Y-rna compositions and methods of using the same

EP4770649A1Pending Publication Date: 2026-07-08MEDICAL COLLEGE OF WISCONSIN INC

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
MEDICAL COLLEGE OF WISCONSIN INC
Filing Date
2024-08-28
Publication Date
2026-07-08

AI Technical Summary

Technical Problem

Aging is associated with impaired organ function and repair, leading to increased susceptibility to chronic diseases, and is characterized by a decline in angiogenesis, which is mediated by reduced levels of Y5-RNA in extracellular vesicles from aged endothelial cells.

Method used

The use of Y5-RNA fragments, including a 5' fragment, in extracellular vesicles, synthetic nanoparticles, and pharmaceutical compositions to inhibit endothelial cell senescence and restore angiogenic activity in aged cells.

Benefits of technology

Overexpression of the Y5-RNA 5' fragment suppresses cellular senescence and upregulates angiogenic factor expression in aged endothelial cells, thereby restoring DNA synthesis, migration, and blood vessel formation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000036_0001
    Figure IMGF000036_0001
  • Figure IMGF000037_0001
    Figure IMGF000037_0001
  • Figure 00000042_0000
    Figure 00000042_0000
Patent Text Reader

Abstract

Disclosed are RNAs comprising a fragment of a Y-RNA, e.g., Y5-RNA or Y1-RNA, expression vectors encoding the same, cells and extracellular vesicles comprising the RNAs, pharmaceutical compositions, and methods of using the preceding for the treatment of disease and disorders, e.g., diseases and disorders associated with endothelial senescence.
Need to check novelty before this filing date? Find Prior Art

Description

Y-RNA COMPOSITIONS AND METHODS OF USING THE SAMECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to U.S. Provisional Patent Application No. 63 / 579,371 that was filed August 29, 2023, the entire contents of which are hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under R01 HL 142578 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] A Sequence Listing accompanies this application and is submitted as an xml file of the sequence listing named “650053 01099. xml” which is 16,877 bytes in size and was created on August 27, 2024. The sequence listing is electronically submitted via Patent Center and is incorporated herein by reference in its entirety.BACKGROUND

[0004] Aging is associated with impaired organ function and repair, which increases susceptibility to various chronic diseases1'4. Angiogenesis plays important roles in organ development, regeneration5'11and pathology12,13. It has been reported that angiogenic signaling (e.g., vascular endothelial growth factor (VEGF), Tie2, FGF, HIF la) and EC proliferation are attenuated in aging animals14'19. For example, the inventors have demonstrated that angiogenesis is impaired in aged mouse lungs through suppression of VEGFR2 or Tie2 signaling14,16. Agedependent decline in angiogenesis is associated with aging-associated diseases, including cardiovascular diseases, Alzheimer’s disease, osteoporosis, diabetes, and COPD1'4,15,17'20. To develop more efficient therapies for aging-associated diseases and promote healthy aging, the inventors need to understand the mechanisms by which aging impairs angiogenesis.SUMMARY

[0005] In an aspect of the current disclosure, RNAs are provided. In some embodiments, the RNAs comprise a fragment of Y5-RNA. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2.

[0006] In an aspect of the current disclosure, extracellular vesicles (EVs) are provided. In some embodiments, the EVs comprise a fragment of Y5-RNA. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome.

[0007] In an aspect of the current disclosure, synthetic nanoparticles are provided. In some embodiments, the synthetic nanoparticles comprise a fragment of Y5-RNA. In some embodiments, the RNAs comprise at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5 ’ fragment. In some embodiments, the fragment of Y 5-RNA comprises or consists of SEQ ID NO: 2.

[0008] In an aspect of the current disclosure, expression vectors are provided. In some embodiments, the expression vectors comprise a sequence encoding a fragment of Y5-RNA. In some embodiments, the fragment of Y5-RNA is SEQ ID NO: 2. In some embodiments, the expression vector further comprises a regulatory sequence operably linked to the sequence encoding the fragment of Y5-RNA.

[0009] In an aspect of the current disclosure, cells are provided. In some embodiments, the cells comprise an RNA comprising a Y5-RNA fragment. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2.

[0010] In some embodiments, the cells comprise an expression vector comprising a sequence encoding a fragment of Y5-RNA. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the expression vector further comprises a regulatory sequence operably linked to the sequence encoding the fragment of Y5-RNA.

[0011] In an aspect of the current disclosure, methods of making extracellular vesicles in in vitro cultured cells are provided. In some embodiments, the methods comprise expressing an expression vector comprising a sequence encoding a fragment of Y5-RNA in a cell, wherein the cell releases extracellular vesicles into a culture medium; and enriching, isolating, or purifying the extracellular vesicles from the culture medium. In some embodiments, the fragment of Y5- RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the expression vector further comprises a regulatory sequence operably linked to the sequence encoding the fragment of Y5- RNA.

[0012] In an aspect of the current disclosure, pharmaceutical compositions are provided. In some embodiments, the pharmaceutical compositions comprise a Y5-RNA. In some embodiments, the Y5-RNA fragment is a 5’ fragment. In some embodiments, the Y5-RNA fragment comprises or consists of SEQ ID NO: 2. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0013] In some embodiments, the pharmaceutical compositions comprise an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA. In some embodiments, the Y5-RNA fragment is a 5‘ fragment. In some embodiments, the Y5-RNA fragment comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable earner or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0014] In an aspect of the current disclosure, methods are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y5-RNA, a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to a subject in need thereof. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0015] In an aspect of the current disclosure, methods of treating at least one aging related symptom in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y 5-RNA, a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of aY5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to treat the at least one aging related symptom in the subject. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0016] In an aspect of the current disclosure, methods of treating a disease or disorder related to endothelial cell senescence in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y5 -RNA. a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to treat the disease or disorder. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, the disease or disorder is selected from the group consisting of: lung fibrosis, chronic obstructive pulmonary disorder (COPD), hypertension, atherosclerosis, pulmonary hypertension, Alzheimer’s disease, osteoporosis, and type 2 diabetes. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0017] In an aspect of the current disclosure, methods of treating lung fibrosis in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y5-RNA, a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellularvesicle (EV) comprising a fragment of Y5-RNA to the subject to treat the lung fibrosis. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0018] In an aspect of the current disclosure, methods of treating cardiovascular disease in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising aY5-RNA, a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to treat the cardiovascular disease. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0019] In an aspect of the current disclosure, methods of treating Alzheimer’s disease in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising aY5-RNA, a Y5 -RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to treat Alzheimer’s disease. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5’ fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceuticallyacceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0020] In an aspect of the current disclosure, methods of treating hypertension in a subject in need thereof. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y5-RNA. a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to treat hypertension in the subject. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5 ’ fragment. In some embodiments, the fragment of Y 5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0021] In an aspect of the current disclosure, methods of improving wound healing in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Y5-RNA, a Y5-RNA fragment, an extracellular vesicle comprising a Y5-RNA or a fragment of a Y5-RNA, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA to the subject to improve wound healing in the subject. In some embodiments, the RNA comprises at least one modified nucleotide. In some embodiments, the fragment of Y5-RNA is a 5' fragment. In some embodiments, the fragment of Y5-RNA comprises or consists of SEQ ID NO: 2. In some embodiments, the EV is an exosome. In some embodiments, the pharmaceutical compositions further comprise at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises administering the pharmaceutical composition directly to a wound in the subject. In some embodiments, administration comprises intravenous administration,intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. In some embodiments, administration comprises intravenous administration.

[0022] In an aspect of the current disclosure, kits are provided. In some embodiments, the kits comprise an RNA comprising a Y5-RNA fragment, an extracellular vesicle comprising a Y5- RNA fragment, or a pharmaceutical composition comprising a Y5-RNA, a Y5-RNA fragment, or an extracellular vesicle (EV) comprising a fragment of Y5-RNA. In some embodiments, the RNAs comprise at least one modified nucleotide. In some embodiments, the kits further comprise instructions for using the kits.

[0023] In an aspect of the current disclosure, extracellular vesicles are provided. In some embodiments, the extracellular vesicles comprise a Yl-RNA, wherein the extracellular vesicle comprises a targeting moiety. In some embodiments, the targeting moiety comprises SEQ ID NO: 3. In some embodiments, the Yl-RNA comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4.

[0024] In an aspect of the current disclosure, synthetic nanoparticles comprising a Yl-RNA are provided. In some embodiments, the synthetic nanoparticle comprises a targeting moiety. In some embodiments, the targeting moiety comprises SEQ ID NO: 3. In some embodiments, the Yl-RNA compnses SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4.

[0025] In an aspect of the current disclosure pharmaceutical compositions are provided and comprise the extracellular vesicle the synthetic nanoparticles of the instant disclosure.

[0026] In an aspect of the current disclosure, methods are provided. In some embodiments, the methods are methods of treating at least one aging related symptom in a subject in need thereof and comprise administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat the at least one aging related symptom in the subject. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Yl-RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0027] In some embodiments, the methods are methods of treating a disease or disorder related to endothelial cell senescence in a subject in need thereof and comprise administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat the disease or disorder. In some embodiments, the disease or disorder is selected from the group consisting of: lung fibrosis, chronic obstructive pulmonary disorder (COPD), hypertension,atherosclerosis, pulmonary hypertension, Alzheimer’s disease, osteoporosis, and type 2 diabetes. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Yl-RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0028] In some embodiments, the methods are methods of treating lung fibrosis in a subject in need thereof and comprise administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat the lung fibrosis. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Y1 -RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0029] In some embodiments, the methods are methods of treating Alzheimer’s disease in a subject in need thereof and comprise administering an effective amount of a pharmaceutical composition comprising a Y1 -RNA fragment to the subject to treat Alzheimer’s disease. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Yl-RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0030] In some embodiments, the methods are methods of treating hypertension in a subject in need thereof and comprise administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat hypertension in the subject. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Yl-RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0031] In some embodiments, the methods are methods of improving wound healing in a subject in need thereof and comprise administering an effective amount of a pharmaceuticalcomposition comprising a Yl-RNA fragment to the subject to improve wound healing in the subject. In some embodiments, administration comprises administering the pharmaceutical composition directly to a wound in the subject. In some embodiments, the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4. In some embodiments, the pharmaceutical composition comprises an extracellular vesicle or synthetic nanoparticle comprising a Yl-RNA fragment and a targeting moiety. In some embodiments, administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0032] In an aspect of the current disclosure, kits are provided. In some embodiments, the kits comprise extracellular vesicles comprising a Yl-RNA, or fragment thereof, a synthetic nanoparticle comprising a Yl-RNA, or a fragment thereof. The kits may further comprise instructions for using the kit.BRIEF DESCRIPTION OF THE FIGURES

[0033] FIGs. 1A, IB, 1C, ID, IE, IF, and 1G. Y5-RNA decreases and mediates EC senescence in aged ECs. A) Immunoblots showing CD63, Flotillin- 1 , and GM-130 in EV free media or EVs isolated from conditioned media of human adipose tissue ECs. B) Size distribution and particle concentration of isolated EVs analyzed using NTA. C) TEM image of EV morphology. Scale bar: 150 nm. Arrows indicate EVs. D) Graph showing the Y5-RNA levels in ECs isolated from young (<50 y.o.) vs. aged (>50 y.o.) human adipose tissues (n=5, mean±s.e.m., *p<0.05). E) Graph showing the levels ofY5-RNA 5’ fragment in ECs isolated from young (<50 y.o.) vs. aged (>50 y.o.) human adipose tissues (n=5, mean±s.e.m., *p<0.05). F) Graph showing the levels of Y5-RNA 5’ fragment, P16, and P21 in ECs isolated from aged (>50 y.o.) human adipose tissues treated with Y5-RNA 5’ fragment (n=3, mean±s.e.m., *p<0.05). G) Micrographs of ECs isolated from aged (>50 y.o.) human adipose tissues treated with Y5-RNA 5’ fragment or control scrambled RNA showing SAbGal activity (top). Graph showing the % of SAbGal -positive cells (n=5, mean±s.e.m., *p<0.05).

[0034] FIGs. 2A and 2B. RBPs increase in aged ECs and mediate EC senescence. A) Graph showing the mRNA levels of Ro60, La, and nucleolin in ECs isolated from young (<50 y.o.) vs. aged (>50 y.o.) human adipose tissues (n=6, mean±s.e.m., *p<0.05). B) Immunofluorescence (IF) micrographs showing Ro60 expression and DAPI (top) and nucleolin expression and DAPI (bottom) in ECs isolated from young (<50 y.o.) vs. aged (>50 y.o.) human adipose tissues. Scale bar, 20 pm. Graph showing quantification of ECs expressing Ro60 andnucleolin in young (<50 y.o.) vs. aged (>50 y.o.) human adipose ECs right, n=6, mean ± s.e.m., *p<0.05).

[0035] FIGs. 3A, 3B, and 3C. Y5-RNA mediates age-dependent decline in angiogenic activity. A) Graph showing EdU-positive young adipose ECs treated with Y5-RNA siRNA or aged adipose ECs treated with Y5-RNA 5’ fragment (n=5, mean±s.e.m., *p<0.05). B) Graph showing young adipose ECs treated with Y5-RNA siRNA or aged ECs treated with Y5-RNA 5’ fragment migrating towards 5% FBS / ECM (n=6, mean±s.e.m., *p<0.05). Representative micrographs showing young adipose ECs treated with Y5-RNA siRNA vs. aged adipose ECs treated with Y5-RNA 5’ fragment migrating towards medium containing 5% FBS (right, Wright Giemsa staining). Scale bar, 50 pm. C) Graphs showing the mRNA levels of Ang2 (left), Tie2 (middle), and VEGFR2 (right) in young ECs treated with Y5-RNA siRNA or aged ECs treated with Y5-RNA 5’ fragment (n=2-3, mean±s.e.m., *p<0.05).

[0036] FIGs. 4A and 4B. Y5-RNA mediates age-dependent decline in angiogenesis in the gel implanted on the back of mice. A) immunofluorescence (IF) micrographs showing GFP- positive blood vessels (lop) and GFP-positive blood vessels and Tie2 expression (bottom) in the fibrin gel supplemented with GFP-labeled young vs. aged human adipose ECs or in combination with treatment with EVs (10 mg / ml) collected from conditioned media of young ECs treated with Y5-RNA siRNA or aged ECs treated with Y5-RNA 5’ fragment and implanted on the back of the mice for 7 days (scale bar, 20 pm). B) Graphs showing quantification of GFP-positive blood vessel length (left), area of ECs expressing Tie2 (2nd) in the fibrin gel supplemented with GFP- labeled young vs. aged human adipose ECs or in combination with treatment with EVs (10 mg / ml) collected from conditioned media of young ECs treated with Y5-RNA siRNA and implanted on the back of the mice for 7 days (n=6. mean ± s.e.m., *p<0.05). Graphs showing quantification of GFP-positive blood vessel length (3rd), area of ECs expressing Tie2 (right) in the fibrin gel supplemented with GFP-labeled aged human adipose ECs or in combination with treatment with EVs (10 mg / ml) collected from conditioned media of aged ECs treated with Y5-RNA 5’ fragment and implanted on the back of the mice for 7 days (n=5-6, mean ± s.e.m., *, p<0.05).

[0037] FIGs. 5A, 5B, and 5C The levels of Yl-RNA and its effects on senescence in lung ECs. A) Yl-RNA levels in PAECs from IPAH patients or healthy individuals (n=4-5, mean±s.e.m., *p<0.05). B) FACS analysis showing 97% of isolated human lung cells (CD31+, VE-cadherin+, CD45-) are CD31 -positive. C) SAp-Gal staining of human lung ECs treated with Yl-RNA. Scale bar, 20 pm. SA|3-Gal+ human lung ECs (n=6, mean±s.e.m., *p<0.05).

[0038] FIGs. 6A, 6B, 6C, 6D, and 6E The levels of Yl-RNA in normoxia vs. hypoxia- treated mouse lung EC-derived EVs. A) IB of CD63, Flotillin-1, and GM130 in EVs collected from exosome-free media (FM) and conditioned media (CM) of mouse lung ECs. B) Size distribution and particle concentration of isolated EVs analyzed using NTA. C) TEM image of EV morphology. Scale bar: 150 nm. Arrows: EVs. D) Yl-RNA levels in EVs or EV depleted supernatant collected (EV Dep Sup) from CM of ECs from normoxia vs. hypoxia treated mouse lungs (n=4, mean±s.e.m, *p<0.05). E) EdU+ PASMCs treated with EVs collected fromHPAECs treated with hypoxia or in combination with control siRNA or Yl-RNA siRNA (n=5. mean±s.e.m., *p<0.05).

[0039] FIG. 7 shows a method of making Y-RNA loaded EVs.

[0040] FIG. 8 IF micrograph showing ECs containing Yl-RNA-FAM (green) encapsulated EVs labeled with Alexa-Fluor 594 (magenta). Scale bar: 50 pm.DETAILED DESCRIPTION

[0041] Disclosed herein are Y5-RNA compositions and methods of using the same for the treatment of diseases and disorders related to aging and endothelial dysfunction. The inventors discovered that extracellular vesicles (EVs) from aged adipose cells comprise significantly less Y5-RNA and Y5-RNA fragments. Y5-RNA and Y5-RNA fragments are non-coding RNAs that have pleiotropic effects on target cells but have not been shown to be involved in the age-related decline in angiogenesis. The inventors further discovered that overexpression of Y5-RNA 5’ fragment inhibits endothelial cell (EC) senescence in aged ECs and ameliorates the age-related decline in angiogenesis.

[0042] The disclosed compositions and methods improve upon existing treatments, e.g., senolytics, which are known to attenuate tissue injury, extend lifespan and delay age-related conditions. However, senescent cells also play critical roles in embryonic development, angiogenesis, and tissue repair, and, therefore, may have harmful side effects. The inventors found that the disclosed compositions and treatment strategies to deliver Y5-RNA fragments may reduce treatment dose relative to senolytics and may improve upon senolytic therapies for the aforementioned reasons.

[0043] Senescent cells promote aging and exacerbate age-related pathologies. The levels of endothelial cell (EC) senescence are higher in aged ECs compared to young ECs, mediating agedependent impairment of angiogenesis. Extracellular vesicles (EVs), including exosomes, serve as a messenger of signals, maintaining tissue homeostasis and function in physiology andcontributing to age-related diseases (e.g., osteoporosis, cancer, immune disorders, cardiovascular diseases), in which angiogenesis is deregulated. The inventors have demonstrated that EVs collected from lung ECs under regeneration stimulate angiogenesis, while senescence-associated secretory phenotype (SASP) factors are enriched in EVs from senescent ECs, highlighting EC- derived EVs as a critical contributor to age-dependent decline in angiogenesis.

[0044] These EVs harbor and transfer a diverse cargo of proteins, lipids, and various types of nucleic acid, including non-coding RNAs (e.g., miRNAs) to target cells and control cell-cell communications. Although miRNAs have been a major focus in EVs, the majority of EV- enclosed RNAs (EV -RNAs) consists of other types of small- to mid-sized noncoding RNAs. Among these EV-RNAs, Y-RNAs are one of the most abundant extracellular non-coding RNAs in plasma and EVs. and the levels of Y-RNAs correlate with pro- and anti-inflammatory effects, cancer and age-related cardiovascular diseases, in which angiogenesis is deregulated. While the structure and protein interactions of Y-RNAs are relatively well studied, the biological roles of Y-RNAs are still under investigation. The role of EV-enclosed Y-RNAs in EC senescence and age-related decline in angiogenesis remains unclear. Among four human Y-RNAs (Yl, 3, 4, 5), Y5-RNA is the most abundant Y-RNAs in EVs.

[0045] The inventors found that: (1) the levels of Y5-RNA are lower in EVs collected from aged human subcutaneous adipose tissue ECs compared to those in young ECs; (2) overexpression of Y5-RNA 5’ fragment that is more abundant than the 3’ fragment in EVs and potentially has gene-regulatory functions, suppresses cellular senescence in aged ECs; (3) EVs collected from Y 5-RNA knocked down ECs inhibits DNA synthesis in young ECs; and (4) young EC-derived EVs restore blood vessel formation of aged ECs in the hydrogel subcutaneously implanted on mice, while Y5-RNA knocked down EC-derived EVs inhibit the effects. Thus, Y5- RNA or Y5-RNA 5' fragment in EC-derived EVs inhibits cellular senescence and potentially reverses the age-related decline in angiogenesis and would be anew and better EV-based strategy for age-related diseases, including chronic lung diseases, atherosclerosis, and cardiovascular diseases.

[0046] Extracellular vesicles (EVs) contain and transfer multiple biomolecules such as proteins21’22, lipids, and various types of nucleic acid23,24including non-coding RNAs (e.g., miRNAs)25'27to the targeting cells, and serve as a messenger of signals as well as remove unused or harmful RNA and proteins28,29. EV s are produced by ECs and other cell types and maintain tissue homeostasis and function in physiology22'24,30. The inventors have reported that EC -derived EVs from mouse lungs under regenerative lung growth stimulate angiogenesis22. SASP factorsare enriched in EVs from senescent cells21,31, and contribute to age-related pathologies (e.g., osteoporosis32, cancer33, immune disorders29,34,15, cardiovascular diseases21,16'40). For example, the inventors have reported that hypoxia-treated mouse lung EC-derived EVs contain senescence / SASP related factors and contribute to PH pathology21.

[0047] Although miRNAs have been a major focus of EV research24'27, miRNAs constitute a minor percentage of EV-enclosed RNA (EV-RNA) and the majority of EV-RNA consists of other types of non-coding RNAs29,36,41'43. Among these EV-RNAs, Y-RNAs detected in different cell types and animal species29,41,42,44, are one of the most abundant extracellular non-coding RNAs in plasma43,46and EVs29,36, and the levels of Y-RNAs in EVs correlate with pro- and antiinflammatory' effects29,36,42,47, cancer45,46,48,49and age-related cardiovascular diseases36,49,50, in which angiogenesis is deregulated1'4, 15 17'19. Although Y-RNAs were discovered almost 40 years ago51and their structure and protein interactions are relatively well studied, the biological roles of Y-RNAs are still under investigation52. There are four distinct human Y-RNAs (Yl, Y3, Y4, Y5-RNA), while two in mice (Yl, Y3) that share a stem-loop secondary structure and high sequence conservation between the upper and lower stem53,54. Upon transcription, newly- generated Y-RNAs remain in the nucleus through binding to RNA-binding protein (RBP) La or are transported into the cytoplasm by Ran GTPase through binding to RBP Ro60 that also stabilizes Y-RNA in the cytoplasm29,33. These Y-RNAs are cleaved into fragments and both full- length and fragmented Y-RNAs as well as RBPs bound to Y-RNA are co-packaged into EVs and transferred to the target cells, where Y-RNA and co-transferred RBPs exert their cellular function29,53. Fragmented forms of Y-RNA in the EVs have gene-regulatory functions29,41,42,44,46,55and link to diseases36,48,30,52. Ro60 is a ring-shaped protein and binds the 5’ and 3’ stem portions of Y-RNAs to control their activity and stability-36. On the contrary, Y-RNAs regulate the subcellular localization of Ro60, tether Ro60 to effector proteins and regulate the access of other RNAs to its central cavity and control their stability and function56. For example, depletion of Y RNAs results in nuclear accumulation of Ro6056'58. In mammals, Ro60 accumulates in nuclei and enhances cellular survival after exposure to UV irradiation57,59, in which cells are senescent. The role of Ro60 and EV-enclosed Y-RNAs in age-related decline in angiogenesis remains unclear.

[0048] Here the inventors have demonstrated that the levels of Y5-RNA decrease in aged EC- derived EVs, which induces EC senescence and mediates age-dependent decline in angiogenesis. Overexpression ofY5-RNA 5’ fragment inhibits EC senescence in aged ECs and restores the age- related decline in angiogenesis. Modulation of Y 5-RNA would be an efficient therapeutic strategy for aging-associated diseases.RNAs

[0049] In an aspect of the current disclosure, ribonucleic acids (RNAs) are provided. In some embodiments, the RNAs comprise a fragment of Y5-RNA. The RNAs may further comprise at least one modified nucleotide. Human Y5-RNA has the sequence SEQ ID NO: 1. An exemplary fragment of Y5-RNA is SEQ ID NO: 2, which is a 5’ fragment of SEQ ID NO: 1, or a sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or greater identity to SEQ ID NO: 2.

[0050] As used herein, a “5’ fragment of Y5-RNA” refers to a fragment which is derived from primarily the 5’ half of SEQ ID NO: 1. As SEQ ID NO: 1 consists of 84 ribonucleotides, an exemplary' 5’ fragment may be comprised of at least 50% nucleotides 1-44 of SEQ ID NO: 1, with reference to the nucleotides aligned to SEQ ID NO: 1. The disclosed RNAs, including those comprising a 5’ fragment ofY5-RNA, may further comprise additional nucleotide sequences, e.g., RNA or DNA sequences, and may include modified nucleotides, detectable labels, purification tags (e.g., stretches of nucleic acid designed to be captured by a complementary binding partner).

[0051] As used herein, "‘modified nucleotide” refers to a non-natural modification of a nucleotide including, but not limited to, locked nucleic acids (LNAs), phosphorothioate modifications, 2’ O-methyl modifications, 2’-deoxy-2’-Fluoro modifications (2-F), etc. Additional nucleotide modifications are known in the art.

[0052] In an aspect of the current disclosure, RNAs comprising a fragment of Y5-RNA are provided, wherein the fragment of Y5-RNA is not identical to SEQ ID NO: 1 or SEQ ID NO: 2.

[0053] Also referred to herein are Yl-RNAs and fragments thereof, e.g., SEQ ID NO: 4, or a sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or greater identity to SEQ ID NO: 4. The Yl-RNAs, or fragments thereof, may also comprise modified nucleotides.Extracellular vesicles

[0054] In another aspect of the current disclosure, extracellular vesicles (EVs) are provided. The EVs may comprise an RNA comprising a fragment of Y5-RNA. The RNAs may further comprise at least one modified nucleotide.

[0055] As used herein, “extracellular vesicles” or “EVs” refers to lipid bound vesicles secreted by cells into the extracellular space. The three main subtypes of EVs are microvesicles (MVs),exosomes, and apoptotic bodies, which are differentiated based upon their biogenesis, release pathways, size, content, and function.

[0056] The EVs may be exosomes. As used herein, '’exosome" refers to a subset of EVs with a diameter of about 40 to about 160 nm and may have an average diameter of about 100 nm. Exosomes are typically produced in the endosomal compartment of cells. Specifically, exosomes are formed from the inward budding of multivesicular bodies which then may be released upon fusing of the multivesicular body with the plasma membrane.

[0057] EVs. e.g.. exosomes may be produced by methods known in the art including engineering EVs, e g., exosomes, to comprise components of interest, e g., Y5-RNA fragments. For example, exosomes may be loaded with RNAs using electroporation. EVs, e.g., exosomes may be produced by expressing Y-RNAs, e.g., Y5-RNA fragments, in cells and collecting conditioned media comprising the EVs.

[0058] EVs may further comprise a targeting moiety, e.g., CAR peptide (SEQ ID NO: 3), which targets EVs to the pulmonary artery. The targeting moiety may be an antibody, e.g., a monoclonal antibody, a Fab, or a single chain variable fragment (scFv). CAR peptide-biotin (CARSKNKDC-biotin) was custom synthesized (Genscript)81,82EVs were surface modified with EDC / NHS chemistry, conjugated with Alexa-Fluor 594 streptavidin (20 pg) to aid in imaging, and subsequently reacted with CAR-biotin (50 pg) for 30 min, and purified by centrifugation83. The efficiency of CAR peptide conjugation was determined using a colorimetric biotin assay (HABA / Avidin kit. Sigma)84.Synthetic nanoparticles

[0059] In an aspect of the current disclosure, synthetic nanoparticles are provided. In some embodiments, the synthetic nanoparticles comprise a Y-RNA or a fragment thereof, e.g., Y5- RNA fragments or Yl-RNA fragments of the instant disclosure. The synthetic nanoparticles may be, e.g., polymeric nanoparticles, dendrimers, liposomes, hybrid nanoparticles comprising a polymeric core and a micellar outer layer.

[0060] Methods of making synthetic nanoparticles are known in the art. Suitable synthetic nanoparticles may be loaded with Y-RNAs, e.g., the disclosed Y5-RNA fragments or Yl -RNA fragments, according to methods known in the art.Pharmaceutical compositions

[0061] In another aspect of the current disclosure, pharmaceutical compositions are provided. The pharmaceutical compositions may comprise a Y-RNA, e.g., a Yl-RNA, Y5-RNA, or a Y5-RNA fragment. The pharmaceutical compositions may comprise a Y5-RNA fragment of the instant disclosure, which may further comprise at least one modified nucleotide.

[0062] The pharmaceutical compositions may be formulated for administration by any acceptable route. Exemplary pharmaceutical compositions may be formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration. The formulation of pharmaceutical compositions for administration by any standard route is considered routine in the art.

[0063] The disclosed pharmaceutical compositions may further comprise at least one pharmaceutically acceptable carrier or excipient. Suitable carriers or excipients are known in the art and the selection of a suitable carrier or excipient is considered routine.Expression vectors

[0064] In another aspect of the current disclosure, expression vectors are provided. The expression vectors may comprise a sequence encoding a Y-RN A, e.g.. aY-IRNA, a Y-5RNA, or a fragment of Y5-RNA of the instant disclosure, e.g.. SEQ ID NO: 2. The expression vectors may further comprise a regulator}' sequence, e.g., one or more promoter or enhancer, operably linked to the sequence encoding the fragment of Y5-RNA.

[0065] As used herein, “operably linked” refers to the regulatory sequence regulating the expression of the sequence encoding a fragment of Y5-RNA. Suitable regulators- sequences are known in the art, e.g., promoters and enhancers.Cells

[0066] This disclosure further provides cells which may comprise an RNA of the instant disclosure or an expression vector of the instant disclosure. Suitable cells may be, for example, endothelial cells, mesenchymal stem cells, HEK293T cells, H1299 cells, HCT116 cells, and Expi293F cells. For the use of the disclosed cells in the production of EVs, it may be advantageous to use particular cell types, e.g., endothelial cells or mesenchymal stem cells, which may include cell or tissue specific factors, as well as the Y5-RNAs, in the Evs. In one example, endothelial cell-derived Evs may include more endothelial specific factors in the Evs to modulate angiogenesis.

[0067] The cells of the instant disclosure may be used to express the Evs comprising Y -RNAs, e.g., Y5-RNA fragments of the instant disclosure or Yl-RNA fragments, in vivo. For example, cells that produce the Y5-RNA fragments in EVs maybe implanted in a subject whereby the cells produce the EVs comprising the Y-RNAs, e g., the disclosed Y5-RNA fragments or the Y-RNAfragments, in the subject, e.g., in a targeted area or tissue or such that the EVs are distributed systemically.Methods of making extracellular vesicles

[0068] In another aspect of the current disclosure, methods of making extracellular vesicles in in vitro cultured cells, the method comprising expressing an expression vector of the instant disclosure in a cell, wherein the cell releases extracellular vesicles into a culture medium; and enriching, isolating, or purifying the extracellular vesicles from the culture medium. Suitable cells for the disclosed methods include, but are not limited to, endothelial cells, mesenchymal stem cells, HEK293T cells, H1299 cells, HCT116 cells, and Expi293F cells.

[0069] Suitable culture medium for use in the disclosed methods may be determined by one of skill in the art and may comprise a defined culture medium such that the extracellular vesicles may be produced according to good manufacturing practices (GMP).

[0070] Enriching, isolating, or purifying the extracellular vesicles from the culture medium may comprise methods known in the art, including, but not limited to particle precipitation, normal flow filtration (NFF), tangential flow filtration (TFF), ultracentrifugation, chromatography, e.g., anion exchange chromatography, high performance liquid chromatography (HPLC), or size exclusion chromatography.

[0071] As discussed above, engineered EVs may be produced by enriching, isolating, or purifying EVs from conditioned media from cells, then introducing the RNAs of the instant disclosure into the EVs, e.g., exosomes, by, e.g., electroporation. This method may be useful in the context of RNAs of the instant disclosure which comprise at least one modified nucleotide.Methods of treatment

[0072] The inventors discovered that overexpression of Y5-RNA 5’ fragment inhibits endothelial cell (EC) senescence in aged ECs and ameliorates the age-related decline in angiogenesis. Therefore, methods of administering the disclosed pharmaceutical compositions comprising Y-RNA fragments, e.g., Yl-RNA fragments or Y5-RNA fragments are provided in this disclosure.

[0073] In an aspect of the current disclosure, methods of treatment are provided. In some embodiments, the methods comprise administering an effective amount of pharmaceutical composition of the instant disclosure to a subject in need thereof.

[0074] As used herein, “a subject in need thereof’ may refer to a subject in need of treatment for at least one aging related symptom, a disease or disorder related to endothelial cell senescence,e.g., lung fibrosis, chronic obstructive pulmonary' disorder (COPD), hypertension, atherosclerosis, coronary artery disease, pulmonary hypertension, Alzheimer’s disease, neurodegenerative disease, osteoporosis, and type 2 diabetes, or a wound which requires improved healing. Further, a subject in need thereof, may be a subject who would like treatment for a cosmetic issue related to aging.

[0075] As disclosed herein, it is anticipated that systemic or localized administration of the therapeutic compositions of the present disclosure will allow for attenuation or inhibition of EC senescence, thereby extending EC lifespan, and / or increasing angiogenesis in tissues comprising aged ECs, or EC exhibiting aging symptoms (e.g.. decreased angiogenesis, increased vascular leakiness in tissues).

[0076] In an aspect of the current disclosure, methods of treating at least one aging related symptom in a subject in need thereof are provided. In some embodiments, the methods comprise administering a pharmaceutical composition of the instant disclosure to the subject.

[0077] Exemplary ageing related symptoms include, but are not limited to, decline in function of the musculoskeletal system, cardiovascular system, decline in learning and memory, decline in the function of sensory' organs, e.g., eyes and ears, and other signs and symptoms of normal aging.

[0078] In an aspect of the current disclosure, methods of treating a disease or disorder related to endothelial cell senescence in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition of the instant disclosure to the subject to treat the disease or disorder.

[0079] Diseases or disorders related to endothelial cell senescence include, but are not limited to, lung fibrosis, chronic obstructive pulmonary disorder (COPD), hypertension, atherosclerosis, coronary artery' disease, pulmonary' hypertension, Alzheimer’s disease, neurodegenerative disease, osteoporosis, and ty pe 2 diabetes.

[0080] In an aspect of the current disclosure, methods of treating lung fibrosis (pulmonary fibrosis) in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition of the instant disclosure to the subject to treat the lung fibrosis. Treatment by the disclosed methods of treating lung fibrosis may result in improvement in shortness of breath, reduction in coughing, improved respiration.

[0081] Endothelial cell senescence is associated with a variety of cardiovascular diseases. Therefore, in an aspect of the current disclosure, methods of treating cardiovascular disease in a subject in need thereof are provided. In some embodiments, the methods comprise administeringan effective amount of a pharmaceutical composition of the instant disclosure to the subject to treat the cardiovascular disease in the subject.

[0082] As used herein, "‘cardiovascular disease” may refer to, but is not limited to, abnormal heart rhythms, or arrhythmias, aorta disease and Marfan syndrome, congenital heart disease, coronary artery disease, deep vein thrombosis and ulmonary embolism, heart attack, heart failure, heart muscle disease (cardiomyopathy), heart valve disease, pericardial disease, peripheral vascular disease, rheumatic heart disease, stroke, and vascular disease.

[0083] Alzheimer's disease is associated with an increase in senescent cells, e.g., senescent endothelial cells in the brain of affected individuals. Therefore, in an aspect of the current disclosure, methods of treating Alzheimer’s disease in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition of the instant disclosure to the subject to treat Alzheimer’s disease in a subject.

[0084] Treating Alzheimer’s disease in a subject may comprise improvement in at least one sign or symptom of Alzheimer’s disease including, but not limited to, improvement, or stabilization of memory, learning, or communication in a subject.

[0085] In an aspect of the current disclosure, methods of treating hypertension in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition of the instant disclosure to the subject to treat hypertension in the subj ect.

[0086] Treating hypertension may refer to improvement in at least one sign or symptom of hypertension including, but not limited to, reduction in systolic blood pressure, reduction in diastolic blood pressure, or a reduction in both systolic and diastolic blood pressure.

[0087] In an aspect of the current disclosure, methods of improving wound healing in a subj ect in need thereof are provided. In some embodiments, the methods comprise administering a pharmaceutical composition of the instant disclosure to the subject to improve wound healing.

[0088] As used herein, “improving wound healing” refers to reduction in the time of full wound closure in a subject as compared to another subject or as compared to another wound on a subject which was treated with a control / placebo in place of a pharmaceutical composition of the instant disclosure. Improving wound healing may also refer to improved outcome of wound healing, e.g., less scarring or hyperpigmentation, prevention of infection, etc.

[0089] Administration, as used herein, may comprise administration by any suitable route including, but not limited to, intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

[0090] As used herein, “an effective amount” is an amount of the pharmaceutical compositions of the instant disclosure effective to reach the desired outcome, e.g., an amount effective in treating at least one aging related symptom in a subject in need thereof or effective in treating a sign or symptom of a disease or disorder associated with endothelial cell senescence, e.g., a sign or symptom of lung fibrosis in a subject in need thereof, an amount effect to improve at least one sign or symptom of cardiovascular disease, Alzheimer’s disease, hypertension, or wound healing.

[0091] An effective amount may comprise administration once per day. twice per day, three times or more per day or may comprise administration every other day, every 2. every 3, every 4. every 5, every 6, every 7 days or more. An effective amount may be determined by a physician based on clinical responses to the administered pharmaceutical compositions.Kits

[0092] In another aspect of the current disclosure, kits are provided. In some embodiments, the kits comprise an RNA of the instant disclosure, an extracellular vesicle of the instant disclosure, a pharmaceutical composition of the instant disclosure, or any combination thereof. The kits may further comprise instructions for using any of the constituents.

[0093] The present invention is described herein using several definitions, as set forth below and throughout the application.Definitions

[0094] The disclosed subject matter may be further described using definitions and terminology as follows. The definitions and terminology used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0095] As used in this specification and the claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise. For example, the term “a substituent” should be interpreted to mean “one or more substituents,” unless the context clearly dictates otherwise.

[0096] As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary’ skill in the art given the context in which it is used, “about” and “approximately” will mean up to plus or minus 10% of the particular term and “substantially” and “significantly” will mean more than plus or minus 10% of the particular term.

[0097] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term “consisting essentially of’ should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.

[0098] The phrase “such as” should be interpreted as “for example, including.” Moreover, the use of any and all exemplary language, including but not limited to “such as”, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0099] Furthermore, in those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, B alone. C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or ‘B or “A and B.”

[0100] All language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can subsequently be broken down into ranges and subranges. A range includes each individual member. Thus, for example, a group having 1-3 members refers to groups having 1, 2, or 3 members. Similarly, a group having 6 members refers to groups having 1, 2, 3, 4, or 6 members, and so forth.

[0101] The modal verb “may” refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb “may” refers to an affirmative act regarding how to make or use and aspect of a described embodiment or feature contained in the same, or a definitive decision to usea specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb “may” has the same meaning and connotation as the auxiliary verb “can.”EXAMPLES

[0102] The following Examples are illustrative and should not be interpreted to limit the scope of the claimed subj ect matter.Example 1 - Y-RNA in endothelial senescence and age-related changes in angiogenesis

[0103] Angiogenesis is impaired in aging animals. Extracellular vesicles (EVs) contain and transfer a diverse cargo of proteins, lipids, and various types of nucleic acid to target cells, maintaining tissue homeostasis and contributing to age-related diseases. Y-RNAs are one of the most abundant EV-enclosed non-coding RNAs. and the levels of Y-RNAs correlate with age- related cardiovascular diseases. The role of EV-enclosed Y-RNAs in age-related decline in angiogenesis remains unclear. In this disclosure, the inventors have demonstrated that the levels of Y5-RNA decrease in EVs collected from aged human endothelial cells (ECs). Overexpression of Y5-RNA 5’ fragment suppresses cellular senescence and upregulates angiogenic factor expression in aged ECs. EVs collected from Y5-RNA 5’ fragment ov erexpressing ECs restore DNA synthesis and migration in aged ECs, while Y5-RNA knocked down EC-derived EVs inhibit the effects in young ECs. Young EC-derived EVs or EVs collected from Y5-RNA 5’ fragment overexpressing aged ECs restore blood vessel formation of aged ECs in the subcutaneously- implanted hydrogel, while Y5-RNA knocked down EC-derived EVs inhibit the effects. These results suggest that Y5-RNA in EC-derived EVs mediates EC senescence and impairment of angiogenesis in aged ECs. Modulation of Y5-RNA may be a novel intervention to reverse age- related decline in angiogenesis and will lead to the development of efficient EV-based strategies for aging-associated diseases.

[0104] Results

[0105] Y5-RNA expression decreases in aged human adipose tissue EC-derived EVs.

[0106] When EVs were isolated from pre-filtered (0.2pm) conditioned media of ECs (lx 106cells) isolated from young (< 50 y.o.) vs. aged (>50 y.o.) human subcutaneous adipose tissues19’60, the isolated EV population was positive for exosome markers (CD63, Flotillin- 1) and negative for the cellular marker GM130 when analyzed using IB (Fig. 1 A). Nanoparticle tracking analysis (NTA) revealed that isolated EC EVs were heterogeneous in diameter with 90-150nm (Fig. IB). Transmission electron microscopy (TEM) images exhibited the typical round vesicular likemorphology with ~50-100nm in size (Fig. 1C). The levels of Y5-RNA and Y5-RNA 5’ fragment were lower by 72% and 49%, respectively, in EVs isolated from aged human adipose tissue ECs compared to those in young ECs (Fig. ID, E). Overexpression of Y5-RNA 5‘ fragment decreased expression of senescence marker P16mk4Aand P21 in aged human adipose ECs (Fig. IF) and EC senescence activity analyzed using SAb-gal staining; the SAb-gal-positive senescent EC number was 48% lower in Y5-RNA 5’ fragment-treated aged human adipose ECs (Fig. 1G).

[0107] Consistent with the irradiated stressed cells56’57,59, the mRNA levels of RBPs Ro60, La and nucleolin were significantly higher in aged ECs (Fig. 2A), while the levels of these RBPs in EVs were significantly lower in aged EC-derived EVs (Fig. 2D). Immunocytochemical (ICC) analysis confirmed the results (Fig. 2B); the levels of Ro60 werel.7-times higher in aged ECs. These results suggest that Ro60 and Y 5-RNA mediate age-dependent induction of EC senescence.

[0108] Y5-RNA mediates age-dependent changes in angiogenic activities in vitro.

[0109] When the inventors knocked down Y5-RNA in young adipose ECs using Y5- RNA siRNA treatment, EC DNA synthesis analyzed using an EdU assay was inhibited by 28% compared to that treated with scrambled siRNA (Fig. 3A). EC migration analyzed using a transwell migration assay was also inhibited (Fig. 3B). On the contrary. Y5-RNA 5’ fragment overexpression reversed EC DNA synthesis and migration inhibited in aged ECs; EC DNA synthesis was 1.7-times higher than those treated with control scrambled fragment-treated ECs (Fig. 3A, B). Consistently, Y5-RNA knockdown in young ECs decreased, while overexpression of Y5-RNA 5‘ fragment in aged ECs increased expression of angiogenic factor angiopoietin2 (Ang2) and angiogenic receptors Tie2 and VEGFR2 (Fig. 3C). suggesting that Y5-RNA mediates age-dependent inhibition of angiogenic factor expression and angiogenic activities in vitro.

[0110] Y5-RNA mediates age-dependent decline in angiogenesis.

[0111] Angiogenesis is impaired in aged mice14'19. Y5-RNA mediates age-dependent increases in EC senescence and inhibition of angiogenic abilities (Figs. 1, 3). When the inventors subcutaneously implanted fibrin gel supplemented with GFP-labeled human adipose ECs with different ages on the back of the NSG mouse61, GFP-labeled human young adipose ECs supplemented in the gel formed well-organized vascular lumen structures in the gel 7 days after implantation as analyzed using confocal fluorescence microscopy (Fig. 4 A). In contrast, GFP- labeled aged adipose ECs supplemented in the gel formed a disorganized vasculature in the gel; the vessel length was 76% shorter in aged ECs (Fig. 4B). Y5-RNA knocked down young EC- derived EVs disrupted blood vessel structures and decreased the Tie2 expression in the gelsupplemented with young human adipose ECs; blood vessels were 71% shorter in the gel treated with Y5-RNA knocked down EC-derived EVs (Fig. 4A, B). EVs derived from aged ECs overexpressing Y5-RNA 5’ fragment reversed the disorganized vascular formation and Tie2 expression in aged ECs supplemented in the gel (Fig. 4A, B). These findings imply that Y 5-RNA- o verexpressing EC-derived EVs induce functional vascular formation in the gel.

[0112] Discussion

[0113] In this disclosure, the inventors have demonstrated that the levels of Y5-RNA decrease in EVs isolated from aged human ECs, which contributes to EC senescence and age-dependent decline in angiogenesis. Overexpression of Y5-RNA 5’ fragment suppresses EC senescence, upregulates angiogenic factor expression in aged ECs, and EVs collected from Y5-RNA 5’ fragment overexpressing aged ECs restore DNA synthesis and migration in aged ECs in vitro and blood vessel formation of aged ECs in the subcutaneously implanted hydrogel, while Y5-RNA knocked down EC-derived EVs inhibit the angiogenic effects in young ECs. Modulation of Y5- RNA may reverse age-related decline in angiogenesis and lead to the development of novel EV- based strategies for aging-associated diseases.

[0114] The inventors have demonstrated that decreases in EV-enclosed Y5-RNA mediate EC senescence in aged ECs. Other Y-RNAs (Yl, 3, 4 in human) may have different effects or change activity of Y5-RNA, and control EC senescence and angiogenesis. For example, Yl-RNA fragment contributes to cardioprotection36RBPs control stability and localization of Y-RNAs56, the effects of which may be different among Y-RNAs / Y -RNA binding proteins or among ages. Y-RNAs regulate the subcellular localization of Ro60 and control the stability and function of other RNAs interacting with Ro6056, which in turn changes Y-RNA expression and activity. For example, depletion of Y-RNAs results in nuclear accumulation of Ro6056'58. Aging may also have improper folding of Y-RNA to disturb tertiary structure, which may inhibit Y-RNA stability and decrease their expression levels. Further analysis of expression of other Y-RNAs and RBPs will elucidate the mechanism. If necessary, the inventors will use publicly available RNAseq / scRNAseq data62,63to identify other potential Y-RNA binding proteins and analyze the effects as the inventors did for other settings21-22.

[0115] It has been reported that Ro60 has an evolutionarily conserved role in mitigating stress from UV irradiation57,59, which is involved in cellular senescence. The inventors’ results reveal that Ro60 expression increases, while Y5-RNA expression decreases in aged human ECs (Fig. 2); however, UV exposure did not alter expression of Ro60 or Y-RNAs in animal cells (e.g., mouse embryonic stem cells, mouse fibroblasts), rather changing distribution of Ro60 from thecytoplasm to the nucleus after UV irradiation57'59’64. This inconsistency may be due to a difference between human ECs vs. mouse cells or the difference in the effects between acute UV irradiation and more chronic aging, in which various feedback mechanisms are involved in a special temporal manner in the body. While decreases in Y5-RNA in aged ECs result in EC senescence, senescent cells induce EV secretion with age33,65’66and secrete various cytokines21,31’67’68, which may change Y5-RNA and RBP expression.

[0116] The inventors' results suggest that Y5-RNA 5' fragment overexpression reverses EC senescence and restores angiogenic ability in aged ECs (Figs. 1, 3). EVs collected from aged ECs in which Y5-RNA 5’ fragment is overexpressing also reverse vascular formation in aged ECs in the gel implanted on mice (Fig. 4). The effects of direct transfection of Y5-RNA on target ECs may be different from those treated with EVs collected from ECs in which Y5-RNA expression is manipulated. Y-RNAs affect the function of recipient cells via the action of Y-RNA binding proteins present in target cells or co-transferred by the EVs29,69, which may alter Y-RNA stability and translation efficiency to control EC senescence and angiogenic ability. In addition, aging also alters EV biogenesis / trafficking70, which may affect packaging / secretion of Y-RNAs in EVs. Since EVs contain multiple proteins and nucleic acids (e.g., ECM molecules, cytoskeleton remodeling molecules)21,22, they may enhance the effects of Y-RNAs or reduce the adverse effects compared to treating cells with Y-RNAs alone. Furthermore, EVs are small in size and protected from degradation due to their lipid bilayer structure, inhibiting immune response and facilitating delivery’ to their target23,24’30’33’35,71’72.Thus, MSC-derived exosomes have been studied to suppress various diseases (e.g., BPD, airway inflammation, and pulmonary fibrosis)23-24-3"-33-35-71-72. pyscollected from Y5-RNA-modulated cells or EVs loaded with Y5-RNA 5’ fragment may reverse age-related decline in angiogenesis and have therapeutic potentials to age-related diseases.

[0117] The inventors’ results suggest that overexpression of Y 5-RNA 5’ fragment or treatment with EVs collected from ECs overexpressing Y5-RNA 5’ fragment restores angiogenic activity in aged ECs. Other Y-RNAs may also be required for more functional blood vessel formation. Treatment of aged ECs with Y5-RNA in combination with other Y-RNAs will elucidate the mechanism. The inventors still don’t know the downstream signaling by which Y5-RNA controls EC senescence and angiogenesis. The inventors have reported that Wnt co-receptor LRP5 stimulates lung vascular development in neonatal mice73,74and compensatory lung growth after PNX in adult mice75, and mediates age-dependent angiogenesis and lung regeneration16. It has been reported that LRP5 expression / activity is controlled by Wnt3a76,77, which also controlscellular senescence78. Thus, LRP5 and Wnt-related molecules may be one of the candidate pathways to mediate the mechanism.

[0118] To analyze the age-dependent changes in vascular morphogenesis of human ECs. the inventors implanted fibrin gel mixed with human ECs of different ages in combination with EVs from ECs in which Y5-RNA expression is manipulated. Angiogenic activity in vitro and in the gel seem to be different; Y5-RNA 5’ fragment looks almost fully restores EC DNA synthesis and migration in vitro but only partially restores blood vessel formation in the implanted gel (Figs. 3, 4). The supplemented aged ECs secrete growth factors, ECMs, and inflammatory factors that affect tissue microenvironment and recruit host cells into the gel (e.g., fibroblasts, ECs) that also secrete angiogenic and other chemical factors, which in turn changes the gradients of angiogenic and growth factors, and indirectly control vascular formation in the gel. Gel implantation also has inflammatory reactions, which may affect EC senescence and vascular formation in the gel.

[0119] In summary, the inventors have demonstrated that Y5-RNA mediates age-related decline in angiogenesis in human adipose tissue derived ECs in vitro and in the gel subcutaneously implanted on mice. Modulation of Y5-RNA would potentially lead to the development of new EV -based therapeutic strategies for aging-associated diseases.

[0120] Materials and Methods

[0121] Materials. Anti-flotillin-1 and -nucleolin antibodies were from Cell Signaling (Danvers, MA). Anti-GM130 antibody was from BD Biosciences (Franklin Lakes, NJ). Anti- CD63 antibody was from Santa Cruze Biotechnology (Dallas, TX). Anti-Trove2 and -fibrillarin antibodies were from Sigma (St. Louis, MO).

[0122] Human adipose tissue acquisition. Fresh human subcutaneous adipose tissues (n= 10 people) were obtained as discarded surgical specimens from patients undergoing abdominal surgeries. After surgical removal, samples were placed in ice-cold HEPES buffer and immediately transferred to the laboratory’ for cell isolation. De-identified patient demographic data were collected using the Generic Clinical Research Database (GCRD) at the Medical College of Wisconsin. All protocols were approved by the Institutional Review Board of the Medical College of Wisconsin and Froedtert Hospital. The patients with any types of cancer were excluded. ECs were isolated from human adipose tissues using anti-CD31 conjugated magnetic beads and sorted by FACS (CD31+, VE-Cadherin+, CD45 ) as previously reported16’60. Isolated ECs were validated as ECs by FACS. Isolated human adipose ECs were cultured in ECM medium containing 5% FBS and growth factors (VEGF, bFGF and PDGF, Science Cell, Carlsbad, CA) and were used between passages 1-3.

[0123] Oligonucleotide synthesis and gene knockdown._Gene knockdown was performed using the RNA interference technique16,60. Target sequence of siRNA for human Y5-RNA was UUUAACAUUGUCUCCCCCCACAACCGCGC (SEQ ID NO: 5). Human nucleolin siRNAs were (siRNAl: AGAGUUUGCUUCAUUCGAATT (SEQ ID NO: 6); and siRNA2: GACAGUGAUGAAGAGGAGGTT (SEQ ID NO: 7)). Human Trove2 siRNA was ON- TARGETplus Human TROVE2 (6738) siRNA - SMARTpool (Horizon Discovery , Cambridge, UK). Human adipose ECs were transfected using siLentFect (BioRad, Hercules, CA)16,60and used for collecting EVs 3 days after transfection. As a control, siRNA duplex with an irrelevant sequence (QIAGEN) was used. 5’-linked Rhodamine RedTM-X [NHS Ester] labeled Y5-RNA 5’ fragment oligonucleotide (AGU UGG UCC GAG UGU UGU GGG UUA UUG UUA AGU UGA UUU AAC AUU GUC UC (SEQ ID NO: 2) was synthesized by IDT (Coralville, IA). Human adipose ECs were transfected using Dharmafect (Horizon Discovery, Boulder, CO).

[0124] Molecular biological and biochemical methods. Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad, Hercules, CA) using the BioRad real time PCR system (BioRad). Beta 2 microglobulin (B2M) controlled for overall DNA content. The primers used for human P16mk4a, P21, Tie2, VEGFR2, angiopoietin2, and B2M were previously described74,75,79. The primers for human Y5- RNA forward; 5’-AGTTGGTCCGAGTGTTGTGG-3’ (SEQ ID NO: 8) and reverse; 5’- AACAGCAAGCTAGTCAAGCG-3’ (SEQ ID NO: 9); human Y5-5’ fragment forward; 5’-AGT TGG TCC GAG TGT TGTGGG-3’ (SEQ ID NO: 10) and reverse; 5’-GTC AAG CGC GGT TGT GGG G-3’ (SEQ ID NO: 11); human nucleolin forward; 5’-GCACCTGGAAAACGAAAGAAGG-3’ (SEQ ID NO: 12) and reverse; 5’-GAAAGCCGTAGTCGGTTCTGT-3’ (SEQ ID NO: 13); human Ro60 forward; 5’-GAAGCAGATAGCCAATTCTCAGG-3’ (SEQ ID NO: 14) and reverse; 5’-CCACCTTCAGAACCGAAAC ATA-3’ (SEQ ID NO: 15); human La forward; 5 - AATTTGCCACGGGACAAGTTT-3’ (SEQ ID NO: 16) and reverse; 5’-TGTTGTTAGACGGTTCAACCTG-3’ (SEQ ID NO: 17).

[0125] EV isolation. ECs isolated from human adipose tissues w ere plated (IxlO6cells per 6 cm dish), cultured with media containing exosome free FBS, and conditioned media was collected after 24 hours. EVs were isolated using Total Exosome Isolation Reagent from Cell Culture Media (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s protocol21,22. The EV pellet was resuspended in 25 pl of 0.2 pm filtered PBS. Isolated EVs were confirmed with exosome marker proteins (CD63, flotillin- 1) using immunoblotting (IB). For transmissionelectron microscopy (TEM) to analyze the ultrastructure of the EVs. resuspended EVs were adsorbed onto freshly ionized, 400 mesh formvar / carbon grids, washed once with distilled water, and negatively stained with 2% aqueous Uranyl acetate. EV preparations were viewed in a Hitachi H600 transmission electron microscope and images were recorded with a Hamamatsu ccd camera using AMT image capture software. Size and concentration distributions of EVs were determined using nanoparticle tracking analysis (NTA; NanoSight LM10 system, Malvern instruments, Malvern, UK)21’22. EV RNA was isolated using the miRNeasy Serum / Plasma Kit (QIAGEN) according to the manufacturer’s protocol.

[0126] In vitro cell biological assay. Human adipose tissue-derived ECs were treated with Y 5- RNA siRNA or Y5-RNA 5’ fragment, and DNA synthesis of ECs was analyzed by an EdU assay21,22’60. EC migration was analyzed using a modified trans well migration assay21-22’60. The cells that migrated towards the 0.5% serum ECM through the membrane were stained with Giemsa and counted. Cellular senescence was characterized using a S A-|3 galactosidase assay kit (cell signaling)19’21.

[0127] Mouse subcutaneous gel implantation. The in vivo animal study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was reviewed and approved by the Animal Care and Use Committee of MCW. NOD SCID gamma (NSG) mice (Jackson Laboratory, stock#, 5557) were used for the study. Human adipose ECs were treated with viral stock expressing GFP for labeling and the transduction efficiency was confirmed before the assay. Fibrin gel was fabricated as previously described, and GFP-labeled human adipose ECs (IxlO6cells) and EVs collected from ECs, in which Y5-RNA expression was manipulated, were mixed in the gel 14, 19,60.61.80 Te rOpS of gels were incubated at 37 °C for 30 min and subcutaneously implanted on the back of the NSG mice. The gel was harvested 7 days after implantation, fixed with 4% paraformaldehyde, cryosectioned, and immunohistochemical (IHC) analysis was conducted as described previously14’19’60-61’80. The IHC images were taken using a Nikon AIR confocal laser scanning microscope and stacks of optical sections (20-pm thick) were compiled to form three dimensional images using software associated with a confocal microscope. Morphometric analysis was performed using ImageJ software. Vascular network formation of GFP-labeled human adipose ECs was evaluated by measuring the length of GFP-labeled blood vessels from five different areas of the gel.

[0128] Statistical Analysis. All phenotypic analysis was performed by masked observers unaware of the identity of experimental groups. Error bars (SEM) and p values were determined from the results of three or more independent experiments. Student's t-test was used for statistical significance for two groups. For more than two groups, one-way ANOVA with a post-hoc analysis using the Bonferroni test was conducted.

[0129] In the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and / or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0130] Citations to a number of patent and non-patent references may be made herein. The cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.

[0131] References1 Donato, A. J., Machin, D. R. & Lesniewski, L. A. Mechanisms of Dysfunction in the Aging Vasculature and Role in Age-Related Disease. Circ Res 123, 825-848 (2018).2 Franceschi, C. et al. The Continuum of Aging and Age-Related Diseases: Common Mechanisms but Different Rates. Front Med (Lausanne) 5, 61 (2018).3 North, B. J. & Sinclair, D. A. The intersection between aging and cardiovascular disease. Circ Res 110, 1097-1108 (2012).4 Tuder, R. M. & Petrache, I. Pathogenesis of chronic obstructive pulmonary disease. J Clin Invest 122, 2749-2755 (2012).5 Carmeliet, P. Angiogenesis in health and disease. Nat Med 9, 653-660 (2003).6 Mammoto, A. & Mammoto, T. Vascular Niche in Lung Alveolar Development, Homeostasis, and Regeneration. Front Bioeng Biotechnol 7, 318 (2019).7 Mammoto, T., Muyleart, M. & Mammoto, A. Endothelial YAP1 in regenerative lung growth through the angiopoietin-Tie2 pathway Am J Respir Cell Mol Biol. 60, 117-127 (2019).8 Ding, B. S. et al. Endothelial-derived angiocnne signals induce and sustain regenerative lung alveolarization. Cell 147, 539-553 (2011).9 Rafii, S., Butler, J. M. & Ding, B. S. Angiocrine functions of organ-specific endothelial cells. Nature 529, 316-325 (2016).10 Butler, J. M., Kobayashi, H. & Rafn, S. Instructive role of the vascular niche in promoting tumour growth and tissue repair by angiocnne factors. Nat Rev Cancer 10, 138-146 (2010).11 Hu, J. et al. Endothelial cell-derived angiopoietin-2 controls liver regeneration as a spatiotemporal rheostat. Science 343, 416-419 (2014).12 Carmeliet, P. & Jain, R. K. Molecular mechanisms and clinical applications of angiogenesis. Nature 473, 298-307 (2011).13 Chung, A. S. & Ferrara, N. Developmental and pathological angiogenesis. Annu Rev Cell Dev Biol 27, 563-584 (2011).14 Hendee, K. et al. Twistl signaling in age-dependent decline in angiogenesis and lung regeneration. Aging (Albany NY) 13 (2021).15 Lahteenvuo, J. & Rosenzweig, A. Effects of aging on angiogenesis. Circ Res 110, 1252-1264 (2012).16 Mammoto, A., Muyleart, M. & Mammoto, T. LRP5 in age-related changes in vascular and alveolar morphogenesis in the lung. Aging (Albany NY) 11, 89-103 (2019).17 Ungvan, Z. et al. Endothelial dysfunction and angiogenesis impairment in the ageing vasculature. Nat Rev Cardiol 15, 555-565 (2018).18 Moriya, J. & Minamino, T. Angiogenesis, Cancer, and Vascular Aging. Front Cardiovasc Med 4, 65 (2017).19 Mammoto, T. et al. Effects of age-dependent changes in cell size on endothelial cell proliferation and senescence through YAP1. Aging (Albany NY) 11 (2019).20 Rivard, A. et al. Age-dependent impairment of angiogenesis. Circulation 99, 111-120 (1999).21 Kyi, P. et al. Endothelial senescence mediates hypoxia-induced vascular remodeling by modulating PDGFB expression. Frontiers in Medicine (2022).22 Mammoto, T. et al. Hydrostatic Pressure Controls Angiogenesis Through Endothelial YAP1 During Lung Regeneration. Front Bioeng Biotechnol 10, 823642 (2022).23 Thery, C., Zitvogel, L. & Amigorena, S. Exosomes: composition, biogenesis and function. Nat Rev Immunol 2, 569-579 (2002).24 Kourembanas, S. Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy. Annu Rev Physiol 77, 13-27 (2015).25 Valadi, H. et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 9, 654-659 (2007).26 Montecalvo, A. et al. Mechanism of transfer of functional microRNAs between mouse dendritic cells via exosomes. Blood 119, 756-766 (2012).27 Alexander, M. et al. Exosome-delivered microRNAs modulate the inflammatory response to endotoxin. Nat Commun 6, 7321 (2015).28 Tkach, M. & Thery, C. Communication by Extracellular Vesicles: Where We Are and Where We Need to Go. Cell 164, 1226-1232 (2016).29 Driedonks, T. A. P. & Nolte-'t Hoen, E. N. M. Circulating Y-RNAs in Extracellular Vesicles and Ribonucleoprotein Complexes; Implications for the Immune System. Front Immunol 9, 3164 (2018).30 Pant, S., Hilton, H. & Burczynski, M. E. The multifaceted exosome: biogenesis, role in normal and aberrant cellular function, and frontiers for pharmacological and biomarker opportunities. Biochem Pharmacol 83, 1484-1494 (2012).31 Basisty, N. et al. A proteomic atlas of senescence-associated secretomes for aging biomarker development. PLoS Biol 18, e3000599 (2020).32 Xie, Y. et al. Involvement of serum-derived exosomes of elderly patients with bone loss in failure of bone remodeling via alteration of exosomal bone- related proteins. Aging Cell 17, el2758 (2018).33 Jakhar, R. & Crasta, K. Exosomes as Emerging Pro-Tumorigenic Mediators of the Senescence- Associated Secretory Phenotype. Int J Mol Sci 20 (2019).34 Robbins, P. D., Dorronsoro, A. & Booker, C. N. Regulation of chronic inflammatory and immune processes by extracellular vesicles. J Clin Invest 126, 1173-1180 (2016).35 Thery, C., Ostrowski, M. & Segura, E. Membrane vesicles as conveyors of immune responses. Nat Rev Immunol 9, 581-593 (2009).36 Cambier, L. et al. Y RNA fragment in extracellular vesicles confers cardioprotection via modulation of IL- 10 expression and secretion. EMBO Mol Med 9, 337-352 (2017).37 Ibrahim, A. & Marban, E. Exosomes: Fundamental Biology and Roles in Cardiovascular Physiology. Annu Rev Physiol 78, 67-83 (2016).38 Kishore, R. & Khan, M. More Than Tiny Sacks: Stem Cell Exosomes as Cell-Free Modality for Cardiac Repair. Circ Res 118, 330-343 (2016).39 Sahoo, S. & Losordo, D. W. Exosomes and cardiac repair after myocardial infarction. Circ Res 114, 333-344 (2014).40 Osteikoetxea, X., Nemeth, A., Sodar, B. W., Vukman, K. V. & Buzas, E. I. Extracellular vesicles in cardiovascular disease: are they Jedi or Sith? J Physiol 594, 2881-2894 (2016).41 Nolte-'t Hoen, E. N. et al. Deep sequencing of RNA from immune cell- derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions. Nucleic Acids Res 40, 9272-9285 (2012).42 Driedonks, T. A. P. et al. Immune stimuli shape the small non-coding transcriptome of extracellular vesicles released by dendritic cells. Cell Mol Life Sci 75, 3857-3875 (2018).43 Shurtleff, M. J. et al. Broad role for YBX1 in defining the small noncoding RNA composition of exosomes. Proc Natl Acad Sci U S A 114, E8987-E8995 (2017).44 van Balkom, B. W , Eisele, A. S., Pegtel, D. M., Bervoets, S. & Verhaar, M. C. Quantitative and qualitative analysis of small RNAs in human endothelial cells and exosomes provides insights into localized RNA processing, degradation and sorting. J Extracell Vesicles 4, 26760 (2015).45 Yeri, A. et al. Total Extracellular Small RNA Profiles from Plasma, Saliva, and Urine of Healthy Subjects. Sci Rep 7, 44061 (2017).46 Vojtech, L. et al. Exosomes in human semen carry a distinctive repertoire of small non-coding RNAs with potential regulatory functions. Nucleic Acids Res 42, 7290-7304 (2014).47 Hizir, Z., Bottim, S., Grandjean, V., Trabucchi, M. & Repetto, E. RNY (YRNA)-denved small RNAs regulate cell death and inflammation in monocytes / macrophages. Cell Death Dis 8, e2530 (2017).48 Dhahbi, J. M., Spindler, S. R., Atamna, H., Boffelli, D. & Martin, D. I. Deep Sequencing of Serum Small RNAs Identifies Patterns of 5' tRNA Half and YRNA Fragment Expression Associated with Breast Cancer. Biomark Cancer 6, 37-47 (2014).49 Jae, N. & Dimmeler, S. Noncoding RNAs in Vascular Diseases. Circ Res 126, 1127-1145 (2020).50 Repetto, E. et al. RNY-denved small RNAs as a signature of coronary artery disease. BMC Med 13, 259 (2015).51 Lerner, M. R., Boyle, J. A., Hardin, J. A. & Steitz, J. A. Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus. Science 211, 400-402 (1981).52 Valkov, N. & Das, S. Y RNAs: Biogenesis, Function and Implications for the Cardiovascular System. Adv Exp Med Biol 1229, 327-342 (2020).53 Guglas, K. et al. YRNAs and YRNA-Derived Fragments as New Players in Cancer Research and Their Potential Role in Diagnostics. Int J Mol Sci 21 (2020).54 Teunissen, S. W. et al. Conserved features of Y RNAs: a comparison of experimentally derived secondary structures. Nucleic Acids Res 28, 610-619 (2000).55 Thomson, D. W. et al. Assessing the gene regulatory properties of Argonaute-bound small RNAs of diverse genomic origin. Nucleic Acids Res 43, 470-481 (2015).56 Boccitto, M. & Wohn, S. L. Ro60 and Y RNAs: structure, functions, and roles in autoimmunity. Crit Rev Biochem Mol Biol 54, 133-152 (2019).57 Sim, S. et al. The subcellular distribution of an RNA quality control protein, the Ro autoantigen, is regulated by noncoding Y RNA binding. Mol Biol Cell 20, 1555-1564 (2009).58 Leng, Y., Sim, S., Magidson, V. & Wolin, S. L. Noncoding Y RNAs regulate the levels, subcellular distribution and protein interactions of their R06O autoantigen partner. Nucleic Acids Res 48, 6919-6930 (2020).59 Chen, X. et al. The Ro autoantigen binds misfolded U2 small nuclear RNAs and assists mammalian cell survival after UV irradiation. Curr Biol 13, 2206-2211 (2003).60 Hunyenyiwa, T. et al. Obesity Inhibits Angiogenesis Through TWIST1- SLIT2 Signaling. Front Cell Dev Biol 9, 693410 (2021).61 Mammoto, A., Muyleart, M., Kadlec, A., Gutterman, D. & Mammoto, T. YAP1-TEAD1 signaling controls angiogenesis and mitochondrial biogenesis through PGCla. Microvasc Res 119, 73-83 (2018).62 Norreen-Thorsen, M. et al. A human adipose tissue cell-type transcriptome atlas. Cell Rep 40, 111046 (2022).63 Nguyen, H. P. et al. Aging-dependent regulatory cells emerge in subcutaneous fat to inhibit adipogenesis. Dev Cell 56, 1437-1451 e!433 (2021).64 Sim, S. et al. The zipcode-binding protein ZBP1 influences the subcellular location of the Ro 60-kDa autoantigen and the noncoding Y3 RNA. RNA 18, 100- 110 (2012).65 Alfonzo, M. C., Al Saedi, A., Fulzele, S. & Hamrick, M. W. Extracellular Vesicles as Communicators of Senescence in Musculoskeletal Aging. JBMR Plus 6, el 0686 (2022).66 Kadota, T. et al. Emerging role of extracellular vesicles as a senescence- associated secretory phenotype: Insights into the pathophysiology of lung diseases. Mol Aspects Med 60, 92-103 (2018).67 Campisi, J. Cellular senescence: putting the paradoxes in perspective. Curr Opin Genet Dev 21, 107-112 (2011).68 van Deursen, J. M. The role of senescent cells in ageing. Nature 509, 439- 446 (2014).69 Lunavat, T. R. et al. Small RNA deep sequencing discriminates subsets of extracellular vesicles released by melanoma cells— Evidence of unique microRNA cargos. RNA Biol 12, 810-823 (2015).70 Lark, D. S. & LaRocca, T. J. Expression of Exosome Biogenesis Genes Is Differentially Altered by Aging in the Mouse and in the Human Brain During Alzheimer's Disease. J Gerontol A Biol Sci Med Sci 77, 659-663 (2022).71 Lai, R. C., Yeo, R. W., Tan, K. H. & Lim, S. K. Exosomes for drug delivery- a novel application for the mesenchymal stem cell. Biotechnol Adv 31, 543-551 (2013).72 Vickers, K. C. & Remaley, A. T. Lipid-based carriers of microRNAs and intercellular communication. Curr Opin Lipidol 23, 91-97 (2012).73 Mammoto, T., Jiang, E., Jiang, A. & Mammoto, A. ECM structure and tissue stiffness control postnatal lung development through the LRP5-Tie2 signaling system. . American journal of respiratory cell and molecular biology 49, 1009-1018 (2013).74 Mammoto, T. et al. LRP5 Regulates Development of Lung Microvessels and Alveoli through the Angiopoietin-Tie2 Pathway. PLoS ONE 7, e41596 (2012).75 Mammoto, T. et al. Platelet-rich plasma extract accelerates lung regeneration through the LRP5-Tie2 pathway Am J Respir Cell Mol Biol. 54, 103-113 (2016).76 MacDonald, B. T. & He, X. Frizzled and LRP5 / 6 receptors for Wnt / beta- catenin signaling. Cold Spring Harb Perspect Biol 4 (2012).77 Brunt, K. R. et al. Role of WNT / beta-catenin signaling in rejuvenating myogenic differentiation of aged mesenchymal stem cells from cardiac patients. Am J Pathol 181, 2067-2078 (2012).78 Jeoung, J. Y. et al. A decline in Wnt3a signaling is necessary for mesenchymal stem cells to proceed to replicative senescence. Stem Cells Dev 24, 973-982 (2015).79 Mammoto, A. et al. A mechanosensitive transcriptional mechanism that controls angiogenesis. Nature 457, 1103-1108 (2009).80 Mammoto, A., Hendee, K., Muyleart, M. & Mammoto, T. EndothelialTwist 1-PDGFB signaling mediates hypoxia-induced proliferation and migration of aSMA-positive cells Sci Rep (2020).81 Wang, J. et al. CAR (CARSKNKDC) Peptide Modified ReNcell-Derived Extracellular Vesicles as a Novel Therapeutic Agent for Targeted Pulmonary Hypertension Therapy. Hypertension 76, 1 147-1 160 (2020).82 Toba, M. et al. A novel vascular homing peptide strategy to selectively enhance pulmonary drug efficacy in pulmonary arterial hypertension. Am J Pathol 184, 369-375 (2014).83 Teng, Y. et al. MVP-mediated exosomal sorting of miR-193a promotes colon cancer progression. Nat Commun 8, 14448 (2017).84 Zhang, C., He, T., Vedadghavami, A. & Bajpayee, A. G. Avidin-biotin technology to synthesize multi-arm nano-construct for drug delivery. MethodsX 7, 100882 (2020).Example 2 - Characterization of Yl-RNA expression in idiopathic pulmonary hypertension and generation of extracellular vesicles comprising Yl-RNA fragments

[0132] De-identified human idiopathic pulmonary artery hypertension (IP AH) patient ECs were obtained from the Pulmonary' Hypertension Breakthrough Initiative (PHBI) Network. The inventors obtained ECs isolated from PA (>5 mm in diameter) from females and males. The levels of Yl-RNA (qRT-PCR). which is known to contribute to cardiovascular diseases, increased in IP AH patient ECs compared to those in healthy controls (Fig. 5A). ECs were also isolated from mouse lungs (8-10 week old) or de-identified human lungs (<50 y.o., MCW Tissue Bank) using anti-CD31 conjugated magnetic beads, sorted by FACS (CD31+, VE-cadherin+, CD45"), and cultured on collagen-coated plates as the inventors reported. FACS analysis confirmed that 97% of the FACS- sorted isolated human lung cells express EC markers (e.g., CD31, Fig. 5B). Yl- RNA overexpression (Dharmafect) increased the levels of EC senescence in human lung ECs at the levels of that under hypoxia (SApGal staining, Fig. 5C). These ECs will be cultured in ECMmedium containing 5% FBS and grow th factors (VEGF, bFGF and PDGF, Science Cell, Carlsbad, CA).

[0133] Increases in Yl-RNA in hypoxia-treated mouse lung EC-EVs mediate PASMC proliferation under hypoxia: EVs were isolated from conditioned medium (CM) of mouse lung ECs as the inventors reported; briefly, the inventors changed media to EV -free media the day before isolation and EVs were isolated from pre-filtered (0.2 pm) CM of mouse lung ECs (IxlO6cells) using total EV isolation reagent as the inventors reported. Isolated EVs were positive for EV markers (CD63, Flotillin-1) and negative for the cellular marker GM130 (Fig. 6A). Nanoparticle tracking analysis (NT A) revealed that isolated EVs were heterogenous in diameter (90-180 nm, Fig. 2B) that exhibit round vesicular morphology when analyzed by transmission electron microscopy (TEM, Fig. 6C), confirming successful isolation of EVs. The levels of Yl- RNA were higher in EVs isolated from hypoxia-treated PH mouse lung ECs compared to that in normoxia- treated lung EC-EVs (Fig. 6D). The levels of Yl-RNA were significantly lower in EV- depleted supernatant (Fig. 6D), suggesting that Yl-RNA is enriched in EVs and the effects are not due to protein / RNA contamination. EVs collected from hypoxia- treated human PAECs (HPAECs, Lonza) stimulated DNA synthesis of PASMCs compared to those treated with normoxia-treated EC-EVs, while Yl -RNA knocked down EC-EVs suppressed the effects (Fig. 6E).

[0134] Yl-RNA encapsulation into EVs: CAR peptide-biotin (CARSKNKDC (SEQ ID NO: 3)-biotin) was custom synthesized (Genscript). EV s were encapsulated with Y 1 -RNA-FAM using Exo-Fect transfection kit (System Biosciences); briefly, 100 pg of EVs were mixed with 2.5 pg Y1-RNA-(SEQ ID NO:4)-FAM in PBS and Exo-Fect reagent, incubated for 10 min at 37°C, and purified by centrifugation. These Y-RNA-FAM encapsulated EVs w ere surface modified with EDC / NHS chemistry, conjugated with Alexa-Fluor 594 streptavidin (20 pg) to aid in imaging, and subsequently reacted with CAR-biotin (50 pg) for 30 min, and purified by centrifugation (Fig. 7). The efficiency of Yl-RNA encapsulation and CAR peptide conjugation was determined by measuring FAM fluorescence and using a colorimetric biotin assay (HABA / Avidin kit, Sigma), respectively. Approximately 26% of Yl-RNA (550-600 ng / 100 pg EVs) was loaded and 48% of CAR peptide were conjugated (Table 1), which is standard efficiency. These engineered EVs w ere incorporated into the ECs 30 min after treatment (Fig. 8).Table 1.Table 2. Exemplary sequences

Claims

CLAIMS1. An RNA comprising a fragment of Y5-RNA, wherein the RNA comprises at least one modified nucleotide.

2. The RNA of claim 1, wherein the fragment of Y5-RNA is a 5’ fragment.

3. The RNA of claim 1, wherein the fragment of Y5-RNA comprises SEQ ID NO: 2, or a sequence with at least 95% identity to SEQ ID NO: 2.

4. An extracellular vesicle (EV) comprising the RNA of claim 1.

5. The EV of claim 4, wherein the EV is an exosome.

6. A synthetic nanoparticle comprising the RNA of claim 1.

7. An expression vector comprising a sequence encoding a fragment of Y5-RNA.

8. The expression vector of claim 7. wherein the fragment of Y5-RNA is SEQ ID NO: 2 or a sequence with at least 95% identity to SEQ ID NO: 2.

9. The expression vector of claim 8. further comprising a regulatory sequence operably linked to the sequence encoding the fragment of Y5-RNA.

10. A cell comprising the RNA of claim 1.

11. A cell comprising the expression vector of claim 7.

12. A method of making extracellular vesicles in in vitro cultured cells, the method comprising expressing the expression vector of claim 7 in a cell, wherein the cell releases extracellular vesicles into a culture medium; and enriching, isolating, or purifying the extracellular vesicles from the culture medium.

13. A pharmaceutical composition comprising a Y5-RNA.

14. A pharmaceutical composition comprising a Y5-RNA fragment.

15. The pharmaceutical composition of claim 14, wherein the Y 5-RNA fragment is a 5 ’ fragment.

16. The pharmaceutical composition of claim 15, wherein the Y5-RNA fragment comprises SEQ ID NO: 2, or a sequence with at least 95% identity to SEQ ID NO: 2.

17. A pharmaceutical composition comprising an extracellular vesicle comprising aY5- RNA or a fragment of a Y5-RNA.

18. A pharmaceutical composition comprising the extracellular vesicle (EV) of claim 4 or the synthetic nanoparticle of claim 6.

19. The pharmaceutical composition of claim 13, further comprising at least one pharmaceutically acceptable carrier or excipient.

20. The pharmaceutical composition of claim 13, wherein the pharmaceutical composition is formulated for intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

21. A method comprising administering an effective amount of the pharmaceutical composition of any one of claims 13-17 or 19-20 to a subject in need thereof.

22. A method of treating at least one aging related symptom in a subj ect in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat the at least one aging related symptom in the subject.

23. A method of treating a disease or disorder related to endothelial cell senescence in a subject in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat the disease or disorder.

24. The method of claim 23, wherein the disease or disorder is selected from the group consisting of lung fibrosis, chronic obstructive pulmonary disorder (COPD), hypertension, atherosclerosis, pulmonary hypertension, Alzheimer’s disease, osteoporosis, and type 2 diabetes.

25. A method of treating lung fibrosis in a subject in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat the lung fibrosis.

26. A method of treating cardiovascular disease in a subject in need thereof, the method compnsing administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat the cardiovascular disease.

27. A method of treating Alzheimer’s disease in a subject in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat Alzheimer’s disease.

28. A method of treating hypertension in a subject in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to treat hypertension in the subject.

29. A method of improving wound healing in a subject in need thereof, the method comprising administering an effective amount of the pharmaceutical composition of claim 13 to the subject to improve wound healing in the subject.

30. The method of claim 29, wherein administration comprises administering the pharmaceutical composition directly to a wound in the subject.

31. The method of any one of claims 21-30, wherein administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

32. The method of claim 31, wherein administration comprises intravenous administration.

33. A kit comprising the RNA of any one of claims 1-3, the extracellular vesicle of anyone of claims 4-5, the synthetic nanoparticle of claim 6, or the pharmaceutical composition of any one of claims 13-20.

34. The kit of claim 33. further comprising instructions for using the kit.

35. An extracellular vesicle comprising a Yl-RNA, wherein the extracellular vesicle comprises a targeting moiety.

36. The extracellular vesicle of claim 35, wherein the targeting moiety comprises SEQ ID NO: 3.

37. The extracellular vesicle of claim 35, wherein the Yl-RNA comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4.

38. A synthetic nanoparticle comprising a Yl-RNA, wherein the synthetic nanoparticle comprises a targeting moiety-.

39. The synthetic nanoparticle of claim 38, wherein the targeting moiety comprises SEQ ID NO: 3.

40. The synthetic nanoparticle of claim 38, wherein the Yl-RNA comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4.

41. A pharmaceutical composition comprising the extracellular vesicle of any one of claims 35-37 or the synthetic nanoparticle of any one of claims 38-40.

42. A method of treating at least one aging related symptom in a subj ect in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Y1 -RNA fragment to the subject to treat the at least one aging related symptom in the subject.

43. A method of treating a disease or disorder related to endothelial cell senescence in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat the disease or disorder.

44. The method of claim 43, wherein the disease or disorder is selected from the group consisting of: lung fibrosis, chronic obstructive pulmonary disorder (COPD), hypertension, atherosclerosis, pulmonary hypertension, Alzheimer’s disease, osteoporosis, and type 2 diabetes.

45. A method of treating lung fibrosis in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat the lung fibrosis.

46. A method of treating Alzheimer's disease in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat Alzheimer’s disease.

47. A method of treating hypertension in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to treat hypertension in the subject.

48. A method of improving wound healing in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Yl-RNA fragment to the subject to improve wound healing in the subject.

49. The method of claim 48, wherein administration comprises administering the pharmaceutical composition directly to a wound in the subject.

50. The method of any one of claims 42-49, wherein the Yl-RNA fragment comprises SEQ ID NO: 4 or a sequence with at least 95% identity to SEQ ID NO: 4.

51. The method of any one of claims 42-49, wherein the pharmaceutical composition comprises the pharmaceutical composition of claim 41.

52. The method of any one of claims 42-51, wherein administration comprises intravenous administration, intranasal administration, intratracheal instillation, inhalation, direct injection, or topical administration.

53. A kit comprising the extracellular vesicle of any one of claims 35-37 or the synthetic nanoparticle of any one of claims 38-40.

54. The kit of claim 53, further comprising instructions for using the kit.