Functional nucleic acid

EP4758251A1Pending Publication Date: 2026-06-17HARNESS THERAPEUTICS LTD

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
HARNESS THERAPEUTICS LTD
Filing Date
2024-08-09
Publication Date
2026-06-17

AI Technical Summary

Technical Problem

Current therapeutic interventions for Huntington's disease (HD) and other triplet repeat disorders are limited, with no effective disease-modifying treatments available to address the progression and onset of these diseases.

Method used

Development of functional nucleic acid molecules that target the 3’ UTR of the Fan1 mRNA, specifically designed to relieve the repressive effect of miR-124-3p, thereby increasing Fan1 protein expression and potentially modulating the progression of triplet repeat disorders.

Benefits of technology

The functional nucleic acid molecules effectively increase Fan1 protein expression, which has been associated with delayed onset and progression of HD, offering a potential disease-modifying approach for triplet repeat disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000033_0001
    Figure IMGF000033_0001
  • Figure IMGF000034_0001
    Figure IMGF000034_0001
  • Figure IMGF000035_0001
    Figure IMGF000035_0001
Patent Text Reader

Abstract

The present invention relates to functional nucleic acids that target FAN1 mRNA, or miRNAs that bind to FAN1 mRNAs, and thereby relieve microRNA mediated repression of FAN1. The invention also encompasses methods of enhancing FAN1 protein expression, and methods of treating or ameliorating diseases or disorders associated with FAN1, such as triplet expansion disorders, including those of the polyglutamine family of disorders, using the functional nucleic acids of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] FUNCTIONAL NUCLEIC ACID

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to functional nucleic acids that target FAN1 mRNA, or miRNAs that bind to FAN1 mRNAs, and thereby relieve microRNA-mediated repression of FAN1. The invention also encompasses methods of enhancing FAN1 protein expression, and methods of treating or ameliorating diseases or disorders associated with FAN1, such as triplet expansion disorders, using the functional nucleic acids of the invention.

[0004] BACKGROUND OF THE INVENTION

[0005] Triplet, or trinucleotide, repeat disorders are a large group of human diseases that result from the expansion of repetitive trinucleotide sequences within the genome, which gives rise to a disease-specific tandem repeat tract. These diseases are typically neurological and vary in terms of the genomic location of the repeat tract, symptomology, and stage of development in which they occur.

[0006] Expansion of these triplet repeats ultimately gives rise to aberrant proteins, which can result in either gain- or loss of function mutations. The number of triplet repeats is typically associated with the age at onset (AAO) of disease, with a greater expansion of the repeat sequences corresponding to an earlier AAO.

[0007] One family of triplet repeat disorders is the polyglutamine (polyQ) disease family, which consists of a group of hereditary neurological diseases that are linked to the expansion of a triplet ‘CAG’ repeat. Further disorders are associated with: the expansion of ‘OGG’ repeats, such as fragile X-related disorders (FXDs); ‘CTG’ repeats, such as myotonic dystrophy type 1 ; ‘GAA’ repeats, such as Friedreich ataxia; ‘GCC’ repeats, such as FRAXE mental retardation; and ‘GOG’ repeats, such as oculopharyngeal muscular dystrophy.

[0008] The polyglutamine group comprises disorders that are amongst the most common inherited neurological diseases and includes a number of Spinocerebellar Ataxias (e.g., Type 1 (SCA1), Type 2 (SCA2), Type 3 (SCA3), 6 (SCA6), Type 7 (SCA7), and Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy X-linked 1 (SMAX1 / SBMA), and Huntington’s disease (HD). Huntington's disease (HD) is an autosomal dominant, inherited, degenerative neurological disease caused by an expanded CAG trinucleotide repeat in the huntingtin gene. HD causes a spectrum of cognitive, movement and psychiatric disorders, which are associated with variety of symptoms.

[0009] The onset of symptoms of HD often varies greatly between individuals. Both the CAG repeat length and genetic variation at other locations within the genome are known to affect age of disease onset. Indeed, genome-wide association studies (GWAS) have identified a number of single nucleotide polymorphisms (SNPs) that are associated with modulating the age of onset of HD symptoms.

[0010] Several of the identified SNPs identified map to chromosome 15 and are linked to the Fan1 gene. Fan1 encodes the protein FAN1 (FANCD2 / FANCI-associated nuclease 1), an enzyme possessing both endo- and exo-nuclease activity that is important in DNA interstrand crosslink repair.

[0011] Increased FAN1 expression has been shown in model systems to limit somatic CAG repeat expansion and is associated with delayed HD onset and progression, whilst Fan1 knockdown increases CAG repeat expansion (Goold R, et al., FAN1 modifies Huntington's disease progression by stabilizing the expanded HTT CAG repeat. Hum Mol Genet. 2019 Feb 15;28(4):650-661. doi: 10.1093 / hmg / ddy375. PMID: 30358836; PMCID: PMC6360275). FAN1 is thus implicated in modulating HD onset and progression; McAllister B, et al.,. Exome sequencing of individuals with Huntington's disease implicates FAN1 nuclease activity in slowing CAG expansion and disease onset. Nat Neurosci. 2022 Apr;25(4):446- 457. doi: 10.1038 / s41593-022-01033-5. Epub 2022 Apr 4. PMID: 35379994; PMCID: PMC8986535).

[0012] A SNP that has been identified that is associated with delayed onset of HD motor dysfunction is rs3512. rs3512 maps to the 3’-UTR (exon 15) of the Fan1 gene, which is also within an intron of the MTMR10 gene encoded on the antisense strand. Expression quantitative trait loci (eQTL) transcriptomic analyses have revealed that rs3512 is associated with increased expression of the Fan1 gene (Genetic Modifiers of Huntington’s Disease (GeM-HD) Consortium. Identification of Genetic Factors that Modify Clinical Onset of Huntington's Disease. Cell. 2015 Jul 30;162(3):516-26. doi: 10.1016 / j.cell.2015.07.003. PMID: 26232222; PMCID: PMC4524551), suggesting that rs3512 delays HD onset by impacting a regulatory mechanism inhibiting Fan1 expression. Gene regulatory mechanisms are diverse and complex. One group of regulatory mechanisms is mediated by microRNAs (miRNAs). miRNAs are short non-coding RNAs that are expressed within a cell that are able to negatively regulate target gene expression at the mRNA level through their ability to bind to the 3’-UTR of specific target mRNAs and thereby either repress translation initiation / elongation or trigger mRNA decay.

[0013] HD is associated with debilitating symptoms that worsen over an individual’s lifetime until their premature death. Despite being a well-known disease, a paucity of therapeutic interventions exist for the control of disease onset and progression. Further, there is a general lack of any disease-modifying interventions for both HD and triplet repeat diseases more widely.

[0014] The aim of the invention is to provide target specific functional nucleic acids that can function as disease-modifying agents in the treatment and prevention of triplet repeat diseases, especially HD.

[0015] SUMMARY OF THE INVENTION

[0016] The present inventors sought to develop functional nucleic acid molecules that may function as disease-modifying agents for triplet repeat diseases. In particular, HD.

[0017] Fan1 is implicated both in HD, in the wider polyQ family of diseases, and further in triplet repeat disorders associated with the expansion of other motifs. As such, the present inventors conducted a literature and database search in order to identify regulatory pathways involved in the control of Fan1.

[0018] The present inventors have identified a microRNA, miR-124-3p, which targets Fan1. Interestingly, the binding site of miR-124-3p, which is located in the Fan1 3’-UTR is altered in rs3512-bearing HD patients, who exhibit delayed onset of HD motor dysfunction.

[0019] Together, these observations suggest that increased expression of Fan1 in rs3512-bearing HD patients is linked to loss of miR-124-3p-mediated Fan1 repression. As such, the present inventors sought to replicate the naturally observed repressive effect of the rs3512 SNP by designing functional nucleic acid molecules that are able to relieve the repressive effect of miR-124-3p upon Fan1 and thereby act as disease-modulators in the triplet expansion disorders with which Fan1 is associated.

[0020] In a first aspect, provided herein is a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0021] In an aspect, there is provided a conjugate comprising the functional nucleic acid molecule of the invention and one or more moieties covalently bound to said functional nucleic acid molecule.

[0022] In an aspect, there is provided a pharmaceutically acceptable salt of the functional nucleic acid molecule or the conjugate of the invention.

[0023] In an aspect, there is provided a composition comprising the functional nucleic acid molecule, the conjugate, or the pharmaceutically acceptable salt of the invention, and a diluent, solvent, carrier, salt and / or adjuvant.

[0024] In an aspect, there is provided a pharmaceutical composition comprising the functional nucleic acid molecule, the conjugate, or the pharmaceutically acceptable salt of the invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0025] In another aspect, there is provided an in vivo or in vitro method for modulating Fan1 protein expression in a target cell in which Fan1 and the microRNA miR-124-3p are present, the method comprising the steps of exposing the cell to the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0026] In a further aspect, there is provided a method of treating, preventing, or delaying the onset of a disease associated with Fan1 protein in a subject, comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention. In an aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in medicine.

[0027] In an aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a triplet repeat expansion disease.

[0028] In an aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament for the treatment, prevention, or delay of a triplet repeat expansion disease.

[0029] In some embodiments of the invention according to the foregoing methods and uses, the disease is a polyglutamine (polyQ) disease, wherein the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3),

[0030] Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7),

[0031] Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

[0032] In one embodiment the disease is Huntington’s disease (HD).

[0033] BRIEF DESCRIPTION OF THE FIGURES

[0034] Figure 1 - An miR-124-3p mimic downregulated Fan1 mRNA

[0035] Transfection of an oligonucleotide mimic of miR-124-3p results in the downregulation of Fan1 mRNA (Figure 1A). Figure 1A shows miR-124-3p mimic-mediated downregulation of Fan1 mRNA at both 50 nM and 100 nM of the mimic. Figure 1 B serves as a positive control of RNA transfection and Fan1 detection and shows siRNA mediated downregulation of Fan1. Data represent the mean and SD of all experiments performed (n=3). Statistical analysis consisted of a two-way ANOVA with Tukey’s multiple comparisons test for mimic treatments, and unpaired t-test for siRNA treatment.

[0036] Figure 2 - An miR-124-3p mimic downregulated Fan1 protein

[0037] Transfection of an oligonucleotide mimic of miR-124-3p results in the downregulation of

[0038] Fan1 protein (Figure 2A and 2B). Figure 2A shows the imaged western blot bands wherein three independent repeat experiments are shown for each of the non-targeting mimic control (+) and miR-124-3p mimic (+) groups. Figure 2B shows the observed Fan1 band intensity at 24 and 48 hours post treatment. Data represent the mean and SD of all experiments performed (at 24h n=3, at 48h: n=2). Statistical analysis of the 24h data consisted of an unpaired t-test.

[0039] Figure 3 - The SNP rs3512 reduces miR-124-3p-mediated repression

[0040] Introduction of the rs3512 SNP into the 3’ UTR sequence of Fan1 reduces miR-124-3p- mediated repression. Figure 3A illustrates the dual-reporter system utilized to investigate the effect of rs3512 upon the repressive activity of the miRNA miR-124-3p upon mRNAs bearing 3’ UTR sequences from Fan1. Figure 3B shows the fold change in FLuc reporter gene fluorescence, as normalized against RLuc, in the presence of a non-targeting miRNA mimic control and the miR-124-3p mimic. Data represent the mean and SD of all experiments performed (n=5). Statistical analysis consisted of a two-way ANOVA with Tukey’s multiple comparisons test.

[0041] Figure 4 - Schematic representation of functional nucleic acid molecules targeting Fan1 3’-UTR at the miR-124-3p binding site

[0042] Functional nucleic acid molecules were designed against the 3’-UTR region of human Fan1 , at the putative miR-124-3p seed sequence (i.e., where miR-124-3p is predicted to bind). Functional nucleic acid molecules were designed using a tiling approach whereby the functional nucleic acid molecules are complementary to target sequences that are each one nucleotide downstream (i.e., 3’) of the previous target sequence. Fan1 mRNA is illustrated with the approximate region encompassing the functional nucleic acid molecule binding sites in expanded view.

[0043] Figure 5 - ASO-mediated steric blocking of miR-124-3p on FAN1 3’-UTR leads to FAN1 upregulation in cortical neurons

[0044] (A) Schematic overview of the cortical neuron differentiation and gymnosis protocol. Neural stem cells were differentiated and matured for 20 days. Mature cortical neurons were treated by gymnosis with non-targeting control or miR-124-3p steric blocking ASOs at 5 pM concentration for 10 days. (B) Imaged western blot and measured FAN1 band density after normalisation with TUBB3. Fold change was calculated relative to non-targeting ASO control. Data represent the mean and SD of two replicates in one experiment. Figure 6 - ASO-mediated steric blocking of miRNA target sites on FAN1 3’-UTR leads to FAN1 upregulation

[0045] Fold change of Hi BiT luminescence signal normalized by cell viability relative to mock- transfected samples following treatment with PS-Me (A), PS-Me-LNA (B), PS-MOE (C) or PS-MOE-LNA miRNA steric blocking ASOs. Data represent the mean and SD of averages in each experiment. N=2 for PS-Me, PS-MOE and PS-MOE-LNA libraries; N=4 for PS-Me- LNA library. Figure 6A-D encompass compound_26 to compound_57.

[0046] Figure 7 - ASO-mediated steric blocking of miR-197-3p on FAN1 3’-UTR leads to FAN1 upregulation

[0047] (A) Functional nucleic acid molecules were designed against the 3’-UTR region of human Fan1 at the miR-197-3p predicted binding site. Functional nucleic acid molecules were designed using a tiling approach whereby the functional nucleic acid molecules are complementary to target sequences that are each three nucleotides downstream (i.e. , 3’) of the previous target sequence. Fan1 3’-UTR is illustrated with the approximate region encompassing the functional nucleic acid molecule binding sites. (B) Fold change of Hi BiT luminescence signal normalized (right) and not normalized (left) by cell viability relative to mock-transfected samples following treatment with PS-Me-LNA miR-197-3p steric blocking ASOs. Data represent the mean and SD of averages in each experiment, N=2. Optimisation of ASO chemical modifications results in ASOs with retained or improved functionality (C). ASO mediated upregulation is mediated at the translational level as mRNA is essentially unchanged (D) upon ASO treatment.

[0048] Figure 8 - Functional nucleic acid molecules targeting the different miRNA seed regions in the 3’-UTR of Fan1 increase FAN1 protein expression

[0049] ASOs targeting the miR-197-3p, miR-181-5p, and miR-145-5p seed regions cause FAN1 upregulation (A), which is mediated at the translational level as mRNA is essentially unchanged (B) upon ASO treatment.

[0050] Figure 9 - Functional nucleic acid molecules targeting the different miRNA seed regions in the 3’-UTR of Fan1 increase FAN1 protein expression in HD patient-derived medium spiny neurons

[0051] The Fan1 upregulating activity of miRNA steric blocking ASOs is replicated in a HD relevant cell model, wherein ASOs are able to upregulate FAN1 in a disease-related cell type (A and B). Figure 10 - FAN1 eQTL data extracted from the GTEx Portal shows Fan1 upregulation exclusively in brain-derived tissues in individuals carrying the rs3512 SNP

[0052] Increased level of Fan1 transcript is detected exclusively in brain-derived tissue from individuals carrying the rs3512 SNP in one (G / C) or both alleles (C / C) in comparison with individuals homozygous for the reference allele (G / G). Similar level of Fan1 transcript is detected, regardless of genotype, in whole blood and adipose tissue, where miR-124-3p is not expressed.

[0053] DETAILED DESCRIPTION OF THE INVENTION

[0054] It is an object of the present invention to provide a functional nucleic acid molecule that acts to relieve post-transcriptional repression of Fan1 mRNA.

[0055] To this end, the inventors have devised functional nucleic acid molecules comprising one or more contiguous nucleotide sequences, which each independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0056] Complementarity of the functional nucleic acid molecules of the invention to the 3’ UTR of Fan1 mRNA and / or other RNAs that bind the 3’ UTR of Fan1, such as miRNAs, for example miR-124-3p, allow them to bind or anneal to said RNAs and thereby prevent post- transcriptional repression of Fan1.

[0057] Targeting either the Fan 1 mRNA directly, or targeting other RNAs that themselves target the Fan1 mRNA, may block the miRNA binding to Fan1 mRNA and thereby prevent it’s repressive effect upon Fan1 expression.

[0058] The functional nucleic acid molecules of the invention may therefore be utilised for targeted modulation of Fan1 expression, e.g., in diseases or disorders wherein Fan1 modulates disease. Fan 1 is implicated in modulating triplet expansion diseases of the polyglutamine family. Hence, the functional nucleic acid molecules of the invention may be utilised as disease-modifying agents in polyglutamine disorders such as Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0059] Functional Nucleic Acid Molecule

[0060] Provided herein is a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0061] A functional nucleic acid molecule according to the invention may also be defined by other terms in the art, depending upon structural and functional features of the specific functional nucleic acid. For example, the functional nucleic acid molecule may be considered to be an antisense oligonucleotide (ASO), long non-coding RNA (IncRNA), a steric-blocking oligonucleotide (SBO), or an anti-miRNA oligonucleotide (AMO).

[0062] In one embodiment, the functional nucleic acid molecule is an antisense oligonucleotide (ASO).

[0063] In one embodiment, the functional nucleic acid molecule is an anti-miRNA oligonucleotide (AMO).

[0064] In one embodiment, the functional nucleic acid molecule is a steric-blocking oligonucleotide (SBO).

[0065] By way of further example, the functional nucleic acid molecule may be a small activating RNA (saRNA), a small interfering RNA (siRNA), or a heteroduplex oligonucleotide (HDO).

[0066] In one embodiment, the functional nucleic acid molecule is a small activating RNA (saRNA).

[0067] In one embodiment, the functional nucleic acid molecule is a small interfering RNA (siRNA).

[0068] In one embodiment, the functional nucleic acid molecule is a heteroduplex oligonucleotide (HDO).

[0069] The “functional nucleic acid molecule” referred to herein is a synthetic molecule of the invention. In particular, the term “functional nucleic acid molecule” describes a nucleic acid molecule (e.g. DNA, RNA, or a mixture, or synthetic analogue thereof) that is capable of relieving post-translational repression of Fan1.

[0070] It will be understood that terms such as “relieving post-translational repression of Fan1" may also be expressed in relation to other functional effects that are linked with this effect. For example, it could equally be said that the functional nucleic acid molecule of the invention increases the expression of Fan1 (i.e., by relieving said repression).

[0071] The term “functional RNA molecule” refers equally to instances wherein the functional nucleic acid molecule is formed of any combination of RNA and modified versions thereof; of DNA and modified versions thereof; of a mixture of RNA and DNA, and modified versions thereof; and of chemical analogues of nucleotides.

[0072] A functional nucleic molecule of the invention may be a DNA molecule that is transcribed into a functional RNA molecule according to the invention.

[0073] A functional nucleic molecule of the invention may be a DNA molecule that is transcribed into a functional RNA molecule according to the invention that is then further modified by chemical or enzymatic modification.

[0074] In one embodiment, the functional nucleic molecule is a single-stranded molecule.

[0075] In one embodiment, the functional nucleic molecule is a double stranded molecule.

[0076] In one embodiment, the functional nucleic comprises regions of single stranded and double stranded oligonucleotides and / or analogues thereof.

[0077] In relation to the foregoing, it will be understood that double stranded refers to complementary base pairing between two or more distinct molecules. Hence, a single stranded molecule (i.e., single molecule) will be considered single stranded according to the foregoing even if said molecule forms double stranded secondary structures (e.g., stemloops).

[0078] In one embodiment, the functional nucleic molecule consists of DNA.

[0079] In one embodiment, the functional nucleic molecule comprises DNA. A DNA molecule may not be functional in the same way that an RNA molecule is functional. For example, a functional DNA molecule may be functional in that it encodes a functional RNA molecule, wherein the RNA molecule is a functional nucleic acid molecule according to the invention.

[0080] In one embodiment, the functional nucleic molecule consists of RNA.

[0081] In one embodiment, the functional nucleic molecule comprises RNA.

[0082] In one embodiment, the functional nucleic molecule consists of modified RNA nucleotides.

[0083] In one embodiment, the functional nucleic molecule comprises modified RNA nucleotides.

[0084] In one embodiment, the functional nucleic molecule consists of synthetic nucleotide analogues.

[0085] In one embodiment, the functional nucleic molecule comprises synthetic nucleotide analogues.

[0086] In one embodiment, the functional nucleic molecule comprises or consists of morpholino nucleotides.

[0087] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0088] The one or more contiguous nucleotide sequences may be selected independently from one another, where more than one contiguous nucleotide sequence is present. Features (e.g., length, composition and % complementarity) of any one contiguous nucleotide sequence can be selected entirely independently of any other one (i.e. , all of the other) contiguous nucleotide sequences within the same functional nucleic acid molecule. As a result of the foregoing, there is no limitation imposed on any one contiguous nucleotide sequence by any other contiguous nucleotide sequence within the functional nucleic acid molecule.

[0089] Each of the one or more contiguous nucleotide sequences may target discontinuous sequences within the 3’-UTR of Fan1. That is, the functional nucleic acid molecule may bind to the target oligonucleotide at discrete target sites, wherein said target sites are not contiguous with one another. As such, the functional nucleic acid molecule may bid to the target oligonucleotide at more than one location and ‘loop out’ intervening regions of the functional nucleic acid molecule.

[0090] The contiguous nucleotide sequences may simultaneously bind Fan1 or may separately bind Fan1 (i.e., not at the same time).

[0091] A single functional nucleic acid molecule may bind to a single Fan1 mRNA. Alternatively, in embodiments where the functional nucleic acid contains more than one contiguous nucleotide sequence, a single functional nucleic acid molecule may bind to a more than one Fan1 mRNA, e.g., wherein one contiguous nucleotide sequences may bind to one Fan1 mRNA molecule whilst a second contiguous nucleotide sequence may simultaneously bind to a second Fan1 mRNA molecule, either at the same target sequence or different target sequences.

[0092] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising a contiguous nucleotide sequences of 5 or more nucleotides in length, wherein the contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0093] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 35 nucleotides in length, comprising one or more contiguous nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0094] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 35 nucleotides in length, comprising a contiguous nucleotide sequences of 5 or more nucleotides in length, wherein the contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0095] In one embodiment the functional nucleic acid molecule consists of the one or more contiguous nucleotide sequences.

[0096] In one embodiment, the functional nucleic acid molecule is 10 to 40 nucleotides in length, such as 10 to 35, 10 to 30, 10 to 25, 10 to 20, or 10 to 15 nucleotides in length. In one embodiment, the functional nucleic acid molecule is more than 10 nucleotides in length, such as more than 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or more than 39 nucleotides in length.

[0097] In one embodiment, the functional nucleic acid molecule is 10 nucleotides in length. In other embodiments, the function nucleic acid molecule is 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 ,

[0098] 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0099] In one embodiment, the one or more contiguous nucleotide sequences are independently 5 to 40 nucleotides in length, such as 10 to 35, 10 to 30, 10 to 25, 10 to 20, or 10 to 15 nucleotides in length.

[0100] In one embodiment, the one or more contiguous nucleotide sequences are independently more than 5 nucleotides in length, such as more than 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or more than 39 nucleotides in length.

[0101] In one embodiment, the one or more contiguous nucleotide sequences are independently 5 nucleotides in length. In other embodiments, the one or more contiguous nucleotide sequences are independently 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22,

[0102] 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0103] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0104] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0105] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0106] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1. In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0107] In one embodiment, the one or more contiguous nucleotide sequences is 100% complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1.

[0108] In one embodiment the functional nucleic acid molecule comprises one or more contiguous nucleotide sequences.

[0109] In another embodiment the functional nucleic acid molecule comprises or consists of one contiguous nucleotide sequences.

[0110] In another embodiment the functional nucleic acid molecule comprises or consists of two, three, four, five or more contiguous nucleotide sequences.

[0111] It will be understood that by 3’ UTR of Fan1 it is meant the complete 3’ UTR sequence as present on both the coding and non-coding strand of the DNA. Thus, each contiguous nucleotide sequence may or may not be complementary to the mRNA and may or may not be complementary to a miRNA (which is itself complementary to the 3’ UTR of Fan1 mRNA).

[0112] It will be understood that the functional nucleic acid molecule of the present invention may be a DNA or an RNA molecule, as such, sequences that are represented herein as being implicitly DNA (i.e. , by containing T rather than U) are to be understood as also representing a corresponding RNA molecule in which each T nucleotide in the sequence is replaced with a U nucleotide. Hence, sequences according to the invention may be either DNA sequences or RNA sequences. The representation of a sequence as either one or the other herein is enacted solely for simplicity and does not imply a sequence is restricted to being a DNA or RNA sequence, unless expressly indicated in the text.

[0113] Reference to nucleotides or nucleosides herein may equally refer to ribo- or deoxyribo- nucleotides / nucleosides, and modified versions thereof.

[0114] With reference to target sequences, it will be readily understood by those skilled in the art what the substituent parts of such a molecule are. For example, in instances where the target molecule is an mRNA said nucleotides / nucleosides will be ribo- nucleotides / nucleosides, etc. Herein, polypeptide or polynucleotide sequences are said to be the same as or “identical” to other polypeptide or polynucleotide sequences, if they share 100% sequence identity. Residues in sequences are numbered from left to right, i.e. from N- to C- terminus for polypeptides; from 5’ to 3’ terminus for polynucleotides. If closely related sequences are not identical they may be similar, i.e., they may possess a certain, quantifiable, degree of sequence identity, e.g., a sequence may have 50%, 60%, 70%, 80%, 90%, 95% or 99% sequence identity to another sequence. Unless a specific reference range is given, e.g., with respect to the nucleotide positions, any quoted sequence identity will be understood as being calculated across the residue range over which the two sequences are aligned. The aligned residue range may represent the entirety of one or more of the input sequences or a contiguous section of sequence of one or more of the input sequences, and is typically determined by standard tools known in the art, e.g., NCBI BLAST.

[0115] For the purposes of comparing two closely-related polynucleotide sequences, the “% sequence identity” between a first nucleotide sequence and a second nucleotide sequence may be calculated using NCBI BLAST, using standard settings for nucleotide sequences (BLASTN). For the purposes of comparing two closely-related polypeptide sequences, the “% sequence identity” between a first polypeptide sequence and a second polypeptide sequence may be calculated using NCBI BLAST, using standard settings for polypeptide sequences (BLASTP). A “difference” between sequences refers to an insertion, deletion or substitution of a single nucleotide in a position of the second sequence, compared to the first sequence. Insertions, deletions or substitutions in a second sequence which is otherwise identical (100% sequence identity) to a first sequence result in reduced % sequence identity.

[0116] “Complementarity” relates to the Watson-Crick base pairing principle that ‘A’ nucleotides will hydrogen bond with T (or ‘U’) nucleotides, and ‘G’ nucleotides with ‘C’ nucleotides to form double stranded structures that associate via said “complementary” nucleotides. Herein, a “complementary” sequence is a sequence closely related to another sequence such that such base pairing can occur. Complementary sequences may be 100% complementary such that they may base pair across their entire length, or they may be e.g., 99%, 90%, 80%, 70%, or 60% complementary etc., such that they base pair across portions of their sequence. Here, as is common in the art, a complementary sequence may also be called a “reverse complementary” sequence.

[0117] The functional nucleic acid comprises a sequence, which is sufficient in length to bind to the target (e.g., mRNA or miRNA). In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064; 1065 to 1130; 1137 to 1138; and / or 1139 to 1148.

[0118] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 949 to 973.

[0119] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 974 to 998.

[0120] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 999 to 1064.

[0121] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 1065 to 1130.

[0122] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 1137 to 1138.

[0123] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 1139 to 1148.

[0124] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence with 80% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064; 1065 to 1130; 1137 to 1138; and / or 1139 to 1148.

[0125] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence with 90% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064;

[0126] 1065 to 1130; 1137 to 1138; and / or 1139 to 1148.

[0127] In one embodiment, the functional nucleic acid molecule comprises a contiguous nucleotide sequence comprising or consisting of a sequence with 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064; 1065 to 1130; 1137 to 1138; and / or 1139 to 1148.

[0128] In one embodiment, the functional nucleic acid molecule is selected from the group consisting of ASO 849, ASO 850, ASO 851 , ASO 852, ASO 853, ASO 917, ASO 918, ASO 919, ASO 920, ASO 921 , ASO 922, ASO 864, ASO 968, ASO 970, and ASO 969.

[0129] In one embodiment the functional nucleic acid molecule comprises a 5’-cap. A “5’-cap” refers to an altered nucleotide at the 5’-end of the transcript which provides stability to the molecule, particularly from degradation from exonucleases, and can promote translation. Most commonly, the 5’-cap may be a 7-methylguanylate cap (m7G), i.e. a guanine nucleotide connected to the RNA via a 5' to 5' triphosphate linkage and methylated on the 7 position.

[0130] FAN1

[0131] Fan1 encodes the protein FAN1 (FANCD2 / FANCI-associated nuclease 1), an enzyme possessing both endo- and exo-nuclease activity that is important in DNA interstrand crosslink repair.

[0132] Herein, Fan1 is used to refer to the gene (i.e., DNA) and any other sequences encoding the sequence thereof (e.g., mRNAs). The protein is referred to as FANI . Nevertheless, the context of reference to Fan1 will readily be understood by the skilled protein in order to determine the type of molecule being referred to. The aforementioned naming convention is thus not intended to be in any way limiting.

[0133] The 3’-UTR sequences of 4 human Fan1 variants are set out below.

[0134] FAN1-201 ; ensembl_transcript_id: ENST00000362065 (SEQ ID NO: 1)

[0135] AAGAUUCCCUACAGGAGAAAAUGGAAAUGAGGAGGAGAGAAACUCCGGUGUCCCCGA GGUGUCGGUGUGGUGAGGGCCGCUGGCGUUGAAGUACAUCCUGCUCUGGCCCAGC UCCCCAUAGCAGGCCUCCAGGGGGCCACUGCGCUGUUGCCGCAGCAUCCUGCUCAG UACGUCGACUUCAUCAGCCAGGAGGGAGAGCUUGUGAAAGGCUGUGAUGGAGCCAC

[0136] CCAGGCUGAUCUGGGCCUCGGGAACCCAGCGGAAGUAGCACAGUUUCCACAGUUUU

[0137] AUGUGUGUUCCAGAGACACGUGGCAGAAUAACACCGUGCAGGUUGGCGGGUUUGGA

[0138] AAACCAUUCUCUAAAAUACUGCUCCGUAUCACUGUUCUGGCUGUCGGUUUGCUGAG

[0139] CUGGAUCUGGCUUUGGUUUUAAUAUCAAUGAAUUUCUCCUUGGAAGUAAUUCUUGG

[0140] UCACUGAUGAUUCCAUUCUUUAAGGCAGACGGCAUUCCUCUUAGUGUGGAGCUGUA

[0141] GCUUUUCUAUACAGAAGAGAUUUUAUUAUGUUCCGGGGAUUCCCUUUUUAGAAAGAU

[0142] UGAAGGAUGCAAUGGCAAAUAUAAACUCAAUACUAUGAAAAAUUAAUGGAAUUUCAGC

[0143] CUCAAAGAACAUUUUCCUCCCUUCCUUUGUGUCCUUAUUCUAAUCCUCCUCCCCUGG

[0144] AAUUACACUUUUUUAUGUGUUGACUCUACCUAGGCUGUUACUAUCAGCCUGAAUGG

[0145] GGGCGGGAUGAGAGUACCUCCUAUCCACUAAUUUGCUUAAGGAUAAGUUCUAAGAC

[0146] GGGCUAGAAAAAACACUAGACCUGGCCGAUUCUAUCAAGAACAAUGGCAAACUGAAC

[0147] AGAGGCAGUCAGGAGGCCAAAUGUCUGAUUCUUUGUUCUGUACCUUUCAGUAGUCU

[0148] GCAAAUUUUCUACCAAAAAAAAUCCCAAGAAUUUAUUUGGGAAUUAUUAAAAAGGCAA

[0149] ACAAUGAAUGUUAUUAGGACAAGAAUAUAGCAGUCAGGAGGCCAUGACUACAUCACA

[0150] GCCAGGCGGCAUUCCCUGCCACAGUGGCGGCUUGAAUCAUCAAGAAAUGGAUAAAU

[0151] GGGGCUUUAGUAAAUCAGGCUUGCAGGCUCAAAGCUGCAAUCUGCCCACUCUCAGG

[0152] UACUGAGACUUUGUGGGCCUCAGACACCAGGAAGAAAGCUGGGAUACAGUCAUUUG

[0153] AGUUAAAAAGGGAAUGACCCCUCAGAAACCCGCAUUAGCAGUGUUACUCUUGGAAGU

[0154] GCCUUUACUUUUAACGCUCUCUGUUCUGAAAAAGAGGUGUUUGGUUACGUGUGAGC

[0155] CAACAUCACGUUUUGUUAGCUGUGAUUUACCUUUGUCCGUUUAAAAGACUUCACGGA

[0156] GCCAUUCUGUAUACAAGGUGUGCUCUUUCCAAUGUAGAAGGGGUUAUGGAAAAGGG

[0157] UGCGAUCCUUUGCUGUAAACUGGAGAGACCAGUCCCAAACAGAGGGGAAUUUUAAG

[0158] CCCUUCUCAUCACCCAAUUGGAUGUUUUUGCUUAUAGCAAAUUCCUGCAAAAUAAAU AAAUAAAUAUUUGCAAAACUAAA

[0159] FAN1-215; ensembl_transcript_id: ENST00000656435 (SEQ ID NO: 2)

[0160] AAGAUUCCCUACAGGAGAAAAUGGAAAUGAGGAGGAGAGAAACUCCGGUGUCCCCGA

[0161] GGUGUCGGUGUGGUGAGGGCCGCUGGCGUUGAAGUACAUCCUGCUCUGGCCCAGC

[0162] UCCCCAUAGCAGGCCUCCAGGGGGCCACUGCGCUGUUGCCGCAGCAUCCUGCUCAG

[0163] UACGUCGACUUCAUCAGCCAGGAGGGAGAGCUUGUGAAAGGCUGUGAUGGAGCCAC

[0164] CCAGGCUGAUCUGGGCCUCGGGAACCCAGCGGAAGUAGCACAGUUUCCACAGUUUU

[0165] AUGUGUGUUCCAGAGACACGUGGCAGAAUAACACCGUGCAGGUUGGCGGGUUUGGA

[0166] AAACCAUUCUCUAAAAUACUGCUCCGUAUCACUGUUCUGGCUGUCGGUUUGCUGAG

[0167] CUGGAUCUGGCUUUGGUUUUAAUAUCAAUGAAUUUCUCCUUGGAAGUAAUUCUUGG

[0168] UCACUGAUGAUUCCAUUCUUUAAGGCAGACGGCAUUCCUCUUAGUGUGGAGCUGUA

[0169] GCUUUUCUAUACAGAAGAGAUUUUAUUAUGUUCCGGGGAUUCCCUUUUUAGAAAGAU UGAAGGAUGCAAUGGCAAAUAUAAACUCAAUACUAUGAAAAAUUAAUGGAAUUUCAGC

[0170] CUCAAAGAACAUUUUCCUCCCUUCCUUUGUGUCCUUAUUCUAAUCCUCCUCCCCUGG

[0171] AAUUACACUUUUUUAUGUGUUGACUCUACCUAGGCUGUUACUAUCAGCCUGAAUGG

[0172] GGGCGGGAUGAGAGUACCUCCUAUCCACUAAUUUGCUUAAGGAUAAGUUCUAAGAC

[0173] GGGCUAGAAAAAACACUAGACCUGGCCGAUUCUAUCAAGAACAAUGGCAAACUGAAC

[0174] AGAGGCAGUCAGGAGGCCAAAUGUCUGAUUCUUUGUUCUGUACCUUUCAGUAGUCU

[0175] GCAAAUUUUCUACCAAAAAAAAUCCCAAGAAUUUAUUUGGGAAUUAUUAAAAAGGCAA

[0176] ACAAUGAAUGUUAUUAGGACAAGAAUAUAGCAGUCAGGAGGCCAUGACUACAUCACA

[0177] GCCAGGCGGCAUUCCCUGCCACAGUGGCGGCUUGAAUCAUCAAGAAAUGGAUAAAU

[0178] GGGGCUUUAGUAAAUCAGGCUUGCAGGCUCAAAGCUGCAAUCUGCCCACUCUCAGG

[0179] UACUGAGACUUUGUGGGCCUCAGACACCAGGAAGAAAGCUGGGAUACAGUCAUUUG

[0180] AGUUAAAAAGGGAAUGACCCCUCAGAAACCCGCAUUAGCAGUGUUACUCUUGGAAGU

[0181] GCCUUUACUUUUAACGCUCUCUGUUCUGAAAAAGAGGUGUUUGGUUACGUGUGAGC

[0182] CAACAUCACGUUUUGUUAGCUGUGAUUUACCUUUGUCCGUUUAAAAGACUUCACGGA

[0183] GCCAUUCUGUAUACAAGGUGUGCUCUUUCCAAUGUAGAAGGGGUUAUGGAAAAGGG

[0184] UGCGAUCCUUUGCUGUAAACUGGAGAGACCAGUCCCAAACAGAGGGGAAUUUUAAG

[0185] CCCUUCUCAUCACCCAAUUGGAUGUUUUUGCUUAUAGCAAAUUCCUGCAAAAUAAAU

[0186] FAN1-221 ; ensembl_transcript_id: ENST00000664837 (SEQ ID NO: 3)

[0187] AAGAUUCCCUACAGGAGAAAAUGGAAAUGAGGAGGAGAGAAACUCCGGUGUCCCCGA

[0188] GGUGUCGGUGUGGUGAGGGCCGCUGGCGUUGAAGUACAUCCUGCUCUGGCCCAGC

[0189] UCCCCAUAGCAGGCCUCCAGGGGGCCACUGCGCUGUUGCCGCAGCAUCCUGCUCAG

[0190] UACGUCGACUUCAUCAGCCAGGAGGGAGAGCUUGUGAAAGGCUGUGAUGGAGCCAC

[0191] CCAGGCUGAUCUGGGCCUCGGGAACCCAGCGGAAGUAGCACAGUUUCCACAGUUUU

[0192] AUGUGUGUUCCAGAGACACGUGGCAGAAUAACACCGUGCAGGUUGGCGGGUUUGGA

[0193] AAACCAUUCUCUAAAAUACUGCUCCGUAUCACUGUUCUGGCUGUCGGUUUGCUGAG

[0194] CUGGAUCUGGCUUUGGUUUUAAUAUCAAUGAAUUUCUCCUUGGAAGUAAUUCUUGG

[0195] UCACUGAUGAUUCCAUUCUUUAAGGCAGACGGCAUUCCUCUUAGUGUGGAGCUGUA

[0196] GCUUUUCUAUACAGAAGAGAUUUUAUUAUGUUCCGGGGAUUCCCUUUUUAGAAAGAU

[0197] UGAAGGAUGCAAUGGCAAAUAUAAACUCAAUACUAUGAAAAAUUAAUGGAAUUUCAGC

[0198] CUCAAAGAACAUUUUCCUCCCUUCCUUUGUGUCCUUAUUCUAAUCCUCCUCCCCUGG

[0199] AAUUACACUUUUUUAUGUGUUGACUCUACCUAGGCUGUUACUAUCAGCCUGAAUGG

[0200] GGGCGGGAUGAGAGUACCUCCUAUCCACUAAUUUGCUUAAGGAUAAGUUCUAAGAC

[0201] GGGCUAGAAAAAACACUAGACCUGGCCGAUUCUAUCAAGAACAAUGGCAAACUGAAC

[0202] AGAGGCAGUCAGGAGGCCAAAUGUCUGAUUCUUUGUUCUGUACCUUUCAGUAGUCU

[0203] GCAAAUUUUCUACCAAAAAAAAUCCCAAGAAUUUAUUUGGGAAUUAUUAAAAAGGCAA

[0204] ACAAUGAAUGUUAUUAGGACAAGAAUAUAGCAGUCAGGAGGCCAUGACUACAUCACA GCCAGGCGGCAUUCCCUGCCACAGUGGCGGCUUGAAUCAUCAAGAAAUGGAUAAAU

[0205] GGGGCUUUAGUAAAUCAGGCUUGCAGGCUCAAAGCUGCAAUCUGCCCACUCUCAGG

[0206] UACUGAGACUUUGUGGGCCUCAGACACCAGGAAGAAAGCUGGGAUACAGUCAUUUG

[0207] AGUUAAAAAGGGAAUGACCCCUCAGAAACCCGCAUUAGCAGUGUUACUCUUGGAAGU

[0208] GCCUUUACUUUUAACGCUCUCUGUUCUGAAAAAGAGGUGUUUGGUUACGUGUGAGC

[0209] CAACAUCACGUUUUGUUAGCUGUGAUUUACCUUUGUCCGUUUAAAAGACUUCACGGA

[0210] GCCAUUCUGUAUACAAGGUGUGCUCUUUCCAAUGUAGAAGGGGUUAUGGAAAAGGG

[0211] UGCGAUCCUUUGCUGUAAACUGGAGAGACCAGUCCCAAACAGAGGGGAAUUUUAAG

[0212] CCCUUCUCAUCACCCAAUUGGAUGUUUUUGCUUAUAGCAAAUUCCUGCAAAAUAAA

[0213] FAN1-228; ensembl_transcript_id: ENST00000670849 (SEQ ID NO: 4)

[0214] AAGAUUCCCUACAGGAGAAAAUGGAAAUGAGGAGGAGAGAAACUCCGGUGUCCCCGA

[0215] GGUGUCGGUGUGGUGAGGGCCGCUGGCGUUGAAGUACAUCCUGCUCUGGCCCAGC

[0216] UCCCCAUAGCAGGCCUCCAGGGGGCCACUGCGCUGUUGCCGCAGCAUCCUGCUCAG

[0217] UACGUCGACUUCAUCAGCCAGGAGGGAGAGCUUGUGAAAGGCUGUGAUGGAGCCAC

[0218] CCAGGCUGAUCUGGGCCUCGGGAACCCAGCGGAAGUAGCACAGUUUCCACAGUUUU

[0219] AUGUGUGUUCCAGAGACACGUGGCAGAAUAACACCGUGCAGGUUGGCGGGUUUGGA

[0220] AAACCAUUCUCUAAAAUACUGCUCCGUAUCACUGUUCUGGCUGUCGGUUUGCUGAG

[0221] CUGGAUCUGGCUUUGGUUUUAAUAUCAAUGAAUUUCUCCUUGGAAGUAAUUCUUGG

[0222] UCACUGAUGAUUCCAUUCUUUAAGGCAGACGGCAUUCCUCUUAGUGUGGAGCUGUA

[0223] GCUUUUCUAUACAGAAGAGAUUUUAUUAUGUUCCGGGGAUUCCCUUUUUAGAAAGAU

[0224] UGAAGGAUGCAAUGGCAAAUAUAAACUCAAUACUAUGAAAAAUUAAUGGAAUUUCAGC

[0225] CUCAAAGAACAUUUUCCUCCCUUCCUUUGUGUCCUUAUUCUAAUCCUCCUCCCCUGG

[0226] AAUUACACUUUUUUAUGUGUUGACUCUACCUAGGCUGUUACUAUCAGCCUGAAUGG

[0227] GGGCGGGAUGAGAGUACCUCCUAUCCACUAAUUUGCUUAAGGAUAAGUUCUAAGAC

[0228] GGGCUAGAAAAAACACUAGACCUGGCCGAUUCUAUCAAGAACAAUGGCAAACUGAAC

[0229] AGAGGCAGUCAGGAGGCCAAAUGUCUGAUUCUUUGUUCUGUACCUUUCAGUAGUCU

[0230] GCAAAUUUUCUACCAAAAAAAAUCCCAAGAAUUUAUUUGGGAAUUAUUAAAAAGGCAA

[0231] ACAAUGAAUGUUAUUAGGACAAGAAUAUAGCAGUCAGGAGGCCAUGACUACAUCACA

[0232] GCCAGGCGGCAUUCCCUGCCACAGUGGCGGCUUGAAUCAUCAAGAAAUGGAUAAAU

[0233] GGGGCUUUAGUAAAUCAGGCUUGCAGGCUCAAAGCUGCAAUCUGCCCACUCUCAGG

[0234] UACUGAGACUUUGUGGGCCUCAGACACCAGGAAGAAAGCUGGGAUACAGUCAUUUG

[0235] AGUUAAAAAGGGAAUGACCCCUCAGAAACCCGCAUUAGCAGUGUUACUCUUGGAAGU

[0236] GCCUUUACUUUUAACGCUCUCUGUUCUGAAAAAGAGGUGUUUGGUUACGUGUGAGC

[0237] CAACAUCACGUUUUGUUAGCUGUGAUUUACCUUUGUCCGUUUAAAAGACUUCACGGA

[0238] GCCAUUCUGUAUACA In one embodiment, the sequence from the 3’ UTR of Fan1 is a sequence from the coding strand of Fan1.

[0239] In one embodiment, the 3’ UTR of Fan1 is as set forth in SEQ ID NOs: 1 to 4.

[0240] In one embodiment, the 3’ UTR of Fan1 is as set forth in SEQ ID NOs: 1 to 4.

[0241] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to any one or more of SEQ ID NOs: 1 to 4.

[0242] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 1 to 4.

[0243] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 1 to 4.

[0244] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 1 to 4.

[0245] In one embodiment, the one or more contiguous nucleotide sequences is 100% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 1 to 4.

[0246] A further 4 sequences of the human Fan1 3’-UTR are set out below. Each of these sequences represents the reverse complement of SEQ ID NOs: 1 to 4, as set out above. Thus, SEQ ID NOs 1 to 4 and 5 to 8 are 100% complementary to one another.

[0247] FAN1-201_reverse complement (SEQ ID NO: 5)

[0248] UUUAGUUUUGCAAAUAUUUAUUUAUUUAUUUUGCAGGAAUUUGCUAUAAGCAAAAAC AUCCAAUUGGGUGAUGAGAAGGGCUUAAAAUUCCCCUCUGUUUGGGACUGGUCUCU CCAGUUUACAGCAAAGGAUCGCACCCUUUUCCAUAACCCCUUCUACAUUGGAAAGAG CACACCUUGUAUACAGAAUGGCUCCGUGAAGUCUUUUAAACGGACAAAGGUAAAUCA CAGCUAACAAAACGUGAUGUUGGCUCACACGUAACCAAACACCUCUUUUUCAGAACA

[0249] GAGAGCGUUAAAAGUAAAGGCACUUCCAAGAGUAACACUGCUAAUGCGGGUUUCUGA

[0250] GGGGUCAUUCCCUUUUUAACUCAAAUGACUGUAUCCCAGCUUUCUUCCUGGUGUCU

[0251] GAGGCCCACAAAGUCUCAGUACCUGAGAGUGGGCAGAUUGCAGCUUUGAGCCUGCA

[0252] AGCCUGAUUUACUAAAGCCCCAUUUAUCCAUUUCUUGAUGAUUCAAGCCGCCACUGU

[0253] GGCAGGGAAUGCCGCCUGGCUGUGAUGUAGUCAUGGCCUCCUGACUGCUAUAUUCU

[0254] UGUCCUAAUAACAUUCAUUGUUUGCCUUUUUAAUAAUUCCCAAAUAAAUUCUUGGGA

[0255] UUUUUUUUGGUAGAAAAUUUGCAGACUACUGAAAGGUACAGAACAAAGAAUCAGACA

[0256] UUUGGCCUCCUGACUGCCUCUGUUCAGUUUGCCAUUGUUCUUGAUAGAAUCGGCCA

[0257] GGUCUAGUGUUUUUUCUAGCCCGUCUUAGAACUUAUCCUUAAGCAAAUUAGUGGAUA

[0258] GGAGGUACUCUCAUCCCGCCCCCAUUCAGGCUGAUAGUAACAGCCUAGGUAGAGUC

[0259] AACACAUAAAAAAGUGUAAUUCCAGGGGAGGAGGAUUAGAAUAAGGACACAAAGGAA

[0260] GGGAGGAAAAUGUUCUUUGAGGCUGAAAUUCCAUUAAUUUUUCAUAGUAUUGAGUUU

[0261] AUAUUUGCCAUUGCAUCCUUCAAUCUUUCUAAAAAGGGAAUCCCCGGAACAUAAUAA

[0262] AAUCUCUUCUGUAUAGAAAAGCUACAGCUCCACACUAAGAGGAAUGCCGUCUGCCUU

[0263] AAAGAAUGGAAUCAUCAGUGACCAAGAAUUACUUCCAAGGAGAAAUUCAUUGAUAUU

[0264] AAAACCAAAGCCAGAUCCAGCUCAGCAAACCGACAGCCAGAACAGUGAUACGGAGCA

[0265] GUAUUUUAGAGAAUGGUUUUCCAAACCCGCCAACCUGCACGGUGUUAUUCUGCCAC

[0266] GUGUCUCUGGAACACACAUAAAACUGUGGAAACUGUGCUACUUCCGCUGGGUUCCC

[0267] GAGGCCCAGAUCAGCCUGGGUGGCUCCAUCACAGCCUUUCACAAGCUCUCCCUCCU

[0268] GGCUGAUGAAGUCGACGUACUGAGCAGGAUGCUGCGGCAACAGCGCAGUGGCCCCC

[0269] UGGAGGCCUGCUAUGGGGAGCUGGGCCAGAGCAGGAUGUACUUCAACGCCAGCGG

[0270] CCCUCACCACACCGACACCUCGGGGACACCGGAGUUUCUCUCCUCCUCAUUUCCAU

[0271] UUUCUCCUGUAGGGAAUCUU

[0272] FAN1-215_reverse complement (SEQ ID NO: 6)

[0273] AUUUAUUUUGCAGGAAUUUGCUAUAAGCAAAAACAUCCAAUUGGGUGAUGAGAAGGG

[0274] CUUAAAAUUCCCCUCUGUUUGGGACUGGUCUCUCCAGUUUACAGCAAAGGAUCGCA

[0275] CCCUUUUCCAUAACCCCUUCUACAUUGGAAAGAGCACACCUUGUAUACAGAAUGGCU

[0276] CCGUGAAGUCUUUUAAACGGACAAAGGUAAAUCACAGCUAACAAAACGUGAUGUUGG

[0277] CUCACACGUAACCAAACACCUCUUUUUCAGAACAGAGAGCGUUAAAAGUAAAGGCAC

[0278] UUCCAAGAGUAACACUGCUAAUGCGGGUUUCUGAGGGGUCAUUCCCUUUUUAACUC

[0279] AAAUGACUGUAUCCCAGCUUUCUUCCUGGUGUCUGAGGCCCACAAAGUCUCAGUAC

[0280] CUGAGAGUGGGCAGAUUGCAGCUUUGAGCCUGCAAGCCUGAUUUACUAAAGCCCCA

[0281] UUUAUCCAUUUCUUGAUGAUUCAAGCCGCCACUGUGGCAGGGAAUGCCGCCUGGCU

[0282] GUGAUGUAGUCAUGGCCUCCUGACUGCUAUAUUCUUGUCCUAAUAACAUUCAUUGU

[0283] UUGCCUUUUUAAUAAUUCCCAAAUAAAUUCUUGGGAUUUUUUUUGGUAGAAAAUUUG CAGACUACUGAAAGGUACAGAACAAAGAAUCAGACAUUUGGCCUCCUGACUGCCUCU GUUCAGUUUGCCAUUGUUCUUGAUAGAAUCGGCCAGGUCUAGUGUUUUUUCUAGCC CGUCUUAGAACUUAUCCUUAAGCAAAUUAGUGGAUAGGAGGUACUCUCAUCCCGCCC CCAUUCAGGCUGAUAGUAACAGCCUAGGUAGAGUCAACACAUAAAAAAGUGUAAUUC CAGGGGAGGAGGAUUAGAAUAAGGACACAAAGGAAGGGAGGAAAAUGUUCUUUGAG GCUGAAAUUCCAUUAAUUUUUCAUAGUAUUGAGUUUAUAUUUGCCAUUGCAUCCUUC AAUCUUUCUAAAAAGGGAAUCCCCGGAACAUAAUAAAAUCUCUUCUGUAUAGAAAAGC UACAGCUCCACACUAAGAGGAAUGCCGUCUGCCUUAAAGAAUGGAAUCAUCAGUGAC

[0284] CAAGAAUUACUUCCAAGGAGAAAUUCAUUGAUAUUAAAACCAAAGCCAGAUCCAGCUC AGCAAACCGACAGCCAGAACAGUGAUACGGAGCAGUAU U U UAGAGAAUGGU U U UCCA AACCCGCCAACCUGCACGGUGUUAUUCUGCCACGUGUCUCUGGAACACACAUAAAAC UGUGGAAACUGUGCUACUUCCGCUGGGUUCCCGAGGCCCAGAUCAGCCUGGGUGG CUCCAUCACAGCCUUUCACAAGCUCUCCCUCCUGGCUGAUGAAGUCGACGUACUGA GCAGGAUGCUGCGGCAACAGCGCAGUGGCCCCCUGGAGGCCUGCUAUGGGGAGCU GGGCCAGAGCAGGAUGUACUUCAACGCCAGCGGCCCUCACCACACCGACACCUCGG GGACACCGGAGUUUCUCUCCUCCUCAUUUCCAUUUUCUCCUGUAGGGAAUCUU

[0285] FAN1-221_reverse complement (SEQ ID NO: 7)

[0286] UUUAUUUUGCAGGAAUUUGCUAUAAGCAAAAACAUCCAAUUGGGUGAUGAGAAGGGC UUAAAAUUCCCCUCUGUUUGGGACUGGUCUCUCCAGUUUACAGCAAAGGAUCGCAC CCUUUUCCAUAACCCCUUCUACAUUGGAAAGAGCACACCUUGUAUACAGAAUGGCUC

[0287] CGUGAAGUCUUUUAAACGGACAAAGGUAAAUCACAGCUAACAAAACGUGAUGUUGGC UCACACGUAACCAAACACCUCUUUUUCAGAACAGAGAGCGUUAAAAGUAAAGGCACU UCCAAGAGUAACACUGCUAAUGCGGGUUUCUGAGGGGUCAUUCCCUUUUUAACUCA AAUGACUGUAUCCCAGCUUUCUUCCUGGUGUCUGAGGCCCACAAAGUCUCAGUACC UGAGAGUGGGCAGAUUGCAGCUUUGAGCCUGCAAGCCUGAUUUACUAAAGCCCCAU UUAUCCAUUUCUUGAUGAUUCAAGCCGCCACUGUGGCAGGGAAUGCCGCCUGGCUG UGAUGUAGUCAUGGCCUCCUGACUGCUAUAUUCUUGUCCUAAUAACAUUCAUUGUUU

[0288] GCCUUUUUAAUAAUUCCCAAAUAAAUUCUUGGGAUUUUUUUUGGUAGAAAAUUUGCA GACUACUGAAAGGUACAGAACAAAGAAUCAGACAUUUGGCCUCCUGACUGCCUCUGU UCAGUUUGCCAUUGUUCUUGAUAGAAUCGGCCAGGUCUAGUGUUUUUUCUAGCCCG UCUUAGAACUUAUCCUUAAGCAAAUUAGUGGAUAGGAGGUACUCUCAUCCCGCCCCC

[0289] AUUCAGGCUGAUAGUAACAGCCUAGGUAGAGUCAACACAUAAAAAAGUGUAAUUCCA GGGGAGGAGGAUUAGAAUAAGGACACAAAGGAAGGGAGGAAAAUGUUCUUUGAGGC UGAAAUUCCAUUAAUUUUUCAUAGUAUUGAGUUUAUAUUUGCCAUUGCAUCCUUCAA UCUUUCUAAAAAGGGAAUCCCCGGAACAUAAUAAAAUCUCUUCUGUAUAGAAAAGCU ACAGCUCCACACUAAGAGGAAUGCCGUCUGCCUUAAAGAAUGGAAUCAUCAGUGACC AAGAAUUACUUCCAAGGAGAAAUUCAUUGAUAUUAAAACCAAAGCCAGAUCCAGCUCA

[0290] GCAAACCGACAGCCAGAACAGUGAUACGGAGCAGUAUUUUAGAGAAUGGUUUUCCAA

[0291] ACCCGCCAACCUGCACGGUGUUAUUCUGCCACGUGUCUCUGGAACACACAUAAAACU

[0292] GUGGAAACUGUGCUACUUCCGCUGGGUUCCCGAGGCCCAGAUCAGCCUGGGUGGC

[0293] UCCAUCACAGCCUUUCACAAGCUCUCCCUCCUGGCUGAUGAAGUCGACGUACUGAG

[0294] CAGGAUGCUGCGGCAACAGCGCAGUGGCCCCCUGGAGGCCUGCUAUGGGGAGCUG

[0295] GGCCAGAGCAGGAUGUACUUCAACGCCAGCGGCCCUCACCACACCGACACCUCGGG

[0296] GACACCGGAGUUUCUCUCCUCCUCAUUUCCAUUUUCUCCUGUAGGGAAUCUU

[0297] FAN1-228_reverse complement (SEQ ID NO: 8)

[0298] UGUAUACAGAAUGGCUCCGUGAAGUCUUUUAAACGGACAAAGGUAAAUCACAGCUAA

[0299] CAAAACGUGAUGUUGGCUCACACGUAACCAAACACCUCUUUUUCAGAACAGAGAGCG

[0300] UUAAAAGUAAAGGCACUUCCAAGAGUAACACUGCUAAUGCGGGUUUCUGAGGGGUCA

[0301] UUCCCUUUUUAACUCAAAUGACUGUAUCCCAGCUUUCUUCCUGGUGUCUGAGGCCC

[0302] ACAAAGUCUCAGUACCUGAGAGUGGGCAGAUUGCAGCUUUGAGCCUGCAAGCCUGA

[0303] UUUACUAAAGCCCCAUUUAUCCAUUUCUUGAUGAUUCAAGCCGCCACUGUGGCAGG

[0304] GAAUGCCGCCUGGCUGUGAUGUAGUCAUGGCCUCCUGACUGCUAUAUUCUUGUCCU

[0305] AAUAACAUUCAUUGUUUGCCUUUUUAAUAAUUCCCAAAUAAAUUCUUGGGAUUUUUU

[0306] UUGGUAGAAAAUUUGCAGACUACUGAAAGGUACAGAACAAAGAAUCAGACAUUUGGC

[0307] CUCCUGACUGCCUCUGUUCAGUUUGCCAUUGUUCUUGAUAGAAUCGGCCAGGUCUA

[0308] GUGUUUUUUCUAGCCCGUCUUAGAACUUAUCCUUAAGCAAAUUAGUGGAUAGGAGG

[0309] UACUCUCAUCCCGCCCCCAUUCAGGCUGAUAGUAACAGCCUAGGUAGAGUCAACACA

[0310] UAAAAAAGUGUAAUUCCAGGGGAGGAGGAUUAGAAUAAGGACACAAAGGAAGGGAGG

[0311] AAAAUGUUCUUUGAGGCUGAAAUUCCAUUAAUUUUUCAUAGUAUUGAGUUUAUAUUU

[0312] GCCAUUGCAUCCUUCAAUCUUUCUAAAAAGGGAAUCCCCGGAACAUAAUAAAAUCUC

[0313] UUCUGUAUAGAAAAGCUACAGCUCCACACUAAGAGGAAUGCCGUCUGCCUUAAAGAA

[0314] UGGAAUCAUCAGUGACCAAGAAUUACUUCCAAGGAGAAAUUCAUUGAUAUUAAAACC

[0315] AAAGCCAGAUCCAGCUCAGCAAACCGACAGCCAGAACAGUGAUACGGAGCAGUAUUU

[0316] UAGAGAAUGGUUUUCCAAACCCGCCAACCUGCACGGUGUUAUUCUGCCACGUGUCU

[0317] CUGGAACACACAUAAAACUGUGGAAACUGUGCUACUUCCGCUGGGUUCCCGAGGCC

[0318] CAGAUCAGCCUGGGUGGCUCCAUCACAGCCUUUCACAAGCUCUCCCUCCUGGCUGA

[0319] UGAAGUCGACGUACUGAGCAGGAUGCUGCGGCAACAGCGCAGUGGCCCCCUGGAGG

[0320] CCUGCUAUGGGGAGCUGGGCCAGAGCAGGAUGUACUUCAACGCCAGCGGCCCUCAC

[0321] CACACCGACACCUCGGGGACACCGGAGUUUCUCUCCUCCUCAUUUCCAUUUUCUCC

[0322] UGUAGGGAAUCUU In one embodiment, the sequence from the 3’ UTR of Fan 1 is a sequence from the noncoding strand of Fan1.

[0323] In one embodiment, the 3’ UTR of Fan1 is as set forth in SEQ ID NOs: 5 to 8.

[0324] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to any one or more of SEQ ID NOs: 5 to 8.

[0325] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 5 to 8.

[0326] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 5 to 8.

[0327] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 5 to 8.

[0328] In one embodiment, the one or more contiguous nucleotide sequences are independently 100% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 5 to 8.

[0329] The sequence from the 3’ UTR of Fan 1 may be derived from either the coding or non-coding strand of Fan1.

[0330] MicroRNAs

[0331] MicroRNAs (miRNAs) are short non-coding RNAs that act to post-transcriptionally regulate target gene expression by their ability to bind to the 3’-UTR of target mRNAs and thereby either repress translation initiation / elongation or trigger mRNA decay. miRNAs typically comprise a seed that consists of the first 2 to 7 nucleotides (i.e. , counting from the 5' end of the miRNA) embedded within the seed region (nucleotides 1 to 8), which are responsible for Watson-Crick base pairing with their target mRNA (canonical sites). Not all nucleobases within the seed region are required to Watson-Crick base pair with a nucleobase of their target; some nucleotide within the seed may involve G:ll wobble pairing or contain imperfect seed match (non-canonical sites). Hence the seed region may not be 100% complementary to its target.

[0332] The miRNA termed ‘miR-124-3p’, is the mature active form of a miRNA that targets Fan1. miR-124-3p is produced from 3 genes encoded on different chromosomes. A further mature miRNA, miR-506-3p, has an identical seed sequence to miR-124-3p, but differs in its 3’- sequence outside of this seed region.

[0333] Further, there also exist ‘isomiRs’ of miRNAs, which differ only by a few nucleotides relative to a reference sequence and are generated by various processes. It will be understood that isomiRs of specific miRNAs referenced herein, including miR-124-3p, are to be encompassed by the reference to the reference miRNA alone. As such, reference to miR- 124-3p encompasses isomiRs of miR-124-3p.

[0334] In one embodiment, the functional nucleic acid molecule of the invention competes with a microRNA for binding to Fan1 mRNA.

[0335] In one embodiment, the contiguous nucleotide sequence of the functional nucleic acid of the invention is complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with a nucleotide sequence bound by a microRNA that targets the 3’-UTR of Fan1.

[0336] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within a microRNA that targets the 3’- UTR o Fan1.

[0337] In one embodiment, the microRNA is associated with modulating the onset of a triplet repeat disorder.

[0338] In one embodiment, the microRNA is associated with reducing the age at onset (AAO) of a triplet repeat disorder. In one embodiment, the microRNA is associated with increasing the age at onset (AAO) of a triplet repeat disorder.

[0339] In one embodiment, the microRNA is selected from the group consisting of: hsa-miR-299-3p, hsa-miR-3940-5p, hsa-miR-4265, hsa-miR-4507, hsa-miR-4657, hsa-miR-6748-5p, hsa-miR- 6759-5p, hsa-miR-6793-5p, hsa-miR-6796-5p, hsa-miR-6839-3p, hsa-miR-629-5p, hsa-miR- 1275, hsa-miR-193b-5p, hsa-miR-3675-5p, hsa-miR-4665-5p, hsa-miR-6751-5p, hsa-miR- 6803-5p, hsa-miR-6835-5p, hsa-miR-6842-5p, hsa-miR-6890-5p, hsa-miR-7109-5p, hsa- miR-7110-5p, hsa-miR-198, hsa-miR-1911-3p, hsa-miR-6753-5p, hsa-miR-1256, hsa-miR- 3910, hsa-miR-1910-3p, hsa-miR-2682-5p, hsa-miR-34a-5p, hsa-miR-34b-5p, hsa-miR-34c- 5p, hsa-miR-449a, hsa-miR-449b-5p, hsa-miR-449c-5p, hsa-miR-548au-3p, hsa-miR-584-3p, hsa-miR-6511a-5p, hsa-miR-6808-5p, hsa-miR-6893-5p, hsa-miR-940, hsa-miR-3714, hsa- miR-125b-1-3p, hsa-miR-155-5p, hsa-miR-3621 , hsa-miR-3610, hsa-miR-4665-3p, hsa-miR- 4755-3p, hsa-miR-3622a-5p, hsa-miR-5582-5p, hsa-miR-124-3p, and hsa-miR-506-3p, or an isomiR thereof.

[0340] In another embodiment, the microRNA is selected from the group consisting of the miRNAs defined in Table 1 , i.e.,: hsa-miR-299-3p, hsa-miR-3940-5p, hsa-miR-4265, hsa-miR-4507, hsa-miR-4657, hsa-miR-6748-5p, hsa-miR-6759-5p, hsa-miR-6793-5p, hsa-miR-6796-5p, hsa-miR-6839-3p, hsa-miR-629-5p, hsa-miR-1275, hsa-miR-193b-5p, hsa-miR-3675-5p, hsa- miR-4665-5p, hsa-miR-6751-5p, hsa-miR-6803-5p, hsa-miR-6835-5p, hsa-miR-6842-5p, hsa-miR-6890-5p, hsa-miR-7109-5p, hsa-miR-7110-5p, hsa-miR-198, hsa-miR-1911-3p, hsa- miR-6753-5p, hsa-miR-1256, hsa-miR-3910, hsa-miR-1910-3p, hsa-miR-2682-5p, hsa-miR- 34a-5p, hsa-miR-34b-5p, hsa-miR-34c-5p, hsa-miR-449a, hsa-miR-449b-5p, hsa-miR-449c- 5p, hsa-miR-548au-3p, hsa-miR-584-3p, hsa-miR-6511a-5p, hsa-miR-6808-5p, hsa-miR- 6893-5p, hsa-miR-940, hsa-miR-3714, hsa-miR-125b-1-3p, hsa-miR-155-5p, hsa-miR-3621 , hsa-miR-3610, hsa-miR-4665-3p, hsa-miR-4755-3p, hsa-miR-3622a-5p, hsa-miR-5582-5p, hsa-miR-124-3p, hsa-miR-506-3p, hsa-miR-10527-5p, hsa-miR-1207-5p, hsa-miR-1262, hsa- miR-1273h-3p, hsa-miR-1287-3p, hsa-miR-1301-3p, hsa-miR-1303, hsa-miR-1304-5p, hsa- miR-1343-5p, hsa-miR-141-3p, hsa-miR-186-5p, hsa-miR-1914-3p, hsa-miR-200a-3p, hsa- miR-204-5p, hsa-miR-211-5p, hsa-miR-23a-5p, hsa-miR-23b-5p, hsa-miR-3120-3p, hsa-miR- 3122, hsa-miR-3182, hsa-miR-3199, hsa-miR-335-3p, hsa-miR-3681-5p, hsa-miR-3913-5p, hsa-miR-3925-3p, hsa-miR-4284, hsa-miR-4469, hsa-miR-450b-5p, hsa-miR-4640-5p, hsa- miR-4649-3p, hsa-miR-4650-3p, hsa-miR-4667-3p, hsa-miR-4677-5p, hsa-miR-4693-3p, hsa-miR-4701-3p, hsa-miR-4726-5p, hsa-miR-4763-3p, hsa-miR-4768-5p, hsa-miR-4771 , hsa-miR-4775, hsa-miR-4776-3p, hsa-miR-4797-3p, hsa-miR-485-5p, hsa-miR-5002-3p, hsa- miR-5008-5p, hsa-miR-5089-5p, hsa-miR-513b-5p, hsa-miR-5190, hsa-miR-5191 , hsa-miR- 5193, hsa-miR-5194, hsa-miR-543, hsa-miR-545-3p, hsa-miR-548a-3p, hsa-miR-548aa, hsa- miR-548an, hsa-miR-548ap-3p, hsa-miR-548ar-3p, hsa-miR-548az-3p, hsa-miR-548bc, hsa- miR-548e-3p, hsa-miR-548n, hsa-miR-548t-3p, hsa-miR-589-3p, hsa-miR-6730-5p, hsa-miR- 6736-5p, hsa-miR-6738-5p, hsa-miR-6740-5p, hsa-miR-676-3p, hsa-miR-6770-5p, hsa-miR- 6826-3p, hsa-miR-6831-5p, hsa-miR-6833-3p, hsa-miR-6845-3p, hsa-miR-6870-3p, hsa- miR-6875-3p, hsa-miR-6878-3p, hsa-miR-6884-3p, hsa-miR-7108-3p, hsa-miR-7974, hsa- miR-802, hsa-miR-939-5p, hsa-let-7f-2-3p, hsa-miR-11181-3p, hsa-miR-1185-1 -3p, hsa-miR- 1185-2-3p, hsa-miR-1197, hsa-miR-12129, hsa-miR-12136, hsa-miR-1228-3p, hsa-miR-124- 3p, hsa-miR-1264, hsa-miR-1265, hsa-miR-1276, hsa-miR-1288-5p, hsa-miR-1290, hsa-miR- 1299, hsa-miR-130a-5p, hsa-miR-135a-2-3p, hsa-miR-135b-3p, hsa-miR-138-1-3p, hsa-miR- 145-5p, hsa-miR-15b-3p, hsa-miR-16-1-3p, hsa-miR-181 a-5p, hsa-miR-181 b-5p, hsa-miR- 181c-5p, hsa-miR-181 d-5p, hsa-miR-187-3p, hsa-miR-194-5p, hsa-miR-196a-3p, hsa-miR- 196b-3p, hsa-miR-197-3p, hsa-miR-19a-5p, hsa-miR-19b-1-5p, hsa-miR-216b-5p, hsa-miR- 2276-3p, hsa-miR-2276-5p, hsa-miR-2278, hsa-miR-2355-3p, hsa-miR-27a-5p, hsa-miR- 29a-5p, hsa-miR-3064-5p, hsa-miR-3085-3p, hsa-miR-3125, hsa-miR-3127-3p, hsa-miR- 3135a, hsa-miR-3143, hsa-miR-3150a-3p, hsa-miR-3154, hsa-miR-3158-3p, hsa-miR-3159, hsa-miR-3160-5p, hsa-miR-3163, hsa-miR-3184-3p, hsa-miR-3189-5p, hsa-miR-3191-5p, hsa-miR-3202, hsa-miR-331-3p, hsa-miR-342-3p, hsa-miR-346, hsa-miR-3605-3p, hsa-miR- 3663-5p, hsa-miR-3677-5p, hsa-miR-372-5p, hsa-miR-376b-5p, hsa-miR-378a-5p, hsa-miR- 3916, hsa-miR-3929, hsa-miR-3938, hsa-miR-424-3p, hsa-miR-4254, hsa-miR-4282, hsa- miR-4323, hsa-miR-4428, hsa-miR-4443, hsa-miR-4451 , hsa-miR-4476, hsa-miR-4478, hsa- miR-4502, hsa-miR-4503, hsa-miR-4515, hsa-miR-4679, hsa-miR-4694-5p, hsa-miR-4699- 3p, hsa-miR-4729, hsa-miR-4738-3p, hsa-miR-4739, hsa-miR-4745-5p, hsa-miR-4755-5p, hsa-miR-4756-5p, hsa-miR-4766-5p, hsa-miR-4773, hsa-miR-4781-3p, hsa-miR-4803, hsa- miR-488-3p, hsa-miR-498-5p, hsa-miR-5001-3p, hsa-miR-5006-3p, hsa-miR-5008-3p, hsa- miR-505-3p, hsa-miR-506-3p, hsa-miR-506-5p, hsa-miR-5088-3p, hsa-miR-5089-3p, hsa- miR-5094, hsa-miR-5189-3p, hsa-miR-5195-3p, hsa-miR-539-5p, hsa-miR-548a-5p, hsa- miR-548ab, hsa-miR-548ad-5p, hsa-miR-548ae-5p, hsa-miR-548ag, hsa-miR-548ai, hsa- miR-548ak, hsa-miR-548am-5p, hsa-miR-548ap-5p, hsa-miR-548aq-5p, hsa-miR-548ar-5p, hsa-miR-548as-5p, hsa-miR-548au-5p, hsa-miR-548ay-5p, hsa-miR-548az-5p, hsa-miR- 548b-5p, hsa-miR-548ba, hsa-miR-548bb-5p, hsa-miR-548c-5p, hsa-miR-548d-5p, hsa-miR- 548g-3p, hsa-miR-548h-5p, hsa-miR-548i, hsa-miR-548j-5p, hsa-miR-548m, hsa-miR-548o- 5p, hsa-miR-548p, hsa-miR-548t-5p, hsa-miR-548v, hsa-miR-548w, hsa-miR-548y, hsa-miR- 5586-5p, hsa-miR-559, hsa-miR-5591-5p, hsa-miR-5693, hsa-miR-570-5p, hsa-miR-578, hsa-miR-596, hsa-miR-601 , hsa-miR-6081 , hsa-miR-643, hsa-miR-6501-3p, hsa-miR-6504- 5p, hsa-miR-6511a-3p, hsa-miR-6511 b-3p, hsa-miR-6513-5p, hsa-miR-660-3p, hsa-miR-661 , hsa-miR-663b, hsa-miR-664a-3p, hsa-miR-6726-5p, hsa-miR-6734-5p, hsa-miR-6736-3p, hsa-miR-6737-3p, hsa-miR-6738-3p, hsa-miR-6739-3p, hsa-miR-6742-3p, hsa-miR-6746-3p, hsa-miR-6756-3p, hsa-miR-676-5p, hsa-miR-6761-5p, hsa-miR-6763-3p, hsa-miR-6763-5p, hsa-miR-6791-3p, hsa-miR-6796-3p, hsa-miR-6818-3p, hsa-miR-6825-5p, hsa-miR-6829-3p, hsa-miR-6833-5p, hsa-miR-6843-3p, hsa-miR-6848-3p, hsa-miR-6854-5p, hsa-miR-6859-5p, hsa-miR-6876-5p, hsa-miR-6894-5p, hsa-miR-6895-3p, hsa-miR-7114-5p, hsa-miR-7157-3p, hsa-miR-765, hsa-miR-766-5p, hsa-miR-7852-3p, hsa-miR-7977, hsa-miR-7978, hsa-miR- 8485, hsa-miR-888-5p, hsa-miR-920, hsa-miR-943, hsa-miR-10398-5p, hsa-miR-105-5p, hsa-miR-10a-3p, hsa-miR-12115, hsa-miR-1236-3p, hsa-miR-1253, hsa-miR-125b-2-3p, hsa- miR-1286, hsa-miR-129-5p, hsa-miR-1293, hsa-miR-1302, hsa-miR-1324, hsa-miR-1343-3p, hsa-miR-1470, hsa-miR-147b-5p, hsa-miR-186-3p, hsa-miR-1912-5p, hsa-miR-196a-5p, hsa- miR-196b-5p, hsa-miR-1976, hsa-miR-205-5p, hsa-miR-2116-5p, hsa-miR-22-5p, hsa-miR- 221-5p, hsa-miR-24-3p, hsa-miR-2467-5p, hsa-miR-2682-3p, hsa-miR-26b-3p, hsa-miR-30a- 3p, hsa-miR-30d-3p, hsa-miR-30e-3p, hsa-miR-31-3p, hsa-miR-3133, hsa-miR-3145-3p, hsa- miR-3152-5p, hsa-miR-3155a, hsa-miR-3155b, hsa-miR-3166, hsa-miR-3171 , hsa-miR-3175, hsa-miR-3177-3p, hsa-miR-3184-5p, hsa-miR-3188, hsa-miR-3190-3p, hsa-miR-324-5p, hsa- miR-326, hsa-miR-330-5p, hsa-miR-3529-5p, hsa-miR-3612, hsa-miR-362-5p, hsa-miR- 3621 , hsa-miR-363-5p, hsa-miR-3655, hsa-miR-365a-5p, hsa-miR-365b-5p, hsa-miR-3675- 5p, hsa-miR-3680-3p, hsa-miR-3682-3p, hsa-miR-3682-5p, hsa-miR-3686, hsa-miR-3688-5p, hsa-miR-376a-3p, hsa-miR-376b-3p, hsa-miR-379-5p, hsa-miR-3925-5p, hsa-miR-3940-3p, hsa-miR-3942-3p, hsa-miR-423-5p, hsa-miR-4273, hsa-miR-4287, hsa-miR-4298, hsa-miR- 4457, hsa-miR-4483, hsa-miR-4484, hsa-miR-450a-1-3p, hsa-miR-4632-3p, hsa-miR-4659a- 3p, hsa-miR-4659a-5p, hsa-miR-4659b-3p, hsa-miR-4660, hsa-miR-4668-3p, hsa-miR-4685- 3p, hsa-miR-4685-5p, hsa-miR-4687-3p, hsa-miR-4695-5p, hsa-miR-4707-5p, hsa-miR- 4722-5p, hsa-miR-4724-5p, hsa-miR-4727-3p, hsa-miR-4733-5p, hsa-miR-4736, hsa-miR- 4740-3p, hsa-miR-4742-3p, hsa-miR-4757-5p, hsa-miR-4762-3p, hsa-miR-4764-3p, hsa- miR-4769-3p, hsa-miR-4774-3p, hsa-miR-4779, hsa-miR-4799-5p, hsa-miR-484, hsa-miR- 486-5p, hsa-miR-495-3p, hsa-miR-500b-5p, hsa-miR-501-5p, hsa-miR-507, hsa-miR-518a- 5p, hsa-miR-526b-5p, hsa-miR-527, hsa-miR-542-5p, hsa-miR-548as-3p, hsa-miR-548at-3p, hsa-miR-548aw, hsa-miR-548ay-3p, hsa-miR-551b-5p, hsa-miR-557, hsa-miR-5582-3p, hsa- miR-5584-5p, hsa-miR-5587-3p, hsa-miR-5590-5p, hsa-miR-5687, hsa-miR-5688, hsa-miR- 572, hsa-miR-576-5p, hsa-miR-590-3p, hsa-miR-6074, hsa-miR-6089, hsa-miR-6128, hsa- miR-623, hsa-miR-629-3p, hsa-miR-650, hsa-miR-6508-3p, hsa-miR-6511 b-5p, hsa-miR- 6515-3p, hsa-miR-6516-5p, hsa-miR-6721-5p, hsa-miR-6728-5p, hsa-miR-6729-3p, hsa- miR-6741-5p, hsa-miR-6745, hsa-miR-6750-5p, hsa-miR-6756-5p, hsa-miR-6764-3p, hsa- miR-6765-5p, hsa-miR-6766-5p, hsa-miR-6768-3p, hsa-miR-6774-5p, hsa-miR-6777-5p, hsa-miR-6781-3p, hsa-miR-6783-3p, hsa-miR-6792-5p, hsa-miR-6795-3p, hsa-miR-6807-5p, hsa-miR-6809-3p, hsa-miR-6811-5p, hsa-miR-6817-5p, hsa-miR-6820-5p, hsa-miR-6823-3p, hsa-miR-6824-3p, hsa-miR-6837-5p, hsa-miR-6844, hsa-miR-6873-3p, hsa-miR-6889-5p, hsa-miR-6890-5p, hsa-miR-6891-3p, hsa-miR-7-1-3p, hsa-miR-7-2-3p, hsa-miR-7113-3p, hsa-miR-7113-5p, hsa-miR-7151-5p, hsa-miR-7156-3p, hsa-miR-7156-5p, hsa-miR-7162-3p, hsa-miR-766-3p, hsa-miR-769-3p, hsa-miR-7853-5p, hsa-miR-8057, hsa-miR-8073, hsa- miR-874-5p, hsa-miR-885-5p, hsa-miR-887-5p, hsa-miR-95-3p, hsa-miR-9500, hsa-miR- 9903, hsa-miR-9983-3p, hsa-let-7a-3p, hsa-let-7a-5p, hsa-let-7b-3p, hsa-let-7b-5p, hsa-let- 7c-5p, hsa-let-7d-5p, hsa-let-7e-5p, hsa-let-7f-1-3p, hsa-let-7f-5p, hsa-let-7g-5p, hsa-let-7i- 5p, hsa-miR-1-3p, hsa-miR-10392-3p, hsa-miR-10526-3p, hsa-miR-106a-5p, hsa-miR-106b- 5p, hsa-miR-10b-3p, hsa-miR-1183, hsa-miR-1185-5p, hsa-miR-1199-3p, hsa-miR-1199-5p, hsa-miR-1200, hsa-miR-1208, hsa-miR-12124, hsa-miR-12132, hsa-miR-12135, hsa-miR- 122-3p, hsa-miR-1226-5p, hsa-miR-122b-3p, hsa-miR-122b-5p, hsa-miR-1237-3p, hsa-miR- 1245a, hsa-miR-1245b-5p, hsa-miR-1247-5p, hsa-miR-1248, hsa-miR-1251-3p, hsa-miR- 1252-3p, hsa-miR-125b-1-3p, hsa-miR-1261 , hsa-miR-1285-3p, hsa-miR-1288-3p, hsa-miR- 1291 , hsa-miR-1296-3p, hsa-miR-1298-5p, hsa-miR-1306-5p, hsa-miR-130b-5p, hsa-miR- 132-3p, hsa-miR-1323, hsa-miR-134-3p, hsa-miR-135a-5p, hsa-miR-135b-5p, hsa-miR-136- 3p, hsa-miR-136-5p, hsa-miR-139-5p, hsa-miR-140-3p, hsa-miR-1468-3p, hsa-miR-149-3p, hsa-miR-149-5p, hsa-miR-153-5p, hsa-miR-1537-3p, hsa-miR-155-5p, hsa-miR-17-5p, hsa- miR-181 a-2-3p, hsa-miR-181d-3p, hsa-miR-187-5p, hsa-miR-1909-3p, hsa-miR-191-5p, hsa- miR-194-3p, hsa-miR-200c-5p, hsa-miR-202-3p, hsa-miR-203a-3p, hsa-miR-2052, hsa-miR- 206, hsa-miR-208b-5p, hsa-miR-20a-5p, hsa-miR-20b-3p, hsa-miR-20b-5p, hsa-miR-21-3p, hsa-miR-211-3p, hsa-miR-2110, hsa-miR-2115-3p, hsa-miR-212-3p, hsa-miR-216a-5p, hsa- miR-216b-3p, hsa-miR-217-3p, hsa-miR-218-2-3p, hsa-miR-218-5p, hsa-miR-221-3p, hsa- miR-222-3p, hsa-miR-222-5p, hsa-miR-2277-3p, hsa-miR-2392, hsa-miR-25-3p, hsa-miR- 27a-3p, hsa-miR-27b-3p, hsa-miR-29b-2-5p, hsa-miR-302a-5p, hsa-miR-3064-3p, hsa-miR- 3074-5p, hsa-miR-3115, hsa-miR-3116, hsa-miR-3130-3p, hsa-miR-3136-3p, hsa-miR-3136- 5p, hsa-miR-3137, hsa-miR-3142, hsa-miR-3144-5p, hsa-miR-3148, hsa-miR-3149, hsa-miR- 3150b-3p, hsa-miR-3152-3p, hsa-miR-3157-5p, hsa-miR-3160-3p, hsa-miR-3162-5p, hsa- miR-3167, hsa-miR-3173-3p, hsa-miR-3179, hsa-miR-3180-5p, hsa-miR-3187-5p, hsa-miR- 3191-3p, hsa-miR-3194-5p, hsa-miR-32-5p, hsa-miR-3200-3p, hsa-miR-320a-3p, hsa-miR- 320a-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-324-3p, hsa-miR-328-3p, hsa-miR-329-3p, hsa-miR-330-3p, hsa-miR-331-5p, hsa-miR-335-5p, hsa-miR-33a-3p, hsa- miR-340-3p, hsa-miR-345-5p, hsa-miR-34a-3p, hsa-miR-34b-3p, hsa-miR-3605-5p, hsa-miR- 3609, hsa-miR-361-3p, hsa-miR-3610, hsa-miR-3613-3p, hsa-miR-3614-3p, hsa-miR-3616- 5p, hsa-miR-3617-3p, hsa-miR-362-3p, hsa-miR-3620-3p, hsa-miR-3622a-5p, hsa-miR-363- 3p, hsa-miR-365a-3p, hsa-miR-365b-3p, hsa-miR-3662, hsa-miR-3663-3p, hsa-miR-3671 , hsa-miR-3675-3p, hsa-miR-3679-3p, hsa-miR-3679-5p, hsa-miR-3688-3p, hsa-miR-3689a- 5p, hsa-miR-3689b-5p, hsa-miR-3689e, hsa-miR-3689f, hsa-miR-369-3p, hsa-miR-3690, hsa-miR-3691-5p, hsa-miR-370-3p, hsa-miR-3714, hsa-miR-371a-5p, hsa-miR-371 b-5p, hsa- miR-373-5p, hsa-miR-375-3p, hsa-miR-377-3p, hsa-miR-378g, hsa-miR-383-5p, hsa-miR- 3910, hsa-miR-3919, hsa-miR-3920, hsa-miR-3928-3p, hsa-miR-3934-3p, hsa-miR-3940-5p, hsa-miR-3943, hsa-miR-409-3p, hsa-miR-421 , hsa-miR-4270, hsa-miR-4288, hsa-miR-4290, hsa-miR-4292, hsa-miR-4429, hsa-miR-4446-3p, hsa-miR-4456, hsa-miR-4458, hsa-miR- 4474-3p, hsa-miR-4475, hsa-miR-4477a, hsa-miR-4496, hsa-miR-4500, hsa-miR-4507, hsa- miR-4516, hsa-miR-4519, hsa-miR-4633-3p, hsa-miR-4639-5p, hsa-miR-4646-3p, hsa-miR- 4652-3p, hsa-miR-4652-5p, hsa-miR-4653-3p, hsa-miR-4661-3p, hsa-miR-4665-3p, hsa- miR-4676-5p, hsa-miR-4677-3p, hsa-miR-4690-5p, hsa-miR-4691-3p, hsa-miR-4709-5p, hsa-miR-4711-3p, hsa-miR-4712-3p, hsa-miR-4713-5p, hsa-miR-4714-3p, hsa-miR-4715-3p, hsa-miR-4719, hsa-miR-4720-3p, hsa-miR-4728-3p, hsa-miR-4728-5p, hsa-miR-4731-3p, hsa-miR-4731-5p, hsa-miR-4732-5p, hsa-miR-4734, hsa-miR-4738-5p, hsa-miR-4740-5p, hsa-miR-4743-3p, hsa-miR-4744, hsa-miR-4747-3p, hsa-miR-4752, hsa-miR-4753-3p, hsa- miR-4755-3p, hsa-miR-4758-3p, hsa-miR-4763-5p, hsa-miR-4764-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4782-5p, hsa-miR-4784, hsa-miR-4788, hsa-miR-4793-3p, hsa- miR-4793-5p, hsa-miR-4794, hsa-miR-4796-3p, hsa-miR-4797-5p, hsa-miR-4801 , hsa-miR- 4804-3p, hsa-miR-488-5p, hsa-miR-490-3p, hsa-miR-499b-5p, hsa-miR-5002-5p, hsa-miR- 5088-5p, hsa-miR-513a-3p, hsa-miR-513c-3p, hsa-miR-515-5p, hsa-miR-516b-5p, hsa-miR- 5189-5p, hsa-miR-5196-3p, hsa-miR-519d-3p, hsa-miR-520g-3p, hsa-miR-520h, hsa-miR- 526b-3p, hsa-miR-541-5p, hsa-miR-544b, hsa-miR-548ac, hsa-miR-548ad-3p, hsa-miR- 548ae-3p, hsa-miR-548ah-3p, hsa-miR-548ah-5p, hsa-miR-548aj-3p, hsa-miR-548aj-5p, hsa-miR-548am-3p, hsa-miR-548aq-3p, hsa-miR-548av-3p, hsa-miR-548bb-3p, hsa-miR- 548d-3p, hsa-miR-548e-5p, hsa-miR-548f-5p, hsa-miR-548g-5p, hsa-miR-548h-3p, hsa-miR- 548j-3p, hsa-miR-548k, hsa-miR-548l, hsa-miR-548o-3p, hsa-miR-548q, hsa-miR-548x-5p, hsa-miR-548z, hsa-miR-550a-3p, hsa-miR-558, hsa-miR-5582-5p, hsa-miR-5680, hsa-miR- 5690, hsa-miR-5692a, hsa-miR-5692c, hsa-miR-5696, hsa-miR-5699-5p, hsa-miR-5702, hsa- miR-5703, hsa-miR-5706, hsa-miR-573, hsa-miR-579-3p, hsa-miR-580-3p, hsa-miR-583, hsa-miR-603, hsa-miR-6090, hsa-miR-612, hsa-miR-615-5p, hsa-miR-616-3p, hsa-miR-616- 5p, hsa-miR-624-5p, hsa-miR-627-3p, hsa-miR-629-5p, hsa-miR-632, hsa-miR-642a-3p, hsa- miR-642a-5p, hsa-miR-642b-3p, hsa-miR-642b-5p, hsa-miR-647, hsa-miR-649, hsa-miR- 6499-3p, hsa-miR-6505-5p, hsa-miR-6507-3p, hsa-miR-6507-5p, hsa-miR-651-3p, hsa-miR- 6510-3p, hsa-miR-6510-5p, hsa-miR-6512-3p, hsa-miR-6515-5p, hsa-miR-6529-3p, hsa- miR-656-3p, hsa-miR-664a-5p, hsa-miR-664b-3p, hsa-miR-6715a-3p, hsa-miR-6720-5p, hsa-miR-6722-3p, hsa-miR-6724-5p, hsa-miR-6727-5p, hsa-miR-6735-3p, hsa-miR-6749-3p, hsa-miR-6751-3p, hsa-miR-6754-5p, hsa-miR-6757-3p, hsa-miR-6758-3p, hsa-miR-6758-5p, hsa-miR-6760-3p, hsa-miR-6760-5p, hsa-miR-6767-3p, hsa-miR-6769a-3p, hsa-miR-6771- 3p, hsa-miR-6773-5p, hsa-miR-6774-3p, hsa-miR-6775-3p, hsa-miR-6778-3p, hsa-miR- 6782-5p, hsa-miR-6783-5p, hsa-miR-6784-3p, hsa-miR-6785-5p, hsa-miR-6787-3p, hsa- miR-6791-5p, hsa-miR-6792-3p, hsa-miR-6798-5p, hsa-miR-6799-5p, hsa-miR-6800-3p, hsa-miR-6801-3p, hsa-miR-6810-3p, hsa-miR-6810-5p, hsa-miR-6813-3p, hsa-miR-6827-3p, hsa-miR-6827-5p, hsa-miR-6830-3p, hsa-miR-6830-5p, hsa-miR-6832-5p, hsa-miR-6834-5p, hsa-miR-6836-3p, hsa-miR-6836-5p, hsa-miR-6839-3p, hsa-miR-6842-3p, hsa-miR-6851-5p, hsa-miR-6852-5p, hsa-miR-6856-3p, hsa-miR-6856-5p, hsa-miR-6857-5p, hsa-miR-6858-3p, hsa-miR-6860, hsa-miR-6861-5p, hsa-miR-6862-3p, hsa-miR-6865-3p, hsa-miR-6868-3p, hsa-miR-6885-3p, hsa-miR-6889-3p, hsa-miR-6890-3p, hsa-miR-6891-5p, hsa-miR-6892-3p, hsa-miR-6893-3p, hsa-miR-7108-5p, hsa-miR-7109-3p, hsa-miR-7152-3p, hsa-miR-7152-5p, hsa-miR-7154-3p, hsa-miR-7155-3p, hsa-miR-718, hsa-miR-758-5p, hsa-miR-7704, hsa- miR-8062, hsa-miR-873-5p, hsa-miR-876-5p, hsa-miR-877-3p, hsa-miR-889-5p, hsa-miR- 892a, hsa-miR-892c-5p, hsa-miR-9-3p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93-5p, hsa-miR-939-3p, hsa-miR-98-3p, hsa-miR-98-5p, hsa-miR-9985, hsa-miR-99a-3p, hsa-miR- 99b-3p, or an isomiR thereof.

[0341] In one embodiment, the microRNA is miR-124-3p or isomiRs thereof.

[0342] In one embodiment, the microRNA comprises a sequence selected from the group consisting of: SEQ ID NOs: 9 to 60, or SEQ ID NO: 61 to 944.

[0343] In one embodiment, the microRNA consists of a sequence selected from the group consisting of: SEQ ID NOs: 9 to 60, or SEQ ID NO: 61 to 944. microRNAs are described in Table 1 below.

[0344] Table 1 - Putative Fan 7-tarqetinq MicroRNAs

[0345]

[0346]

[0347]

[0348] Seed sequences displayed in Table 1 represent nucleotides 2 to 7 (as read 5’-3’) of the miRNA. It will be understood that the ‘Target sequence’ corresponds to a sequence, e.g., a Fan1 sequence, that is bound by the miRNA and represents the reverse complement of the sequence identified as the ‘Seed sequence’. Thus, both seed and target sequences are encompassed by the invention.

[0349] In one embodiment, the functional nucleic acid molecule of the invention competes with one or more of the microRNAs defined in Table 1 , or an isomiR thereof, for binding to Fan1 mRNA.

[0350] In one embodiment, the contiguous nucleotide sequence of the functional nucleic acid of the invention is complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with a nucleotide sequence (i.e. , the target sequence) bound by any one or more of the microRNAs defined in Table 1, or an isomiR thereof,.

[0351] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in T able 1 , or an isomiR thereof.

[0352] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in Table 1, or an isomiR thereof.

[0353] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in Table 1, or an isomiR thereof.

[0354] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in Table 1, or an isomiR thereof. In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in Table 1, or an isomiR thereof.

[0355] In one embodiment, the one or more contiguous nucleotide sequences are independletly 100% complementary to a contiguous nucleotide sequence within one or more microRNAs defined in Table 1 , or an isomiR thereof.

[0356] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within SEQ ID NOs: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0357] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within SEQ ID NO: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0358] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within SEQ ID NO: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0359] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within SEQ ID NO: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0360] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within SEQ ID NO: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0361] In one embodiment, the one or more contiguous nucleotide sequences are independently 100% complementary to a contiguous nucleotide sequence within SEQ ID NO: 9 to 60, and / or SEQ ID NOs 61 to 944.

[0362] In one embodiment, the functional nucleic acid molecule binds to one or more microRNAs defined in Table 1 , or an isomiR thereof, thereby preventing binding to Fan1 mRNA. In one embodiment, the functional nucleic acid molecule comprises one or more contiguous nucleotide sequences, wherein the one or more contiguous nucleotide sequences are complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with a nucleotide sequence bound by one or more microRNAs defined in Table 1 , or an isomiR thereof.

[0363] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 1 nucleotide within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0364] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 2 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0365] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 3 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0366] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 4 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0367] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 5 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0368] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 6 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof. In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 7 nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0369] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with all of the nucleotides within the nucleotide sequence bound by one or more microRNAs defined in Table 1, or an isomiR thereof.

[0370] The endogenous microRNA miR-124-3p targets Fan1. The sequence of miR-124-3p is set out in SEQ ID NO: 59.

[0371] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA.

[0372] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA.

[0373] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA.

[0374] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA.

[0375] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA.

[0376] In one embodiment, the one or more contiguous nucleotide sequences are 100% complementary to a contiguous nucleotide sequence within the miR-124-3p microRNA. In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or at least 100% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0377] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0378] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0379] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0380] In one embodiment, the one or more contiguous nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0381] In one embodiment, the one or more contiguous nucleotide sequences are 100% complementary to a contiguous nucleotide sequence within SEQ ID NO: 59.

[0382] In one embodiment, the functional nucleic acid molecule competes with the microRNA miR- 124-3p for binding to Fan1 mRNA.

[0383] In one embodiment, the functional nucleic acid molecule binds to the microRNA miR-124-3p, preventing binding to Fan1 mRNA.

[0384] In one embodiment, the functional nucleic acid molecule comprises one or more contiguous nucleotide sequences, wherein the one or more contiguous nucleotide sequences is complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with a nucleotide sequence bound by the microRNA miR-124-3p.

[0385] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 1 nucleotide within the nucleotide sequence bound by the microRNA miR- 124-3p. In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 2 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0386] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 3 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0387] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 4 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0388] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 5 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0389] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 6 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0390] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with 7 nucleotides within the nucleotide sequence bound by the microRNA miR- 124-3p.

[0391] In one embodiment, the one or more contiguous nucleotide sequences are independently complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with all of the nucleotides within the nucleotide sequence bound by the microRNA miR-124-3p.

[0392] By overlapping, it is meant that any given nucleotide bound by a specified miRNA is also bound by the functional nucleic acid. Chemical modifications

[0393] The functional nucleic acid molecules provided herein may comprise or consist of chemically modified substituents. That is, substituents that differ relative to the common naturally occurring DNA and RNA nucleotides.

[0394] Chemically modified functional nucleic acid molecules comprise one or more modifications as compared with a functional nucleic acid molecules consisting of common naturally occurring (i.e., ‘unmodified’) DNA and RNA nucleotides. Said modified functional nucleic acid molecules comprise one or more modified nucleosides and / or, independently, one or more modified internucleoside linkage.

[0395] The term “modification” or "chemical modification" refers to a structural change in, or on, the most common, natural ribonucleotides: adenosine, guanosine, cytidine, thymidine, or uridine ribonucleotides. In particular, the chemical modifications described herein may be changes in or on a nucleobase (i.e. a chemical base modification), or in or on a sugar (i.e. a chemical sugar modification). The chemical modifications may be introduced co-transcriptionally (e.g. by substitution of one or more nucleotides with a modified nucleotide during synthesis), or post-transcriptionally (e.g. by the action of an enzyme), or via chemical (i.e., not transcription-based) oligonucleotide synthesis.

[0396] Chemical modifications typically constitute chemical modifications of the nucleobase comprising the nucleoside, chemical modifications of the sugar moiety comprising the oligonucleotide and / or modified internucleoside linkages joining nucleosides (which themselves may be modified or unmodified).

[0397] In one embodiment, the functional nucleic acid molecule comprises DNA nucleotides, RNA nucleotides, modified DNA nucleotides, and / or modified RNA nucleotides. In one embodiment, the functional nucleic acid comprises DNA and / or RNA analogues.

[0398] In one embodiment, the functional nucleic acid molecule comprises DNA nucleosides, RNA nucleosides, modified DNA nucleosides, and / or modified RNA nucleosides.

[0399] It will be understood that a functional RNA molecule or a functional DNA molecule of the invention may refer to a functional RNA / DNA comprising only unmodified RNA / DNA nucleotides; a functional RNA / DNA comprising both modified and unmodified RNA / DNA nucleotides; and a functional RNA / DNA comprising all modified RNA / DNA nucleotides.

[0400] Thus, reference to an RNA or DNA shall include reference to modified RNA / DNAs according to the invention.

[0401] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of the nucleobase comprising the nucleosides therein.

[0402] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of the sugar moiety comprising the nucleosides therein.

[0403] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of internucleoside linkages joining nucleosides.

[0404] In one embodiment, the functional nucleic acid molecule comprises one or more: modified nucleobases, modified sugar moieties, and / or modified internucleoside linkages.

[0405] In one embodiment, the functional nucleic acid molecule comprises between 1 and 40 modified nucleosides.

[0406] In one embodiment, the functional nucleic acid molecule comprises one or more modified nucleosides.

[0407] In one embodiment, the functional nucleic acid molecule comprises no modified nucleosides.

[0408] In one embodiment, the functional nucleic acid molecule comprises one or more modified nucleosides such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 modified nucleosides.

[0409] In one embodiment, the functional nucleic acid molecule comprises modified nucleosides wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the nucleosides are modified nucleosides.

[0410] Chemical modifications are known in the art, for example as described in The RNA

[0411] Modification Database provided by The RNA Institute (https: / / mods.rna.albany.edu / mods / ). Exemplary chemical modifications are described in detail elsewhere, including but not limited to, WO 2023 / 092057, WO 2023 / 064707, and WO 2023 / 023550, which are incorporated herein by reference.

[0412] Modified nucleobases

[0413] In one embodiment, the chemical modification is a chemical base modification, i.e., a modification of the nucleobase moiety. The chemical base modification may be selected from a modification of an adenine, cytosine and / or uracil nucleobase.

[0414] In one embodiment, the modified nucleobase is modified by alkylation, such as methylation, and / or isomerisation.

[0415] In some embodiments, the modified nucleobase refers to a nucleosides that is modified to lack a nucleobase. Hence, in some embodiments the modified nucleoside is an abasic nucleoside.

[0416] The modified nucleobases can be selected from the group consisting of: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines.

[0417] The modified nucleobases can be selected from the group consisting of: 2- aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyl adenine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-propynyl uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6- azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5 - trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F- adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3 - deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N- benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases.

[0418] Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2- one, 1,3-diazaphenothiazine-2-one and 9-(2 -aminoethoxy)-1, 3 -diazaphenoxazine-2 -one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases that may be known to those skilled in the art.

[0419] In a further embodiment, the chemical base modification is selected from the group consisting of: Pseudouridine (^P), N1 -Methylpseudouridine (Nl m^P), 5-Methylcytidine (m5C) and N6-Methyladenosine (m6A). In a further embodiment, the chemical base modification is selected from the group consisting of: Pseudouridine, N1 -Methylpseudouridine and N6- Methyladenosine.

[0420] Modified sugar moieties

[0421] In one embodiment, the chemical modification is a chemical sugar modification, i.e. , a modification of the sugar moiety.

[0422] Modified sugar moieties comprise a modified ribose ring structure as compared with the ribose sugar (i.e., deoxy and non-deoxy) as found in unmodified or naturally occurring DNA or RNA.

[0423] Sugars may be modified, for example, by replacement with a hexose ring (HNA), or a bicyclic ring, wherein said bicyclic ring may have a bridge between the C2 and C4 carbons on the ribose ring forming a locked nucleic acid (LNA).

[0424] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen or the 2’-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions.

[0425] In some embodiments the modified sugar moiety is a non-bicyclic modified sugar moiety.

[0426] In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety.

[0427] In further embodiments, the modified sugar moiety is a sugar surrogate (i.e., a non-sugar) or a non-ribose sugar, which may optionally comprise one or more substitutions as described for other types of modified sugar moieties.

[0428] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and / or 5’ positions. Examples of 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCHs (“OMe” or “O-methyl”), and 2'- O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”), and 2’-O-N-alkyl acetamide, e.g., 2’-O-N- methyl acetamide (“NMA”), 2’-O-N-dimethyl acetamide, 2’-O-N-ethyl acetamide, or 2’-O-N- propyl acetamide.

[0429] It will be understood that modified sugar moieties may be further defined by the isomeric configuration in relation to a specific modification. Hence, isomeric variants of modified sugar moieties may also be used within the functional nucleic acid molecules described herein.

[0430] In one embodiment, the modification is a chemical sugar modification is a 2’ modification.

[0431] A 2’ sugar modification results in a nucleoside in which a substituent other than H or -OH is present at the 2’ position (i.e., 2’ substituted). These 2’ modified sugars include 2’ linked biradicle capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, thereby forming a LNA (2’ - 4’ biradicle bridged)

[0432] In some embodiments the 2’ sugar modification is independently selected from the group consisting of: 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside.

[0433] In a preferred embodiment the chemical sugar modification a 2'-O-Methyl (2-OMe) modification.

[0434] In a further embodiment, the chemical sugar modification is 2'-O-Methyladenosine (Am).

[0435] In a further embodiment, the chemical sugar modification is 2’-deoxy sugar.

[0436] In a further embodiment, the chemical sugar modification is 2’-Methoxyethyl sugar (2’-MOE).

[0437] In a further embodiment, the chemical sugar modification is 2’-Fluoride modification (2’-F).

[0438] In a further embodiment, the modified nucleoside is a bicyclic sugar moiety.

[0439] In one embodiment, the modified nucleoside is a locked nucleic acid (LNA). In one embodiment, the modified nucleoside is a 2’-O-ethyl (cET) nucleotide.

[0440] Modified internucleoside linkages

[0441] The functional nucleic acid molecule of the invention may comprise one or more modified internucleoside linkages.

[0442] By modified internucleoside linkage it will be understood that the internucleoside linkage is a linkage other than a phosphodiester linkages, which functions analogously thereto to covalently couple two nucleosides.

[0443] Modified internucleoside linkages may confer on the functional nucleic acid molecules advantageous properties such as increased resistance to nucleases. Such properties may be employed to improve, for example, the in vitro or in vivo half-life of the functional nucleic acid molecule.

[0444] In one embodiment, the modified internucleoside linkage is an analogue of a phosphodiester linkage.

[0445] In one embodiment, the modified internucleoside linkage is a phosphonoacetate (PACE) linkage.

[0446] In one embodiment, the modified internucleoside linkage is a phosphoramidite linkage.

[0447] In one embodiment, the modified internucleoside linkage is a phosphorothioate linkage or a variant or derivative thereof.

[0448] In one embodiment, the modified internucleoside linkage is a diphosphorothioate linkage.

[0449] In one embodiment, the modified internucleoside linkage is a alkyl-, aryl- or heteroaryl- phosphorothioate linkage.

[0450] In one embodiment, the modified internucleoside linkage is a methyl-phosphorothioate linkage.

[0451] In one embodiment, the modified internucleoside linkage is a boranophosphate linkage. In one embodiment, the modified internucleoside linkage is a phospohonate linkage or a variant or derivative thereof.

[0452] In one embodiment, the modified internucleoside linkage is a alkyl-, aryl- or heteroaryl- phospohonate linkage.

[0453] In one embodiment, the modified internucleoside linkage is a methyl-phospohonate linkage.

[0454] In one embodiment, the modified internucleoside linkage is a phosphoryl guanidine linkage.

[0455] In one embodiment, each internucleoside linkage in the functional nucleic acid is independently selected from the group consisting of: a phosphodiester linkage; a phosphonoacetate (PACE) linkage; a phosphoramidite linkage; a phosphorothioate linkage; a diphosphorothioate linkage; an alkyl-phosphorothioate linkage; an aryl-phosphorothioate linkage; a heteroaryl-phosphorothioate linkage; a boranophosphate linkage; a phospohonate linkage; an alkyl-phospohonate linkage; an aryl-phospohonate linkage; a heteroaryl- phospohonate linkage; a methyl-phospohonate linkage; and a phosphoryl guanidine linkage, and / or variants or derivatives thereof.

[0456] In one embodiment, the modified internucleoside linkage is independently selected from the group consisting of: a phosphodiester linkage; a phosphonoacetate (PACE) linkage; a phosphoramidite linkage; a phosphorothioate linkage; a diphosphorothioate linkage; an alkyl- phosphorothioate linkage; an aryl-phosphorothioate linkage; a heteroaryl-phosphorothioate linkage; a boranophosphate linkage; a phospohonate linkage; an alkyl-phospohonate linkage; an aryl-phospohonate linkage; a heteroaryl-phospohonate linkage; a methyl-phospohonate linkage; and a phosphoryl guanidine linkage, and / or variants or derivatives thereof.

[0457] In one embodiment, the functional nucleic acid molecule comprises one or more modified internucleoside linkages.

[0458] In one embodiment, the functional nucleic acid molecule comprises between 1 and 39 modified internucleoside linkages.

[0459] In one embodiment, the functional nucleic acid molecule comprises no modified internucleoside linkages. In another embodiment, the functional nucleic acid molecule comprises one or more modified internucleoside linkages, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or 39 modified internucleoside linkages.

[0460] In one embodiment, the functional nucleic acid molecule comprises modified internucleoside linkages wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the internucleoside linkages are modified internucleoside linkages.

[0461] It will be understood that any sutable internucleoside linkage known to the person skilled in the art may be selected for use in the functional nucleic acid molecule of the invention. Internuceoside linkages described herein are for example only and are not intended to be limiting.

[0462] It will also be understood that the choice of any given internucleoside linkage will be independent of the choice of any other internucleoside linkage, i.e., between any other pair of consecutive nucleosides.

[0463] Nucleotide and nucleic acid analogues

[0464] Nucleotide and nucleic acid analogues are compounds that are structurally and / or functionally analogous to naturally occurring (or ‘unmodified’) RNA and DNA.

[0465] In one embodiment the functional nucleic acid molecule comprises or consists of nucleotide analogues.

[0466] Nucleotide analogues may comprise nucleoside analogues wherein the sugar moiety is replaced with a non-sugar moiety, for example a peptide nucleic acids (PNA), or a morpholino nucleic acids, thereby providing structural analogy with an unmodified nucleoside but not comprising a modified sugar, perse.

[0467] In one embodiment the nucleotide analogue is independently selected from any one or more of a peptide nucleic acid (PNA) nucleotide, a morpholino nucleotide, a locked nucleic acid (LNA) nucleotide, a glycol nucleic acid (GNA) nucleotide, a threose nucleic acid (TNA) nucleotide, and / or a hexitol nucleic acid (HNA) nucleotide. In one embodiment the nucleotide analogue is a morpholino nucleotide.

[0468] In one embodiment, the functional nucleic acid molecule comprises one or more nucleotide analogues.

[0469] In one embodiment, the functional nucleic acid molecule comprises between 1 and 40 nucleotide analogues.

[0470] In one embodiment, the functional nucleic acid molecule comprises no nucleotide analogues, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotide analogues.

[0471] In one embodiment, the functional nucleic acid molecule comprises nucleotide analogues linkages wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the nucleotides are nucleotide analogues.

[0472] Conjugates and linkers

[0473] In one aspect, there is provided a conjugate comprising the functional nucleic acid molecule of the invention and one or more moieties covalently bound to said functional nucleic acid molecule.

[0474] In one embodiment, the conjugate is a non-nucleotide based moiety.

[0475] In one embodiment, the conjugate is a polypeptide or polypeptide analogue.

[0476] In one embodiment, the conjugate is a polypeptide or protein or a region (e.g., one or more domains), domain or fragment thereof.

[0477] Suitable polypeptides and proteins may be selected from any known source and may, for example, include: viral proteins such as viral envelope / capsid proteins; toxins; and cellular receptors. In one embodiment, the conjugate is an antibody, an scFv, a nanobody, an antibody-based moiety, or a fragment of any of the foregoing.

[0478] In one embodiment, the conjugate is a ligand or receptor, or fragment thereof, capable of binding a corresponding receptor or ligand. In a preferred embodiment, the ligand and / or receptor are a cell-surface ligand / receptors.

[0479] In one embodiment, the conjugate is a carbohydrate moiety, such as an N-acetyl glucosamine moiety.

[0480] In one embodiment, the conjugate is a lipid moiety.

[0481] In one embodiment, the conjugate is a lipophilic moiety.

[0482] In one embodiment, the conjugate is a small molecule, such as a small heterocyclic molecule.

[0483] In one embodiment, the conjugate is a small molecule, such as a small heterocyclic molecule.

[0484] Any combination or one or more of the foregoing conjugates may be independently selected. Further, said conjugates may be covalently bound to the functional nucleic acid at any suitable position within the molecule.

[0485] The conjugate moieties may confer favorable properties on the functional nucleic acid. Conjugates may, for example: improve bioavailability, increase stability, improve cellular targeting, and / or improve cellular uptake.

[0486] In a particularly preferred embodiment, the conjugate will facilitate or improve delivery across the blood brain barrier.

[0487] In one embodiment, the conjugate is an oligonucleotide or analogue thereof.

[0488] In a preferred embodiment, the conjugate is a functional nucleic acid molecule according to the invention. Hence, functional nucleic acid molecules according to the invention may be conjugated together, with or without the use of intervening linkers. In such cases, the aforementioned conjugate moieties may also be considered linkers if used to interspace two or more functional nucleic acid molecules of the invention.

[0489] In one embodiment, the functional nucleic acid molecule comprises a linker. It will be understood that a linker may be used independently of a conjugate moiety as discussed above.

[0490] A linker may be any moiety that serves to link, such as covalently link, two or more distinct moieties (e.g., functional nucleic acid molecules and conjugate moieties).

[0491] Advantageously, linkers may be cleavable, such as by enzymes, in order to facilitate temporal and / or spatial control of moieties attached to the functional nucleic acid molecule. For example, a conjugate moiety may be joined to a functional nucleic acid molecule via a cleavable linker, which, upon contact with a cellular protease may be cleaved to liberate the functional nucleic acid molecule from the conjugate.

[0492] In one embodiment, the linker is an oligonucleotide or analogue thereof.

[0493] It will be understood that a functional nucleic acid of the invention may be represented by both a basic sequence, or just ‘sequence’, which utilises standard IUB / IUPAC nucleic acid codes to represent the nucleobase sequence (e.g., A, T / ll, G, C etc.) and / or a code in which chemical modifications of the constituent components are detailed. If a functional nucleic acid of the invention is represented herein by a basic sequence, this permits any chemical modification of the constituent components, as detailed herein.

[0494] DNA molecules and vectors

[0495] According to a further aspect of the invention, there is provided a DNA molecule encoding a functional nucleic acid molecule of the invention.

[0496] According to a further aspect of the invention, there is provided an expression vector comprising said DNA molecule.

[0497] Exemplary expression vectors are known in the art and may include, for example, plasmid vectors, viral vectors (for example adenovirus, adeno-associated virus, retrovirus or lentivirus vectors), phage vectors, cosmid vectors and the like. The choice of expression vector may be dependent upon the type of host cell to be used and the purpose of use. In particular, and without limitation, the following plasmids have been used for expression of functional nucleic acid molecule:

[0498] Mammalian expression plasmids:

[0499] - pCDNA3.1 (-) pDUAL-eGFPA (modified from peGFP-C2)

[0500] Viral vectors: pAAV (an Adeno-Associated Virus vector) rcLV -TetOne-Puro (a 3rdgeneration Lentivirus vector) pLPCX-link (a 3rdgeneration Retrovirus vector)

[0501] In one embodiment the mammalian expression plasmid is pCDNA3.1 (-).

[0502] In another embodiment the mammalian expression plasmid is pDUAL-eGFPA.

[0503] Plasmids of the invention may comprise any one of more features selected from the list comprising: a CMV promoter, a H1 promoter, and / or a BGH poly(A) terminator.

[0504] In one embodiment the viral vector is pAAV.

[0505] In one embodiment the viral vector is rcLV -TetOne-Puro.

[0506] In one embodiment the viral vector is pLPCX-link.

[0507] Vectors of the invention may comprise any one of more features selected from the list comprising: a CAG promoter, a CMV enhancer, SV40 late poly(A) terminator, a LTR-TREt (Tre-Tight) promoter, and / or a BGH poly(A) terminator.

[0508] It should be noted that any promoter may be used in the vector. Since the activity of the functional nucleic acids of the invention is independent of the promoter it is envisaged that these will work just as well as those exemplified above.

[0509] Compositions and methods

[0510] The present invention also relates to compositions comprising the functional nucleic acid molecule, the DNA molecule or the expression vector according to the invention. The composition may comprise components which enable delivery of said functional nucleic acid molecule by viral vectors (AAV, lentivirus and the like) and non-viral vectors (nanoparticles, lipid particles and the like). Alternatively, the functional nucleic acid molecule of the invention may be administered as naked or unpackaged DNA and or RNA.

[0511] The composition may comprise components that are known in the art to aid the stability of the nucleic acid molecule, e.g., salts (such as those providing Mg2+ions).

[0512] The functional nucleic acid molecule may be administered as part of a composition, for example a composition comprising a suitable carrier. In certain embodiments, the carrier is selected based upon its ability to facilitate the transfection of a target cell with one or more functional nucleic acid molecules.

[0513] Therefore, according to a further aspect of the invention, there is provided a composition comprising the functional nucleic acid molecule, the DNA molecule, or the expression vector as described herein.

[0514] In one embodiment, there is provided a pharmaceutical composition comprising at least one functional nucleic acid molecule, at least one DNA molecule, or at least one expression vector according to the present invention.

[0515] Suitably, a pharmaceutical composition may comprise at least one functional nucleic acid molecule, at least one DNA molecule, or at least one expression vector according to the present invention with a suitable pharmaceutical excipient, diluent, carrier, and / or salt.

[0516] The suitable pharmaceutical excipient, diluent, carrier, and / or salt may depend on the intended route of administration and standard pharmaceutical practice.

[0517] A suitable carrier may include any of the standard pharmaceutical carriers, vehicles, diluents or excipients known in the art and which are generally intended for use in facilitating the delivery of nucleic acids, such as RNA. Liposomes, exosomes, lipidic particles or nanoparticles are examples of suitable carriers that may be used for the delivery of RNA. In a preferred embodiment, the carrier or vehicle delivers its contents to the target cell such that the functional nucleic acid molecule is delivered to the appropriate subcellular compartment, such as the cytoplasm. Methods, methods of treatment and medical uses

[0518] Functional nucleic acids of the invention, which are capable of increasing the expression of Fan1 vial post-transcriptional inhibition of miRNA-mediated repression of Fan1 can be used for therapeutic and non-theraputic purposes.

[0519] In one aspect, there is provided an in vitro or in vivo method for modulating Fan1 protein expression in a target cell in which Fan 1 and a microRNA targeting Fan 1 are present, the method comprising the steps of exposing the cell to the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0520] In one embodiment, there is provided an in vitro or in vivo method for modulating Fan1 protein expression in a target cell in which Fan1 and the microRNA miR-124-3p are present, the method comprising the steps of exposing the cell to the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0521] In one aspect, there is provided an in vivo method for modulating Fan1 protein expression in a target cell in which Fan 1 and a microRNA targeting Fan 1 are present, the method comprising the steps of administering to the cell a therapeutically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0522] In one embodiment, there is provided an in vivo method for modulating Fan1 protein expression in a target cell in which Fan1 and the microRNA miR-124-3p are present, the method comprising the steps of administering to the cell a therapeutically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0523] In a further aspect, there is provided a method of treating, preventing, or delaying the onset of a disease associated with Fan1 protein in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention. In a further aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in medicine or therapy.

[0524] The methods and uses herein are applicable to the treatment, prevention, or delay of onset of a disease associated with the expansion of disease-associated polynucleotide tracts.

[0525] In one embodiment, the disease is a triplet repeat disorder.

[0526] In one embodiment, the disease is a disease associated with or caused by CAG triplet repeat expansion, CGG triplet repeat expansion, CTG triplet repeat expansion, GAA triplet repeat expansion, GCC triplet repeat expansion, or GCG triplet repeat expansion.

[0527] In one embodiment, the disease is a CAG, CGG, CTG, GAA, GCC, or GCG triplet repeat disorder.

[0528] In one embodiment, the disease is a CGG repeat disorder.

[0529] In one embodiment, the disease is a polyglutamine (polyQ) disease.

[0530] In a further embodiment, the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0531] In a preferred embodiment, the disease is Huntington’s disease (HD).

[0532] In one embodiment, the disease is a CGG repeat disorder.

[0533] In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0534] In one embodiment, the disease is a a CTG repeat disorder.

[0535] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1. In one embodiment, the disease is a GAA repeat disorder.

[0536] In one embodiment, the GAA repeat disorder is Friedreich ataxia.

[0537] In one embodiment, the disease is a GCC repeat disorder.

[0538] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0539] In one embodiment, the disease is a GCG repeat disorder.

[0540] In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0541] In an aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a triplet repeat disorder.

[0542] In one embodiment, the triplet repeat disorder is a CAG, CGG, CTG, GAA, GCC, or GCG triplet repeat disorder.

[0543] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CAG repeat disorder.

[0544] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a polyglutamine (polyQ) disease.

[0545] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a disease selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), SpinocerebellarAtaxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0546] In a preferred embodiment, the disease is Huntington’s disease (HD). In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CGG repeat disorder.

[0547] In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0548] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CTG repeat disorder.

[0549] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1.

[0550] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GAA repeat disorder.

[0551] In one embodiment, the GAA repeat disorder is Friedreich ataxia.

[0552] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GCC repeat disorder.

[0553] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0554] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GCG repeat disorder.

[0555] In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0556] In an aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament for the treatment, prevention, or delay of a triplet repeat disorder.

[0557] In one embodiment, the medicament is for the treatment, prevention, or delay of a CAG triplet repeat disorder. In one embodiment, the medicament is for the treatment, prevention, or delay of a polyglutamine disease (polyQ).

[0558] In one embodiment, the medicament is for the treatment, prevention, or delay of a disease selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

[0559] In one embodiment, the medicament is for the treatment, prevention, or delay of Huntington’s disease (HD).

[0560] In one embodiment, the medicament is for the treatment, prevention, or delay of a CGG repeat disorder.

[0561] In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0562] In one embodiment, the medicament is for the treatment, prevention, or delay of a CTG repeat disorder.

[0563] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1.

[0564] In one embodiment, the medicament is for the treatment, prevention, or delay of a GAA repeat disorder.

[0565] In one embodiment, the GAA repeat disorder is Friedreich ataxia.

[0566] In one embodiment, the medicament is for the treatment, prevention, or delay of a GCC repeat disorder.

[0567] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0568] In one embodiment, the medicament is for the treatment, prevention, or delay of a GCG repeat disorder. In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0569] In all of the foregoing methods and uses the action of the functional nucleic acid may be considered disease modifying.

[0570] Further, in each of the foregoing aspects, a DNA or vector encoding the functional nucleic acid molecule of the invention may also be utilised, either in combination with any other component or in isolation.

[0571] Methods of the invention can be performed in vitro, ex vivo or in vivo.

[0572] The methods described herein may comprise transfecting into a cell the functional nucleic acid molecule, DNA molecule, expression vector, composition or pharmaceutical composition as defined herein. The functional nucleic acid molecule, DNA molecule, expression vector, composition or pharmaceutical composition may be administered to target cells using methods known in the art and include, for example, microinjection, lipofection, electroporation, using calcium phosphate, self-infection by the vector or viral transduction.

[0573] The functional nucleic acid molecules, DNA molecules, compositions and / or pharmaceutical compositions can be used as medicaments, preferably for triplet repeat expansion diseases / disorders, for example polyglutamine (polyQ) diseases.

[0574] It will be understood that, since these disorders are hereditary, prevention refers to the prevention of triplet expansion and any pathological consequences associated therewith. That is, rather than prevention of the disease outright.

[0575] Further prevention may also encompass modulation of the age at onset of disease (AAO).

[0576] It will be understood that the functional nucleic acid molecule of the invention ultimately finds use in increasing the level of Fan1 protein. Said increase in Fan1 is preferably within a cell, such as the cell of a subject.

[0577] In preferable embodiments, the subject is a human subject.

[0578] In yet further preferable embodiments, the subject is a human subject with a hereditary triplet repeat disorder. In one embodiment, the disease or disorder is a neurological disease or disorder.

[0579] In one embodiment, the disease or disorder is Huntington’s disease (HD).

[0580] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 1 (SCA1).

[0581] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 2 (SCA2).

[0582] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 3 (SCA3). Spinocerebellar Ataxia Type 3 is also known as Machado-Joseph disease (MJD).

[0583] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 6 (SCA6).

[0584] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 7 (SCA7).

[0585] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 17 (SCA17).

[0586] In one embodiment, the disease or disorder is dentatorubral pallidoluysian atrophy (DRPLA).

[0587] In one embodiment, the disease or disorder is and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0588] Herein instances of the plural form of words should be taken to cover also the singular form of the word and vice versa, unless the context clearly dictates otherwise.

[0589] The invention will now be illustrated with reference to the following non-limiting examples.

[0590] EXAMPLES

[0591] Example 1 - A miRNA mimic downregulates Fan1 mRNA and protein levels.

[0592] To investigate whether the miRNA miR-124-3p targets Fan1 mRNA and thereby mediates expression of FAN1 , oligonucleotide mimics of miR-124-3p were used to transfect HCT 116 cells. Oligonucleotides lacking targeting sequences were utilized as controls. qRT-PCR analysis

[0593] HCT116 cells were cultured in DMEM GlutaMAX media (Gibco), supplemented with 10% Fetal Bovine Serum and 1% Penicillin-Streptomycin. Cells were seeded at 100,000 cells per well in 12-well plates and incubated at 37°C, 95% humidity, 5% CO2 overnight.

[0594] Cells were transfected using Lipofectamine RNAiMax (Invitrogen) with hsa-miR-124-3p mirVana® miRNA mimic (Invitrogen, 4464066, assay ID MC10060) or mirVana™ miRNA Mimic Negative Control #1 (Invitrogen, 4464058) at a final concentration of 50 nM or 100 nM. As controls, cells were equally transfected with Fan1-specific or non-targeting control siRNAs (Dharmacon, L-020327-00-0005 and D-001810-10-05) at a final concentration of 10 nM.

[0595] On the day following transfection, the medium was removed from the wells and the wells were washed three times with phosphate buffered saline (PBS). Cells were lysed in RLT Buffer and total RNA was extracted according to the manufacturer’s instructions, including the use of the gDNA Eliminator column (RNeasy Plus Mini Kit, Qiagen).

[0596] RNA concentration and purity was measured using a Nanodrop spectrophotometer (Thermo Scientific), and 250 ng of RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions. To rule out gDNA contamination, reverse transcription reactions were prepared omitting the reverse transcriptase (-RT controls).

[0597] Following synthesis, cDNA was diluted 1 :5. qPCR was performed in a QuantStudio 1 Real- Time PCR System (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems) with the following primers and conditions:

[0598] Table 2 - Primer sequences (IDT) Table 3 - qPCR reaction composition

[0599] Table 4 - qPCR conditions

[0600] Analysis was performed using the comparative Ct method using B2M as a normalises Fold change between non-targeting control mimic- and miR-124-3p mimic-transfected, or of nontargeting control siRNA- and FAN1 siRNA-transfected samples was calculated. The experiment was independently reproduced three times.

[0601] Western blot analysis

[0602] Transfection of cells was carried out as described in the qRT-PCT section above at a final concentration of 100 nM. At 24h or 48h after transfection, cells were washed with ice-cold PBS and collected in 500 l of PBS. Cells suspensions were centrifuged for 5 min at 5,000 rpm at 4°C and the supernatant was removed. The cellular pellet was resuspended in 100 pl RIPA buffer (Thermo Scientific), containing protease and phosphatase inhibitors (PhosStop Tablets and complete Mini, EDTA-free, Protease Inhibitor Cocktail, Roche).

[0603] Samples were incubated on ice for 15 minutes, with regular mixing. Samples were then centrifuged for 15 minutes at 13,000 rpm at 4°C and the supernatant collected. The supernatant represents the collected soluble protein fraction. The Pierce BCA protein assay (Thermo Scientific) was performed using the manufacturer’s instructions to determine total protein content in the samples.

[0604] Samples were mixed with 4x LDS Sample Buffer and DTT (50 mM final concentration) and boiled at 95°C for 5 min before being subjected to SDS-PAGE analysis using NuPAGE 4- 12% Bis Tris Midi Gels (ThermoFisher). 10 pg of protein was loaded per well. The separated proteins were transferred to nitrocellulose membranes using BOLT Transfer Buffer (ThermoFisher). Membranes were blocked in 5% BSA (Sigma Aldrich) and then probed with primary antibodies overnight followed by 1h incubation with the secondary antibodies (see Table 5 below). Proteins were visualised using Clarity Western ECL Substrate (Bio-Rad) and imaged using Odyssey Imager (Li-Cor). Protein bands were quantified using Empiria Studio 2.2. Analysis was performed using tubulin as normaliser. Fold change between non-targeting control mimic- and miR-124-3p mimic-transfected, or of non-targeting control siRNA- and FAN1 siRNA-transfected samples was calculated. The experiment was independently reproduced two (48h) or three (24h) times.

[0605] Table 5: antibodies utilized for western blotting

[0606] When normalised against their respective control values, the data reveal that the levels of both Fan1 mRNA (Figure 1) and protein (Figure 2) are reduced in cells receiving the miR- 124-3p mimic relative to cells receiving only the control oligonucleotide.

[0607] These data suggest the ability of the naturally occurring microRNA, miR-124-3p, to downregulate Fan1 mRNA and protein levels. It is therefore plausible, given that both mRNA and protein levels are reduced, that Fan1 repression may be achieved via mRNA targeted post-transcriptional repression that is achieved by miRNA-induced mRNA degradation.

[0608] Example 2 - The rs3512 SNP impacts miRNA-mediated Fan1 downregulation

[0609] To investigate the impact of the rs3512 SNP on miR-124-3p-mediated Fan1 regulation, a dual luciferase assay was performed. Briefly, the putative miR-124-3p target region of the Fan1 3’-UTR was cloned downstream of a firefly luciferase (FLuc) expression cassette within a construct also containing an independent Renilla luciferase (RLuc) expression cassette, for use as a normalizer.

[0610] The following constructs were produced and tested in combination with a non-targeting miRNA mimic control or the miR-124-3p mimic:

[0611] • wt FAN1 3’-UTR: wild type sequence of the putative miR-124-3p target region;

[0612] • rs3512 FAN1 3’-UTR: the putative miR-124-3p target region carrying the rs3512 (G>C) SNP;

[0613] • Mutated seed pairing: putative miR-124-3p target region with mutated nucleotides to abolish pairing with positions 2, 3, 5 and 6 of miR-124-3p seed. Negative control.

[0614] • miR-124-3p sensor: putative miR-124-3p target region with mutated nucleotides to be fully complementary to miR-124-3p ( / .e. siRNA-like). Positive control.

[0615] Illustration of the constructs can be found in Figure 3A. pmirGLO dual luciferase-FAN1 3’-UTR reporter cloning

[0616] Forward and reverse oligonucleotides were designed and synthesised to include the sequences of interest and the required restriction enzyme overhangs for cloning (IDT).

[0617] Oligonucleotides were hybridized and pmirGLO vector (Promega) was linearised with Pmel and Xbal (NEB). Following ligation, constructs were transformed into Dh5-alpha competent Escherichia coli (NEB) and selected in LB-Ampicilin (50 pg / ml). Positive clones were propagated in culture and final constructs were purified using a PureLink™ Fast Low- Endotoxin Maxi Plasmid Purification Kit (Thermo Scientific). Plasmid sequences were verified by Sanger Sequencing (Genewiz).

[0618] Transfection and dual luciferase reporter assay

[0619] HCT116 cells were cultured in DMEM GlutaMAX media (Gibco), supplemented with 10% Fetal Bovine Serum and 1% Penicillin-Streptomycin). 10,000 cells per well were seeded in 96-well white-walled plates and incubated at 37°C, 95% humidity, 5% CO2 overnight.

[0620] On the morning following seeding, cells were transfected with 25 ng of the respective reporter using Trans-IT 2020 (Mirus Bio). In the afternoon, cells were transfected with hsa- miR-124-3p miRCURY LNA miRNA Mimic (Qiagen, 339173, assay YM00471256-ADA) or Negative Control miRCURY LNA miRNA Mimic (Qiagen, 339173, assay YM00479902-ADA) at a final concentration of 100 nM using Lipofectamine RNAiMax (Invitrogen).

[0621] At 24 hours following the last transfection, dual luciferase assays were performed using a Dual-Luciferase® Reporter Assay System (Promega), according to the manufacturer’s instructions.

[0622] For analysis, and following background removal, FLuc signal from each well was normalized with RLuc signal, and the fold change was calculated between samples transfected with miR-124-3p mimic and non-targeting control mimic. The experiment was reproduced five times.

[0623] The SNP rs3512 is able to mitigate miR-124-3p mimic-induced repression of Flue reporter gene expression. Introduction of sequences from the 3’-UTR of Fan1 into the 3’-UTR of an Flue reporter gene renders it susceptible to downregulation by the miR-124-3p mimic. The observed downregulation in the Flue reporter gene is impacted by the insertion of the rs3512 SNP into the Fan1 3’-UTR sequence (figure 3B).

[0624] Taken together, these data and the data of Example 1 indicate that miR-124-3p induces the degradation of mRNA comprising a Fan1 3’-UTR sequence (Figure 1), which results in a decrease Fan1 protein (Figure 2), or the proteins (e.g., FLuc) of chimeric constructs encoded by mRNAs harboring said Fan1 3’-UTR sequence (Figure 3). It is further apparent that the SNP rs3512 is able to relieve the repressive effect of miR-124-3p, thereby increasing protein expression in the presence of miR-124-3p as compared with proteins encoded by sequences harboring the wild type Fan 1 3’-UTR.

[0625] Example 3 - Functional nucleic acids targeting the Fan1 3’-UTR inhibit miRNA- mediated downregulation of Fan1

[0626] To investigate whether synthetic functional nucleic acids can prevent miR-124-3p-mediated repression of Fan1, a panel of functional nucleic acids were designed and synthesized.

[0627] Functional nucleic acid molecules were designed against the 3’-UTR region of human Fan1 where the miR-124-3p seed is predicted to bind, using a tiling approach whereby antisense oligonucleotides are complementary to target sequences that are each one nucleotide downstream (i.e. 3’) of the previous target sequence. In Figure 4, Fan1 mRNA is illustrated with the approximate region encompassing the predicted miR-124-3p targeting site in expanded view.

[0628] Sequences are presented in Table 10, wherein "m" denotes a 2'-O-methyl modified nucleoside; 752MOEr_ / , / i2MOEr_ / , / 32MOEr” denote 5’, internal and 3’_2'-O-methoxyethyl nucleosides, respectively; "*" denotes a phosphorothioate bond between adjacent nucleotides; and "+" denotes an LNA nucleotide.

[0629] Example 4 - ASO-mediated steric blocking of miR-124-3p on FAN1 3’-UTR leads to FAN1 upregulation.

[0630] MiR-124 is highly conserved and expressed in a tissue-specific manner, representing 25- 50% of total miRNAs in mice brain (Lagos-Quintana et al, 2002). As a proof-of-concept for the utilisation of miR-124-3p steric blocking ASOs for FAN1 upregulation, human cortical neurons were utilized as a cell model.

[0631] Cortical neuron differentiation and qymnosis

[0632] Wild-type neural stem cells (axoCells, Axol Bioscience Ltd) were thawed and 32,000 cells were seeded per well of 96-well plates, according to the manufacturer’s instructions. Cells were maintained at 37°C, 95% humidity, 5% CO2 overnight, unless otherwise stated. Cells were differentiated (days 1-6) and matured (days 7-14) into cerebral cortical neurons according to the manufacturer’s instructions.

[0633] On day 20 post-differentiation, neurons were first treated via gymnosis with non-targeting control or miR-124-3p steric blocking ASOs. ASOs were manufactured by Integrated DNA Technologies (IDT) and resuspended in TE buffer. Briefly, a 50% medium change was performed every other day, except on weekends, with pre-warmed medium (Neural Maturation Basal Medium, 20 ng / mL BDNF, 0.5 mM cAMP and 0.2 mM Ascorbic Acid) supplemented with ASOs to achieve a final concentration of 5 pM. Neurons were dosed five times before sample collection at day 31 post-plating.

[0634] The miR-124-3p steric blocking ASO used herein corresponds to compound_58 (SEQ ID NOs: 1031 and 1097). Western blotting

[0635] Medium was removed, each well was lysed in 10 pl Laemmli SDS buffer (Thermo Scientific), and two wells were pooled per sample. Samples were boiled at 95°C for 5 min before being subjected to SDS-PAGE analysis using NuPAGE 4-12% Bis Tris Midi Gels (ThermoFisher) at 150V for 80 min. 10 pl of lysate was loaded per well.

[0636] The separated proteins were transferred to nitrocellulose membranes using BOLT Transfer Buffer (ThermoFisher) at 350 mA for 1h. Membranes were blocked in 5% BSA (Sigma Aldrich) and probed with primary antibodies for 3h followed by 1h incubation with fluorescent secondary antibodies at room temperature (see Table 6 below). Proteins were imaged using an Odyssey Imager (Li-Cor). Protein bands were guantified using the Empiria Studio 2.2 software. Analysis was performed using Tubulin-p3 as a normaliser. Fold change between non-targeting ASO control miR-124-3p steric blocking ASO samples was calculated.

[0637] Table 6: antibodies utilized for western blotting

[0638] When normalised against their respective control value, the data reveal that the level of FAN1 is increased in neurons treated with a miR-124-3p steric blocking ASO relative to those receiving the control ASO (Figure 5B).

[0639] These data suggest the ability of a steric blocking ASO to bind to Fan1 3’-UTR and compete with miR-124-3p, relieving miRNA-mediated repression and thereby upregulating FAN1 protein levels.

[0640] These data further support the proof of concept that blocking or competing with miRNAs can be used as a strategy to upregulate FAN1.

[0641] Example 5 - ASO-mediated steric blocking of miRNA target sites on FAN1 3’-UTR leads to FAN1 upregulation.

[0642] To further demonstrate the effectiveness of the concept of miRNA steric blocking as a strategy for FAN1 upregulation, other candidate miRNAs were explored. A set of brain- enriched miRNAs were identified and prioritised according to target site strength and expression in HCT116: miR-186-5p, miR-335-3p, miR-145-5p, miR-181-5p, miR-197-3p and miR-194-5p.

[0643] To facilitate screening, a CRISPR-engineered HCT116 cell line was created to express a C- terminal HiBiT-tagged version of FAN1, which can be quantified in a luminescence assay. ASOs were designed as 18-mers or 22-mers with sequences antisense to the predicted binding region of each miRNA on Fan1 3’-UTR. Each sequence was produced with four different sets of chemical modifications:

[0644] • Phosphorothioate backbone (PS), 2’-O-methyl (Me): referred to as “PS-Me”

[0645] • Phosphorothioate backbone (PS), 2’-O-methyl (Me), three most 3’ nucleotides as locked nucleic acid (LNA): referred to as “PS-Me-LNA”

[0646] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE): referred to as “PS- MOE”

[0647] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE), three most 3’ nucleotides as locked nucleic acid (LNA): referred to as “PS-MOE-LNA”

[0648] Cell culture and transfection

[0649] ASOs were manufactured by Integrated DNA Technologies (IDT), resuspended in TE buffer and dispatched onto 96-well white-walled plates using an Assist Plus Pipetting Robot (INTEGRA Biosciences Ltd). Plates were kept at -20°C until the moment of use.

[0650] HOT 116 FAN1-HiBiT cells were engineered by Synthego. Cells were cultured in DMEM GlutaMAX media (Gibco), supplemented with 10% Fetal Bovine Serum and 1% Penicillinstreptomycin).

[0651] A transfection mix was prepared with HiPerFect (Qiagen) and dispatched onto the wells containing ASOs. Plates were shaken and incubated 10 min at room temperature. Following incubation, 10,000 cells per well were seeded in each transfection plate and incubated at 37°C, 95% humidity, 5% CO2 for 48h. Volumes were adjusted to achieve 50 nM final ASO concentration.

[0652] Fluorescence and luminescence assays

[0653] At 48 hours following transfection, the non-lytic CellTiter-Fluor™ Cell Viability Assay was performed (Promega), according to the manufacturer’s instructions. HiBiT expression, as a proxy of FAN1 expression, was measured using the Nano-Gio® HiBiT Lytic Detection System (Promega) according to the manufacturer’s instructions.

[0654] For analysis, following background removal, HiBiT luminescence signal from each well was normalised with the respective CellTiter-Fluor fluorescence signal, and the fold change was calculated between samples transfected with miRNA steric blocking ASOs or mock- transfected.

[0655] When normalised against their respective control value, the data reveal that steric blocking of multiple miRNA binding sites individually can lead to FAN1 upregulation, most notably miR-145-5p, miR-181-5p and miR-197-3p (Figure 6 A-D).

[0656] To attempt to improve the upregulation observed, a small tiling library was designed against miR-197-3p site. Sequences were designed against the 3’-UTR region of human Fan1 where the miR-197-3p seed is predicted to bind, using a tiling approach whereby antisense oligonucleotides are complementary to target sequences that are each three nucleotide downstream (i.e. 3’) of the previous target sequence (Figure 7A). Cell culture, transfection and analyses were performed as previously described.

[0657] When normalised against their respective control value, the data reveal that all ASOs tested led to FAN1 upregulation, with up to 30% more protein being detected upon treatment, when compared to mock-transfected cells (Figure 7B).

[0658] The ASO used herein corresponds to:

[0659] • ASO 849 = compound_77 (SEQ ID NO: 1050 and 1116)

[0660] • ASO 850 = compound_78 (SEQ ID NO: 1051 and 1117)

[0661] • ASO 851 = compound_79 (SEQ ID NO: 1052 and 1118)

[0662] • ASO 852 = compound_80 (SEQ ID NO: 1053 and 1119)

[0663] • ASO 853 = compound_81 (SEQ ID NO: 1054 and 1120)

[0664] (see also tables 10 and 11 )

[0665] Example 6 - Chemical modification of functional nucleic acids can increase FAN1 upregulation

[0666] Functional nucleic acids, which may also be referred to as antisense oligonucleotides (ASOs), were designed, using a tiling approach, across the miR-197-3p target site (Figure 7A) and their ability to upregulate FAN1 was assessed, as described herein, both with (Figure 7B; right) and without (Figure 7B; left) normalization.

[0667] One particularly effective functional nucleic acid (see e.g., Figure 7B) termed ASO_849 herein, was selected for further iterations of chemical modification in an attempt to further improve its effect.

[0668] ASO 849 was designed as an ASO that targets a site also targeted by the miRNA miR-197- 3p, thus acting as a steric blocking ASO for this miRNA.

[0669] Functional nucleic acid molecule design

[0670] A set of ASOs was designed, each of which had an identical underlying nucleotide sequence (i.e., SEQ ID NO: 1050) but was modified to comprise different chemical modifications, which include:

[0671] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE): referred to as “PS- MOE”

[0672] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE), three most 3’ nucleotides as locked nucleic acid (LNA)

[0673] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE), two most 3’ and one most 5’ nucleotides as locked nucleic acid (LNA)

[0674] • Phosphorothioate backbone (PS), 2’-O-methoxyethyl (MOE), two most 3’ and two most 5’ nucleotides as locked nucleic acid (LNA)

[0675] • Phosphorothioate backbone (PS), 2’-O-methyl (Me), two most 3’ and one most 5’ nucleotides as locked nucleic acid (LNA)

[0676] • Phosphorothioate backbone (PS), 2’-O-methyl (Me), two most 3’ and two most 5’ nucleotides as locked nucleic acid (LNA)

[0677] To facilitate screening of the above compounds, a CRISPR-engineered HCT116 cell line was created that expressed a C-terminal HiBiT-tagged version of FAN1, which facilitates quantification by a luminescence assay.

[0678] The ability of these ASOs to upregulate FAN1 is shown in Figure 7C, wherein all compounds are capable of upregulating FAN1. Cell culture and transfection

[0679] ASOs were manufactured by Integrated DNA Technologies (IDT), re-suspended in TE buffer and dispatched onto 96-well white-walled plates using an Assist Plus Pipetting Robot (INTEGRA Biosciences Ltd). Plates were kept at -20°C until the moment of use.

[0680] HCT 116 FAN1-HiBiT cells were engineered by Synthego. Cells were cultured in DMEM GlutaMAX media (Gibco), supplemented with 10% Fetal Bovine Serum and 1% Penicillinstreptomycin).

[0681] A transfection mix was prepared with HiPerFect (Qiagen) and dispatched onto the wells containing ASOs. Plates were shaken and incubated for 10 min at room temperature. Following incubation, 10,000 cells per well were seeded in each transfection plate and incubated at 37°C, 95% humidity, 5% CO2 for 48h. Volumes were adjusted to achieve 50 nM final ASO concentration.

[0682] Fluorescence and luminescence assays

[0683] At 48 hours following transfection, the non-lytic CellTiter-Fluor™ Cell Viability Assay was performed (Promega), according to the manufacturer’s instructions. HiBiT expression, as a proxy of FAN1 expression, was measured using the Nano-Gio® HiBiT Lytic Detection System (Promega) according to the manufacturer’s instructions.

[0684] For analysis, following background removal, HiBiT luminescence signal from each well was normalised with the respective CellTiter-Fluor fluorescence signal, and the fold change was calculated between samples transfected with miRNA steric blocking ASOs or mock- transfected.

[0685] When normalised against their respective control value, the data reveal that changes in ASO chemical modification can lead to more pronounced FAN1 upregulation, most notably PS-Me + 2 LNAs 3’, 1 LNA 5’ (Table 7 and Figure 7C). Table 7. miR-197-3p steric blocking ASO iterations and their respective impact on FAN1 levels.

[0686] Fold change of FAN1 levels relative to mock-treated cells are represented as follows: 1.0 - 1.09: 1.1 - 1.19: +; 1.2 - 1.29: ++; >1.3: +++

[0687] To determine whether the observed effect occurs at the RNA or protein level, cells were treated with ASOs 920, 921 , 922 (miR-197 steric blocking) and 864 (non-targeting) followed by qRT-PCR analyses (Figure 7D). Cell culture and transfection were performed as previously described. qRT-PCR qRT-PCR was performed in three independent wells per condition using a Cells-to-CT™ 1- Step TaqMan® Kit (Ambion) according to the manufacturer’s instructions. Primers and probes were synthesised by IDT.

[0688] Analysis was performed using the comparative Ct method using B2M as a normaliser. Fold change between mock- and miR-197-3p steric blocking or of non-targeting ASO-treated samples was calculated. The experiment was independently reproduced two times. Table 8: Primer and probe sequences qRT-PCR analysis suggests that FAN1 upregulation following ASO treatment occurs at the translational level, as RNA levels remained unchanged across treatments (Figure 7D). This is consistent with the canonical mode of action of many animal miRNAs acting on translational repression, as well as with the effects previously observed using miRNA steric blocking ASOs (Iwakawa et al., 2015; Aggarwal et al., 2023).

[0689] The ASO used herein corresponds to:

[0690] • ASO 849 = SEQ ID NO: 1116

[0691] • ASO 850 = SEQ ID NO: 1117

[0692] • ASO 851 = SEQ ID NO: 1118

[0693] • ASO 852 = SEQ ID NO: 1119

[0694] • ASO 853 = SEQ ID NO: 1120

[0695] • ASO 917 = SEQ ID NO: 1139

[0696] • ASO 918 = SEQ ID NO: 1140

[0697] • ASO 919 = SEQ ID NO: 1141

[0698] • ASO 920 = SEQ ID NO: 1142

[0699] • ASO 921 = SEQ ID NO: 1143

[0700] • ASO 922 = SEQ ID NO: 1144

[0701] • ASO 864 = SEQ ID NO: 1145

[0702] (see also Tables 10 and 11)

[0703] Example 7 - Optimised miRNA steric blocking functional nucleic acid chemistry and delivery leads to improved FAN1 upregulation

[0704] To demonstrate that a similar strategy can be applied to design miRNA steric blocking ASOs against other miRNA sites on Fan1 3’-UTR, new miRNA steric blocking ASOs were designed against miR-181-5p and miR-145-5p sites. In addition, ASO delivery was further improved by titrating ASO dose and amount of transfection reagent.

[0705] ASOs were manufactured by Integrated DNA Technologies (IDT), re-suspended in TE buffer and dispatched onto 96-well white-walled plates using an Assist Plus Pipetting Robot (INTEGRA Biosciences Ltd). Plates were kept at -20°C until the moment of use.

[0706] HCT116 FAN1-HiBiT cells were engineered by Synthego. Cells were cultured in DMEM GlutaMAX media (Gibco), supplemented with 10% Fetal Bovine Serum and 1% Penicillinstreptomycin).

[0707] A transfection mix was prepared with HiPerFect (Qiagen) and dispatched onto the wells containing ASOs. Plates were shaken and incubated 10 min at room temperature. Following incubation, 25,000 cells per well were seeded in each 96-well transfection plate and incubated at 37°C, 95% humidity, 5% CO2 for 24h. Volumes were adjusted to achieve 25 nM final ASO concentration.

[0708] The miRNA steric blocking ASOs used herein correspond to:

[0709] • ASO 921 = SEQ ID NO: 1143

[0710] • ASO 968 = SEQ ID NO: 1146

[0711] • ASO 970 = SEQ ID NO: 1147

[0712] (see also Table 11)

[0713] Fluorescence and luminescence assays

[0714] At 24 hours following transfection, a non-lytic CellTiter-Fluor™ Cell Viability Assay (Promega) was performed according to the manufacturer’s instructions. HiBiT expression, as a proxy of FAN1 expression, was measured using the Nano-Gio® HiBiT Lytic Detection System (Promega) according to the manufacturer’s instructions.

[0715] For analysis, following background removal, HiBiT luminescence signal from each well was normalised with the respective CellTiter-Fluor fluorescence signal, and the fold change was calculated between samples transfected with miRNA steric blocking ASOs or mock- transfected.

[0716] Following ASO chemistry and delivery optimisation, higher levels of FAN1 upregulation are observed with miRNA steric blocking ASOs designed against miR-197-3p, miR-181-5p and miR-145-5p (Figure 8A). In some examples, more than 40% upregulation is observed, reinforcing the potential of miRNA steric blocking ASOs as a tool for FAN1 modulation and, therefore, as a therapeutic agent for Huntington’s disease.

[0717] To determine whether this effect occurs at the RNA or protein (translational) level, qRT-PCR analyses were performed as previously described. As seen before (Example 5), the data suggest that FAN1 upregulation following ASO treatment occurs at the translational level, as RNA levels remained essentially unchanged across treatments (Figure 8B).

[0718] Example 8 - Functional nucleic acid-mediated steric blocking of miRNA in Fan1 3’- UTR leads to FAN1 upregulation in HD patient-derived medium spiny neurons

[0719] To verify whether the activity of optimised miRNA steric blocking ASOs could be observed in a HD relevant cell model, gymnosis was performed in patient-derived medium spiny neurons carrying a mutant Htt allele with >109 CAG repeats. In addition to previously tested ASOs, a miRNA steric blocking ASO against miR-124-3p site in Fan1 UTR was also included, as this miRNA is expected to be expressed specifically in neurons.

[0720] Medium Spiny Neuron (MSN) culture and gymnosis

[0721] MSN (BrainXell, BX-0700) were cultured on plates coated with PDL (Thermo, A3890401) and SureBond (Axol, ax0053). Cell thawing and maintenance was performed following the manufacturer’s protocol. Forty thousand cells were plated per well in 96-well plates.

[0722] On day 7, MSN were first treated via gymnosis with a non-targeting control ASO or miRNA steric blocking ASOs. ASOs were manufactured by Integrated DNA Technologies (IDT) and resuspended in TE buffer. Briefly, a 50% medium change was performed every week with pre-warmed medium supplemented with ASOs to achieve a final concentration of 5 pM. Neurons were dosed five times before sample collection at day 42.

[0723] The miRNA steric blocking ASOs used herein correspond to:

[0724] • ASO 921 = SEQ ID NO: 1143

[0725] • ASO 968 = SEQ ID NO: 1146

[0726] • ASO 969 = SEQ ID NO: 1148

[0727] • ASO 970 = SEQ ID NO: 1147

[0728] (see also Table 11) Western blotting analysis

[0729] Medium was removed, each well was washed with PBS and lysed in 20 pl Laemmli SDS buffer (Thermo Scientific) diluted to 1x with RIPA (ThermoFisher). Samples were boiled at 95°C for 5 min and 13 pl of lysate was loaded per well. Samples were run on NuPAGE 4- 12% Bis Tris Midi Gels (ThermoFisher) at 150V for 80 min.

[0730] Separated proteins were transferred to nitrocellulose membranes using BOLT Transfer Buffer (ThermoFisher) at 350 mA for 1h. Membranes were blocked in 5% BSA (Sigma Aldrich) and probed with primary antibodies for 1h at room temperature (for Tubulin-p3) or overnight at 4°C (for FAN1), followed by 1h incubation with fluorescent secondary antibodies at room temperature (see Table 9 below). Proteins were imaged using an Odyssey Imager (Li-Cor) and bands were guantified using the Empiria Studio 2.2 software. Analysis was performed using Tubulin-p3 as a normaliser. Fold change between non-targeting ASO control and miRNA steric blocking ASO samples was calculated.

[0731] Table 9: antibodies utilized for western blotting

[0732] When normalised against their respective control value, the data reveal that the level of FAN1 is increased in neurons treated with miR-181-5p, miR-124-3p and miR-145-5p steric blocking ASOs relative to those receiving the control ASO (Figure 9). FAN1 upregulation was not consistently observed upon treatment with a miR-197-3p steric blocking ASO. This could be explained by the fact that the activity of this ASO modality is expected to be highly correlated with the expression level of the miRNA of interest, which is highly cell type and cell state-dependent.

[0733] These data suggest the ability of a steric blocking ASO to bind to Fan1 3’-UTR and compete with different miRNAs (in this example, miR-181-5p, miR-124-3p and miR-145-5p), relieving miRNA-mediated repression and thereby upregulating FAN1 protein levels.

[0734] These data further support the proof of concept that blocking or competing with miRNAs can be used as a strategy to upregulate FAN1. Example 9 - miRNA steric blocking ASO-mediated FAN1 upregulation in HD patient- derived medium spiny neurons decreases the rate of CAG repeat expansion

[0735] It has been shown that FAN1 upregulation decreases the rate of Htt CAG repeat expansion (Goold et al, 2019). To investigate whether miRNA steric blocking ASO treatment in medium spiny neurons affects CAG expansion rate as a result of FAN1 upregulation, an experiment is performed to determine CAG tract mean somatic length gain in these cells.

[0736] After 10 weeks of gymnosis, gDNA is extracted from neurons treated with miRNA steric blocking or non-targeting ASOs. As a control, neurons treated with non-targeting or FAN1 gapmer are also included. gDNA is used for PCR amplification of the Htt locus. PCR products are sent for Nanopore long-read sequencing and the resulting data is used to calculate the CAG tract mean somatic length gain.

[0737] The data reveal that increased FAN1 level, as a result of miRNA steric blocking ASO treatment, is associated with slower expansion of the CAG tract. Conversely, control neurons treated with FAN1 gapmer show faster expansion of the CAG tract as a result of FAN1 downregulation. This reinforces the relevance of miRNA regulation blockage as a valid strategy for FAN1 upregulation in Huntington’s disease therapies

[0738] Example 10 - Disruption of miR-124-3p mediated regulation of FAN1 by the introduction of the SNP rs3512 or seed target site mutation leads to FAN1 upregulation and reduced CAG expansion in HD patient-derived neurons

[0739] Huntington’s disease patients carrying the rs3512 SNP on the predicted binding site of miR- 124-3p on Fan1 3’-UTR show delayed disease onset due to slower CAG expansion.

[0740] Transcriptome data retrieved from the Genotype-Tissue Expression (GTEx) Portal suggests that individuals that carry the same SNP have higher levels of Fan1 mRNA in brain tissue, where miR-124-3p is specifically expressed. Conversely, Fan1 mRNA level remains unchanged in adipose tissue and whole blood across all genotypes, suggesting a correlation between miR-124-3p expression and FAN1 upregulation in the presence of rs3512 (Figure 10, data extracted from the Genotype-Tissue Expression (GTEx) Portal).

[0741] To investigate whether there is an association between rs3512, FAN1 levels and CAG repeat expansion, the rs3512 SNP or an alternative mutation within the miRNA seed region is introduced into patient-derived iPSCs carrying >127 CAG repeats on the Htt locus, and a C-terminal HiBiT tag on the Fan1 locus to facilitate quantification.

[0742] CRISPR single guide RNAs (sgRNAs) are designed to introduce a double-strand break on the DNA outside the 3’-UTR of Fan1. Repair templates were designed to: / . introduce the rs3512 (G>C) SNP on the 3’-UTR (converting the predicted miR-124-3p 7mer-m8 site into a 6mer), or / / , introduce two nucleotide mutations on the predicted binding site of the miR-124- 3p seed (therefore eliminating any predicted miR-124-3p regulation). In addition, a PAM motif mutation was included at the sgRNA target site outside the 3’-UTR in both repair templates to avoid Cas9 re-cutting after an HDR event.

[0743] Patient-derived iPSCs carrying >127 CAG repeats were electroporated with a mixture of ribonucleoproteins consisting of Cas9 and sgRNA, and HDR template. Cells are serially- diluted and plated sparsely to encourage the formation of single cell-derived colonies. Clones are picked and plated onto separate wells, expanded and genotyped for the presence / absence of the desired edits. Homozygous and heterozygous clones carrying rs3512 or a two-nucleotide mutation on the miR-124-3p seed binding site are identified, validated and expanded.

[0744] Parental (wild-type) and validated iPSC clones of different genotypes are differentiated into excitatory neurons and kept in culture for >10 weeks to allow CAG repeat expansion. At the experiment endpoint, three wells per genotype are taken for HiBiT luminescence assay, and three wells taken for gDNA extraction.

[0745] HiBiT luminescence is measured as a proxy of FAN1 level, revealing that the introduction of rs3512 induces FAN1 upregulation in an allele-dependent manner: heterozygous rs3512 and homozygous rs3512 clones have 50% and 100% higher levels of FAN1 in comparison to parental control, respectively, as seen in datasets from the GTEx portal. In addition, the introduction of a two-nucleotide mutation on the miR-124-3p seed binding site leads to even higher FAN1 upregulation in an allele-dependent manner, revealing the full potential of FAN1 upregulation when blocking the interaction between miR-124-3p and Fan1 3’-UTR. It is envisaged that this would be achieved by using a miRNA steric blocking functional nucleic acid molecule, such as those described herein. gDNA extracted from replicates of the same clones is used for PCR amplification of the Htt locus. PCR products are sent for Nanopore long-read sequencing and the resulting data used to calculate the CAG tract mean somatic length gain. The data reveal that increased FAN1 level, as a result of the disrupted interaction between miR-124-3p and Fan1 3’-UTR, is proportionally associated with slower expansion of the CAG tract, reinforcing the relevance of miRNA regulation blockage as a valid strategy for FAN1 upregulation in Huntington’s disease therapies.

[0746] Table 10: Functional nucleic acid molecules utilised herein

[0747]

[0748]

[0749]

[0750]

[0751]

[0752]

[0753]

[0754]

[0755] Table 11 : Functional nucleic acid molecules utilised in Examples 5 to 7

[0756]

[0757] wherein "m" denotes a 2'-O-methyl modified nucleoside; "*" denotes a phosphorothioate bond between adjacent nucleotides; "+" denotes an LNA nucleotide; and 752MOEr_ / , / i2MOEr_ / , / 32MOEr” denote 5’, internal and 3’_2'-O-methoxyethyl nucleosides, respectively.

Claims

CLAIMS1. A functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous nucleotide sequence is at least 80% complementary to a contiguous nucleotide sequence within the 3’-UTR of Fan1.

2. The functional nucleic acid molecule of claim 1 , wherein the functional nucleic acid molecule competes with a microRNA for binding to Fan1 mRNA.

3. The functional nucleic acid molecule of claim 1 or claim 2, wherein one or more of the contiguous nucleotide sequences is complementary to a contiguous nucleotide sequence within the 3’ UTR of Fan1 that is overlapping with a nucleotide sequence bound by a microRNA.

4. The functional nucleic acid molecule of any of the preceding claims, wherein the microRNA is associated with modulating the onset of a triplet repeat disorder.

5. The functional nucleic acid molecule of any of the preceding claims, wherein the microRNA:(a) is selected from the group consisting of: hsa-miR-299-3p, hsa-miR-3940-5p, hsa-miR-4265, hsa-miR-4507, hsa-miR-4657, hsa-miR-6748-5p, hsa-miR- 6759-5p, hsa-miR-6793-5p, hsa-miR-6796-5p, hsa-miR-6839-3p, hsa-miR- 629-5p, hsa-miR-1275, hsa-miR-193b-5p, hsa-miR-3675-5p, hsa-miR-4665- 5p, hsa-miR-6751-5p, hsa-miR-6803-5p, hsa-miR-6835-5p, hsa-miR-6842-5p, hsa-miR-6890-5p, hsa-miR-7109-5p, hsa-miR-7110-5p, hsa-miR-198, hsa- miR-1911-3p, hsa-miR-6753-5p, hsa-miR-1256, hsa-miR-3910, hsa-miR- 1910-3p, hsa-miR-2682-5p, hsa-miR-34a-5p, hsa-miR-34b-5p, hsa-miR-34c- 5p, hsa-miR-449a, hsa-miR-449b-5p, hsa-miR-449c-5p, hsa-miR-548au-3p, hsa-miR-584-3p, hsa-miR-6511a-5p, hsa-miR-6808-5p, hsa-miR-6893-5p, hsa-miR-940, hsa-miR-3714, hsa-miR-125b-1-3p, hsa-miR-155-5p, hsa-miR- 3621 , hsa-miR-3610, hsa-miR-4665-3p, hsa-miR-4755-3p, hsa-miR-3622a-5p, hsa-miR-5582-5p, hsa-miR-124-3p, hsa-miR-506-3p, hsa-miR-10527-5p, hsa- miR-1207-5p, hsa-miR-1262, hsa-miR-1273h-3p, hsa-miR-1287-3p, hsa-miR- 1301-3p, hsa-miR-1303, hsa-miR-1304-5p, hsa-miR-1343-5p, hsa-miR-141- 3p, hsa-miR-186-5p, hsa-miR-1914-3p, hsa-miR-200a-3p, hsa-miR-204-5p, hsa-miR-211-5p, hsa-miR-23a-5p, hsa-miR-23b-5p, hsa-miR-3120-3p, hsa-miR-3122, hsa-miR-3182, hsa-miR-3199, hsa-miR-335-3p, hsa-miR-3681-5p, hsa-miR-3913-5p, hsa-miR-3925-3p, hsa-miR-4284, hsa-miR-4469, hsa-miR- 450b-5p, hsa-miR-4640-5p, hsa-miR-4649-3p, hsa-miR-4650-3p, hsa-miR- 4667-3p, hsa-miR-4677-5p, hsa-miR-4693-3p, hsa-miR-4701-3p, hsa-miR- 4726-5p, hsa-miR-4763-3p, hsa-miR-4768-5p, hsa-miR-4771 , hsa-miR-4775, hsa-miR-4776-3p, hsa-miR-4797-3p, hsa-miR-485-5p, hsa-miR-5002-3p, hsa- miR-5008-5p, hsa-miR-5089-5p, hsa-miR-513b-5p, hsa-miR-5190, hsa-miR- 5191 , hsa-miR-5193, hsa-miR-5194, hsa-miR-543, hsa-miR-545-3p, hsa-miR- 548a-3p, hsa-miR-548aa, hsa-miR-548an, hsa-miR-548ap-3p, hsa-miR- 548ar-3p, hsa-miR-548az-3p, hsa-miR-548bc, hsa-miR-548e-3p, hsa-miR- 548n, hsa-miR-548t-3p, hsa-miR-589-3p, hsa-miR-6730-5p, hsa-miR-6736- 5p, hsa-miR-6738-5p, hsa-miR-6740-5p, hsa-miR-676-3p, hsa-miR-6770-5p, hsa-miR-6826-3p, hsa-miR-6831-5p, hsa-miR-6833-3p, hsa-miR-6845-3p, hsa-miR-6870-3p, hsa-miR-6875-3p, hsa-miR-6878-3p, hsa-miR-6884-3p, hsa-miR-7108-3p, hsa-miR-7974, hsa-miR-802, hsa-miR-939-5p, hsa-let-7f-2- 3p, hsa-miR-11181-3p, hsa-miR-1185-1-3p, hsa-miR-1185-2-3p, hsa-miR- 1197, hsa-miR-12129, hsa-miR-12136, hsa-miR-1228-3p, hsa-miR-124-3p, hsa-miR-1264, hsa-miR-1265, hsa-miR-1276, hsa-miR-1288-5p, hsa-miR- 1290, hsa-miR-1299, hsa-miR-130a-5p, hsa-miR-135a-2-3p, hsa-miR-135b- 3p, hsa-miR-138-1-3p, hsa-miR-145-5p, hsa-miR-15b-3p, hsa-miR-16-1-3p, hsa-miR-181 a-5p, hsa-miR-181 b-5p, hsa-miR-181 c-5p, hsa-miR-181 d-5p, hsa-miR-187-3p, hsa-miR-194-5p, hsa-miR-196a-3p, hsa-miR-196b-3p, hsa- miR-197-3p, hsa-miR-19a-5p, hsa-miR-19b-1-5p, hsa-miR-216b-5p, hsa-miR- 2276-3p, hsa-miR-2276-5p, hsa-miR-2278, hsa-miR-2355-3p, hsa-miR-27a- 5p, hsa-miR-29a-5p, hsa-miR-3064-5p, hsa-miR-3085-3p, hsa-miR-3125, hsa- miR-3127-3p, hsa-miR-3135a, hsa-miR-3143, hsa-miR-3150a-3p, hsa-miR- 3154, hsa-miR-3158-3p, hsa-miR-3159, hsa-miR-3160-5p, hsa-miR-3163, hsa-miR-3184-3p, hsa-miR-3189-5p, hsa-miR-3191-5p, hsa-miR-3202, hsa- miR-331-3p, hsa-miR-342-3p, hsa-miR-346, hsa-miR-3605-3p, hsa-miR-3663- 5p, hsa-miR-3677-5p, hsa-miR-372-5p, hsa-miR-376b-5p, hsa-miR-378a-5p, hsa-miR-3916, hsa-miR-3929, hsa-miR-3938, hsa-miR-424-3p, hsa-miR- 4254, hsa-miR-4282, hsa-miR-4323, hsa-miR-4428, hsa-miR-4443, hsa-miR- 4451 , hsa-miR-4476, hsa-miR-4478, hsa-miR-4502, hsa-miR-4503, hsa-miR- 4515, hsa-miR-4679, hsa-miR-4694-5p, hsa-miR-4699-3p, hsa-miR-4729, hsa-miR-4738-3p, hsa-miR-4739, hsa-miR-4745-5p, hsa-miR-4755-5p, hsa- miR-4756-5p, hsa-miR-4766-5p, hsa-miR-4773, hsa-miR-4781-3p, hsa-miR- 4803, hsa-miR-488-3p, hsa-miR-498-5p, hsa-miR-5001-3p, hsa-miR-5006-3p,hsa-miR-5008-3p, hsa-miR-505-3p, hsa-miR-506-3p, hsa-miR-506-5p, hsa- miR-5088-3p, hsa-miR-5089-3p, hsa-miR-5094, hsa-miR-5189-3p, hsa-miR- 5195-3p, hsa-miR-539-5p, hsa-miR-548a-5p, hsa-miR-548ab, hsa-miR- 548ad-5p, hsa-miR-548ae-5p, hsa-miR-548ag, hsa-miR-548ai, hsa-miR- 548ak, hsa-miR-548am-5p, hsa-miR-548ap-5p, hsa-miR-548aq-5p, hsa-miR- 548ar-5p, hsa-miR-548as-5p, hsa-miR-548au-5p, hsa-miR-548ay-5p, hsa- miR-548az-5p, hsa-miR-548b-5p, hsa-miR-548ba, hsa-miR-548bb-5p, hsa- miR-548c-5p, hsa-miR-548d-5p, hsa-miR-548g-3p, hsa-miR-548h-5p, hsa- miR-548i, hsa-miR-548j-5p, hsa-miR-548m, hsa-miR-548o-5p, hsa-miR-548p, hsa-miR-548t-5p, hsa-miR-548v, hsa-miR-548w, hsa-miR-548y, hsa-miR- 5586-5p, hsa-miR-559, hsa-miR-5591-5p, hsa-miR-5693, hsa-miR-570-5p, hsa-miR-578, hsa-miR-596, hsa-miR-601 , hsa-miR-6081 , hsa-miR-643, hsa- miR-6501-3p, hsa-miR-6504-5p, hsa-miR-6511a-3p, hsa-miR-6511 b-3p, hsa- miR-6513-5p, hsa-miR-660-3p, hsa-miR-661 , hsa-miR-663b, hsa-miR-664a-3p, hsa-miR-6726-5p, hsa-miR-6734-5p, hsa-miR-6736-3p, hsa-miR-6737-3p, hsa-miR-6738-3p, hsa-miR-6739-3p, hsa-miR-6742-3p, hsa-miR-6746-3p, hsa-miR-6756-3p, hsa-miR-676-5p, hsa-miR-6761-5p, hsa-miR-6763-3p, hsa- miR-6763-5p, hsa-miR-6791-3p, hsa-miR-6796-3p, hsa-miR-6818-3p, hsa- miR-6825-5p, hsa-miR-6829-3p, hsa-miR-6833-5p, hsa-miR-6843-3p, hsa- miR-6848-3p, hsa-miR-6854-5p, hsa-miR-6859-5p, hsa-miR-6876-5p, hsa- miR-6894-5p, hsa-miR-6895-3p, hsa-miR-7114-5p, hsa-miR-7157-3p, hsa- miR-765, hsa-miR-766-5p, hsa-miR-7852-3p, hsa-miR-7977, hsa-miR-7978, hsa-miR-8485, hsa-miR-888-5p, hsa-miR-920, hsa-miR-943, hsa-miR-10398- 5p, hsa-miR-105-5p, hsa-miR-10a-3p, hsa-miR-12115, hsa-miR-1236-3p, hsa- miR-1253, hsa-miR-125b-2-3p, hsa-miR-1286, hsa-miR-129-5p, hsa-miR- 1293, hsa-miR-1302, hsa-miR-1324, hsa-miR-1343-3p, hsa-miR-1470, hsa- miR-147b-5p, hsa-miR-186-3p, hsa-miR-1912-5p, hsa-miR-196a-5p, hsa-miR-196b-5p, hsa-miR-1976, hsa-miR-205-5p, hsa-miR-2116-5p, hsa-miR-22-5p, hsa-miR-221-5p, hsa-miR-24-3p, hsa-miR-2467-5p, hsa-miR-2682-3p, hsa- miR-26b-3p, hsa-miR-30a-3p, hsa-miR-30d-3p, hsa-miR-30e-3p, hsa-miR-31- 3p, hsa-miR-3133, hsa-miR-3145-3p, hsa-miR-3152-5p, hsa-miR-3155a, hsa- miR-3155b, hsa-miR-3166, hsa-miR-3171 , hsa-miR-3175, hsa-miR-3177-3p, hsa-miR-3184-5p, hsa-miR-3188, hsa-miR-3190-3p, hsa-miR-324-5p, hsa- miR-326, hsa-miR-330-5p, hsa-miR-3529-5p, hsa-miR-3612, hsa-miR-362-5p, hsa-miR-3621 , hsa-miR-363-5p, hsa-miR-3655, hsa-miR-365a-5p, hsa-miR- 365b-5p, hsa-miR-3675-5p, hsa-miR-3680-3p, hsa-miR-3682-3p, hsa-miR- 3682-5p, hsa-miR-3686, hsa-miR-3688-5p, hsa-miR-376a-3p, hsa-miR-376b-3p, hsa-miR-379-5p, hsa-miR-3925-5p, hsa-miR-3940-3p, hsa-miR-3942-3p, hsa-miR-423-5p, hsa-miR-4273, hsa-miR-4287, hsa-miR-4298, hsa-miR- 4457, hsa-miR-4483, hsa-miR-4484, hsa-miR-450a-1-3p, hsa-miR-4632-3p, hsa-miR-4659a-3p, hsa-miR-4659a-5p, hsa-miR-4659b-3p, hsa-miR-4660, hsa-miR-4668-3p, hsa-miR-4685-3p, hsa-miR-4685-5p, hsa-miR-4687-3p, hsa-miR-4695-5p, hsa-miR-4707-5p, hsa-miR-4722-5p, hsa-miR-4724-5p, hsa-miR-4727-3p, hsa-miR-4733-5p, hsa-miR-4736, hsa-miR-4740-3p, hsa- miR-4742-3p, hsa-miR-4757-5p, hsa-miR-4762-3p, hsa-miR-4764-3p, hsa- miR-4769-3p, hsa-miR-4774-3p, hsa-miR-4779, hsa-miR-4799-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-495-3p, hsa-miR-500b-5p, hsa-miR-501-5p, hsa-miR-507, hsa-miR-518a-5p, hsa-miR-526b-5p, hsa-miR-527, hsa-miR-542-5p, hsa-miR-548as-3p, hsa-miR-548at-3p, hsa-miR-548aw, hsa-miR-548ay-3p, hsa-miR-551 b-5p, hsa-miR-557, hsa-miR-5582-3p, hsa-miR-5584-5p, hsa-miR-5587-3p, hsa-miR-5590-5p, hsa-miR-5687, hsa-miR-5688, hsa- miR-572, hsa-miR-576-5p, hsa-miR-590-3p, hsa-miR-6074, hsa-miR-6089, hsa-miR-6128, hsa-miR-623, hsa-miR-629-3p, hsa-miR-650, hsa-miR-6508-3p, hsa-miR-6511 b-5p, hsa-miR-6515-3p, hsa-miR-6516-5p, hsa-miR-6721-5p, hsa-miR-6728-5p, hsa-miR-6729-3p, hsa-miR-6741-5p, hsa-miR-6745, hsa-miR-6750-5p, hsa-miR-6756-5p, hsa-miR-6764-3p, hsa-miR-6765-5p hsa-miR-6766-5p, hsa-miR-6768-3p, hsa-miR-6774-5p, hsa-miR-6777-5p hsa-miR-6781-3p, hsa-miR-6783-3p, hsa-miR-6792-5p, hsa-miR-6795-3p hsa-miR-6807-5p, hsa-miR-6809-3p, hsa-miR-6811-5p, hsa-miR-6817-5p hsa-miR-6820-5p, hsa-miR-6823-3p, hsa-miR-6824-3p, hsa-miR-6837-5p hsa-miR-6844, hsa-miR-6873-3p, hsa-miR-6889-5p, hsa-miR-6890-5p, hsa- miR-6891-3p, hsa-miR-7-1-3p, hsa-miR-7-2-3p, hsa-miR-7113-3p, hsa-miR- 7113-5p, hsa-miR-7151-5p, hsa-miR-7156-3p, hsa-miR-7156-5p, hsa-miR- 7162-3p, hsa-miR-766-3p, hsa-miR-769-3p, hsa-miR-7853-5p, hsa-miR-8057, hsa-miR-8073, hsa-miR-874-5p, hsa-miR-885-5p, hsa-miR-887-5p, hsa-miR- 95-3p, hsa-miR-9500, hsa-miR-9903, hsa-miR-9983-3p, hsa-let-7a-3p, hsa- let-7a-5p, hsa-let-7b-3p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-5p, hsa-let- 7e-5p, hsa-let-7f-1-3p, hsa-let-7f-5p, hsa-let-7g-5p, hsa-let-7i-5p, hsa-miR-1 - 3p, hsa-miR-10392-3p, hsa-miR-10526-3p, hsa-miR-106a-5p, hsa-miR-106b- 5p, hsa-miR-10b-3p, hsa-miR-1183, hsa-miR-1185-5p, hsa-miR-1199-3p, hsa- miR-1199-5p, hsa-miR-1200, hsa-miR-1208, hsa-miR-12124, hsa-miR-12132, hsa-miR-12135, hsa-miR-122-3p, hsa-miR-1226-5p, hsa-miR-122b-3p, hsa- miR-122b-5p, hsa-miR-1237-3p, hsa-miR-1245a, hsa-miR-1245b-5p, hsa- miR-1247-5p, hsa-miR-1248, hsa-miR-1251-3p, hsa-miR-1252-3p, hsa-miR-125b-1-3p, hsa-miR-1261 , hsa-miR-1285-3p, hsa-miR-1288-3p, hsa-miR- 1291 , hsa-miR-1296-3p, hsa-miR-1298-5p, hsa-miR-1306-5p, hsa-miR-130b- 5p, hsa-miR-132-3p, hsa-miR-1323, hsa-miR-134-3p, hsa-miR-135a-5p, hsa- miR-135b-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-139-5p, hsa-miR- 140-3p, hsa-miR-1468-3p, hsa-miR-149-3p, hsa-miR-149-5p, hsa-miR-153- 5p, hsa-miR-1537-3p, hsa-miR-155-5p, hsa-miR-17-5p, hsa-miR-181a-2-3p, hsa-miR-181d-3p, hsa-miR-187-5p, hsa-miR-1909-3p, hsa-miR-191-5p, hsa- miR-194-3p, hsa-miR-200c-5p, hsa-miR-202-3p, hsa-miR-203a-3p, hsa-miR- 2052, hsa-miR-206, hsa-miR-208b-5p, hsa-miR-20a-5p, hsa-miR-20b-3p, hsa- miR-20b-5p, hsa-miR-21-3p, hsa-miR-211-3p, hsa-miR-2110, hsa-miR-2115- 3p, hsa-miR-212-3p, hsa-miR-216a-5p, hsa-miR-216b-3p, hsa-miR-217-3p, hsa-miR-218-2-3p, hsa-miR-218-5p, hsa-miR-221-3p, hsa-miR-222-3p, hsa- miR-222-5p, hsa-miR-2277-3p, hsa-miR-2392, hsa-miR-25-3p, hsa-miR-27a- 3p, hsa-miR-27b-3p, hsa-miR-29b-2-5p, hsa-miR-302a-5p, hsa-miR-3064-3p, hsa-miR-3074-5p, hsa-miR-3115, hsa-miR-3116, hsa-miR-3130-3p, hsa-miR- 3136-3p, hsa-miR-3136-5p, hsa-miR-3137, hsa-miR-3142, hsa-miR-3144-5p, hsa-miR-3148, hsa-miR-3149, hsa-miR-3150b-3p, hsa-miR-3152-3p, hsa- miR-3157-5p, hsa-miR-3160-3p, hsa-miR-3162-5p, hsa-miR-3167, hsa-miR- 3173-3p, hsa-miR-3179, hsa-miR-3180-5p, hsa-miR-3187-5p, hsa-miR-3191- 3p, hsa-miR-3194-5p, hsa-miR-32-5p, hsa-miR-3200-3p, hsa-miR-320a-3p, hsa-miR-320a-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR- 324-3p, hsa-miR-328-3p, hsa-miR-329-3p, hsa-miR-330-3p, hsa-miR-331-5p, hsa-miR-335-5p, hsa-miR-33a-3p, hsa-miR-340-3p, hsa-miR-345-5p, hsa- miR-34a-3p, hsa-miR-34b-3p, hsa-miR-3605-5p, hsa-miR-3609, hsa-miR-361- 3p, hsa-miR-3610, hsa-miR-3613-3p, hsa-miR-3614-3p, hsa-miR-3616-5p, hsa-miR-3617-3p, hsa-miR-362-3p, hsa-miR-3620-3p, hsa-miR-3622a-5p, hsa-miR-363-3p, hsa-miR-365a-3p, hsa-miR-365b-3p, hsa-miR-3662, hsa- miR-3663-3p, hsa-miR-3671 , hsa-miR-3675-3p, hsa-miR-3679-3p, hsa-miR- 3679-5p, hsa-miR-3688-3p, hsa-miR-3689a-5p, hsa-miR-3689b-5p, hsa-miR- 3689e, hsa-miR-3689f, hsa-miR-369-3p, hsa-miR-3690, hsa-miR-3691-5p, hsa-miR-370-3p, hsa-miR-3714, hsa-miR-371a-5p, hsa-miR-371b-5p, hsa- miR-373-5p, hsa-miR-375-3p, hsa-miR-377-3p, hsa-miR-378g, hsa-miR-383- 5p, hsa-miR-3910, hsa-miR-3919, hsa-miR-3920, hsa-miR-3928-3p, hsa-miR- 3934-3p, hsa-miR-3940-5p, hsa-miR-3943, hsa-miR-409-3p, hsa-miR-421 , hsa-miR-4270, hsa-miR-4288, hsa-miR-4290, hsa-miR-4292, hsa-miR-4429, hsa-miR-4446-3p, hsa-miR-4456, hsa-miR-4458, hsa-miR-4474-3p, hsa-miR- 4475, hsa-miR-4477a, hsa-miR-4496, hsa-miR-4500, hsa-miR-4507, hsa-miR-4516, hsa-miR-4519, hsa-miR-4633-3p, hsa-miR-4639-5p, hsa-miR-4646-3p, hsa-miR-4652-3p, hsa-miR-4652-5p, hsa-miR-4653-3p, hsa-miR-4661-3p hsa-miR-4665-3p, hsa-miR-4676-5p, hsa-miR-4677-3p, hsa-miR-4690-5p hsa-miR-4691-3p, hsa-miR-4709-5p, hsa-miR-4711-3p, hsa-miR-4712-3p hsa-miR-4713-5p, hsa-miR-4714-3p, hsa-miR-4715-3p, hsa-miR-4719, hsa- miR-4720-3p, hsa-miR-4728-3p, hsa-miR-4728-5p, hsa-miR-4731-3p, hsa- miR-4731-5p, hsa-miR-4732-5p, hsa-miR-4734, hsa-miR-4738-5p, hsa-miR- 4740-5p, hsa-miR-4743-3p, hsa-miR-4744, hsa-miR-4747-3p, hsa-miR-4752, hsa-miR-4753-3p, hsa-miR-4755-3p, hsa-miR-4758-3p, hsa-miR-4763-5p, hsa-miR-4764-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4782-5p, hsa-miR-4784, hsa-miR-4788, hsa-miR-4793-3p, hsa-miR-4793-5p, hsa-miR- 4794, hsa-miR-4796-3p, hsa-miR-4797-5p, hsa-miR-4801 , hsa-miR-4804-3p, hsa-miR-488-5p, hsa-miR-490-3p, hsa-miR-499b-5p, hsa-miR-5002-5p, hsa- miR-5088-5p, hsa-miR-513a-3p, hsa-miR-513c-3p, hsa-miR-515-5p, hsa-miR- 516b-5p, hsa-miR-5189-5p, hsa-miR-5196-3p, hsa-miR-519d-3p, hsa-miR- 520g-3p, hsa-miR-520h, hsa-miR-526b-3p, hsa-miR-541-5p, hsa-miR-544b, hsa-miR-548ac, hsa-miR-548ad-3p, hsa-miR-548ae-3p, hsa-miR-548ah-3p, hsa-miR-548ah-5p, hsa-miR-548aj-3p, hsa-miR-548aj-5p, hsa-miR-548am-3p, hsa-miR-548aq-3p, hsa-miR-548av-3p, hsa-miR-548bb-3p, hsa-miR-548d-3p, hsa-miR-548e-5p, hsa-miR-548f-5p, hsa-miR-548g-5p, hsa-miR-548h-3p, hsa-miR-548j-3p, hsa-miR-548k, hsa-miR-548l, hsa-miR-548o-3p, hsa-miR- 548q, hsa-miR-548x-5p, hsa-miR-548z, hsa-miR-550a-3p, hsa-miR-558, hsa- miR-5582-5p, hsa-miR-5680, hsa-miR-5690, hsa-miR-5692a, hsa-miR-5692c, hsa-miR-5696, hsa-miR-5699-5p, hsa-miR-5702, hsa-miR-5703, hsa-miR- 5706, hsa-miR-573, hsa-miR-579-3p, hsa-miR-580-3p, hsa-miR-583, hsa- miR-603, hsa-miR-6090, hsa-miR-612, hsa-miR-615-5p, hsa-miR-616-3p, hsa-miR-616-5p, hsa-miR-624-5p, hsa-miR-627-3p, hsa-miR-629-5p, hsa- miR-632, hsa-miR-642a-3p, hsa-miR-642a-5p, hsa-miR-642b-3p, hsa-miR- 642b-5p, hsa-miR-647, hsa-miR-649, hsa-miR-6499-3p, hsa-miR-6505-5p, hsa-miR-6507-3p, hsa-miR-6507-5p, hsa-miR-651-3p, hsa-miR-6510-3p, hsa- miR-6510-5p, hsa-miR-6512-3p, hsa-miR-6515-5p, hsa-miR-6529-3p, hsa- miR-656-3p, hsa-miR-664a-5p, hsa-miR-664b-3p, hsa-miR-6715a-3p, hsa- miR-6720-5p, hsa-miR-6722-3p, hsa-miR-6724-5p, hsa-miR-6727-5p, hsa- miR-6735-3p, hsa-miR-6749-3p, hsa-miR-6751-3p, hsa-miR-6754-5p, hsa- miR-6757-3p, hsa-miR-6758-3p, hsa-miR-6758-5p, hsa-miR-6760-3p, hsa- miR-6760-5p, hsa-miR-6767-3p, hsa-miR-6769a-3p, hsa-miR-6771-3p, hsa- miR-6773-5p, hsa-miR-6774-3p, hsa-miR-6775-3p, hsa-miR-6778-3p, hsa-miR-6782-5p, hsa-miR-6783-5p, hsa-miR-6784-3p, hsa-miR-6785-5p, hsa- miR-6787-3p, hsa-miR-6791-5p, hsa-miR-6792-3p, hsa-miR-6798-5p, hsa- miR-6799-5p, hsa-miR-6800-3p, hsa-miR-6801-3p, hsa-miR-6810-3p, hsa- miR-6810-5p, hsa-miR-6813-3p, hsa-miR-6827-3p, hsa-miR-6827-5p, hsa- miR-6830-3p, hsa-miR-6830-5p, hsa-miR-6832-5p, hsa-miR-6834-5p, hsa- miR-6836-3p, hsa-miR-6836-5p, hsa-miR-6839-3p, hsa-miR-6842-3p, hsa- miR-6851-5p, hsa-miR-6852-5p, hsa-miR-6856-3p, hsa-miR-6856-5p, hsa- miR-6857-5p, hsa-miR-6858-3p, hsa-miR-6860, hsa-miR-6861-5p, hsa-miR- 6862-3p, hsa-miR-6865-3p, hsa-miR-6868-3p, hsa-miR-6885-3p, hsa-miR- 6889-3p, hsa-miR-6890-3p, hsa-miR-6891-5p, hsa-miR-6892-3p, hsa-miR- 6893-3p, hsa-miR-7108-5p, hsa-miR-7109-3p, hsa-miR-7152-3p, hsa-miR-7152-5p, hsa-miR-7154-3p, hsa-miR-7155-3p, hsa-miR-718, hsa-miR-758-5p, hsa-miR-7704, hsa-miR-8062, hsa-miR-873-5p, hsa-miR-876-5p, hsa-miR- 877-3p, hsa-miR-889-5p, hsa-miR-892a, hsa-miR-892c-5p, hsa-miR-9-3p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93-5p, hsa-miR-939-3p, hsa-miR- 98-3p, hsa-miR-98-5p, hsa-miR-9985, hsa-miR-99a-3p, hsa-miR-99b-3p, or an isomiR thereof; and / or(b) comprises or consists of a sequence selected from the group consisting of: SEQ ID NOs: 9 to 944.

6. The functional nucleic acid molecule of any of the preceding claims, wherein the 3’ UTR of Fan1 is as set forth in any one of the sequence selected from the group consisting of SEQ ID NOs: 1 to 8.

7. The functional nucleic acid molecule of any of the preceding claims, wherein one or more of the contiguous nucleotide sequences comprises or consists of a sequence independently selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064; 1065 to 1130; 1137 to 1138; and / or 1139 to 1148, or comprises or consists of a sequence with at least 90% sequence identity to a sequence independently selected from the group consisting of: SEQ ID NOs: 949 to 973; 974 to 998; 999 to 1064; 1065 to 1130; 1137 to 1138; and / or 1139 to 1148.

8. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises one or more modified nucleosides.

9. The functional nucleic acid molecule of claim 8, wherein the one or more modified nucleosides independently comprise a modified sugar moiety or a modified nucleobase.

10. The functional nucleic acid molecule of claim 8 or claim 9, wherein the one or more modified nucleosides independently comprise a modified sugar moiety independently selected from any one or more of: 2’-deoxy, 2’-MOE, 2’-OMe, and 2’-F.11 . The functional nucleic acid molecule of any of claim 8 to 10, wherein the one or more modified nucleosides comprise a bicyclic sugar moiety.

12. The functional nucleic acid molecule of any of claim 8 to 10, wherein the one or more modified nucleosides comprise a bicyclic sugar moiety selected from LNA and cET.

13. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises one or more modified internucleoside linkages.

14. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises one or more nucleotide analogues.15 A conjugate comprising the functional nucleic acid molecule of any of the preceding claims and one or more moieties covalently bound to said functional nucleic acid molecule.

16. A pharmaceutically acceptable salt of the functional nucleic acid molecule of any of claims 1 to 14, or the conjugate of claim 15.

17. A composition comprising the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, or the pharmaceutically acceptable salt of claim 16, and a diluent, solvent, carrier, salt and / or adjuvant.

18. A pharmaceutical composition comprising the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, or the pharmaceutically acceptable salt of claim 16, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

19. An in vivo or in vitro method for modulating Fan1 protein expression in a target cell in which Fan1 and a microRNA targeting Fan1 are present, the method comprising the steps of exposing the cell to the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, the composition of claim 17, or the pharmaceutical composition of claim 18.

20. A method of treating, preventing, or delaying the onset of a disease associated with Fan1 protein in a subject comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule of any of claims 1 to14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, or the pharmaceutical composition of claim 18.

21. The functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim15, the pharmaceutically acceptable salt of claim 16, or the pharmaceutical composition of claim 18 for use in treating, preventing, or delaying the onset of a disease.

22. Use of the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, or the pharmaceutical composition of claim 18 for the preparation of a medicament for the treatment, prevention, or delay of a disease.

23. The method according to claim 20; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to claim 21 ; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to claim 22, wherein the disease is a triplet repeat disorder.

24. The method according to claim 20 or claim 23; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to claim 21 or claim 23; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to claim 22 or claim 23, wherein the disease is a disease associated with or caused by CAG triplet repeat expansion, CGG triplet repeat expansion, CTG triplet repeat expansion, GAA triplet repeat expansion, GCC triplet repeat expansion, or GCG triplet repeat expansion.

25. The method according to any of claims 20, 23, and 24; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of claims 21, 23, and 24; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of claims 22, 23, and 24, wherein the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3),Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7),Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

26. The method according to any of claims 20, and 23 to 25; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of claims 21 , and 23 to 25; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of claims 22, and 23 to 25, wherein the disease is Huntington’s disease (HD).