al 2003). Young mice, aged postnatal day 9-15, were used due to the relative ease of separation of RPE from neural retina. Mouse NR samples were comprised of pooled tissues from each eye to ensure sufficient RNA yields. To obtain sufficient material for analysis, mouse RPE was cultured and expanded for 3-5 days. These primary' mouse RPE samples were combined when harvesting RNA. Pig eyes were obtained through UCLA Division of Laboratory Animal Medicine (DLAM). Eyes were excised from the eye socket and dissected to expose the tissues of the retina. The neural retina was separated from the eyecup and set aside for further processing. The RPE layer was carefully isolated from the eyecup by mechanical separation. De-identified samples of post-mortem human fetal RPE (female) and adult posterior segments (from a 42-year old male and a 90-year old female, neither with any known retinal disease) were provided by the labs of Dr Yirong Peng and Dr Gabriel Travis, respectively, at Stein Eye Institute, according to regulations for anonymous pathological specimens. All tissue samples were immediately processed following isolation, or otherwise flash frozen and stored at - 80°C.

[0081] Cell Culture

[0082] ARPE-19 cells were thawed and cultured in DMEM / F12 with GlutaMAX, 10% FBS, 100 U / mL Penicillin and 100 U / mL Streptomycin, until confluency was reached. Cells were then passaged and seeded into a new culture plate (1.66 x 105cells / cm2) with differentiation medium (MEM-Nic with GlutaMAX, 1% FBS, 100 U / mL Penicillin, 100 U / mL Streptomycin, 1% N1 supplement, 0.1 mM NEAA, taurine (0.25 mg / ml), hydrocortisone (20 ng / ml), triiodo-thyronine (0.013 ng / ml), and 10 mM nicotinamide) (Hazim et al., 2019; Hazim et al., 2022). The cells were maintained for at least 14 days at 37°C. 5% CO2 with media changes every 2-3 days until a polarized morphology was established.

[0083] The H9 embryonic stem cell line used in these studies was generated by WiCell (Madison, Wisconsin), and provided for our studies through the UCLA Broad Stem Cell Research Center Stem Cell Bank. The xcHUFl iPS cell line was also obtained through the UCLA Stem Cell Bank facility, where the line was generated by lentiviral cassette integration of the reprogramming factors Oct4, Sox2, Klf4, and cMyc. This line originated from an individual with no knowor retinal disease, and was used only for isolated iPSC-RPE cultures.

[0084] All stem cells were plated and maintained on Matrigel* Basement Matrix- coated tissue culture plates and cultured in mTeSRrMl Basal Medium. Differentiation from pluripotent state into RPE was performed using a described 14-day differentiation protocol (Buchholz et al., 2013) with modifications (Hazim et al., 2017). Briefly, plated ESC or iPSC colonies were cultured for days 0 and 1 in basal medium supplemented with Noggin (50 ng / mL), Dkkl (10 mg / mL), and IGF1 (10 mg / mL). On day 2, the culture media is replaced with basal medium supplemented with Noggin (10 ng / mL), Dkkl (lOmg / mL). and IGF1 (10 mg / mL), and bFGF (5 ng / mL). On day 4, the medium is again replaced, this time with basal medium supplemented with Dkkl (10 ng / mL) and IGF1 (10 ng / mL). For days 4 through 14, differentiating cultures were maintained in fresh basal medium supplemented with Activin A (100 ng / mL) and SU5402 (10 pM). Finally, after 14 days, culture media is switched to MEM-Nic with 5% FBS. and replaced every 2-3 days until pigmented, cuboidal RPE cells begin to appear within the culture. These patches of RPE were mechanically isolated, and expanded into homogenous hiPS-RPE or hES-RPE cultures.

[0085] Retinal organoids were generated from an hiPSC line derived from CD34+cord blood (A18945. Thermo Fisher Scientific) (Burridge et al.. 2011). This cell line was obtained with verified normal karyotype and contamination- free. Undifferentiated hiPSCs and derived retinal organoids were routinely tested for mycoplasma contamination by polymerase chain reaction (PCR). Cell culture, retinal differentiation, and organoid formation were conducted as previously described (Zhong et al., 2014; Aparicio-Domingo et al., 2023). Retinal organoids at 270 days of differentiation were used for these studies. Induced primary RPE were obtained from retinal organoids (roRPE), according to (Flores-Bellver et al., 2021). Briefly, retinal organoids at 60 days of differentiation were used to isolate RPE tissue. Dissected RPE tissue was enzymatically dissociated into single cells and seeded on to Transwell culture membrane inserts (No. 3460, Coming), coated with Matrigel matrix (No. 354230, Coming). RPE cells were maintained at 37°C and 5% CO2 in MEM-Nic as described above but with 5% FBS, as previously described (Maminishkis et al.. 2006). Cell culture media was changed every other day and roRPE monolayers were used for experiments after 360 days of differentiation.

[0086] Sample Preparation for Quantitative PCR The expression of MYO7A in collected samples was verified using quantitative reverse transcription-PCR (qRT-PCR). Total RNA was extracted from samples using the RNeasy Mini Kit (Qiagen), as described by the manufacturer's protocol. Fully polarized ARPE-19 cells were washed twice with PBS prior to harvest, and then mechanically scraped from the culture well for RNA extraction. roRPE samples were incubated in RNA Protect (Qiagen, Hilden, Germany) to attenuate endogenous RNase activity and mRNA synthesis and scraped off the plate into a 1.5-ml tube. Cells were centrifuged at 2500 x g for 10 min and the pellet was resuspended in buffer RLT plus (RNeasy Plus Micro / Mini Kits; Qiagen) with 2-mercaptoethanol (1 : 100; Sigma- Aldrich Corp.). In the case of retinal organoids, neural retina devoid of RPE was used. Retinal organoid samples were washed twice with PBS and then incubated with 150 pL of TRIzol reagent (Thermo Fisher Scientific, USA) for 5 min at room temperature (RT). The mixture was vortexed well to ensure complete lysis of the tissue. This was followed by the addition of 30 pL of chloroform (Sigma Aldrich, USA), vigorously shaken, and incubated for 3 min at RT. Samples were then centrifuged for 5 min at 12000 x g at 4°C to separate the phases. The aqueous phase was carefully collected, so not to disturb the interphase, and dispensed into another microtube for further RNA processing. Primary mouse and pig tissues were collected and homogenized, then passaged through a syringe to facilitate dissociation. Purified RNA was eluted from the column with a maximum of 40 pL Ultrapure RNase-free water or elution buffer, and then analyzed by nanodrop to determine concentration. RNA concentration was generally standardized to 100 ng / pL or 250 ng / pL. Purified total RNA (1-2 pg) was used immediately for first strand cDNA synthesis or otherwise stored at -80°C. Purified RNA was reverse transcribed into cDNA using Superscript IV First Strand Synthesis Kit (Thermo Fisher) according to the manufacturer's protocol. To ensure that cDNA was generated from only messenger RNA, we opted for the oligo d(T) primer during synthesis. Samples were stored at - 20°C until qPCR analysis. Quantitative PCR Primers

[0087] Primer sets were used for amplification of MYO7A, Myo7a, or housekeeping genes. See Gilmore et al., Vision Research Volume 212, November 2023, 108311.

[0088] Quantitative PCR Standardization

[0089] MYO7A primers were designed to span exon-exon junctions specific to each isoform to ensure that amplification was isoform specific, as well as to avoid amplification of genomic DNA. Standard curves were performed with each MYO7A primer set to ensure resulting data was not biased by preferential amplification (FIG. 5). The DNA template for PCR primer standardization consisted of species-specific versions of the MYO7A gene in a concentrated vector. For mouse samples, full length Myo7a was PCR amplified from mouse NR cDNA, and cloned into a pTOPO backbone plasmid, using the Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen). Clones were screened by Sanger sequencing (Laragen, Culver City, CA) to obtain isoform specific template vectors The resulting templates (pTOPO-musMvoZa-IF l , pTOPO-musA-fvo7a-lF2) were prepared using PureLink™ Quick Plasmid Miniprep Kit (Invitrogen). For human samples, previously prepared plasmid DNA, containing either M YO 7 A IF! or 1F2, was used (pUH-CBA-mCheny-kfYO7A-lFl. pUH-CBA- mCherry-MYO7A-IF2). Template DNA concentrations were diluted to 100 ng / pL, and then serially diluted 1:10 for a total of seven samples. qPCR reactions were prepared in triplicate with each serial dilution, as follows: 1 pL DNA template, 1 pL 10uM Forward and Reverse primer. 10 pL SYBR Green Master Mix. and 8 pL Ultrapure RNase-free water for a total of 20uL per reaction Samples were loaded into individual wells of a 384-well qPCR plate and analyzed using automated threshold analysis using the Quant Studio 3 Pro Real-Time PCR System (Applied Biosystems). Ct values were averaged for each sampling group and plotted against the log of the DNA copy number (Fig. 4). Amplification efficiencies were calculated (Eff = 10(" i / siope) J)anc|recor(jecibeneath each plot. Quantitative PCR Analysis

[0090] Quantitative PCR amplification was performed using SYBR Green Master Mix (Applied Biosystems). Fluorescent detection of PCR amplification was analyzed using Quant Studio 3 Pro Real-Time PCR System (Applied Biosystems) or LightCycler 480 Real-Time PCR Thermal Cycler (Roche), or Q qPCR instrument (Quantabio) with the following program: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 sec followed by 60°C for 1 min. Melt curve analysis was performed to determine specificity of each PCR reaction, as follows: 95°C for 15 sec, 60°C for 1 min, and then 10 sec incremental incline of 1°C, up to 95°C. The housekeeping gene, HPRT, was used as an internal control. The relative expression of MYO7A IF1 and IF2 was determined by calculating AACt, normalized to HPRT expression. The Ct value was determined for each PCR reaction by automated threshold analysis by the PCR instrument, Quant Studio 3 Pro Real-Time PCR System (Applied Biosystems), LightCycler 480 Real-Time PCR Thermal Cycler (Roche), or Q qPCR instrument (Quantabio). Samples containing impurities, as determined by melting curve analysis, were discarded from analysis. The value of each technical replicate within a sample group was calculated and normalized to the housekeeping gene as such: ACt (MYO7A7) = Ct(MYO7A)- Cl(HPRT). The AACt was calculated from the difference in each normalized MYO7A ACt, as AACt = MCX(MYO7A IF1) - ACt(ALKO7A IF2). Finally, the relative expression of each isoform was represented by 2'AACt.

[0091] Quantitative PCR Sample Sizes

[0092] As shown in Table 1, eleven mouse neural retina samples, each consisting of two pooled retinas, and four mouse RPE samples, each consisting of tissues collected from four mice, were collected for analysis. An NR and RPE sample were collected from each of two pig eyes. Seven wells of ARPE-19 were each independently polarized and harvested for analysis. Four cultures of differentiated RPE from xcHUFl hiPSCs, and two cultures from hESCs were sampled. Data collected from stem cell-derived RPE samples were combined into a single group (iPS / ES-RPE) for analysis. Five groups of retinal organoids were used for analysis, each group containing a pool of six organoids. Four biological replicates of roRPE were used for analysis. Three total de-identified post-mortem human subject eyes were collected, one from a human fetal subject, and one each from two adult subjects. For the human fetal subject, an RPE sample was collected. For the adult human post-mortem eyes, both NR and RPE were sampled from the 42-year old subject, while just the RPE was sampled from the 90-year old subject. Between three and six technical replicates were used for each data point, depending on the RNA yield of each sample.

[0093] Table 1. Quantitative PCR samples

[0094] 3D Modeling

[0095] 3D models were generated by the Pymol software (https: / / pymol.Org / 2 / ). Myosin 7a FERMI amino acid sequences were analyzed using the Phyre2 webserver (htp: / / www.sbg.bio.ic.ac uk / phyre2), or otherwise obtained from the Protein Data Bank (https: / / www.rcsb.org / ). The resulting model (.pcb format) was imported into Pymol for 3D visualization analysis.

[0096] Retinal MYO7A isoforms in relation to gene augmentation therapy

[0097] The first clinical trial to prevent USH1B blindness used gene augmentation therapy with MYO7A IF2. Based on our relative expression data, this more highly expressed isoform would seem to have been a more prudent choice - if only one isoform were to be used. The IF2 construct was provided by our lab to Oxford Biomedica for incorporation into an EIAV lentiviral vector for subretinal delivery. This trial was abandoned before efficacy could be properly assessed. Nevertheless, earlier, HIV lentiviral delivery of the same IF2 construct had been shown to correct a variety of known mutant phenotypes due to lack of MY07A function in mouse retinas. Correction was determined by the localization and motility of RPE melanosomes, the degradation of photoreceptor outer segment phagosomes, and the concentration of opsin in the connecting cilia of the photoreceptor cells (Hashimoto et al., 2007). Myo7a-m\AanX mice manifest mislocalized melanosomes in the apical RPE, due to aberrant motility (Liu et al., 1998; Futter et al., 2004; Gibbs et al., 2004), slowed phagosome degradation, due to impaired movement from the apical RPE (Gibbs et al.. 2003; Jiang et al., 2015), and an abnormal accumulation of opsin in the connecting cilia of photoreceptor cells (Liu et al., 1999). However, lack of MY07A also results in several additional mutant phenotypes, which suggest other functions (Williams and Lopes, 2011).

[0098] Electrophysiological studies of A / vo7«-mulant mice showed a slightly reduced a- and b-wave response (Libby and Steel, 2001). With mutant mice on a different genetic background, a more significant electroretinogram abnormality was observed, including a delay in the recovery of rod responsiveness after desensitization (Colella et al., 2013). In the RPE, MY07A is required for the light-dependent translocation of the retinoid isomerase, RPE65. with mice that lack MY07A having lower overall levels of RPE65 as well as mislocalization of the isomerase (Lopes et al., 2011). Correction of these phenotypes was not tested in the initial gene augmentation studies in mice (Hashimoto et al., 2007); nor were they tested in a later study using the same IF2 cDNA. but delivered by AAV (Lopes et al., 2013).

[0099] Interestingly, gene augmentation studies with Myo 7o-mutant mice, using a cDNA (A MY 07 A IF1, have demonstrated correction of some of the same phenotypes that were corrected by MYO7A IF2. Melanosome localization in the apical RPE was corrected with MYO7A cDNA that was reported to be IF1, packaged in either single or dual AAV vectors (Colella et al., 2013; Trapani et al., 2014; Ferla et al., 2023). This treatment also improved the electrophysiological recovery from light desensitization (Colella et al., 2013). The correction of melanosome localization with either IF1 or IF2 is consistent with the reported interaction between MY07A and melanosomes in the RPE.

[0100] Melanosome motility by MY07A is mediated by association of RAB27A on melanosomes with the exophilin, MYRIP, which in turn binds to the tail of MY07A (El-Amraoui et al., 2002; Fukuda and Kuroda, 2002; Klomp et al., 2007; Lopes et al., 2007). This tail region of MYO7A is identical between MY07A IF1 and IF2. It includes the FERM2 domain, but it does not include the FERMI domain, which is where the two isoforms differ (Fig. la). The requirement of the MY07A FERM2 tail region for melanosome motility and localization has been demonstrated in vivo, using Myo7a-mutant mice, known as polka. Polka mice carry a splice site mutation (c.5742+5G>A) that results in a MYO7A protein, truncated at the FERM2 domain. In the RPE of polka mice, the mutant MY07A protein is present at wild-type levels, but it does not associate with melanosomes. resulting in their mislocalization (Schwander et al., 2009).

[0101] Functions that involve protein or organelle association with the FERMI domain of MY07A are more likely to be specific for IF1 or IF2. In this respect, the scaffolding protein, SANS, has been shown to bind the FERMI domain of MY07A (Adato et al.. 2005). Mutations in SANS underlie USH1G (Weil et al.. 2003), and this SANS-MYO7A binding is thought to be part of a network of USH1 proteins (Adato et al., 2005; Reiners et al., 2005), and perhaps involved in ciliary transport (Sorusch et al., 2019).

[0102] In summary, MY07A IF1 and IF2 are likely to have overlapping functions (e.g. melanosome motility' and localization), in addition to distinct functions that involve the FERMI domain. The requirement of expressing both isoforms for effective gene augmentation therapy depends on whether at least one separate function of each isoform is essential for preventing RD. To our knowledge, there are no known USH1B mutations that would affect just one MYO7A isoform. Nevertheless, with our current state of knowledge, we cannot rule out this possibility resulting in RD. For gene augmentation therapy, we suggest testing a single construct with IF1 cDNA that includes intron 34 (0.9 kb), in order to potentially generate both IF1 and IF2 through alternative splicing. (Fig. 3).

[0103] Both the RPE and photoreceptors as necessary targets for USH1B gene therapy

[0104] Previously, we proposed that the photoreceptors were the initial site of the USH1B disease, but that was based on the first detection of cell pathology by in vivo imaging and the similarity7of retinal pathology7of USH1B with that of other Usher syndromes (Jacobson et al., 2008). More advanced imaging of RPE cells may have detected RPE pathology earlier. In any case, there are two fundamental reasons that suggest the need to address both the RPE and photoreceptors in USH1B gene therapy. First, MY07A protein, as well as mutant phenoty pes in its absence, have been detected in both mammalian RPE and photoreceptors (Hasson et al., 1995; Liu et al., 1997; Liu et al., 1998; Liu et al., 1999). Second, the site of manifestation of pathology7is not necessarily the site of the defective molecular mechanism that leads to the evident pathology7. There are several well-known examples among inherited RDs that involve cell nonautonomous impairment, particularly where a molecular defect in the RPE results in primary pathology in the photoreceptor cells (e.g. mutations in MERTK and RPE65). Moreover, the variety of mutant phenotypes due to a lack of MY07A function in the retina suggests that these defects may collectively contribute to USH1B pathology7. While these mutant phenotypes were largely discovered in mice, some have been corroborated in human RPE cells. For example, impaired degradation of phagosomes was shown in MIT? 7^ -deficient human RPE cells (Gibbs et al., 2010). This particular RPE defect seems like a good candidate for contributing to a general insult that leads to USH1B pathology, since it has been linked to RD through mutations in other genes (Rakoczy et al., 2002; Krock et al., 2007; Gordiyenko et al., 2010; Jiang et al., 2015; Esteve-Rudd et al., 2018). Not only, however, should we consider treating both the photoreceptors and the RPE in USH1B in any planned gene therapy, the expression of both MY07A isoforms in both the RPE and the NR (representing the photoreceptor cells) suggests that we should treat both cell types with both MYO7A isoforms.

[0105] MYO7A in the mouse retina

[0106] An early low magnification immunolabeling study of mouse photoreceptors failed to detect MY07A (El-Amraoui et al., 1996), and a recent paper also concluded that MY07A was absent from mouse photoreceptors (Calabro et al., 2019). However, immunoEM studies have not only been able to detect MY07A in the connecting cilium, but also demonstrate the abnormal accumulation of opsin in this region in A7yo7a-mutant mice, thus associating a mutant phenotype due to loss of MY07A function with the photoreceptors. These EM results have now been verified independently by at least 4 different laboratories (Liu et al., 1997; Liu et al., 1999; Hasson, 2000; Wolfrum and Schmitt. 2000; Colella et al., 2013). Moreover, using female Myo7a-null mice, expressing &Myo7a transgene from their X-chromosome, it was demonstrated that this phenotype of abnormal opsin accumulation in the connecting cilium is due to lack of MY07A in the photoreceptor cells themselves and not from lack of MY07A in the RPE cells; the retinas of these mice contained mosaics of MY07A-null and MYO7A-positive photoreceptor and RPE cells (Jacobson et al., 2008).

[0107] ImmunoEM suggests that the localization of MY07A to the photoreceptor connecting cilium is similar between mouse and human (Liu et al., 1997). However, MY07A is also localized to the photoreceptor calycal processes, as are other USH1 proteins (Sahly et al., 2012), and the organization of the calycal processes differs significantly between mouse and human. A calycal process is an f-actin-filled extension from the inner segment that associates with an incisure in the mature outer segment disks. Mouse and rat rod photoreceptors have a single calycal process (Kessel and Kardon, 1979; Arikawa et al., 1992; Volland et al., 2015), which is associated with the single disk incisure. In contrast, the mature disks of primates, pigs, frogs, and many other vertebrates have many incisures, and are associated many calycal processes, which have been illustrated in the literature, dating back to the 1960s (Brown et al., 1963; Hogan et al., 1971 ; Steinberg et al., 1980). Calycal processes require actin filaments for their organization. When f-actin is depolymerized, they collapse, contributing to defective disk membrane morphogenesis that is manifest by overgrown nascent disks (Williams et al.. 1988). Loss of PCDH15 or CDH23, the USH1F and USH1D proteins, results in loss of f- actin in the calycal processes and the same perturbed disk morphogenesis phenotype is observed (Schietroma et al., 2017). Hence, the calycal process localization of USH1 proteins may be important in USH1 retinal pathology (Sahly et al., 2012; Schietroma et al., 2017), although, to date, no mutant phenotype has been linked to the calycal processes due to lack of MY07A.

[0108] We found the expression of Myo7a IF1 to be slightly higher than that of IF2, in mouse NR (representing the photoreceptors), giving a much higher relative ratio than that found in pig or human NR (Fig. 2). This difference may stem from the different relative distribution of MY07A in the photoreceptor cells. In human photoreceptors, there is likely much more MY07A in the calycal processes compared with the connecting cilium (Sahly et al., 2012), but in mouse photoreceptors, there may not be much difference since the sizes of the connecting cilium and the single calycal process are more comparable. If the calycal processes contained mostly MY07A IF2, and the connecting cilium contained mostly IF1, in all species, animals with extensive calycal processes would be expected to have a higher ratio of IF2 to IF1. Therefore, the difference in MY07A isoform expression levels between mouse and human (and pig) NR could therefore be explained by differential subcellular localization of IF1 and IF2 in photoreceptors, together with a difference in the extent of the calycal processes between mouse photoreceptors and the photoreceptors of human (and pig). Results

[0109] In a screen of a human retinal cDNA library7, multiple independent clones were found to represent one of two isoforms of MYO7A (Weil et al., 1996), which we refer to as IF1 and IF2. Fig. la depicts the domains of MY07A and illustrates that the two isoforms differ from each other by a 38 amino acid sequence that is present in IF1 but not IF2. The presence or absence of this sequence is due to alternative splicing of exon 35, and it affects the structure of the FERMI domain in the MY07A tail (Fig. 1).

[0110] FERM domains are common protein binding regions (Chishti et al., 1998), so that any changes in these regions are likely to affect specific protein function. Some binding partners to the FERMI domain of MY07A have been reported, including another Usher 1 protein, SANS (Adato et al., 2005). To investigate the structural and functional implications of modifying this domain, 3D models of each isoform were generated. These models revealed differences in the amino acid sequences at the tip of one loop of the C-lobe of the FERMI domain. The differences appear to affect the opening to the cleft created between different lobes, and are thus likely to result in different protein interactions between IF1 and IF2 (Fig. Id).

[0111] In the retina, MY07A has been detected in the RPE and the photoreceptor cells of rodents and humans by immunocytochemistry (Hasson et al., 1995; Liu et al., 1997). Mutant phenotypes in mice, lacking functional MY07A, confirm this localization by showing functions for MY07A in both these cell types (e.g. Liu et al., 1998; Liu et al., 1999). To determine the relative abundance of each isoform in RPE and photoreceptor cells, we compared the relative expression of IF1 and IF2 in a variety of RPE and neural retina (NR) samples from mouse, pig, and human. The mouse and pig samples consisted of freshly dissected post-mortem retinas, while the human samples included cultures of polarized RPE monolayers that were differentiated from 1) the ARPE19 cell line, 2) hESCs, and 3) hiPSCs, as well as roRPE and NR from retinal organoids that were differentiated from hiPSCs, and RPE from human post-mortem eyes. The ratio of IF1 to IF2 was relatively consistent for the different human and pig samples tested (Fig. 2). IF2 was the predominant isoform expressed in human RPE and NR samples, accounting for 82-90% of the relative MYO 7 A expression. A similar isoform ratio was found in pig tissues, with IF2 accounting for the majority of expression in both the RPE (89%) and NR (90%). On average, IF1 accounted for about 1 in 7 of MYO7A transcripts across pig and human samples. Samples collected from mouse retinas contained relatively more IF1. In mouse RPE, IF1 was still the lower expressed isoform, but accounted for a larger relative proportion of Myo7a transcript (26%). In contrast, mouse NR showed higher expression of IF1 than IF2 expression (59 vs 41%).

[0112] Discussion

[0113] Like most of the other Usher syndrome genes, MYO7A is alternatively spliced (Williams et al., 2017), with two major isoforms expressed in the retina (Weil et al., 1996). Using quantitative PCR, we found that these two isoforms, IF1 and IF2, were found to be expressed at a similar ratio in human and pig NR and RPE, with the expression of IF2 5-9 times greater than that of the longer form. IF 1. The expression ratio was different in mouse retinas, where IF1 expression was found to exceed that of IF2. Irrespective of the relative expression levels of the two isoforms, an important point from our study is that significant levels of both isoforms were detected in both the NR (which represented the photoreceptor cells) and the RPE. This finding suggests that IF 1 and 1F2 of MYO7A are both likely to function in the RPE and in the photoreceptor cells, so that gene augmentation therapy attempts with a single isoform might be of limited success.

[0114] References

[0115] Adato, A., V. Michel, Y. Kikkawa, J. Reiners, K.N. Alagramam, D. Weil, H.

[0116] Yonekawa, U. Wolfrum, A. El-Amraoui, and C. Petit. 2005. Interactions in the network of Usher syndrome type 1 proteins. Hum Mol Genet. 14:347-356. Aparicio-Domingo, S., M. Flores-Bellver, H. Cobb, K.V. Li, B. Conrad, C. Chen, J.A. Brzezinski, and M.V. Canto-Soler. 2023. Generation of Three-Dimensional Retinal Tissue with Physiologically Competent, Light-Sensitive Photoreceptors from Human-Induced Pluripotent Stem Cells. In Brain Organoid Research. J. Gopalakrishnan, editor. Springer US, New York, NY. 99-119.

[0117] Arikawa, K., L.L. Molday, R.S. Molday. and D.S. Williams. 1992. Localization of peripherin / rds in the disk membranes of cone and rod photoreceptors: relationship to disk membrane morphogenesis and retinal degeneration. J Cell Biol. 116:659-667.

[0118] Berger, W., B. Kloeckener-Gruissem, and J. Neidhardt. 2010. The molecular basis of human retinal and vitreoretinal diseases. Prog Retin Eye Res. 29:335-375.

[0119] Brown. P.K.. l.R. Gibbons, and G. Wald. 1963. The Visual Cells and Visual Pigment of the Mudpuppy, Necturus. J Cell Biol. 19:79-106.

[0120] Buchholz, D.E., B.O. Pennington, R.H. Croze, C.R. Hinman, P.J. Coffey, and D.O. Clegg. 2013. Rapid and efficient directed differentiation of human pluripotent stem cells into retinal pigmented epithelium. Stem Cells Transl Med. 2:384- 393.

[0121] Burridge, P.W., S. Thompson, M.A. Millrod, S. Weinberg, X. Yuan, A. Peters, V. Mahairaki, V.E. Koliatsos, L. Tung, and E.T. Zambidis. 2011. A universal system for highly efficient cardiac differentiation of human induced pluripotent stem cells that eliminates interline variability. PLoS One. 6:el8293.

[0122] Calabro, K.R., S.L. Boye, S. Choudhury, D. Fajardo, J.J. Peterson, W. Li, S.M. Crosson, M.J. Kim, D. Ding, R. Salvi, S. Someya, and S.E. Boye. 2019. A Novel Mouse Model of MY07A USH1B Reveals Auditory and Visual System Haploinsufficiencies. Front Neurosci. 13: 1255.

[0123] Castiglione, A., and C. Moller. 2022. Usher Syndrome. Audio! Res. 12:42-65. Cehajic-Kapetanovic, J., K. Xue, C. Martinez-Fernandez de la Camara, A. Nanda, A. Davies, L.J. Wood, A.P. Salvetti, M.D. Fischer, J.W. Aylward, A.R. Barnard, J.K. Jolly, E. Luo, B.J. Lujan, T. Ong, A. Girach, G.C.M. Black, N.Z. Gregori, J.L. Davis. P R. Rosa. A.J. Lotery, B.L. Lam, P.E. Stanga. and R.E. MacLaren. 2020. Initial results from a first-in-human gene therapy trial on X- linked retinitis pigmentosa caused by mutations in RPGR. Nat Med. 26:354- 359.

[0124] Chishti, A.H., A.C. Kim, S.M. Marfatia, M. Lutchman, M. Hanspal, H. Jindal. S.C. Liu, P.S. Low, G.A. Rouleau, N. Mohandas, J.A. Chasis, J.G. Conboy, P. Gascard, Y. Takakuwa, S.C. Huang, E.J. Benz, Jr., A. Bretscher, R.G. Fehon, J.F. Gusella, V. Ramesh, F. Solomon, V.T. Marchesi, S. Tsukita, S. Tsukita, K B. Hoover, and et al. 1998. The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane. Trends Biochem Sci. 23:281-282.

[0125] Cideciyan, A.V., S.G. Jacobson, W.A. Beltran, A. Sumaroka, M. Swider, S. Iwabe, A.J. Roman. M.B. Olivares, S.B. Schwartz, A.M. Komaromy, W.W. Hauswirth, and G.D. Aguirre. 2013. Human retinal gene therapy for Leber congenital amaurosis shows advancing retinal degeneration despite enduring visual improvement. Proc Natl Acad Sci U SA. 110:E517-525.

[0126] Colella. P., A. Sommella, E. Marrocco, U. Di Vicino, E. Polishchuk, M.G. Garrido, M.W. Seeliger. R. Polishchuk, and A. Auricchio. 2013. Myosin7a deficiency results in reduced retinal activity which is improved by gene therapy. PloS one. 8:e72027.

[0127] El-Amraoui, A., I. Sahly, S. Picaud, J. Sahel, M. Abitbol, and C. Petit. 1996. Human Usher IB / mouse shaker-1 : the retinal phenotype discrepancy explained by the presence / absence of myosin VIIA in the photoreceptor cells. Hum Mol Genet. 5: 1171 -1178.

[0128] El-Amraoui, A., J.S. Schonn, P. Kussel-Andermann, S. Blanchard, C. Desnos, J.P. Henry , U. Wolfrum, F. Darchen, and C. Petit. 2002. MyRIP, a novel Rab effector, enables myosin Vila recruitment to retinal melanosomes. EMBO Rep. 3:463-470.

[0129] Esteve-Rudd. J., R.A. Hazim, T. Diemer. A.E. Paniagua, S. Volland, A. Umapathy, and D.S. Williams. 2018. Defective phagosome motility and degradation in cell nonautonomous RPE pathogenesis of a dominant macular degeneration. Proc Natl Acad Sci USA. 115:5468-5473.

[0130] Ferla. R., F. Dell'Aquila, M. Doria, M. Ferraiuolo, A. Noto, F. Grazioli, V. Ammendola, F. Testa. P. Melillo, C. lodice. G. Risca, N. Tedesco, P.R. le Brun, E.M. Surace, F. Simonelli, S. Galimberti, M.G. Valsecchi, J.B. Marteau, P. Veron, S. Colloca, and A. Auricchio. 2023. Efficacy, pharmacokinetics, and safety in the mouse and primate retina of dual AAV vectors for Usher syndrome type IB. Mol Ther Methods Clin Dev. 28:396-411.

[0131] Fischer, M.D.. S. Michalakis. B. Wilhelm. D. Zobor, R. Muehlfriedel. S. Kohl. N. Weisschuh, G.A. Ochakovski, R. Klein, C. Schoen, V. Sothilingam, M. Garcia-Garrido, L. Kuehlewein, N. Kahle, A. Wemer, D. Dauletbekov, F. Paquet-Durand. S. Tsang, P. Martus, T. Peters, M. Seeliger, K.U. Bartz- Schmidt, M. Ueffing. E. Zrenner, M. Biel, and B. Wissinger. 2020. Safety and Vision Outcomes of Subretinal Gene Therapy Targeting Cone Photoreceptors in Achromatopsia: A Nonrandomized Controlled Trial. JAMA Ophthalmol. 138:643-651.

[0132] Flores-Bellver, M., J. Mighty, S. Aparicio-Domingo, K.V. Li, C. Shi. J. Zhou. H. Cobb, P. McGrath, G. Michelis, P. Lenhart, G. Bilousova, S. HeisseL M.J. Rudy, C. Coughlan, A.E. Goodspeed, S.P. Becerra, S. Redenti, and M.V. Canto-Soler. 2021. Extracellular vesicles released by human retinal pigment epithelium mediate increased polarised secretion of drusen proteins in response to AMD stressors. J Extracell Vesicles. 10:el2165.

[0133] Fukuda, M., and T.S. Kuroda. 2002. Slac2-c (synaptotagmin-like protein homologue lacking C2 domains-c), a novel linker protein that interacts with Rab27, myosin Va / VIIa, and actin. J Biol Chem. 277:43096-43103. Futter, C.E., J.S. Ramalho, G.B. Jaissle, M.W. Seeliger, and M.C. Seabra. 2004. The role of Rab27a in the regulation of melanosome distribution within retinal pigment epithelial cells. Mol Biol Cell. 15:2264-2275.

[0134] Gibbs, D., S.M. Azarian, C. Lillo, J. Kitamoto. A.E. Klomp, K.P. Steel, R.T. Libby, and D.S. Williams. 2004. Role of myosin Vila and Rab27a in the motility and localization of RPE melanosomes. J Cell Sci. 117:6473-6483.

[0135] Gibbs, D., T. Diemer, K. Khanobdee, J. Hu. D. Bok. and D.S. Williams. 2010. Function of MY07A in the human RPE and the validity of shakerl mice as a model for Usher syndrome IB. Invest Ophthalmol Vis Sci. 51 : 1130-1135.

[0136] Gibbs, D., J. Kitamoto, and D.S. Williams. 2003. Abnormal phagocytosis by retinal pigmented epithelium that lacks myosin Vila, the Usher syndrome IB protein. Proc Natl Acad Sci USA. 100:6481-6486.

[0137] Gordiyenko, N.V.. R.N. Fariss, C. Zhi. and l.M. MacDonald. 2010. Silencing of the CHM gene alters phagocytic and secretory pathways in the retinal pigment epithelium. Investigative ophthalmology & visual science. 51 :1143-1150.

[0138] Hashimoto. T., D. Gibbs, C. Lillo, S.M. Azarian, E. Legacki, X.M. Zhang, X.J. Yang, and D.S. Williams. 2007. Lentiviral gene replacement therapy of retinas in a mouse model for Usher syndrome type IB. Gene therapy. 14:584-594.

[0139] Hasson, T. 2000. Personal Communication.

[0140] Hasson, T., M B. Heintzelman, J. Santos-Sacchi, D.P. Corey, and M.S. Mooseker. 1995. Expression in cochlea and retina of myosin Vila, the gene product defective in Usher syndrome type IB. Proc. Natl. Acad. Sci. USA. 92:9815- 9819.

[0141] Hazim, R.A., S. Karumbayaram, M. Jiang, A. Dimashkie, V.S. Lopes, D. Li, B.L. Burgess, P. Vijayaraj, J.A. Alva-Ornelas, J.A. Zack. D.B. Kohn, B.N. Gomperts, A.D. Pyle, W.E. Lowry, and D.S. Williams. 2017. Differentiation of RPE cells from integration-free iPS cells and their cell biological characterization. Stem Cell Res Ther. 8:217. Hazim, R.A., A.E. Paniagua, L. Tang, K. Yang, K.K.O. Kim, L. Stiles, A.S. Divakaruni, and D.S. Williams. 2022. Vitamin B3, nicotinamide, enhances mitochondrial metabolism to promote differentiation of the retinal pigment epithelium. J Biol Chem. 298: 102286.

[0142] Hazim, R.A., S. Volland, A. Yen, B.L. Burgess, and D.S. Williams. 2019. Rapid differentiation of the human RPE cell line, ARPE-19, induced by nicotinamide. Exp Eye Res. 179: 18-24.

[0143] Hogan, M.J., J. A. Alvarado, and J.E. Weddell. 1971. Histology of the human eye: An atlas and textbook. Saunders.

[0144] Jacobson, S.G., A.V. Cideciyan, T.S. Aleman, A. Sumaroka, A.J. Roman, L.M. Gardner, H.M. Prosser, M. Mishra, N.T. Bech-Hansen, W. Herrera, S.B. Schwartz. X.Z. Liu, W.J. Kimberling, K.P. Steel, and D.S. Williams. 2008. Usher syndromes due to MY07A, PCDH15, USH2A or GPR98 mutations share retinal disease mechanism. Human molecular genetics. 17:2405-2415.

[0145] Jiang, M., J. Esteve-Rudd, V.S. Lopes, T. Diemer, C. Lillo, A. Rump, and D.S. Williams. 2015. Microtubule motors transport phagosomes in the RPE, and lack of KLC1 leads to AMD-like pathogenesis. J Cell Biol. 210:595-611.

[0146] Kessel, R.G., and R.H. Kardon. 1979. Nervous tissue - eye and ear. In A text atlas of scanning electron microscopy. R.G. Kessel, editor. W.H. Freeman, San Francisco.

[0147] Klomp. A.E., K. Teofilo. E. Legacki, and D.S. Williams. 2007. Analysis of the linkage of MYRIP and MY07A to melanosomes by RAB27A in retinal pigment epithelial cells. Cell Motil Cytoskeleton. 64:474-487.

[0148] Krock, B.L., J. Bilotta, and B.D. Perkins. 2007. Noncell-autonomous photoreceptor degeneration in a zebrafish model of choroideremia. Proc Nall Acad Sci U S A. 104:4600-4605.

[0149] Libby, R.T., and K.P. Steel. 2001. Electroretinographic anomalies in mice with mutations in Myo7a, the gene involved in human Usher syndrome type IB. Invest Ophthalmol Vis Sci. 42:770-778. Liu, X., B. Ondek, and D.S. Williams. 1998. Mutant myosin Vila causes defective melanosome distribution in the RPE of shaker-1 mice. Nat. Genet. 19: 117- 118.

[0150] Liu, X., I.P. Udovichenko. S.D. Brown. K.P. Steel, and D.S. Williams. 1999. Myosin Vila participates in opsin transport through the photoreceptor cilium. .7 Neurosci. 19:6267-6274.

[0151] Liu, X., G. Vansant, I.P. Udovichenko, U. Wolfrum, and D.S. Williams. 1997. Myosin Vila, the product of the Usher IB syndrome gene, is concentrated in the connecting cilia of photoreceptor cells. Cell Motil Cytoskeleton. 37:240- 252.

[0152] Lopes, V.S., S.E. Boye, C.M. Louie, S. Boye, F. Dyka, V. Chiodo, H. Fofo, W.W. Hauswirth, and D.S. Williams. 2013. Retinal gene therapy with a large MYO7A cDNA using adeno-associated virus. Gene therapy. 20:824-833.

[0153] Lopes, V.S., D. Gibbs, R.T. Libby, T.S. Aleman, D.L. Welch, C. Lillo, S.G. Jacobson, R.A. Radu, K.P. Steel, and D.S. Williams. 2011. The Usher IB protein, MY07A, is required for normal localization and function of the visual retinoid cycle enzyme, RPE65. Hum Mol Genet.

[0154] Lopes, V.S., J.S. Ramalho, D.M. Owen, M.O. Karl, O. Strauss, C.E. Futter, and M.C. Seabra. 2007. The ternary Rab27a-Myrip-Myosin Vila complex regulates melanosome motility in the retinal pigment epithelium. Traffic. 8:486-499.

[0155] Rakoczy, E.P., A.L. Magno. C.M. Lai, C.M. Pierce, M.A. Degli-Esposti, M.S. Blumenkranz, and I. J. Constable. 2019. Three-Year Follow-Up of Phase 1 and 2a rAAV.sFLT-1 Subretinal Gene Therapy Trials for Exudative Age-Related Macular Degeneration. Am J Ophthalmol. 204: 113-123.

[0156] Rakoczy, P.E., D. Zhang, T. Robertson, N.L. Barnett, J. Papadimitriou. I.J. Constable, and C.M. Lai. 2002. Progressive age-related changes similar to age-related macular degeneration in a transgenic mouse model. Am J Pathol. 161 :1515- 1524. Reiners, J., E. van Wijk, T. Marker, U. Zimmermann, K. Jurgens, H. te Brinke, N. Overlack, R. Roepman, M. Knipper, H. Kremer, and U. Wolfrum. 2005. Scaffold protein harmonin (USH1C) provides molecular links between Usher syndrome type 1 and type 2. Hum Mol Genet. 14:3933-3943.

[0157] Sahly, I., E. Dufour, C. Schietroma, V. Michel, A. Bahloul, I. Perfettini, E. Pepermans, A. Estivalet, D. Carette, A. Aghaie, I. Ebermann, A. Lelli, M. Iribame, J.P. Hardelin, D. Weil, J.A. Sahel, A. El-Amraoui, and C. Petit. 2012. Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice. J Cell Biol. 199:381-399.

[0158] Schietroma, C., K. Parain, A. Estivalet, A. Aghaie, J. Boutet de Monvel, S. Picaud, J.A. Sahel, M. Perron, A. El-Amraoui, and C. Petit. 2017. Usher syndrome type 1 -associated cadherins shape the photoreceptor outer segment. J Cell Biol. 216: 1849-1864.

[0159] Schwander, M., V. Lopes, A. Sczaniecka, D. Gibbs, C. Lillo, D. Delano, L.M. Tarantino, T. Wiltshire, D.S. Williams, and U. Muller. 2009. A novel allele of myosin Vila reveals a critical function for the C-terminal FERM domain for melanosome transport in retinal pigment epithelial cells. J Neurosci. 29: 15810-15818.

[0160] Sorusch, N., A. Yildirim, B. Knapp, J. Janson, W. Fleck, C. Scharf, and U. Wolfrum. 2019. SANS (USH1G) Molecularly Links the Human Usher Syndrome Protein Network to the Intraflagellar Transport Module by Direct Binding to IFT-B Proteins. Front Cell Dev Biol. 7:216.

[0161] Steinberg, R.H., S.K. Fisher, and D.H. Anderson. 1980. Disc morphogenesis in vertebrate photoreceptors. J. Comp. Neurol. 190:501-508.

[0162] Trapani, L, P. Colella, A. Sommella, C. lodice. G. Cesi, S. de Simone, E. Marrocco, S. Rossi, M. Giunti. A. Palfi, G.J. Farrar, R. Polishchuk, and A. Auricchio. 2014. Effective delivery of large genes to the retina by dual AAV vectors. EMBO molecular medicine. 6: 194-211. Udovichenko, I.P., D. Gibbs, and D.S. Williams. 2002. Actin-based motor properties of native myosin Vila. J Cell Sci. 115:445-450.

[0163] Volland, S., L.C. Hughes, C. Kong, B.L. Burgess. K.A. Linberg, G. Luna, Z.H. Zhou, S.K. Fisher, and D.S. Williams. 2015. Three-dimensional organization of nascent rod outer segment disk membranes. Proc Natl Acad Sci US A.

[0164] Weil, D., S. Blanchard, J. Kaplan, P. Guilford, F. Gibson, J. Walsh, P. Mburu, A. Varela, J. Levilliers, M.D. Weston, P.M. Kelley, W.J. Kimberling, M. Wagenaar, F. Levi-Acobas, D. Larget-PieL A. Munnich, K.P. Steel, S.D.M. Brown, and C. Petit. 1995. Defective myosin VIIA gene responsible for Usher syndrome type IB. Nature. 374:60-61.

[0165] Weil, D., A. ELAmraoui, S. Masmoudi, M. Mustapha, Y. Kikkawa, S. Laine, S. Delmaghani, A. Adato, S. Nadifi, B.Z. Zina, C. Hamel, A. Gal, H. Ayadi. H. Yonekawa. and C. Petit. 2003. Usher syndrome type 1 G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Human Mol Genet. 12:463-471.

[0166] Weil, D., G. Levy, I. Sahly, F. Levi-Acobas, S. Blanchard, A. ELAmraoui, F. Crozet, H. Philippe, M. Abitbol, and C. Petit. 1996. Human myosin VIIA responsible for the Usher IB syndrome: a predicted membrane-associated motor protein expressed in developing sensory epithelia. Proc Natl Acad Sci U SA. 93:3232- 3237.

[0167] Williams, D.S., A. Chadha, R. Hazim, and D. Gibbs. 2017. Gene therapy approaches for prevention of retinal degeneration in Usher syndrome. Gene Ther. 24:68- 71.

[0168] Williams, D.S., K.A. Linberg, D.K. Vaughan, R.N. Fariss, and S.K. Fisher. 1988. Disruption of microfilament organization and deregulation of disk membrane morphogenesis by cytochalasin D in rod and cone photoreceptors. J Comp Neurol. 272: 161 -176.

[0169] Williams, D.S., and V.S. Lopes. 2011. The many different cellular functions of MYO7A in the retina. Biochemical Society’ transactions . 39: 1207-1210. Wolfrum, U., and A. Schmitt. 2000. Rhodopsin transport in the membrane of the connecting cilium of mammalian photoreceptor cells. Cell Motil Cytoskeleton. 46:95-107.

[0170] Yu-Wai-Man, P.. N.J. Newman. V. Carelli, M.L. Moster. V. Biousse, A.A. Sadun, T.

[0171] Klopstock, C. Vignal-Clermont, R.C. Sergott, G. Rudolph, C. La Morgia, R. Karanjia, M. Taiel, L. Blouin, P. Burguiere, G. Smits, C. Chevalier, H. Masonson, Y. Salermo, B. Katz, S. Picaud, D.J. Calkins, and J. A. Sahel. 2020. Bilateral visual improvement with unilateral gene therapy injection for Leber hereditary optic neuropathy. Sci Tr ansi Med. 12.

[0172] Zhong, X., C. Gutierrez, T. Xue, C. Hampton, M.N. Vergara, L.H. Cao, A. Peters, T.S. Park, E.T. Zambidis, J.S. Meyer, D.M. Gamm, K.W. Yau, and M.V. Canto-Soler. 2014. Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCs. Nat Commun. 5:4047.

[0173] Illustrative MYO7A sequence of the invention: atggtgattcttcagcagggggaccatgtgtggatggacctgagattggggcaggagttcgacgtgcccatcggggcggtggtgaag ctctgcgactctgggcaggtccaggtggtggatgatgaagacaatgaacactggatctctccgcagaacgcaacgcacatcaagccta tgcaccccacgtcggtccacggcgtggaggacatgatccgcctgggggacctcaacgaggcgggcatcttgcgcaacctgcttatcc gctaccgggaccacctcatctacacgtatacgggctccatcctggtggctgtgaacccctaccagctgctctccatctactcgccagag cacatccgccagtataccaacaagaagattggggagatgcccccccacatctttgccattgctgacaactgctacttcaacatgaaacg caacagccgagaccagtgctgcatcatcagtggggaatctggggccgggaagacggagagcacaaagctgatcctgcagttcctgg cagccatcagtgggcagcactcgtggattgagcagcaggtcttggaggccacccccattctggaagcatttgggaatgccaagaccat ccgcaatgacaactcaagccgtttcggaaagtacatcgacatccacttcaacaagcggggcgccatcgagggcgcgaagattgagca gtacctgctggaaaagtcacgtgtctgtcgccaggccctggatgaaaggaactaccacgtgttctactgcatgctggagggtatgagtg aggatcagaagaagaagctgggcttgggccaggcctctgactacaactacttggccatgggtaactgcataacctgtgagggccggg tggacagccaggagtacgccaacatccgctccgccatgaaggtgctcatgttcactgacaccgagaactgggagatctcgaagctcct ggctgccatcctgcacctgggcaacctgcagtatgaggcacgcacatttgaaaacctggatgcctgtgaggttctcttctccccatcgct ggccacagctgcatccctgcttgaggtgaaccccccagacctgatgagctgcctgactagccgcaccctcatcacccgcggggagac ggtgtccaccccactgagcagggaacaggcactggacgtgcgcgacgccttcgtaaaggggatctacgggcggctgttcgtgtggat tgtggacaagatcaacgcagcaattacaagcctccctcccaggatgtgaagaactctegcaggtccatcggcctcctggacatctttg ggttgagaactttgctgtgaacagctttgagcagctctgcatcaacttcgccaatgagcacctgcagcagttcttgtgcggcacgtgttc aagctggagcaggaggaatatgacctggagagcattgactggctgcacatcgagttcactgacaaccaggatgccctggacatgattg ccaacaagcccatgaacatcatctccctcatcgatgaggagagcaagttccccaagggcacagacaccaccatgttacacaagctga actcccagcacaagctcaacgccaactacatcccccccaagaacaaccatgagacccagtttggcatcaaccattttgcaggcatcgtc tactatgagacccaaggcttcctggagaagaaccgagacaccctgcatggggacattatccagctggtccactcctccaggaacaagt tcatcaagcagatcttccaggccgatgtcgccatgggcgccgagaccaggaagcgctcgcccacacttagcagccagttcaagcggt cactggagctgctgatgcgcacgctgggtgcctgccagcccttctttgtgcgatgcatcaagcccaatgagttcaagaagcccatgctg ttcgaccggcacctgtgcgtgcgccagctgcggtactcaggaatgatggagaccatccgaatccgccgagctggctaccccatccgc tacagcttcgtagagttgtggagcggtaccgtgtgctgctgccaggtgtgaagccggcctacaagcagggcgacctccgcgggactt gccagcgcatggctgaggctgtgctgggcacccacgatgactggcagataggcaaaaccaagatctttctgaaggaccaccatgaca tgctgctggaagtggagcgggacaaagccatcaccgacagagtcatcctccttcagaaagtcatccggggattcaaagacaggtctaa ctttctgaagctgaagaacgctgccacactgatccagaggcactggcggggtcacaactgtaggaagaactacgggctgatgcgtctg ggcttcctgcggctgcaggccctgcaccgctcccggaagctgcaccagcagtaccgcctggcccgccagcgcatcatccagttcca ggcccgctgccgcgcctatctggtgcgcaaggccttccgccaccgcctctgggctgtgctcaccgtgcaggcctatgcccggggcat gatcgcccgcaggctgcaccaacgcctcagggctgagtatctgtggcgcctcgaggctgagaaaatgcggctggcggaggaagag aagcttcggaaggagatgagcgccaagaaggccaaggaggaggccgagcgcaagcatcaggagcgcctggcccagctggctcgt gaggacgctgagcgggagctgaaggagaaggaggccgctcggcggaagaaggagctcctggagcagatggaaagggcccgcc atgagcctgtcaatcactcagacatggtggacaagatgtttggcttcctggggacttcaggtggcctgccaggccaggagggccaggc acctagtggctttgaggacctggagcgagggcggagggagatggtggaggaggacctggatgcagccctgcccctgcctgacgag gatgaggaggacctctctgagtataaatttgccaagttcgcggccacctacttccaggggacaaccacgcactcctacacccggcggc cactcaaacagccactgctctaccatgacgacgagggtgaccagctggcagccctggcggtctggatcaccatcctccgcttcatggg ggacctccctgagcccaagtaccacacagccatgagtgatggcagtgagaagatccctgtgatgaccaagatttatgagaccctgggc aagaagacgtacaagagggagctgcaggccctgcagggcgagggcgaggcccagctccccgagggccagaagaagagcagtgt gaggcacaagctggtgcatttgactctgaaaaagaagtccaagctcacagaggaggtgaccaagaggctgcatgacggggagtcca cagtgcagggcaacagcatgctggaggaccggcccacctccaacctggagaagctgcacttcatcatcggcaatggcatcctgcgg ccagcactccgggacgagatctactgccagatcagcaagcagctgacccacaacccctccaagagcagctatgcccggggctggat tctcgtgtctctctgcgtgggctgtttcgccccctccgagaagtttgtcaagtacctgcggaacttcatccacgggggcccgcccggcta cgccccgtactgtgaggagcgcctgagaaggacctttgtcaatgggacacggacacagccgcccagctggctggagctgcaggcc accaagtccaagaagccaatcatgttgcccgtgacattcatggatgggaccaccaagaccctgctgacggactcggcaaccacggcc aaggagctctgcaacgcgctggccgacaagatctctctcaaggaccggttcgggttctccctctacattgccctgtttgacaaggtgtcc tccctgggcagcggcagtgaccacgtcatggacgccatctcccagtgcgagcagtacgccaaggagcagggcgcccaggagcgc aacgccccctggaggctctcttccgcaaagaggtcttcacgccctggcacagcccctccgaggacaacgtggccaccaacctcatct accagcaggtggtgcgaggagtcaagtttggggagtacaggtgtgagaaggaggacgacctggctgagctggcctcccagcagtac ttgtagactatggctctgagatgatcctggagcgcctcctgaacctcgtgcccacctacatccccgaccgcgagatcacgcccctgaa gacgctggagaagtgggcccagctggccatcgccgcccacaagaaggggatttatgcccagaggagaactgatgcccagaaggtc aaagaggatgtggtcagttatgcccgcttcaagtggcccttgctcttctccaggttttatgaagcctacaaattctcaggccccagtctccc caagaacgacgtcatcgtggccgtcaactggacgggtgtgtactttgtggatgagcaggagcaggtacttctggagctgtccttcccag agatcatggccgtgtccagcagcaggtgaggaggcccgcatggagatgcagacagacagaggggaaggagaggggctggagctt ccctgcgggtcacaggaagtgaagaggcatgaagtggcctgcctggttgcacgtgattgggcagtttgtgccgcactgtgcagaccc ctctggcacctcctagtggagggatgggcttgggctttacagcacattaaggctgttctgagacaggaatgggctgtcaggacaggca ggggcaggtgagtgtgtacaaaagagcttgacctgggggttcaggggactgagtagcactcactctatgtcttcattcctaaaacagga gtcttaatacttttctcgcataacagtggtggggaatgaatgcaataatagatgggagagctctttataaactgcaaagtgcagtgcacata ggtggaatggtggggtgggttgctgggattgactggctttcccagcagtgcagtggctccctcctccaccatctggggcttgtagcagt gtctttgggttgtgtctgatatgggctggagtcagactgtgtccagcactgaccagacacatgccaggcacacaggatgcagtagtgac aagatagtccttgtcctcttggatcttcagtcaagagaggagacagacattgaataggccattttaaagcatggtatgatcagggctgtgg gagggcagggaggacttcctggaggaagtggcatgtaggttgagatttaaagggtgagtaggaattagacaggcaaaggagaagta ggccgggccactgtgggtctccctctgggccatgcctgactctggccaggccagctctgacttagcctgagatgtgtctgagctgggc cacgtctcccactggttggggcatgactgactcaactggccttgatctccttcagggagtgccgtgtctggctctcactgggctgctctga tcttggctgtgctgcgcctcactcaggctgggcaggactgaccccggcggggccctgttctccgtgttggtcctgcaggggagcgaaa acgacggcccccagcttcacgctggccaccatcaagggggacgaatacaccttcacctccagcaatgctgaggacattcgtgacctg gtggtcaccttcctagaggggctccggaagagatctaagtatgttgtggccctgcaggataaccccaaccccgcaggcgaggagtca ggcttcctcagctttgccaagggagacctcatcatcctggaccatgacacgggcgagcaggtcatgaactcgggctgggccaacggc atcaatgagaggaccaagcagcgtggggacttccccaccgacagtgtgtacgtcatgcccactgtcaccatgccaccgcgggagatt gtggccctggtcaccatgactcccgatcagaggcaggacgttgtccggctcttgcagctgcgaacggcggagcccgaggtgcgtgc caagccctacacgctggaggagtttcctatgactacttcaggcccccacccaagcacacgctgagccgtgtcatggtgtccaaggcc cgaggcaaggaccggctgtggagccacacgcgggaaccgctcaagcaggcgctgctcaagaagctcctgggcagtgaggagctc tcgcaggaggcctgcctggccttcattgctgtgctcaagtacatgggcgactacccgtccaagaggacacgctccgtcaacgagctca ccgaccagatctttgagggtcccctgaaagccgagcccctgaaggacgaggcatatgtgcagatcctgaagcagctgaccgacaac cacatcaggtacagcgaggagcggggttgggagctgctctggctgtgcacgggcctttcccacccagcaacatcctcctgccccac gtgcagcgcttcctgcagtcccgaaagcactgcccactcgccatcgactgcctgcaacggctccagaaagccctgagaaacgggtcc cggaagtaccctccgcacctggtggaggtggaggccatccagcacaagaccacccagattttccacaaagtctactccctgatgaca ctgacgaggcctcgaagtggagtccagcaccaaggccaaggacttctgccagaacatcgccaccaggctgctcctcaagtcctcag agggatcagcctcttgtcaaaattgcagacaaggtcctcagcgttcctgagaatgacttcttctttgacttgttcgacactgacagact ggataaagaaagctcggcccatcaaggacggaattgtgccctcactcacctaccaggtgttcttcatgaagaagctgtggaccaccac ggtgccagggaaggatcccatggccgatccatctccactattaccaggagttgcccaagtatctccgaggctaccacaagtgcacgc gggaggaggtgctgcagctgggggcgctgatctacagggtcaagttcgaggaggacaagtcctacttccccagcatccccaagctg ctgcgggagctggtgccccaggaccttatccggcaggtctcacctgatgactggaagcggtccatcgtcgcctacttcaacaagcacg cagggaagtccaaggaggaggccaagctggccttcctgaagctcatcttcaagtggcccacctttggctcagccttcttcgaggtgaa gcaaactacggagccaaacttccctgagatcctcctaattgccatcaacaagtatggggtcagcctcatcgatcccaaaacgaaggata tcctcaccactcatcccttcaccaagatctccaactggagcagcggcaacacctacttccacatcaccattgggaacttggtgcgcggg agcaaactgctctgcgagacgtcactgggctacaagatggatgacctcctgacttcctacattagccagatgctcacagccatgagcaa acagcggggctccaggagcggcaagtgagatggatgacctcctgacttcctacattagccagatgctcacagccatgagcaaacagc ggggctccaggagcggcaagtga (SEQ ID NO: 1)

[0174] CONCLUSION This concludes the description of embodiments of the present invention. The foregoing description of one or more embodiments of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Many modifications and variations are possible in light of the above teaching.

Claims

CLAIMS:

1. A vector comprising a promoter in operable linkage with a polynucleotide sequence encoding human MY07A polypeptides, wherein when transduced into human retinal cells, the polynucleotide sequence expresses multiple polypeptide isoforms of myosin Vila.

2. The vector of claim 1, wherein the vector comprises a cDNA encoding a polypeptide isoform of myosin Vila, in combination with a preceding intron of an exon encoding the isoform.

3. The vector of claim 1, wherein the MY07A polypeptide isoforms comprise IFland IF2.

4. The vector of claim 1, wherein the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms comprises SEQ ID NO: 1.

5. The vector of claim 1, wherein the vector is a lentiviral vector or an adeno associated viral vector.

6. The lentiviral vector of claim 1, wherein the promoter is a CMV promoter.

7. The lentiviral vector of claim 1, wherein the vector is disposed within a human retinal cell.

8. A method of making a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding MY07A, the method comprising disposing a polynucleotide sequence encoding MY07A within the vector, wherein the polynucleotide sequence encoding MY07A is selected so that when transduced into human retinal cells, the polynucleotide sequence expresses multiple polypeptide isoforms of myosin Vila.

9. The method of claim 8, wherein the vector is formed to comprise a cDNA encoding a polypeptide isoform of myosin Vila, in combination with a preceding intron of an exon encoding the isoform.

10. The method of claim 8, wherein the vector is formed to comprise the MY07A polypeptide isoforms comprise IF1 and IF2.

11. The method of claim 8, wherein the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms is selected to comprise SEQ ID NO: 1.

12. The method of claim 8, wherein the vector is a lentiviral vector or an adeno associated viral vector.

13. The method of claim 8, wherein the promoter is a CMV promoter.

14. A method for the treatment or amelioration of an ocular disease, comprising delivering to target cells in at least one eye of a subject in need of said treatment, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding a plurality of human myosin Vila (MY07A) polypeptide isoforms, wherein the plurality of MY07A polypeptide isoforms are expressed in said target cells, thereby treating ocular disease in said subject.

15. The method of claim 14 wherein the polynucleotide sequence comprises intron 34 of the myosin Vila gene.

16. The method of claim 14, wherein the MY07A polypeptide isoforms comprise IF land IF2.

17. The method of claim 15, wherein the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms comprises SEQ ID NO: 1.

18. A method for treatment or amelioration of blindness due to Usher IB syndrome in a subject, comprising delivering to target cells in at least one eye of the subject, a vector comprising a promoter in operable linkage with a polynucleotide sequence encoding a plurality of myosin Vila (MY07A) polypeptide isoforms, wherein the plurality of MY07A polypeptide isoforms are expressed in said target cells thereby treating blindness in said subject.

19. The method of claim 18, wherein the MY07A polypeptide isoforms comprise IFland IF2.

20. The method of claim 19, wherein the polynucleotide sequence encoding a plurality of MY07A polypeptide isoforms comprises SEQ ID NO: 1.

Images