Alcoholic beverages having a high content of fruity volatile compounds and a low volatile acidity and preparation process thereof

Abstract

The present invention relates to alcoholic beverages having a good content of fruity volatile compounds and a low volatile acidity, in particular thanks to the fermentation process by means of the yeast Cyberlindnera saturnus, preferably of the SPACE strain, and to the use of such a yeast as a food inoculum.

Description

[0001] ALCOHOLIC BEVERAGES HAVING A HIGH CONTENT OF FRUITY VOLATILE COMPOUNDS AND A LOW VOLATILE ACIDITY AND PREPARATION PROCESS THEREOF.

[0002] DESCRIPTION

[0003] Technical Field

[0004] The present invention is placed in the field of food beverages, and in particular relates to alcoholic beverages, where said beverages have a high content of fruity volatile compounds and a low volatile acidity, in particular thanks to the fermentation process by means of the yeast Cyberlindnera saturn us, preferably of the SPACE strain, and to the use of such yeast as a food inoculum.

[0005] Background

[0006] In the production of alcoholic beverages, such as wine or beer, the use of microbial starters is a fundamental practice which allows to control and guide the fermentation process.

[0007] Microbial starters are intended as a yeast strain characterised by physiological, biochemical and oenological properties which are optimised in relation to the technological requirements of the pure fermentation processes (Pretorius, 2000), or sequential inoculations, if Non-Saccharomyces yeasts are involved.

[0008] The use of selected yeasts ensures a prompt start of fermentation because the quality and amount of yeast added to the must are carefully chosen; it allows greater control of the fermentation process by the operator who chooses how to conduct the fermentation without leaving it to the yeasts naturally present in the grapes and which do not always have positive characteristics; it reduces the problems of stopping or slowing down of the process characterising spontaneous fermentations; achieves good yields of sugar-to-alcohol transformation; reduces and prevents any damage caused by microbial species contaminants (e.g., acetic bacteria); reduces or eliminates the abnormal organoleptic characteristics; and, last but not least, contributes to the production standardisation of a given wine, enabling it to be recognisable to the consumer year after year (Fleet and Heard, 1993).

[0009] In particular, microbial starters, specifically the appropriately selected yeasts inserted in inoculums and used in the fermentation process, allow to improve the sensory quality of the wines or beers obtained.

[0010] The selection of yeasts to be used as oenological starters generally involves the isolation thereof from must or grapes, the identification thereof (yeasts of the Saccharomyces genus are preferably used), and above all the characterisation thereof on the basis of a series of properties of technological and oenological interest. Technological characteristics are intended as those characteristics linked to the fermentation activity of the yeasts (fermentation vigour, absolute alcoholic strength, rapidity of the start of fermentation), while the oenological characteristics comprise those characteristics which contribute to the aroma and more generally to the organoleptic quality of the wine. These latter characteristics include the low production of acetic acid and the high aromatic potential of the finished product.

[0011] Instead, the selection of yeasts for the production of beer involves choosing on the basis of maltose fermentation capacity, fermentation vigour and the ability to release desired volatile compounds.

[0012] The acetic acid derived from the metabolism of sugar is an undesirable characteristic for the yeasts used in alcoholic fermentations; this characteristic varies as a function of the species and strain of yeast used. The yeasts used in alcoholic fermentations should not produce amounts of acetic acid greater than 0.4 g / L.

[0013] Scientific studies on the use of Non-Saccharomyces yeasts in oenology and for the production of beer have increased since the beginning of the current century due to the potential impact thereof on the sensory amount of the wines and beers obtained (colour, aroma, body and structure) and the need to diversify the products obtained. It should be recalled that market trends seek aromatic wines and beers.

[0014] The main limitations in the use of Non-Saccharomyces yeasts are due to the fact that for most thereof, co-fermentations or sequential inoculums with other Saccharomyces yeasts must be carried out in order to finish the metabolism of the sugars present due to the low tolerance thereof to alcohol and the low fermentation power thereof, as well as, sometimes, the production of secondary compounds which are not always welcome (e.g., acetic acid, 4-ethylphenol, etc.).

[0015] To date, very few Non-Saccharomyces yeasts are propagated and sold as microbial starters for alcoholic fermentations.

[0016] Summary of the invention

[0017] The problem addressed by the present invention is thus to provide a process for the preparation of alcoholic beverages with a good content of fruity volatile compounds and a low volatile acidity, in particular with a higher content of isoamyl acetate, 0-phenylethyl, ethyl butyrate, isobutyl acetate and butyric acid by means of Non-Saccharomyces yeasts.

[0018] Therefore, the present invention solves the aforesaid problem by means of a fermentation process characterised by the presence of the yeast Cyberlindnera saturnus, as outlined in the appended claims, the definitions of which form an integral part of the present description.

[0019] A further aspect of the present invention regards the food inoculum comprising the yeast Cyberlindnera saturnus and the use thereof in the preparation of alcoholic beverages.

[0020] Furthermore, the yeast Cyberlindnera saturnus is adapted to be used as a probiotic in food or as a food supplement.

[0021] Another aspect of the invention regards alcoholic beverages or alcoholic fermentation must comprising the yeast Cyberlindnera saturnus.

[0022] Further characteristics and advantages of the present invention will result from the description of examples of embodiments of the invention, provided as an indication of the invention itself.

[0023] Brief description of the figures

[0024] Fig. 1 shows the colonies of the yeast Cyberlindnera saturnus of the SPACE strain grown on WL agar medium plate after 3 days (a) and after 7 days (b) at 30°C in aerobiosis.

[0025] Fig. 2 shows cells of the yeast Cyberlindnera saturnus of the SPACE strain under an electron microscope.

[0026] Fig. 3 shows the genetic sequence SEQ_ID_1 of the yeast Cyberlindnera saturnus of the SPACE strain having similarity of 99.82% with the yeast Cyberlindnera saturnus CBS 254ITS.

[0027] Fig. 4 shows the analysis with the Bionumerics software of the RAPD R3 profile of the SPACE strain in comparison with the reference strain in the BEP2P database of the Applicant (already sequenced previously) and belonging to the species Cyberlindnera saturnus, similarity of 96%, confirming the species membership.

[0028] Fig. 5 shows the analysis with the Bionumerics software of the RAPD M13 profile of the SPACE strain in comparison with a strain of Cyberlindnera saturnus present in the BEP2P database, similarity of 95%, confirming the species membership.

[0029] Fig. 6 shows the capillary electrophoresis of the amplified ITS fragments and the RFLP analysis thereof performed with the restriction enzymes Hhal and Hinfl. Furthermore, it shows the SPACE strain in comparison with the reference strain in the BEP2P database of the Applicant (already sequenced previously) and belonging to the species Cyberlindnera saturnus. The dimensions of the various fragments are indicated at the bottom of the table. The dimensions match, confirming they belong to the same species.

[0030] Fig. 7 shows the colonies of the yeast Cyberlindnera saturnus of the SPACE strain (a) in comparison with a non-H2S-producing yeast (b) on Lead Acetate Agar medium after 5 days of incubation at 30°C.

[0031] Fig. 8 shows the fermentation progress in prosecco must test 1 of the yeast Cyberlindnera saturnus of the SPACE strain in comparison with the commercial strain 1 H.

[0032] Fig. 9 shows the fermentation progress in prosecco must test 2 of the yeast Cyberlindnera saturnus of the SPACE strain in comparison with the commercial strain 1 H.

[0033] Fig. 10 shows the fermentation progress in prosecco must test 3 of the yeast Cyberlindnera saturnus of the SPACE strain (squares) 40g / HL, (triangles) 20g / HL, in comparison with the commercial strain 1 H (20g / HL of yeast are already effective as inoculum).

[0034] Fig. 11 shows the fermentation progress in prosecco must test 4 of the yeast Cyberlindnera saturnus of the SPACE strain in sequential fermentation with the commercial strain 1 H, inoculated at approximately 3 days. The arrow indicates the moment when inoculation of the commercial strain occurred.

[0035] Fig. 12 shows the fermentation progress in prosecco must test 5 of the yeast Cyberlindnera saturnus of the SPACE strain in sequential fermentation with the commercial strain 1 H, inoculated at approximately 9 days. The curve extending up to approximately 250 hours is for the Non-Saccharomyces yeast alone; the parallel test of a sequential inoculum is described with the curve extending up to approximately 500 hours. The arrow indicates the moment when inoculation of the commercial strain occurred.

[0036] Fig. 13 shows Table 4 indicating the volatile compounds detected or not detected in the samples analysed and the yeast Non-Saccharomyces in comparison with the yeast of the commercial strain 1 H (blank sample). Fig. 14 shows Table 5 indicating the fermentation parameters derived from the analysis of beer samples obtained with the yeast Cyberlindnera saturnus of the strains SPACE and ALE 05; Green Mountain; ALE LN3 in sequential inoculation, in comparison with the beer obtained using the yeasts ALE 05; ALE LN3; Green Mountain and SPACE individually.

[0037] Detailed description of the invention

[0038] For the purposes of the description of the present document, the term “and / or”, when used in a list of two or more items, means that any one of the listed items can be used alone, or in any combination of two or more of the listed items.

[0039] For example, if a combination is described as containing the components A, B and / or C, or, A and / or B and / or C, the composition can contain only A; only B; only C; A and B in combination; A and C in combination; B and C in combination; or A, B and C in combination.

[0040] The terms “comprises”, “comprising” or any other variation thereof are intended to cover a non-exclusive inclusion, so that a system, a method, a use, etc. which comprises a list of elements does not include only those elements but can include other elements not expressly listed or inherent to such a system, method, use, etc.

[0041] An element followed by “comprises... a...” does not prevent, without further constraints, the existence of further identical elements in the system, method or use comprising the element.

[0042] An aim of the present invention is therefore a preparation process of an alcoholic beverage comprising the fermentation step characterised in that said step is carried out in the presence of the yeast Cyberlindnera saturnus.

[0043] In fact, it was surprisingly found that the use of the yeast Cyberlindnera saturnus results in a good content of fruity volatile compounds and a low volatile acidity in the alcoholic fermentation step, such as the increase of some varietal compounds, such as specifically isoamyl acetate, 0-phenylethyl and ethyl butyrate, which improve and / or increase the fragrance and aroma of some alcoholic beverages.

[0044] Studies have also shown that the fermentation of the yeast referred to in the present invention has a different and slower kinetic profile with respect to those obtained from yeasts of standard strains. The different fermentation kinetics also allow to give rise to higher contents of fruity volatile compounds and, at the same time, a lower volatile acidity with respect to the standard yeasts used in alcoholic fermentations.

[0045] Fermentation step is intended as a transformation process which produces ethyl alcohol and carbon dioxide. The fermentation triggered by yeasts is used in various fields such as pharmaceuticals, as well as food, for example in wine production.

[0046] The yeast Cyberlindnera saturnus is intended as a Non-Saccharomyces yeast belonging to the species Cyberlindnera saturnus which has the ability to produce methyl salicylate, isobutyl acetate, isoamyl acetate, 0-phenylethyl acetate, ethyl butyrate, butyric acid and low concentrations of acetic acid.

[0047] According to a preferred embodiment of the present invention, the strain of the Cyberlindnera saturnus yeast is SPACE.

[0048] A strain is defined as a pure population of laboratory cells (moulds, fungi, etc.) of the same species, originating from a single progenitor cell, all of which carry one or more particular hereditary traits.

[0049] The yeast Cyberlindnera saturnus of the SPACE strain was isolated and identified as better described in Example 1 .

[0050] The yeast Cyberlindnera saturnus of the SPACE strain has the gene sequence as shown at the end of Example 5.

[0051] According to a preferred embodiment of the present invention, the alcoholic beverage is wine, beer, cider or mead.

[0052] According to a more preferred embodiment of the present invention, the alcoholic beverage is wine, cider or mead.

[0053] According to an even more preferred embodiment of the present invention, the alcoholic beverage is wine.

[0054] According to a preferred embodiment of the present invention, the process comprises a previous preparation step of the food inoculum, which is better described in the following paragraphs.

[0055] The preparation of the inoculum involves inoculating the yeast cream of the SPACE strain of the species Cyberlindnera saturnus in must (10%) for 3-4 hours under stirring and then subsequent inoculation into the remaining must mass. An amino acid source (such as Lysopol and / or Probios, produced by the Applicant) must be added to the must.

[0056] According to a preferred embodiment of the present invention, the process comprises a subsequent step in which a Saccharomyces yeast is added.

[0057] The next step in which a Saccharomyces yeast is added allows to optimise the entire fermentation process.

[0058] Another aim of the present invention is a food inoculum comprising the yeast Cyberlindnera saturnus.

[0059] According to a preferred embodiment of the present invention, the strain of the yeast Cyberlindnera saturnus is SPACE.

[0060] Another aim of the present invention is an alcoholic beverage or an alcoholic fermentation must comprising the yeast Cyberlindnera saturnus, preferably in which the strain of the yeast Cyberlindnera saturnus is SPACE.

[0061] Preferably, the alcoholic beverage or alcoholic fermentation must comprising the yeast Cyberlindnera saturnus, more preferably in which the strain of the yeast Cyberlindnera saturnus is SPACE, is wine, cider or mead.

[0062] A further aim of the present invention is an alcoholic beverage or an alcoholic fermentation must comprising: isoamyl acetate from 1 to 7 mg / L and / or P-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.

[0063] According to a preferred embodiment of the present invention, the alcoholic beverage is an alcoholic beverage or alcoholic fermentation must comprising: isoamyl acetate from 1 to 7 mg / L and p-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.

[0064] According to a preferred embodiment of the present invention, the alcoholic beverage is an alcoholic beverage or alcoholic fermentation must comprising: isoamyl acetate from 1 to 7 mg / L and p-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L; where the alcoholic beverage is wine, cider or mead.

[0065] According to a preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate from 1 to 7 mg / L and / or P-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.

[0066] According to a more preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate from 1 to 7 mg / L and P-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.

[0067] According to a more preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate from 3 to 5 mg / L and / or P-phenylethyl from 1 to 3 mg / L and / or ethyl butyrate from 0.09 to 0.2 mg / L.

[0068] According to an even more preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate from 3 to 5 mg / L and P-phenylethyl from 1 to 3 mg / L and / or ethyl butyrate from 0.09 to 0.2 mg / L. According to a further preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate at 4.96 mg / L and / or 0-phenylethyl at 2.41 mg / L and / or ethyl butyrate at 0.18 mg / L.

[0069] Finally, according to a further preferred embodiment of the present invention, the alcoholic beverage is wine comprising: isoamyl acetate at 4.96 mg / L and P-phenylethyl at 2.41 mg / L and / or ethyl butyrate at 0.18 mg / L.

[0070] From Table 7, it can be estimated that the yeast of the invention allows the preparation of beer comprising from 3 to 10 pg / l of nerol, preferably from 5 to 7 pg / l of nerol.

[0071] Furthermore, the yeast of the invention allows the preparation of beer comprising from 0.5 to 2 mg / l of 0-phenylethyl acetate, preferably from 1 to 1 .5 mg / l of 0-phenylethyl acetate.

[0072] Furthermore, the yeast of the invention allows the preparation of beer comprising from 1 to 3 mg / l of isoamyl acetate, preferably from 1.5 to 2.5 mg / l of isoamyl acetate.

[0073] Furthermore, the yeast of the invention allows the preparation of beer comprising from 0.5 to 0.6 mg / l of capric acid, preferably from 0.50 to 0.55 mg / l of capric acid.

[0074] Therefore, the yeast of the invention allows the preparation of beer comprising from 3 to 10 pg / l of nerol and / or from 0.5 to 2 mg / l of 0-phenylethyl acetate and / or from 1 to 3 mg / l of isoamyl acetate and / or from 0.5 to 0.6 mg / l of capric acid.

[0075] Preferably, the yeast of the invention allows the preparation of beer comprising from 5 to 7 pg / l of nerol and / or from 1.5 to 2.5 mg / l of 0-phenylethyl acetate and / or from 1 to 3 mg / l of isoamyl acetate and / or from 0.50 to 0.55 mg / l of capric acid.

[0076] Another aim of the present invention is the use of the yeast Cyberlindnera saturnus as a food inoculum according to what has been better described above for the preparation of an alcoholic beverage; in particular, the use of the yeast Cyberlindnera saturnus of the SPACE strain is more preferred. Preferably, the alcoholic beverage is wine, beer, cider or mead.

[0077] A further aim is the use of the yeast Cyberlindnera saturnus as a probiotic in food or food supplements, preferably, as a food supplement. Preferably, the use of the yeast Cyberlindnera saturnus of the SPACE strain as a probiotic in food or food supplements is preferred. According to another, more preferred embodiment, the alcoholic beverage is wine and / or beer.

[0078] Another aim is a Cyberlindnera saturnus yeast of the strain identified as SPACE and deposited at the DBVPG Industrial Yeast Collection of the University of Perugia with deposit number DBVPG 50P.

[0079] According to another preferred embodiment, the yeast Cyberlindnera saturnus has gene sequence SEQ_ID_1 .

[0080] EXPERIMENTAL PART

[0081] The invention will be further described with reference to the following Examples and Tests, which are to be considered as an indication of the invention and therefore in no way limiting.

[0082] Example 1 :

[0083] Isolation of the yeast Cyberlindnera saturnus of the SPACE strain

[0084] The yeast Cyberlindnera saturnus of the SPACE strain was isolated from a soil sample collected in January 2020 in an area of the Veneto region with a high wine-growing vocation: the area of Montello (TV), Italy. The medium was collected in sterile bags and, in the laboratory, an aliquot thereof was resuspended in a sterile flask containing 200 ml of rich culture medium (YPD) with antibiotic added against bacterial growth and alcohol against mould growth. The composition of the medium prepared in distilled water and sterilised in an autoclave at 120°C for 20 min is listed below.

[0085] The flask was kept at a constant temperature of 22-24°C. After a few days, in particular after the selection medium had become cloudy, the yeasts were isolated by sowing in a plate in WL agar differential medium (Yeast Extract 4.0 g / L, Tryptone 5.0 g / L, Glucose 50 g / L, monobasic potassium phosphate 550 mg / L, potassium chloride 425 g / L, calcium chloride 125 mg / L, magnesium sulphate 125 mg / L, iron chloride 2.5 mg / L, manganese sulphate 2.5 mg / L, bromine cresol green 22 mg / L, agar 20 g / L, final autoclave sterilisation pH 5.5 ± 2) incubated at 28°C for 3 days in aerobiosis. This was a differential medium capable of allowing the operator to identify several yeasts more easily through the macroscopic appearance of the colonies. The different colonies were then taken from the WL agar medium plates and purified by means of two successive passages in the same medium and then stored at - 80°C in the presence of 40% glycerol (w / w).

[0086] In the specific case of the yeast Cyberlindnera saturnus of the SPACE strain, the colony was found to be of a floury consistency, with a concave appearance and rather irregular margins, off-white in colour (Figure 1 ).

[0087] The cells under the microscope appeared ovoid with unipolar budding (Figure 2); the cells were subsequently identified as Cyberlindnera saturnus of the SPACE strain, through RAPD R3, RAPD M13, ITS-RFLP analysis and sequencing of the ITS region.

[0088] Identification of the yeast Cyberlindnera saturnus of the SPACE strain

[0089] The yeast Cyberlindnera saturnus of the SPACE strain was identified at the species level by means of sequencing the ITS region. The sequence analysis showed a similarity of 99.82% with the sequence of the strain type CBS 254ITS Cyberlindnera saturnus (no. 165971 ). Figure 3 shows the sequence, the result of the comparison in the NCBI database and its alignment with the sequence of the reference type strain.

[0090] The strain DNA was subjected to RAPD analysis with R3 and M13 primers and ITS-RFLP analysis, in order to analyse the strain and compare it with another strain of the same species present in the Applicant’s strain library, which was already previously identified through sequencing (BEP2P strain).

[0091] Example 2:

[0092] Characterisation of the yeast Cyberlindnera saturnus of the SPACE strain Production of hydrogen sulphide.

[0093] Hydrogen sulphide production was assessed in Lead Acetate Agar medium (yeast extract 5 g / L, glucose 40 g / L, peptone 3 g / L, ammonium sulphate 2 g / L, lead acetate 1 g / L, agar 18 g / L incubated at 30°C for 5 days). In this medium, at the end of the incubation, the colonies showed different colours on the basis of the amount of hydrogen sulphide they produced. Colonies coloured dark brown (Figure 7a) indicated a high production of hydrogen sulphide, colonies coloured light brown-beige were indicative of modest production, while the white colonies were characterised by the inability to produce it. The yeast Cyberlindnera saturnus of the SPACE strain was present in the Lead Acetate Agar medium after incubation with light brown colonies; under the conditions tested it produced medium amounts of H2S (Figure 7).

[0094] Fermentation vigour

[0095] The fermentation vigour of the yeast Cyberlindnera saturnus of the SPACE strain was evaluated in various types of natural grape must. The inoculum was prepared in a YPD-rich medium from an ansate of a pure culture of the same medium in a plate. The inoculum was incubated at 25°C for 24 hours and then inoculated at a rate of 10% in must (final volume 300ml / 400ml or 700ml) in closed flasks (previously sterilised) with a silicon stopper perforated in the centre, into which a Pasteur pipette was inserted, bent so as to allow carbon dioxide to escape without loss of water vapour. It was thereby possible to follow the fermentation progress by monitoring the drop in weight due to the production of CO2, an index of sugar fermentation. The incubation was performed at a constant temperature of 25°C and the evaluation of the drop in weight was performed every day until a constant weight was reached, at which point the fermentation was ended. The strain was compared to the yeast 1 H, a commercial Saccharomyces strain. With the data collected, growth curves were constructed and the fermentation vigour of the yeast Cyberlindnera saturnus of the SPACE strain was compared with the fermentation vigour of the commercial 1 H strain. In the various fermentation tests, the yeast Cyberlindnera saturnus of the SPACE strain showed a typical fermentation by a Non-Saccharomyces yeast, with average values of weight loss at 2 and 7 days which could not overlap those observed in commercial yeasts of the species Saccharomyces and with alcohol tolerance up to a maximum of 6 alcohol degrees with variable times as a function of the type of must used (from 7 to 10 days).

[0096] Figure 8 shows the fermentation progress in prosecco must test 1 of the yeast Cyberlindnera saturnus in comparison with the commercial strain 1 H.

[0097] Figure 9 shows the fermentation progress in prosecco must test 2 of the yeast Cyberlindnera saturnus in comparison with the commercial strain 1 H.

[0098] Figure 10 shows the fermentation progress in prosecco must test 3 of the yeast Cyberlindnera saturnus of the SPACE strain (points with vertical intervals) 40 g / HL, (points with squares) 20 g / HL, in comparison with the commercial strain 1 H. Test 3 was set up to verify the inoculum dose of a yeast cream experimentally produced in the Applicant’s plant. The yeast produced in cream had a count of 1.49x1O10cells / gr and a viability of 94%. The inoculum doses tested were 20 and 40 g / HL; in Figure 10, the fermentation progress of the samples can be observed when the inoculum dose varies in comparison with the commercial strain 1 H. Using an inoculum dose of 40 g / HL, the fermentation of the Non- Saccharomyces yeast was slightly faster, at about 200 hours of fermentation the curves reached the same value of CO2loss and then reached plateau. Sequential fermentations

[0099] The fermentation vigour of the yeast Cyberlindnera saturnus of the SPACE strain was also evaluated in sequential fermentations with the commercial strain of Saccharomyces used previously as a control to evaluate the use thereof in oenology (1 H).

[0100] The results obtained from the sequential fermentation tests show that yeast strain 1 H is capable of finishing the fermentation both when inoculated after 3 days and when inoculated after 9 days of fermentation of the yeast Cyberlindnera saturnus (Figure 11 and Figure 12).

[0101] Example 3:

[0102] HPLC analysis of the samples

[0103] The ability to produce secondary metabolites was assessed by means of HPLC analysis. Comparative tests inoculated with a commercial strain of Saccharomyces were also set up. The results obtained are reported in Tables 1 and 2 and show that the strain is characterised by the ability to singly consume about 60% of the sugars present in a prosecco must and to reach a content of about 6 alcohol degrees. The ability of the yeast to produce succinic acid and the fact that it produces little volatile acidity should be noted.

[0104] Table 1. Amounts of the various metabolites sought (g / L) before and after fermentation in prosecco must test 1 with the yeast Cyberlindnera saturnus of the SPACE strain and the commercial strain 1 H in comparison.

[0105] Table 1

[0106] Table 2. Amounts of the various metabolites sought (g / L) before (left) and after (right) fermentation in prosecco must test 2 with the yeast Cyberlindnera saturnus of the SPACE strain and the commercial strain 1 H in comparison. Table 3. Amounts of the various metabolites sought (g / L) before and after fermentation in prosecco must test 4 with the yeast Cyberlindnera saturnus of the SPACE strain and the commercial strain 1 H (the 2 yeasts together) after 3 days.

[0107] Example 4:

[0108] Aromatic profile

[0109] The aromatic profile of the yeast Cyberlindnera saturnus of the SPACE strain was evaluated in prosecco must incubated at 25°C and brought to the end of fermentation. Similar fermentations in prosecco must inoculated with a commercial strain of Saccharomyces (1 H) were also set up for comparison.

[0110] 700ml of wine at 3 days and 9 days of fermentation for the Non- Saccharomyces Cyberlindnera saturnus yeast of the SPACE strain, while 700ml of wine at the end of fermentation for the control strain (1 H) were sent to “Fondazione Edmund Mach” laboratory of San Michele all’Adige for the gaschromatography analyses (Table 4).

[0111] From the results obtained, it can be seen that already at 3 days, the strain was capable of releasing esters with a fruity scent.

[0112] The samples obtained from the strains (SPACE and 1 H) at the end of the fermentation thereof were compared in order to assess the potential thereof. After approximately 9 days of fermentation, the partially fermented sample obtained was compared with that obtained from the commercial strain 1 H. It can be seen in Table 4 that certain volatile compounds are in greater amounts in the sample obtained from fermentation with the Non- Saccharomyces Cyberlindnera saturnus yeast of the SPACE strain: methyl salicylate, isobutyl acetate, isoamyl acetate, 0-phenylethyl acetate, ethyl butryate, butyric acid.

[0113] In particular, isoamyl acetate, which as indicated in the literature has a perception threshold of 0.03 mg / L (Garcia et al, 2019), is found in a very high amount, 4.96 mg / L, 20 times more than the amount present in the sample fermented with the reference strain 1 H (0.2 mg / L).

[0114] The compound 0-phenylethyl acetate, which as stated in the literature has a perception threshold of 0.25 mg / L (Garcia et al, 2019), is also found in good amounts in the sample fermented with the yeast Cyberlindnera saturnus: 2.41 mg / L of 0-phenylethyl acetate with respect to 0.1 mg / L in the blank sample. 0-phenylethyl acetate has a floral, fruity and sweet scent.

[0115] Ethyl butyrate, having a perception threshold of 0.02 mg / L (Garcia et al, 2019), is a compound with an apple, fruity, sweet scent, and in the sample fermented with the yeast Cyberlindnera saturnus the amount was 0.18 mg / L, viz., 6 times greater than that present in the blank sample (0.03 mg / L).

[0116] Table 4 (Fig. 13): volatile compounds detected or not in the analysed samples, Non-Saccharomyces yeast in comparison with the yeast of the commercial strain 1 H (control sample).

[0117] Example 5:

[0118] Use of the yeast Cyberlindnera saturnus of the SPACE strain in beer

[0119] From knowledge of the microbial species, the yeast Cyberlindnera saturnus is not capable of fermenting maltose (Kurtzman et al, 2011 ). However, microbrewing tests were set up to verify whether the yeast was capable, fermenting the glucose present in the must, of releasing volatile compounds with a fruity scent, as was the case in the grape must tests.

[0120] Also for this Example, the fermentation was brought to termination by a Saccharomyces yeast.

[0121] Microbrewing tests were carried out in lager must (prepared malt MR. MALT) with added glucose (as per recipe), thus obtaining a lager must with the following sugar profile: GLUCOSE 47.6 g / L; FRUCTOSE 2 g / L; MALTOSE 27.32 g / L.

[0122] From the results shown in Table 5, it can be observed that the yeast Cyberlindnera saturnus of the strain SPACE inoculated individually reaches an alcohol content of approximately 2.9 degrees, fermenting the glucose present in the must (49 g / L leading to the theoretical formation of 2.94 degrees of alcohol). The tests performed in sequential inoculation with the commercial strains ALE 05; Green Mountain; ALE LN3 reached 4.42; 4.87; 4.77 degrees of alcohol, values almost identical to the beers obtained from the fermentation of the individual commercial strains, demonstrating that the yeast Cyberlindnera saturnus of the SPACE strain does not inhibit the fermentation of these yeasts used in sequential inoculation (after approximately 6 days of fermentation of the Non-Saccharomyces yeast).

[0123] Table 5: fermentation parameters deriving from the analysis of beer samples obtained with the yeast Cyberlindnera saturnus of the SPACE strain and the strains ALE 05; Green Mountain; ALE LN3 in sequential inoculation, compared with the beer obtained using the yeasts ALE 05; ALE LN3; Green Mountain and SPACE individually.

[0124] In order to best simulate fermentation in beer must, the must (prepared malt MR. MALT) was prepared using malt extract instead of glucose, thus obtaining a must with the following sugar composition: MALTOSE 48.84 g / L; GLUCOSE 10.42 g / L; FRUCTOSE 1.89 g / L. The fermentation tests in lager must with malt extract added were performed with the yeast Cyberlindnera saturnus added at the end of the fermentation thereof with the commercial strain ALE 05.

[0125] At the time of inoculation of the ALE 05 strain, the yeast Cyberlindnera saturnus had produced 1.30 degrees of alcohol, fermenting the available glucose. After the addition of the ALE 05 strain, the fermentation parameters were analysed at the end of fermentation: it is observed that the alcohol produced is almost identical to the control (beer fermented with the ALE 05 strain). The results are shown in the following table and demonstrate that the initial fermentation with the yeast Cyberlindnera saturnus does not inhibit the subsequent fermentation of the commercial strain ALE 05.

[0126] Table 6: fermentation parameters deriving from the analysis of beer samples obtained with the yeast Cyberlindnera saturnus and ALE 05 in sequential inoculation, compared with the beer obtained using ALE 05 alone.

[0127] Sensory analyses of the various samples obtained revealed the same fruity hints as in the wine samples, demonstrating the strain’s ability to produce this type of esters even when fermenting only the glucose present in the beer must. o this end, Table 7 is shown below.

[0128] From table 7 above, it can be estimated that the yeast of the invention allows the preparation of beer comprising from 3 to 10 pg / l of nerol, preferably from 5 to 7 pg / l of nerol. Furthermore, the yeast of the invention allows the preparation of beer comprising from 0.5 to 2 mg / l of 0-phenylethyl acetate, preferably from 1 to 1 .5 mg / l of 0-phenylethyl acetate.

[0129] Furthermore, the yeast of the invention allows the preparation of beer comprising from 1 to 3 mg / l of isoamyl acetate, preferably from 1.5 to 2.5 mg / l of isoamyl acetate.

[0130] Furthermore, the yeast of the invention allows the preparation of beer comprising from 0.5 to 0.6 mg / l of capric acid, preferably from 0.50 to 0.55 mg / l of capric acid.

[0131] Therefore, the yeast of the invention allows the preparation of beer comprising from 3 to 10 pg / l of nerol and / or from 0.5 to 2 mg / l of 0-phenylethyl acetate and / or from 1 to 3 mg / l of isoamyl acetate and / or from 0.5 to 0.6 mg / l of capric acid.

[0132] Preferably, the yeast of the invention allows the preparation of beer comprising from 5 to 7 pg / l of nerol and / or from 1.5 to 2.5 mg / l of 0-phenylethyl acetate and / or from 1 to 3 mg / l of isoamyl acetate and / or from 0.50 to 0.55 mg / l of capric acid.

[0133] In Italy, the denomination “non-alcoholic beer” is reserved for the product with a Plato degree of not less than 3 and not more than 8 and with an alcoholic strength by volume not exceeding 1 .2%.

[0134] The denomination “light beer” is reserved for the product with a Plato degree of not less than 5 and not more than 10.5 and with an alcoholic strength by volume higher than 1 .2% and not more than 3.5%.

[0135] The denomination “beer” is reserved for the product with a Plato degree higher than 10.5 and with an alcoholic strength by volume higher than 3.5%; this product can be called “special beer” if the Plato degree is not less than 12.5 and “double malt beer” if the Plato degree is not less than 14.5.

[0136] The following table summarizes the different definitions of beer.

[0137] The inoculation of the Cyberlindnera saturnus yeast for the production of beer must be followed by the sequential inoculation of a second yeast, a Saccharomyces normally used in brewing, which completes the fermentation by metabolizing the maltose. The alcoholic strength, therefore, can vary depending on the initial Plato degree and the final alcohol content that the brewer wishes to achieve (depending on the style of beer to be obtained).

[0138] The use of Cyberlindnera saturnus yeast allows the development of fruity aromatic scents that traditional Saccharomyces yeasts would not be able to develop.

[0139] As regards the aromas produced and the relative quantities, what is stated in the previous description applies. Therefore, a process for the preparation of an alcoholic beverage as described above is preferred, in which the alcoholic beverage is beer and where said process comprises a subsequent step in which a Saccharomyces yeast is added.

[0140] More preferably, in said process the beer has an alcohol content higher than 3.5%, or a Plato degree higher than 10.5.

[0141] SEQ_ID_1 genetic sequence of the yeast Cyberlindnera saturnus of the SPACE strain

[0142] Seq_ID_1 :

[0143] GGTGCAGCCGCGCTTCCACAGCGCGGCAGCCCAAACCTTACACACTGTG

[0144] ATTAGTTTTTTTACTATTTACTTTGGCTGCGCAAGTGGCCAAAGGTCTTAA

[0145] ACACAAAGATTTATATCTTTTTTTACAAAATTTAGTCAATGAAGTTTTAATAC

[0146] TATAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGA

[0147] AGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGGTTTTCGTGAAT

[0148] CATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCGGAGGGTATG

[0149] CCTGTTTGAGCGTCATTTCTCTCTCAAACCTTAGGGTTTGGTATTGAGTGA

[0150] TACTCTCTTCTGGGTTAACTTGAAATAGTGTACTGGCAAGAGT

[0151] GTGCTTTTGTGGCCTCTTGACTGAGATAATGTATTAGGTTCTACCAACTCG

[0152] TTATAGCAGCTCAATTGTCCCTTTGGCATATCAGCTCGGCCTGACAACTC

[0153] CTTCTAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGC ATATCAATA

Claims

CLAIMS1 ) Preparation process of an alcoholic beverage comprising the fermentation step, characterised in that said fermentation step is carried out in the presence of the yeast Cyberlindnera saturnus.2) Process according to claim 1 , wherein the strain of the yeast Cyberlindnera saturnus is SPACE.3) Process according to claim 1 , wherein the alcoholic beverage is wine, beer, cider or mead.4) Process according to claim 1 , comprising a previous step of preparing a food inoculum comprising the yeast Cyberlindnera saturnus.5) Process according to claim 1 , comprising a subsequent step in which a Saccharomyces yeast is added.6) Food inoculum comprising the yeast Cyberlindnera saturnus.7) Food inoculum according to claim 6, wherein the strain of the yeast Cyberlindnera saturnus is SPACE.8) Alcoholic beverage or alcoholic fermentation must comprising the yeast Cyberlindnera saturnus or the SPACE strain of the yeast Cyberlindnera saturnus.9) Alcoholic beverage or alcoholic fermentation must comprising: isoamyl acetate from 1 to 7 mg / L and / or 0-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.10) Alcoholic beverage according to claim 9, wherein the alcoholic beverage is wine comprising isoamyl acetate from 1 to 7 mg / L and / or P-phenylethyl from 0.5 to 4 mg / L and / or ethyl butyrate from 0.05 to 0.3 mg / L.11 ) Alcoholic beverage, wherein the alcoholic beverage is beer comprising from 3 to 10 pg / l of nerol and / or 0.5 to 2 mg / l of 0-phenylethyl acetate and / or from 1 to 3 mg / l of isoamyl acetate and / or from 0.5 to 0.6 mg / l of capric acid.12) Use of the yeast Cyberlindnera saturnus or the yeast Cyberlindnera saturnus of the SPACE strain as a food inoculum, according to claim 6, for preparing an alcoholic beverage.13) Use of the yeast Cyberlindnera saturnus according to claim 12, characterised in that the alcoholic beverage is wine, beer, cider or mead.14) Cyberlindnera saturnus yeast of the strain identified as SPACE and deposited at the DBVPG Industrial Yeast Collection of the Universityof Perugia with deposit number DBVPG 50P.15) Cyberlindnera saturnus yeast according to claim 14 having gene sequence SEQ_ID_1.16) Use of the yeast Cyberlindnera saturnus as a probiotic in foods or food supplements.17) Process according to any one of claims 1 to 5, wherein the alcoholic beverage is beer and wherein said process comprises a subsequent step in which a Saccharomyces yeast is added.18) Process according to claim 17, in which the beer has an alcohol content higher than 3.5%, or a Plato degree higher than 10.5.

Images