Allogeneic car-t cell therapies and manufacture thereof

EP4770652A1Pending Publication Date: 2026-07-08KYVERNA THERAPEUTICS INC

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
KYVERNA THERAPEUTICS INC
Filing Date
2024-08-28
Publication Date
2026-07-08

AI Technical Summary

Technical Problem

The therapeutic use of allogeneic CAR T cells is limited by the risk of immune rejection and graft-versus-host disease due to mismatched MHC molecules between the donor and recipient.

Method used

Engineered T cells with reduced or eliminated expression of HLA-A, CIITA, and TRAC genes are developed using sequential genetic modifications and lipid nanoparticle-mediated gene editing, allowing for high efficiency and purity of engineered cells.

Benefits of technology

The engineered T cells demonstrate increased persistence and resistance to NK cell-mediated rejection, reducing the risk of immune rejection and improving the safety and efficacy of allogeneic CAR T cell therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024044268_06032025_PF_FP_ABST
    Figure US2024044268_06032025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are engineered T cells expressing a heterologous chimeric antigen receptor (CAR) and deficient in certain T cell receptor (TCR) and major histocompatibility complex (MHC) genes, useful for allogeneic CAR T cell therapy. Also provided are methods of producing such engineered T cells.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. KVN-007WO ALLOGENEIC CAR-T CELL THERAPIES AND MANUFACTURE THEREOF RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 579,076, filed on August 28, 2023, U.S. Provisional Patent Application No.63 / 620,643, filed on January 12, 2024, and U.S. Provisional Patent Application No. 63 / 645,074, filed on May 9, 2024, the entire contents of each of which are incorporated by reference herein for all purposes. BACKGROUND

[0002] Autologous chimeric antigen receptor (CAR) T cells have changed the therapeutic landscape for a number of diseases. Nevertheless, the use of allogeneic CAR T cells from donors has many potential advantages over use of autologous CAR T cells, including immediate availability of cryopreserved batches for patient treatment, possible standardization of the CAR T cell product, time for multiple cell modifications, redosing or use of combinations of CAR T cells directed against different targets, and decreased production cost. However, the therapeutic use of allogeneic CAR T cells has many caveats, including the possibility of causing life-threatening graft-versus-host disease, and they may be rapidly eliminated by the host immune system. SUMMARY

[0003] The present disclosure appreciates that the ability to downregulate MHC class I and / or MHC class II is critical for many in vivo and ex vivo utilities, e.g., when using allogeneic cells (originating from a donor) for transplantation and / or for creating a cell population in vitro that does not activate T cells. In particular, the transfer of allogeneic cells into a patient or subject, e.g., in the form of allogeneic CAR T cells, is of great interest to the field of cell therapy. The present disclosure further appreciates that use of allogeneic cells has been limited due to the problem of rejection by the recipient subject’s immune cells, which recognize the transplanted cells as foreign and mount an attack. To avoid the problem of immune rejection, cell-based therapies have focused on autologous approaches that use a subject’s own cells as the cell source for therapy, an approach that is time-consuming and costly. The present disclosure provides, among other things, engineered T cells and compositions and methods of making engineered T cells (e.g., CAR T cells) useful for 1 IPTS / 128687595.1Attorney Docket No. KVN-007WO allogeneic cell therapies that have properties that overcome the limitations of contemporary cell therapy. Further, the methods of making engineered T cells set forth by the present disclosure provide advantages compared to previous methods in that, among other things, they allow for increased yield, purity, and genetic modification efficiency in the engineered cells.

[0004] Typically, immune rejection of allogeneic cells results from a mismatching of major histocompatibility complex (MHC) molecules between the donor and recipient. Within the human population, MHC molecules exist in various forms, including, e.g., numerous genetic variants of any given human leukocyte antigen (HLA) gene, i.e., alleles, encoding different forms of HLA protein. The primary classes of HLA molecules are referred to as HLA class I and HLA class II. HLA class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) are expressed on all nucleated cells and present antigens to activate cytotoxic T cells (e.g., CD8+ T cells or CTLs). HLA class II molecules (e.g., HLA-DP, HLA-DQ, and HLA- DR in humans) are constitutively expressed on professional antigen presenting cells (APCs) (e.g., B cells, dendritic cells, and macrophages) and present antigens to activate helper T cells (e.g., CD4+ T cells or Th cells), which in turn provide cytokines and signals to orchestrate a stronger immune reaction, such as inducing antibody production from B cells. Other cell types such as T cells can acquire HLA class II expression upon activation and act as nonprofessional APCs. Notably, HLA II expression is regulated by the class II transactivator (CIITA), such that reducing CIITA levels reduces HLA II expression.

[0005] The present disclosure appreciates that slight differences, e.g., mismatches in HLA alleles between individuals, e.g., between a donor and a recipient patient, can cause the T cells in a recipient to become activated. During T cell development, an individual’s T cell repertoire is tolerized to one’s own HLA molecules, but T cells that recognize another individual’s HLA molecules may persist in circulation and are referred to as alloreactive T cells. Alloreactive T cells can become activated, e.g., by the presence of another individual’s cells expressing HLA molecules in the body, causing, e.g., graft versus host disease and transplant rejection.

[0006] The present disclosure also appreciates that the ability to genetically modify a T cell (e.g., to create a CAR T cell) for allogeneic transplantation into a subject, a process that has been hampered by the requirement for multiple gene edits to reduce all HLA protein expression, while at the same time, to avoid other harmful recipient immune responses. For example, while strategies to deplete HLA class I protein may reduce activation of CTLs, cells that lack HLA class I on their surface are susceptible to lysis by natural killer (NK) cells of 2 IPTS / 128687595.1Attorney Docket No. KVN-007WO the immune system because NK cell activation is regulated by HLA class I-specific inhibitory receptors. The present disclosure further recognizes that gene editing strategies to deplete HLA class II molecules have also proven difficult particularly in certain cell types for reasons including low editing efficiencies and low cell survival rates, preventing practical application as a cell therapy.

[0007] The present disclosure sets forth improved methods and compositions for making engineered T cells to overcome the problem of recipient immune rejection and the technical difficulties associated with the multiple genetic modifications required to produce a safer cell for transplant. The present disclosure sets forth methods and compositions for reducing the susceptibility of an engineered T cell to rejection, including, e.g., reducing or eliminating the donor cell’s expression of certain HLA proteins and HLA related proteins (e.g., HLA-A and CIITA), as well as, reducing or eliminating TRAC expression, thereby avoiding deleterious donor T cell responses against host antigens. The present disclosure further provides methods of making an engineered T cell that allow for high gene editing or genetic modification efficiency when targeting HLA-A, CIITA, and TRAC genes, including coding sequences and regulatory elements or sequences thereof, with the goal of reducing or eliminating expression of these genes. The present disclosure also provides a method of inserting with high efficiency an engineered nucleic acid encoding an engineered polypeptide, such as a CAR (e.g., any CAR described herein, including any anti-CD19 CAR described herein), that can be carried out along with genetic modification of HLA-A, CIITA, and TRAC genes, where effiency of HLA-A, CIITA, and TRAC modification is not substantially effected. Provided engineered T cells are particularly suitable for use in CAR T therapy, e.g., anti-CD19 CAR T therapy.

[0008] In some embodiments, the engineered T cells with reduced or eliminated surface expression of HLA-A relative to an unmodified T cell express a complex of an HLA-B and β2-microglobulin on and / or a complex of an HLA-C and β2-microglobulin on the plasma membrane. Such T cells are less sensitive to NK cell cytotoxicity than T cells that have lost all HLA Class I expression (e.g., by deletion of the B2M gene). In some embodiments, the engineered T cells are homozygous for HLA-B and homozygous for HLA-C. The use of T cells that are homozygous for HLA-B and HLA-C, in addition to reducing or eliminating expression of HLA-A in the T cells, reduces the number of different donors that are necessary to provide a series of T cell therapies that cover a majority of recipients in the human population, because only one matching HLA-B allele (as opposed to two) and only one matching HLA-C allele (as opposed to two) are required for any given recipient. The 3 IPTS / 128687595.1Attorney Docket No. KVN-007WO engineered human T cells that have reduced or eliminated surface expression of HLA-A relative to an unmodified cell, disclosed herein, demonstrate persistence and are protected against NK cell-mediated rejection, as compared to engineered T cells with reduced or eliminated B2M expression. Also contemplated are methods and compositions for generating such engineered human T cells with reduced or eliminated surface expression of HLA-A relative to an unmodified T cell, wherein the T cell is homozygous for HLA-B or homozygous for HLA-C. The engineered T cells further have reduced or eliminated expression of HLA class II protein on the surface of the cell by a genetic modification in the CIITA gene. The engineered T cells are further engineered to have reduced or eliminated expression of endogenous T cell receptor proteins by a genetic modification in the TRAC gene, and also comprise an exogenous or engineered nucleic acid, e.g., encoding a polypeptide expressed on the cell surface or a polypeptide that is secreted by the cell (e.g., a CAR polypeptide, such as an anti-CD19 CAR). The present disclosure provides a flexible platform for genetically engineering T cells for desired adoptive cell therapy purposes.

[0009] As described herein, the present disclosure encompasses the recognition that certain challenges exist when genetically modifying multiple genes involved in immune function (e.g., HLA-A, CIITA, and TRAC), in addition to introducing a transgene (e.g., an anti-CD19 CAR) in the case of an engineered CAR T cell. Indeed, carrying out multiple genetic modifications, e.g., via RNA-guided gene editing system (e.g., CRISPR / Cas) and / or lentiviral transduction, in a T cell can result in low efficiency of one or more modifications (e.g., knockout, transgene expression, etc.) cell toxicity or low yield of engineered T cells, and / or undesirable genomic events (e.g., chromosomal translocation). To the contrary, methods of making engineered T cells (e.g., engineered CAR T cells) provided herein allow for, among other things, high efficiency for genetic modifications (e.g., CRISPR / Cas gene editing of HLA-A, CIITA, and TRAC, and lentiviral delivery of a nucleic acid encoding CAR), high viability of engineered T cells, and high purity of engineered T cells.

[0010] The present disclosure provides, in some embodiments, methods of making an engineered CAR T cell using sequential steps of genetic modification, including steps of: (a) genetically modifying an HLA-A gene, (b) transduction of a lentivirus vector comprising a nucleic acid encoding a CAR, (c) genetically modifying a CIITA gene, and (d) genetically modifying a TRAC gene. In some embodiments, the present disclosure provides methods of making an engineered CAR T cell using sequential steps of genetic modification, including steps of: (a) genetically modifying an CIITA gene, (b) transduction of a lentivirus vector comprising a nucleic acid encoding a CAR, (c) genetically modifying an HLA-A gene, and 4 IPTS / 128687595.1Attorney Docket No. KVN-007WO (d) genetically modifying a TRAC gene. In some embodiments, genetic modification of a gene (e.g., HLA-A, CIITA, and / or TRAC) is mediated by a genetic editing system that comprises one or more guide RNAs (e.g., any guide RNA described herein) and an RNA- guided DNA endonuclease (e.g., any Cas protein described herein) or a nucleic acid encoding the RNA-guided DNA endonuclease. In some embodiments, a guide RNA (e.g., a single guide RNA, a crRNA, and / or a tracrRNA) and / or a nucleic acid encoding an RNA-guided DNA endonuclease are delivered to a T cell to be engineered in an LNP formulation (e.g., any LNP formulation described herein). The present disclosure also provides the insight that, as observed in Example 2 below, increasing LNP concentrations or certain CRISPR / Cas gene editing systems correlate with increasing knockout of respective target genes, but when transduction of a certain lentivirus vector follows a first step of a certain LNP-mediated gene editing, increasing LNP concentrations in that previous step correlate with decreased lentiviral transduction efficiency in the following step. Reversely, the lentiviral transduction step also appears to reduce the editing efficiency of the LNP delivered in a following step, and an increased concentration of LNP in this following step improves its editing efficiency. Accordingly, in some embodiments, concentrations of lipids in an LNP formulation are adjusted to maximize knockout efficiency and lentiviral transduction.

[0011] The present disclosure also sets forth the discovery that the editing order for target genes, HLA-A, CIITA, and TRAC, relative to the lentivirus transduction, is critical for knockout efficiency of each target gene. As discussed herein, the T cells not expressing TRAC generally have reduced amount of TCR-CD3 complex on the cell surface. It is understood that in a process that utilizes an anti-CD3-activating agent, TRAC knockout early in the process may reduce T cell survival and proliferation stimulated by the anti-CD3- activating agent. As a result, the T cells deficient in TRAC expression may be outcompeted by other T cells during cell cultivation. Therefore, it is designed herein that the TRAC gene is edited in the last step out of the four genome modification steps. It is discovered that lentivirus transduction is more efficient when conducted on a different day from a gene editing step. It is also preferable to transduce T cells with a lentivirus vector about 24 hours after initiation of anti-CD3 / anti-CD28-mediated T cell activation. Therefore, where T cell activation begins on Day 1, the lentivirus transduction is designed to be conducted on Day 2. In addition, to minimize the risk of chromosomal translocation between edit sites, it is understood that the CIITA editing step and the HLA-A editing step should preferably be separated by at least 48 hours. As such, the lentivirus transduction step is inserted between the CIITA editing step and the HLA-A editing step. In some embodiments, it is advantageous 5 IPTS / 128687595.1Attorney Docket No. KVN-007WO to deliver to a T cell an LNP comprising a genetic editing system targeting HLA-A as a first step, transduce the T cell with a lentiviral vector that delivers a nucleic acid encoding a CAR (e.g., any CAR described herein) as a second step, deliver to the T cell an LNP comprising a genetic editing system targeting CIITA as a third step, and deliver to the T cell an LNP comprising a genetic editing system targeting TRAC as a fourth step. In some embodiments, it is advantageous to deliver to a T cell an LNP comprising a genetic editing system targeting CIITA as a first step, transduce the T cell with a lentiviral vector that delivers a nucleic acid encoding a CAR (e.g., any CAR described herein) as a second step, deliver to the T cell an LNP comprising a genetic editing system targeting HLA-A as a third step, and deliver to the T cell an LNP comprising a genetic editing system targeting TRAC as a fourth step. In some embodiments, methods of the present disclosure include a step of CD3+ cell depletion after sequential genetic modification, to remove the T cells lacking effective TRAC knockout in both alleles.

[0012] The present disclosure provides for a population of engineered T cells, wherein at least 10% of the T cells each comprise: (a) an engineered nucleic acid encoding a chimeric antigen receptor (CAR) that comprises the amino acid sequence of SEQ ID NO: 58; and (b) a genetic modification in a TRAC gene, a genetic modification in a CIITA gene, and a genetic modification in an HLA-A gene, wherein the genetic modifications eliminate or substantially reduce the expression of the respective genes.

[0013] In some embodiments, the genetic modification in the TRAC gene comprises a mutation in the genomic coordinate chr14:22547524-22547544. In some embodiments, a genetic modification in the CIITA gene comprises a mutation in the genomic coordinate chr16:10906853-10906873. In some embodiments, a genetic modification in the HLA-A gene comprises a mutation in the genomic coordinate chr6:29942864-29942884.

[0014] In some embodiments, the nucleic acid encoding the CAR is operably linked to a murine stem cell virus (MSCV) U3 promoter.

[0015] In some embodiments, the population of engineered T cells comprises a CD4+ T cell and a CD8+ T cell.

[0016] In some embodiments, at least 15%, at least 20%, at least 25%, or at least 30% the T cells each comprise (a) and (b) of a provided method.

[0017] The present disclosure provides for a method of engineering a population of T cells, the method comprising steps of: (a) contacting the T cells with a first lipid nanoparticle (LNP) comprising: (i) a guide RNA (gRNA) sequence that is complementary to an HLA-A gene sequence; and (ii) an RNA encoding a first Cas polypeptide; (b) contacting the T cells 6 IPTS / 128687595.1Attorney Docket No. KVN-007WO with a lentivirus vector that comprises a nucleic acid encoding a CAR comprising the amino acid sequence of SEQ ID NO: 58; (c) contacting the T cells with a second LNP comprising: (i) a gRNA sequence that is complementary to a CIITA gene sequence; and (ii) an RNA encoding a second Cas polypeptide; (d) contacting the T cells with a third LNP comprising: (i) a gRNA sequence that is complementary to a TRAC gene sequence; and (ii) an RNA encoding a third Cas polypeptide, wherein the steps are taken in the order of (a) → (b) → (c) → (d) or (c) → (b) → (a) → (d), and in either order, the second step begins 16-32 hours after initiation of the first step, and the third step begins 16-32 hours after initiation of the second step, thereby to produce a population of engineered T cells.

[0018] In some embodiments, the first Cas polypeptide, the second Cas polypeptide, and / or the third Cas polypeptide are Cas9 polypeptides. In some embodiments, the first Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide. In some embodiments, the second Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide. In some embodiments, the third Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide.

[0019] In some embodiments, the HLA-A gRNA comprises the guide sequence of SEQ ID NO: 1. In some embodiments, the HLA-A gRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 3.

[0020] In some embodiments, the CIITA gRNA comprises the guide sequence of SEQ ID NO: 34. In some embodiments, the CIITA gRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 36.

[0021] In some embodiments, the TRAC gRNA sequence comprises the guide sequence of SEQ ID NO: 46. In some embodiments, the TRAC gRNA sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 48.

[0022] In some embodiments, the RNA encoding the first Cas polypeptide, the RNA encoding the second Cas polypeptide, and the RNA encoding the third Cas polypeptide are each a messenger RNA (mRNA).

[0023] In some embodiments, the gRNA and the mRNA in each LNP are at a weight ratio of about 1:1. In some embodiments, the gRNA and the mRNA in each LNP are at a weight ratio of about 1:2.

[0024] In some embodiments, the first LNP, the second LNP, and / or the third LNP are formulated with an amine-to-RNA-phosphate (N:P) ratio of about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6.0, or about 6.5. In some embodiments, the N:P ratio is about 6.0. 7Attorney Docket No. KVN-007WO

[0025] In some embodiments, the first LNP, the second LNP, and / or the third LNP comprise an ionizable lipid with the chemical name ((9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, cholesterol, DSPC, and PEG2k-DMG in a 50:39.5:9:1.5 molar ratio, respectively.

[0026] In some embodiments, in a provided method, the steps are taken in the order of (a) → (b) → (c) → (d). In some embodiments, in a provided method, the steps are taken in the order of (c) → (b) → (a) → (d).

[0027] In some embodiments, the T cells are contacted with the first LNP, the second LNP, and the third LNP at concentrations of 2.5 µg / mL, 5 µg / mL, and 2.5 µg / mL respectively, of total RNA content. In some embodiments, the T cells are contacted with the second LNP, the first LNP, and the third LNP at concentrations of 2.5 µg / mL, 5 µg / mL, and 2.5 µg / mL respectively, of total RNA content.

[0028] In some embodiments, the lentivirus is contacted with the T cells at a multiplicity of infection (MOI) of 10.

[0029] In some embodiments, the nucleic acid encoding the CAR is operably linked to a murine stem cell virus (MSCV) U3 promoter.

[0030] In some embodiments, the population of engineered T cells comprise a CD4+ T cell and a CD8+ T cell.

[0031] In some embodiments, a provided method further comprises a step of: (e) contacting the T cells with one or more agents that activate CD3 and CD28. In some embodiments, the one or more agents that activate CD3 and / or CD28 comprise an anti-CD3 antibody, an anti-CD28 antibody, or both. In some embodiments, step (e) begins 16-32 hours before initiation of step (b).

[0032] In some embodiments, a provided method further comprises steps of: (f) expanding the population of engineered T cells; and (g) depleting CD3+ cells from the expanded population. In some embodiments, a provided method further comprises a step of: (f) depleting CD3+ cells from the population of engineered T cells.

[0033] The present disclosure provides for a population of T cells produced by a method as described herein.

[0034] The present disclosure provides for a pharmaceutical composition comprising a population of T cells as described herein. In some embodiments, the T cells are homozygous for HLA-B and HLA-C. 8 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0035] The present disclosure provides for a method of treating a disease or disorder (e.g., an autoimmune diseases or disorder) in a subject, the method comprising administering a pharmaceutical composition as described herein.

[0036] In some embodiments, the T cells are allogeneic to the subject.

[0037] In some embodiments, the T cells are administered by intravenous infusion. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG.1 is a graph showing the effect of LNP transfection on lentivirus (LV) transduction for different timings of LNP addition and at different MOIs for LV transduction.

[0039] FIGs.2A-2B are graphs showing the effects of LNP transfection on LV transduction (FIG.2A) and of LV transduction on LNP transfection (FIG.2B).

[0040] FIGs.3A-3B are graphs showing the effects of LNP editing order and concentration on the percent knock-out for each target gene (FIG.3A) and the percent triple knock-out, percent CAR expression, and percent of cells with all three knock-outs plus CAR expression (FIG.3B) at the end of production.

[0041] FIG.4 is a series of graphs showing the fold expansion, percent knock-out for each target gene and all three target genes (3KO), and percent CAR expression in cells at the end of production in cells generated under Condition 2B.

[0042] FIGs.5A-5C are graphs showing cytotoxic activity of healthy donor T cells edited with 3 LNPs targeting HLA-A, CIITA and TRAC (3KO) and / or transduced with a Hu19-CD828Z chimeric antigen receptor (CAR) construct against NALM6 (CD19+) cells or control CEM / C1 (CD19-) cells.

[0043] FIGs.6A-6F are graphs showing interferon-gamma (IFNγ) (FIGs.6A-6C) and interleukin-2 (IL-2) (FIGs.6D-6F) release by healthy donor T cells edited with 3 LNPs (3KO) and / or transduced with a Hu19-CD828Z CAR construct following co-culture with NALM6 (CD19+) tumor cells or control CEM / C1 (CD19-) cells.

[0044] FIGs.7A-7C are graphs showing proliferation of LNP edited (3KO) and / or Hu19- CD828Z transduced (CAR) T cells following co-culture with NALM6 (CD19+) tumor cells or control CEM / C1 (CD19-) cells.

[0045] FIGs.8A-8B are graphs showing the in vivo mechanistic activity of LNP edited and Hu19-CD828Z transduced T cells or unedited CAR T cells following adoptive transfer into NSG mice subcutaneously engrafted with NALM6 (CD19+) tumors. FIG.8A shows 9 IPTS / 128687595.1Attorney Docket No. KVN-007WO tumor volume over time following T cell transfer at various doses. FIG.8B shows detection of CAR+T cells in the peripheral blood at various days post-T cell transfer.

[0046] FIGs.9A-9B are graphs showing cytotoxic activity of healthy donor NK cells against allogeneic LNP edited and Hu19-CD828Z transduced T cells (KYV-201), wild-type T cells (WT), LNP edited T cells containing a B2M knock-out in lieu of HLA-A knock-out (B2M KO), or control K562 cells. Percent cytolysis is depicted for a representative host- donor pair at multiple ratios (FIG.9A) and summarized for multiple host-donor pairs normalized to background cytolysis seen against wild-type T cells at a 10:1 ratio (FIG.9B).

[0047] FIGs.10A-10B are graphs showing cytotoxic activity of healthy donor primed and enriched alloreactive T cells against allogeneic LNP edited and Hu19-CD828Z transduced T cells (KYV-201), TRAC knock-out only T cells (TRAC KO), LNP edited T cells containing a B2M knock-out in lieu of HLA-A knock-out (B2M KO), or autologous control T cells. Percent cytolysis of edited T cells is depicted for a representative host-donor pair at multiple ratios (FIG.10A) and summarized for multiple host-donor pairs at a 1:1 ratio (FIG.10B).

[0048] FIG.11 is a graph showing cytotoxic activity of LNP edited and Hu19-CD828Z transduced T cells (KYV-201) or donor-matched wild-type T cells (WT) against allogeneic host B cells in the setting of host total PBMC co-culture with donor T cells for 3 or 6 days at an 8:1 ratio.

[0049] FIG.12 is a schematic of a lentivirus vector encoding an anti-CD19 CAR transgene.

[0050] FIG.13 is a graph showing the total flux of luminescence from mice inoculated with luciferase-expressing leukemia cells and treated with the indicated CAR-T cell therapies. The values are represented as mean ± SEM (n=5 animals per group).

[0051] FIG.14 is a graph showing the percentage of donor CAR-T cells, including KYV-201, unedited CAR T cells, and triple edited CAR T cells lacking the CIITA, TRAC, and B2M genes (“B2M KO CAR T”), surviving after co-culture with allogeneic NK cells at four NK:T cell ratios. The values are represented as Mean ± SEM (n=11 NK:CAR T pairs).

[0052] FIG.15A is a graph showing proliferation of CAR-T cells co-cultured with allogeneic PBMCs, measured as fold expansion calculated based on the final number over the initial number of CAR+T cells plated. FIG.15B is a graph showing cytotoxicity of the CAR-T cells against the B cells in the PBMCs. In each figure, the values are represented as Mean ± SEM (n=9 CAR T:PBMC pairs per condition). Two-way ANOVA followed by 10 IPTS / 128687595.1Attorney Docket No. KVN-007WO Tukey's multiple comparisons test was performed. * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001. n / d: no data.

[0053] FIG.16A is a graph showing fold expansion of KYV-201 cells in an in vitro culture in the presence or absence of IL-2. The values are represented as Mean ± SD of technical duplicates. FIG.16B is a graph showing the percentage of edited or unedited cells containing potential genomic translocations. Each dot represents one independent measurement (n=28). DETAILED DESCRIPTION Definitions

[0054] “About” a number, as used herein, refers to range including the number and ranging from 10% below that number to 10% above that number. “About” a range refers to 10% below the lower limit of the range, spanning to 10% above the upper limit of the range.

[0055] As used herein, the term “antibody” refers to any immunoglobulin, whether naturally occurring or wholly or partially synthetically produced. All derivatives thereof which maintain specific binding ability are also included in the term. In some embodiments, the term “antibody” refers to any protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. Antibody proteins may be derived from natural sources, or partly or wholly synthetically produced. An antibody may be monoclonal or polyclonal. An antibody may be a member of any immunoglobulin class, including any of the human classes: IgG, IgM, IgA, IgD, and IgE. In certain embodiments, an antibody may be a member of the IgG immunoglobulin class.

[0056] As used herein, “derived from” or “derivative” indicates a structural similarity and a functional similarity between a subject molecule and a reference molecule (e.g., between polynucleotides, polypeptides, etc.). With respect to structural similarity, the subject molecule does not necessarily comprise the same sequence (e.g., nucleic acid sequence, amino acid sequence, etc.) as the reference molecule, but has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity to the sequence (e.g., nucleic acid sequence, amino acid sequence, etc.) of the reference molecule or a fragment thereof, the fragment comprising at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of the sequence of the reference molecule. With respect to functional similarity, the subject molecule has at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of an activity of the reference molecule or the fragment thereof as determined in a suitable 11 IPTS / 128687595.1Attorney Docket No. KVN-007WO assay. For example, a subject polypeptide may be considered to be derived from a reference polypeptide when the subject polypeptide has structural similarity, as defined above, to the reference polypeptide and retains certain function(s), such as certain intermolecular or intramolecular interactions (e.g., binding to a protein, e.g., a particular receptor, or a signaling activity), though such interactions could be stronger, equivalent, or weaker than that of the reference polypeptide. As another non-limiting example, a subject polynucleotide may be considered to be derived from a reference polynucleotide when the subject polynucleotide has structural similarity to the reference polynucleotide, as defined above, and encodes a protein or protein fragment that is a derivative of the protein encoded by the reference polynucleotide, or has the same or similar function (e.g., as a regulatory sequence, e.g., promoter or enhancer) as the reference polynucleotide. Functional similarity takes into account the context of the disclosure. For example, when applied to a subject intracellular T cell signaling domain derived from a reference protein (e.g., CD3ζ, CD28), the subject intracellular T cell signaling domain has structural and functional similarities to an intracellular T cell signaling domain of the reference protein as known in the art. Similarly, when applied to a subject transmembrane domains derived from a reference protein, the subject transmembrane domain has structural and functional similarities to a transmembrane domain of the reference protein as known in the art. In one non-limiting example, an intracellular T cell signaling domain derived from a CD3ζ molecule retains sufficient CD3ζ structure such that it has the ability to transduce a signal under appropriate conditions.

[0057] As used herein, the term “functional fragment” of a reference biomolecule, e.g., a polynucleotide or polypeptide, refers to a shorter and / or smaller derivative of the reference biomolecule that has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of a fragment of the reference biomolecule.

[0058] As used herein the term “operably linked” refers to polynucleotide sequences placed into a functional relationship with one another. For instance, a promoter or enhancer is operably linked to a coding sequence if it regulates, or contributes to modulation of, the transcription of a coding sequence. Operably linked DNA sequences encoding regulatory sequences are typically contiguous to a coding sequence. However, enhancers can function when separated from a promoter by up to several kilobases or more. Additionally, multi- cistronic constructs can include multiple coding sequences which use only one promoter by including a 2A self-cleaving peptide, an IRES element, etc. Accordingly, some polynucleotide elements may be operably linked but not contiguous. 12 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0059] As used herein, the term “patient” or “subject” are used interchangeably to refer to any organism to which a compositions disclosed herein may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, a patient or subject is a human. Production of Engineered T Cells

[0060] The present disclosure provides, among other things, engineered T cells, as well as, methods and compositions for making engineered T cells, that are suitable for use in therapy, e.g., adoptive cell transfer (ACT) therapy, such as CAR T therapy. In particular, engineered T cells (e.g., engineered CAR T cells) made by the methods provided herein are useful in allogeneic cell therapy, overcoming many drawbacks associated with allogeneic cell therapy. For example, the provided engineered T cells have diminished susceptibility to recipient rejection, at least in part, due to genetic modification of HLA-A and CIITA genes, such that expression of said genes is reduced or eliminated in the engineered cell. Additionally, the provided engineered T cells have dimished ability to kill recipient cells other than those expressing a specified target (e.g., bound by a CAR expressed by the engineered T cells), at least in part, due to genetic modification of the TRAC gene.

[0061] As described herein, the present disclosure acknowledges that there are certain technical barriers for extensively modifying a T cell for use in cell therapy (e.g., allogeneic CAR T cell therapy). In particular, genetic editing of multiple genes involved in adaptive immune function, e.g., HLA-A, CIITA, and TRAC, in a cell, may result in cell toxicity, low yield, or reduced efficacy of editing of one or more of the genes. Further still, in the case of making engineered CAR T cells, further delivering an engineered nucleic acid encoding a CAR to the cell, e.g., via lentiviral transduction, may exacerbate these negative effects, and / or delivery of the nucleic acid encoding the CAR may be negatively impacted by editing of the genes, e.g., low insertion of the nucleic acid into the cell to be engineered. The present disclosure thus provides for methods of making engineered T cells that overcome these technical barriers by implementing modifications (e.g., genomic editing and / or lentiviral transduction) to a T cell in a sequential order that increases efficiency and lowers toxicity at all steps, among other things.

[0062] The present disclosure provides, in some embodiments, a method of making an engineered T cell, the method comprising delivering to a T cell an LNP comprising a genetic editing system targeting HLA-A as a first step, transducing the T cell with a lentiviral vector 13 IPTS / 128687595.1Attorney Docket No. KVN-007WO that delivers a nucleic acid encoding a CAR (e.g., any CAR described herein) as a second step, delivering to the T cell an LNP comprising a genetic editing system targeting CIITA as a third step, and delivering to the T cell an LNP comprising a genetic editing system targeting TRAC as a fourth step. In some embodiments, the present disclosure provides a method of making an engineered T cell, the method comprising delivering to a T cell an LNP comprising a genetic editing system targeting CIITA as a first step, transducing the T cell with a lentiviral vector that delivers a nucleic acid encoding a CAR (e.g., any CAR described herein) as a second step, delivering to the T cell an LNP comprising a genetic editing system targeting HLA-A as a third step, and delivering to the T cell an LNP comprising a genetic editing system targeting TRAC as a fourth step. In some embodiments, a provided method comprises a step of expanding the T cells after the sequential genetic modification steps. In some embodiments, a provided method comprises a step of CD3+ cell depletion after the sequential genetic modification steps. In some embodiments, a provided method comprises steps of expanding the T cells followed by CD3+ cell depletion after the sequential genetic modification steps. In some embodiments, a CAR is an anti-CD19 CAR as described herein. In some embodiments, the first and second step, the second and third step, and / or the third and fourth step are separated by about 16-32 hours. In some embodiments, each genetic modification step is separated by about 16-32 hours. In some embodiments, the first and second step, the second and third step, and / or the third and fourth step are separated by about 24 hours. In some embodiments, each genetic modification step is separated by about 24 hours. General Methods of Gene Editing Gene Editing Systems

[0063] Any suitable gene editing systems may be used to make an engineered T cells as described herein. In some embodiments, a gene editing system comprises a CRISPR / Cas system, a zinc finger nuclease (ZFN) system, or a transcription activator-like effector nuclease (TALEN) system. In some embodiments, a gene editing system used to make a provided engineered T cell involve the use of an engineered cleavage system to induce a double strand break (DSB) or a nick (e.g., a single strand break, or SSB) in a target DNA sequence. In some embodiments, cleavage or nicking can occur through the use of specific nucleases such as engineered ZFN, TALENs, or using the CRISPR / Cas system with an engineered guide RNA to guide specific cleavage or nicking of a target DNA sequence. Further, targeted nucleases are being developed based on the Argonaute system (e.g., from T. 14 IPTS / 128687595.1Attorney Docket No. KVN-007WO thermophilus, known as ‘TtAgo’, see Swarts et al. (2014) Nature 507(7491): 258-261), which also may have the potential for uses in gene editing in accordance with the present disclosure.

[0064] In some embodiments, the gene editing system is a TALEN system. Transcription activator-like effector nucleases (TALEN) are restriction enzymes that can be engineered to cut specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to a desired DNA sequence, to promote DNA cleavage at specific locations (see, e.g., Boch, 2011, Nature Biotech). The restriction enzymes can be introduced into cells, for use in gene editing or for gene editing in situ, a technique known as gene editing with engineered nucleases. Such methods and compositions for use therein are known in the art. See, e.g., WO2019147805, WO2014040370, and WO2018073393.

[0065] In some embodiments, the gene editing system is a zinc-finger system. Zinc- finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target specific desired DNA sequences to enables zinc-finger nucleases to target unique sequences within complex genomes. The non-specific cleavage domain from the type IIs restriction endonuclease FokI is typically used as the cleavage domain in ZFNs. Cleavage is repaired by endogenous DNA repair machinery, allowing ZFN to precisely alter the genomes of higher organisms. Such methods and compositions for use therein are known in the art. See, e.g., WO2011091324, the contents of which are hereby incorporated in its entirety.

[0066] In some embodiments, the gene editing system is a CRISPR / Cas system, including, e.g., a CRISPR guide RNA comprising a guide sequence and RNA-guided DNA binding agent, and described further herein. Cas Proteins

[0067] In some embodiments, the gene editing systems disclosed herein comprise one or more gRNAs (e.g., any gRNA described herein, e.g., those in Table A) comprising one or more guide sequences from Table A and an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease or protein, such as Cas9 (see, e.g., Table B). In some embodiments, the RNA-guided DNA-binding agent has endonuclease activity. In some embodiments, the endonuclease activity is double-strand endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (e.g., any of those described herein), and modified (e.g., engineered or 15 IPTS / 128687595.1Attorney Docket No. KVN-007WO mutant) versions thereof. See e.g., US2016 / 0312198 A1 and US 2016 / 0312199 A1. Other examples of Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas10, Csm1, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, a Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system. For discussion of various CRISPR systems and Cas nucleases see, e.g., Makarova et al., NAT. REV. MICROBIOL.9:467-477 (2011); Makarova et al., NAT. REV. MICROBIOL, 13: 722-36 (2015); Shmakov et al., MOLECULAR CELL, 60:385- 397 (2015). In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nickase. In some embodiments, the RNA-guided nickase is modified or derived from a Cas protein, such as a Class 2 Cas nuclease (which may be, e.g., a Cas nuclease of Type II, V, or VI). In some embodiments, a Class 2 Cas nuclease comprises a Cas9 protein, a Cpf1 protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, or derivatives or variants thereof.

[0068] Non-limiting exemplary species that the Cas nuclease or the Cas nickase can be derived from include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum 16 IPTS / 128687595.1Attorney Docket No. KVN-007WO lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina.

[0069] In some embodiments, a Cas9 comprises a Streptococcus pyogenes Cas9 (i.e., Spy Cas9). In some embodiments, a Spy Cas9 comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,ID NO: 57. In some embodiments, a Spy Cas9 comprises an amino acid sequence of SEQ ID NO: 57. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity with SEQ ID NO: 55. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence as set forth in SEQ ID NO: 55. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity with SEQ ID NO: 56. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence as set forth in SEQ ID NO: 56. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity with SEQ ID NO: 131. In some embodiments, a nucleic acid encoding a Spy Cas9 comprises a nucleic acid sequence as set forth in SEQ ID NO: 131.

[0070] In some embodiments, the Cas nuclease comprises a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease comprises a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease comprises a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease comprises a Cas9 nuclease is from Staphylococcus aureus. In some embodiments, the Cas nuclease comprises a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease comprises a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease comprises a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In some embodiments, the Cas nuclease comprises a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In some embodiments, the Cas nuclease comprises a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.

[0071] In some embodiments, the Cas nuclease is or is derived from a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is or is derived from a 17 IPTS / 128687595.1Attorney Docket No. KVN-007WO Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is or is derived from a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is or is derived from a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is or is derived from a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is or is derived from a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is or is derived from a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In some embodiments, the Cas nuclease is or is derived from a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In some embodiments, the Cas nuclease is or is derived from a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.

[0072] In some embodiments, the Cas nickase is derived from a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nickase is derived from a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nickase is a nickase form of a Cas9 nuclease from Neisseria meningitidis. See, e.g., WO2020 / 081568, describing an Nme2Cas9 D16A nickase fusion protein. In some embodiments, the Cas nickase is derived from a Cas9 nuclease is from Staphylococcus aureus. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae. In some embodiments, as discussed elsewhere, a nickase may be derived from a nuclease by inactivating one of the two catalytic domains, e.g., by mutating an active site residue essential for nucleolysis, such as D10, H840, of N863 in Spy Cas9. One skilled in the art will be familiar with techniques for easily identifying corresponding residues in other Cas proteins, such as sequence alignment and structural alignment. 18 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0073] In some embodiments, a gRNA is associated with an RNA-guided DNA binding agent to form a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA binding agent is a Cas nuclease or protein (e.g., any Cas nuclease or protein described herein). In some embodiments, a gRNA associated with a Cas nuclease is called a Cas RNP. In some embodiments, an RNP comprises Type-I, Type-II, or Type-III components. In some embodiments, a Cas nuclease is a Cas9 protein from the Type-II CRISPR / Cas system. In some embodiment, a gRNA associated with Cas9 is called a Cas9 RNP.

[0074] Wild type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, a Cas9 protein comprises more than one RuvC domain and / or more than one HNH domain. In some embodiments, a Cas9 protein is a wild type Cas9. In some embodiments, a Cas induces a double strand break in target DNA.

[0075] In some embodiments, a Cas nuclease used in accordance with the present disclosure is a chimeric Cas nuclease. In some embodiments, a chimeric Cas nuclease comprises at least two domains or regions from different Cas nuclease proteins. In some embodiments, a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fok1. In some embodiments, a Cas nuclease may be a modified nuclease.

[0076] In some embodiments, a Cas nuclease or Cas nickase may be from a Type-I CRISPR / Cas system. In some embodiments, a Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR / Cas system. In some embodiments, a Cas nuclease may be a Cas3 protein. In some embodiments, a Cas nuclease may be from a Type-III CRISPR / Cas system. In some embodiments, a Cas nuclease has RNA cleavage activity.

[0077] In some embodiments, an RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a “nick.” In some embodiments, an RNA-guided DNA-binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of a DNA double helix. In some embodiments, a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease described herein) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See e.g., U.S. Pat. No.8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations. In some embodiments, a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.

[0078] In some embodiments, an RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain. In some embodiments, an RNA-guided DNA-binding 19 IPTS / 128687595.1Attorney Docket No. KVN-007WO agent is modified such that one nuclease domain is mutated, or fully or partially deleted, to reduce or inhibit its nucleic acid cleavage activity. In some embodiments, a nickase (e.g., any nickase described herein, e.g., a nickase derived from any RNA-guided DNA-binding agent described herein) used in accordance with the present disclosure comprises a RuvC domain with reduced activity. In some embodiments, a nickase comprises an inactive RuvC domain. In some embodiments, a nickase comprises an HNH domain with reduced activity. In some embodiments, a nickase comprises an inactive HNH domain.

[0079] In some embodiments, a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. In some embodiments, a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3): 759-771. In some embodiments, a Cas nuclease comprises an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB - A0Q7Q2 (CPF1_FRATN)).

[0080] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of gRNAs (e.g., any gRNA described herein) that are complementary to the sense and antisense strands of the target sequence, respectively. In some embodiments, the gRNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking). In some embodiments, use of double nicking may improve specificity and reduce off-target effects. In some embodiments, a nickase is used together with two separate gRNAs targeting opposite strands of DNA to produce a double nick in the target DNA. In some embodiments, a nickase is used together with two separate gRNAs that are selected to be in close proximity to produce a double nick in the target DNA.

[0081] In some embodiments, an RNA-guided DNA-binding agent lacks endonuclease activity of the Cas polypeptide, resulting in a dead Cas (dCas). In some embodiments, an RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. A dCas polypeptide has DNA-binding activity while essentially lacking catalytic (endonuclease) activity. In some embodiments, a dCas polypeptide is a dCas9 polypeptide. In some 20 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, an RNA-guided DNA-binding agent lacking endonuclease activity (e.g., a dCas DNA-binding polypeptide) is derived from a Cas nuclease (e.g., any Cas nuclease described herein) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 2014 / 0186958 A1 and US 2015 / 0166980 A1.

[0082] In some embodiments, an RNA-guided DNA-binding agent as described herein comprises one or more heterologous functional domains. In some embodiments, an RNA- guided DNA-binding agent comprises one or more heterologous functional domains within its sequence (e.g., inserted between two amino acid residues of the RNA-guided DNA- binding agent sequence). In some embodiments, an RNA-guided DNA-binding agent is operably linked (e.g., fused or linked with a linker) to one or more heterologous functional domains. In some embodiments, an RNA-guided DNA binding agent is operably linked at its C-terminus to one or more heterologous functional domains. In some embodiments, an RNA- guided DNA-binding agent is operably linked at its N-terminus to one or more heterologous functional domains. In some embodiments, an RNA-guided DNA-binding agent is operably linked at its C-terminus and N-terminus with at least one heterologous functional domain. In some embodiments, an RNA-guided DNA binding agent is operably linked to one or more heterologous functional domains via a linker. In some embodiments, a linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, a linker is a peptide linker. In some embodiments, a peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids. In some embodiments, a peptide linker is a glycine-serine linker. In some embodiments, a peptide linker comprises one or more glycine residues and one or more serine residues.

[0083] In some embodiments, a heterologous functional domain is or comprises a heterologous nuclease (e.g., Fok1 nuclease). In some embodiments, a heterologous functional domain is or comprises a deaminase. In some embodients, a deaminase comprises a APOBEC3 deaminase. In some embodiments, a APOBEC3 deaminase is an APOBEC3A (A3A), or a variant or derivative thereof. In some embodiments, an A3A is a human A3A, or a variant or derivative thereof.

[0084] In some embodiments, a heterologous functional domain may facilitate transport of an RNA-guided DNA-binding agent into the nucleus of a cell. In some embodiments, a heterologous functional domain is or comprises a nuclear localization signal (NLS). In some embodiments, a heterologous functional domain comprises 1-10 NLS(s). In some 21 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, a heterologous functional domain comprises 1-5 NLS(s). In some embodiments, an NLS is operably linked at the N-terminus or the C-terminus of an RNA- guided DNA binding agent sequence. In some embodiments, an NLS is inserted within an RNA-guided DNA-binding agent sequence. In some embodiments, an RNA-guided DNA- binding agent is operably linked to at least 2, at least 3, at least 4, at least 5, or more NLSs. In some embodiments, an RNA-guided DNA-binding agent is operably linked to three NLSs. In some embodiments, an RNA-guided DNA-binding agent is operably linked to two NLSs. In some embodiments, an RNA-guided DNA-binding agent comprises at least two NLSs that are the same (e.g., 2 SV40 NLSs). In some embodiments, an RNA-guided DNA-binding agent comprises at least 2 NLSs that are different. In some embodiments, an RNA-guided DNA-binding agent is operably linked at its C-terminus to two NLS sequences (e.g., SV40). In some embodiments, an RNA-guided DNA-binding agent is operably linked with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, an NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 127) or PKKKRRV (SEQ ID NO: 128). In some embodiments, an NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 129). In some embodiments, a single PKKKRKV (SEQ ID NO: 130) NLS is operably linked to the C-terminus of an RNA-guided DNA-binding agent. One or more linkers are optionally included at the linkage site. In some embodiments, an RNA-guided DNA-binding agent does not comprise an NLS.

[0085] In some embodiments, a heterologous functional domain may be capable of modifying the intracellular half-life of an RNA-guided DNA binding agent. In some embodiments, an RNA-guided DNA-binding agent comprising a heterologous functional domain has increased stability (e.g., increased half-life) as compared to an RNA-guided DNA-binding agent that does not comprise the heterologous functional domain. In some embodiments, an RNA-guided DNA-binding agent comprising a heterologous functional domain has a reduced stability (e.g., reduced half-life) as compared to an RNA-guided DNA- binding agent that does not comprise the heterologous functional domain. In some embodiments, a heterologous functional domain may act as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, a heterologous functional domain may comprise a PEST sequence. In some embodiments, an RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin- 22 IPTS / 128687595.1Attorney Docket No. KVN-007WO like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin- like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon- stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal-precursor-cell- expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0086] In some embodiments, a heterologous functional domain is or comprises a reporter. In some embodiments, a reporter is a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1 ), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein. In some embodiments, a reporter comprises a luciferase (e.g., Cypridina, Gaussia, Green Renilla, Red Firefly, nanoluciferase, and so forth).

[0087] In some embodiments, a heterologous functional domain is or comprises a purification tag or an epitope tag. Non-limiting exemplary purification tags or epitope tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu- Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin.

[0088] In some embodiments, a heterologous functional domain may target the RNA- guided DNA-binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, a heterologous functional domain may target the RNA-guided DNA-binding agent to mitochondria.

[0089] In some embodiments, a heterologous functional domain is or comprises an effector domain. In some embodiments, when an RNA-guided DNA-binding agent comprising a is directed to its target sequence, e.g., when a Cas nuclease is directed to a 23 IPTS / 128687595.1Attorney Docket No. KVN-007WO target sequence by a gRNA, the effector such as an editor domain may modify or affect the target sequence.

[0090] In some embodiments, an effector domain comprises a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain.

[0091] In some embodiments, an effector domain comprises a nuclease, such as a FokI nuclease, or a variant or derivative thereof. See, e.g., US Pat. No.9,023,649. In some embodiments, an effector domain comprises a transcriptional activator or a transcriptional repressor. See, e.g., Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression,” Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013); Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol.31:833-8 (2013); Gilbert et al., “CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes,” Cell 154:442-51 (2013). As such, an RNA-guided DNA-binding agent comprising a transcriptional activator or transcriptional repressor essentially becomes a transcription factor that can be directed to bind a desired target sequence using a guide RNA. CRISPR Guide RNA

[0092] In some embodiments, methods and compositions of the present disclosure utilize an RNA-guided gene editing system to modify one or more target sequence (e.g., mutation of one or more DNA coding sequences). In some embodiments, an RNA-guided gene editing system is a CRISPR / Cas system. Generally, CRISPR / Cas systems facilitate modification of a target sequence (e.g., a gene) by delivering a CRISPR-associated (Cas) nuclease that complexes with a guide RNA (gRNA), where the gRNA directs the Cas nuclease to the target sequence for modification. In some embodiments, a gRNA is a single guide RNA (sgRNA) comprising (1) a crispr RNA (crRNA) comprising a guide sequence of ~20 nuclotides that is complementary to the target sequence (e.g., of a target gene) and a trans-activating crispr RNA (tracrRNA or trRNA) which serves as a binding scaffold for the Cas nuclease. Thus, one can change the target of the Cas protein by simply changing the guide sequence present in the gRNA.

[0093] In some embodiments, a gRNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.” A dgRNA comprises a first RNA molecule comprising a crRNA comprising a guide sequence (e.g., any guide sequence described herein, see, e.g., Table A) and a tracr mate sequence, and a second RNA molecule comprising a tracrRNA. The first and 24 IPTS / 128687595.1Attorney Docket No. KVN-007WO second RNA molecules may not be covalently linked, but may form an RNA duplex via the base pairing between portions of the crRNA and the tracrRNA.

[0094] In some embodiments, a crRNA and a tracrRNA may be provided as a “single guide RNA” or “sgRNA.” A sgRNA comprises a crRNA comprising a guide sequence (e.g., any guide sequence described herein, see, e.g., Table A) covalently linked to a tracrRNA, e.g., via a phosphodiester bond, one or more bonds that are not a phosphodiester bond., or a linker. A portion of crRNA and tracrRNA sequences, not including the guide sequence, may be referred to as a “scaffold” or “conserved portion” of a sgRNA. In some embodiments, the sgRNA forms a stem-loop structure via the base pairing between portions of the crRNA and the tracrRNA. It is understood that this stem-loop structure may have a shorter length than the corresponding regions in dual guide RNAs, given the stabilization of the sgRNA structure by the covalent linkage. In some embodiments, the sgRNA comprises 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Tables A.

[0095] In some embodiments, a tracrRNA used in accordance with the present disclosure may comprise all or a portion of a tracrRNA sequence derived from a naturally-occurring CRISPR / Cas system. In some embodiments, a tracrRNA comprises a truncated or modified wild type tracrRNA. It will be understood by a person skilled in the art that the length of a tracrRNA depends on the CRISPR / Cas system used. In some embodiments, a tracrRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, a tracrRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.

[0096] In some embodiments, gRNAs of the present disclosure are engineered to recognize (e.g., hybridize to) a target sequence in HLA-A, CIITA, or TRAC genes. In some embodiments, an RNA-guided DNA binding agent, such as a Cas protein, may be directed by a gRNA to a target sequence in HLA-A, CIITA, or TRAC genes, where the guide sequence of the gRNA hybridizes to the target sequence and the RNA-guided DNA binding agent cleaves or nicks the target sequence.

[0097] In some embodiments, the selection of the one or more gRNAs is determined based on target sequences within HLA-A, CIITA, or TRAC. Exemplary gRNAs and corresponding RNA-guided DNA endonucleases for editing the HLA-A gene are disclosed in WO 2022 / 140586. Exemplary gRNAs and corresponding RNA-guided DNA endonucleases for editing the CIITA gene are disclosed in WO 2022 / 140587. Exemplary gRNAs and corresponding RNA-guided DNA endonucleases for editing the TRAC gene are disclosed in 25 IPTS / 128687595.1Attorney Docket No. KVN-007WO WO 2020 / 081613. In some embodiments, a guide sequence is complementary to the genomic region corresponding to HLA-A, CIITA, or TRAC, e.g., genomic regions according to coordinates from human reference genome hg38 as shown in Table A. In some embodiments, a guide sequence is complementary to a target sequence in the close vicinity of the genomic coordinate listed in Table A. For example, a guide sequence of the present disclosure may be complementary to a target sequence that comprises 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table A.

[0098] Without being bound by any particular theory, modifications (e.g., frameshift mutations resulting from indels occurring as a result of a nuclease-mediated DSB) in certain regions of a target sequence (e.g., a gene, such as HLA-A, CIITA, or TRAC) may be less tolerable than mutations in other regions, thus the location of a DSB is an important factor in the amount or type of protein knockdown that may result.

[0099] In some embodiments, the degree of complementarity between a guide sequence of a gRNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, a target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.

[0100] In some embodiments, a guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in a target gene. I. n some embodiments, a guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human HLA-A gene. In some embodiments, a guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human CIITA gene. In some embodiments, a guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human TRAC gene.

[0101] In some embodiment, a guide sequence used in accordance with the present disclosure is complementary to an HLA-A gene sequence. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 1-30. In some embodiments, a guide 26 IPTS / 128687595.1Attorney Docket No. KVN-007WO sequence or gRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-30. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 1. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0102] In some embodiments, a guide sequence used in accordance with the present disclosure is complementary to a CIITA gene sequence. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 31-39. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 31-39. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 34. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 34.

[0103] In some embodiments, a guide sequence used in accordance with the present disclosure is complementary to a TRAC gene. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 40-54. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 40-54. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 46. In some embodiments, a guide sequence or gRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 46.

[0104] In some embodiments, a crRNA sequence used in accordance with the present disclosure comprises a guide sequence (e.g., any guide sequence described herein) and a tracr mate sequence. In some embodiments, a crRNA sequence comprises, from 5’ to 3’: (a) a guide sequence, and (b) a nucleic acid sequence of: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 110).

[0105] In some embodiments, an sgRNA used in accordance with the present disclosure comprises a guide sequence (e.g., any guide sequence described herein) and a scaffold sequence. In some embodiments, an sgRNA comprises, from 5’ to 3’, (a) a guide sequence, and (b) a scaffold sequence comprising a nucleic acid sequence of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 111), or 27 IPTS / 128687595.1Attorney Docket No. KVN-007WO GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 112; which is SEQ ID NO: 111 without the four terminal U’s). In some embodiments, the four terminal U’s of SEQ ID NO: 111 are not present. In some embodiments, only 1, 2, or 3 of the four terminal U’s of SEQ ID NO: 111 are present. In some embodiments, an sgRNA used in accordance with the present disclosure comprises a guide sequence (e.g., any guide sequence described herein, e.g., from Table A) and a scaffold sequence (e.g., any scaffold sequence described herein, e.g., from Table D).

[0106] In some embodiments, an sgRNA comprises, from 5’ to 3’, (a) a guide sequence, and (b) a scaffold sequence comprising a nucleic acid sequence of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GGCACCGAGUCGGUGC (SEQ ID NO: 113). SEQ ID NO: 113 lacks 8 nucleotides with reference to a wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 112).

[0107] Other exemplary scaffold nucleotide sequences are provided in Table D. In some embodiments, an sgRNA comprises, from 5’ to 3’, (a) any one of the guide sequences as set forth in SEQ ID NOs: 1-54, and (b) any guide scaffold sequence provided in Table D, including modified versions of the scaffold sequences, as shown therein.

[0108] In some embodiments, a gRNA of the present disclosure is an sgRNA comprising any one of the nucleic acid sequences shown in Table A and / or Table D. In some embodiments, a gRNA is a chemically modified gRNA. In some embodiments, a gRNA is a chemically modified sgRNA. In some embodiments, a chemically modified gRNA may comprise one or more of sequence modifications as shown in any nucleic acid sequence provided in Table A and / or Table D. In some embodiments, a chemically modified gRNA may comprise one or more sequence modifications as shown in any one of SEQ ID NOs: 115, 117-119, or 121-124.

[0109] In some embodiments, a gRNA is a sgRNA comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-54 with at least one chemical modification (e.g., any chemical modification described herein). In some embodiments, an sgRNA comprises a nucleic acid sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% sequence identity to any one of SEQ ID NOs: 1-54 with at least one chemical modification disclosed herein. 28 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0110] In some embodiments, a gRNA is an sgRNA comprising the modification pattern shown in SEQ ID NOs: 123 or 124. In some embodiments, a gRNA is an sgRNA comprising a nucleic acid sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% sequence identity to any one of SEQ ID NOs: 1-54.

[0111] In some embodiments, a gRNA comprises an sgRNA comprising the modification pattern shown in SEQ ID NO: 115. In some embodiments, a gRNA is an sgRNA comprising the modified nucleotides of SEQ ID NO: 115, including a guide sequence comprising a sequence selected from Table A. In some embodiments, the gRNA is a sgRNA comprising a sequence of SEQ ID NO: 126 or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to SEQ ID NO: 126.

[0112] In some embodiments, the gRNA comprises a sgRNA comprising at least one sequence selected from Table A and / or Table D, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to at least one sequence selected from Table A and / or Table D.

[0113] In some embodiments, the gRNA comprises a guide sequence selected from Table A.

[0114] In some embodiments, a composition comprising one or more gRNAs comprising any guide sequence shown in Table A is provided. In some embodiments, a composition comprising one or more gRNAs comprising any guide sequence shown in Table A is provided, wherein a nucleotide sequence selected from SEQ ID NOs: 110-113 follows the guide sequence at its 3’ end. In some embodiments, the one or more gRNAs comprising any guide sequence shown in Table A, wherein a nucleotide sequence selected from SEQ ID NOs: 110-113 follows the guide sequence at its 3’ end, and is modified according to the modification pattern of any one of SEQ ID NOs: 115, 117-119, and 121-124.

[0115] In some embodiments, a composition comprising one or more gRNAs comprising any guide sequence shown in Table A is provided. In one aspect, a composition comprising one or more gRNAs is provided, comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-54.

[0116] In other embodiments, a composition is provided that comprises at least one gRNA, e.g., at least two, at least three, at least four, etc., comprising guide sequences selected from any two or more of the guide sequences shown in Table A. In some embodiments, the composition comprises at least two gRNAs that each comprise a guide sequence at least 99%, 29 IPTS / 128687595.1Attorney Docket No. KVN-007WO 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the guide sequences shown in Table A.

[0117] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, is provided, used, or administered. Modified gRNAs

[0118] In some embodiments, a gRNA or gRNA sequence (e.g., sgRNA, short-sgRNA, dgRNA, crRNA, or guide sequence) is a modified gRNA or gRNA sequence. The term “modified” or “modification” in the context of a gRNA or gRNA sequence described herein includes any modification described herein, including, for example, (a) end modifications, e.g., 5’ end modifications and / or 3’ end modifications, including 5’ and / or 3’ protective end modifications, (b) nucleobase (or “base”) modifications, including replacement or removal of bases, (c) sugar modifications, including modifications at the 2’, 3’, and / or 4’ positions, (d) internucleoside linkage modifications, and (e) backbone modifications, which can include modification or replacement of the phosphodiester linkages and / or the ribose sugar. A modification of a nucleotide at a given position includes a modification or replacement of the phosphodiester linkage immediately 3’ of the sugar of the nucleotide. Thus, for example, a nucleic acid comprising a phosphorothioate between the first and second sugars from the 5’ end is considered to comprise a modification at position 1. The term “modified gRNA” or “modified guide sequence” generally refers to a gRNA or guide sequence having a modification to the chemical structure of one or more of the base, the sugar, and the phosphodiester linkage or backbone portions, including nucleotide phosphates, all as detailed and exemplified herein. Further description and exemplary patterns of modifications are provided in Table 1 of WO2019 / 237069.

[0119] In some embodiments, a guide sequence or guide region (e.g., of a gRNA) comprises 1, 2, 3, 4, 5, or more YA sites (“guide sequence YA sites”; where Y is a pyrimidine and A is an adjacent adenine, see, e.g., WO2022125968 at FIG.23B). In some embodiments, a guide sequence comprises a modification at 1, 2, 3, 4, 5, or more YA sites. In some embodiments, a guide sequence comprises a modification at one YA site. In some embodiments, a guide sequence comprises a modification at two YA sites. In some embodiments, a guide sequence comprises a modification at three YA sites. In some 30 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, a guide sequence comprises a modification at four YA sites. In some embodiments, a guide sequence comprises a modification at five YA sites.

[0120] In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 5, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 6, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 7, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 8, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 9, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 10, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence. In some embodiments, a guide sequence comprises one or more YA sites located in a region starting at residue 5, 6, 7, 8, 9, or 10, with respect to the 5’ end of the guide sequence, and ending at the 3’ end of the guide sequence, wherein one or more of the YA sites comprises a modification.

[0121] In some embodiments, a modified guide sequence YA site is within 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides of the 3’ end of the guide sequence. For example, if a modified guide sequence YA site is within 10 nucleotides of the 3’ terminal nucleotide of the guide sequence and the guide sequence is 20 nucleotides long, then the modified nucleotide of the modified guide sequence YA site is located at any of positions 11-20. In some embodiments, a modified guide sequence YA site is at or after nucleotide 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’ end of the guide sequence.

[0122] In some embodiments, a modified guide sequence YA site comprises a modification that at least one nucleotide located 5’ of the guide sequence YA site does not comprise. For example, if nucleotides 1-3 comprise phosphorothioates, nucleotide 4 comprises only a 2’-OMe modification, and nucleotide 5 is the pyrimidine of a YA site and comprises a phosphorothioate, then the modified guide sequence YA site comprises a modification (phosphorothioate) that at least one nucleotide located 5’ of the guide sequence YA site (nucleotide 4) does not comprise. In another example, if nucleotides 1-3 comprise 31 IPTS / 128687595.1Attorney Docket No. KVN-007WO phosphorothioates, and nucleotide 4 is the pyrimidine of a YA site and comprises a 2’-OMe, then the modified guide sequence YA site comprises a modification (2’-OMe) that at least one nucleotide located 5’ of the guide sequence YA site (any of nucleotides 1-3) does not comprise. This condition is also always satisfied if an unmodified nucleotide is located 5’ of the modified guide sequence YA site.

[0123] In some embodiments, a gRNA comprises a modification (e.g., any modification described herein) at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, or more YA sites, where Y is a pyrimidine and A is adenine. In some embodiments, a gRNA comprises a modification at one YA site. In some embodiments, a gRNA comprises a modification at two YA sites. In some embodiments, a gRNA comprises a modification at three YA sites. In some embodiments, a gRNA comprises a modification at four YA sites. In some embodiments, a gRNA comprises a modification at five YA sites. In some embodiments, a gRNA comprises a modification at six YA sites. In some embodiments, a gRNA comprises a modification at seven YA sites. In some embodiments, a gRNA comprises a modification at eight YA sites. In some embodiments, a gRNA comprises a modification at nine YA sites. In some embodiments, a gRNA comprises a modification at ten YA sites. In some embodiments, a gRNA comprises a modification at eleven YA sites. In some embodiments, a gRNA comprises a modification at twelve YA sites. In some embodiments, a gRNA comprises a modification at thirteen YA sites. In some embodiments, a gRNA comprises a modification at fourteen YA sites. In some embodiments, a gRNA comprises a modification at fifteen YA sites. In some embodiments, a gRNA comprises a modification at sixteen YA sites.

[0124] In some embodiments, the pyrimidine of a YA site comprises a modification altering the internucleoside linkage immediately 3’ of the sugar of the pyrimidine. In some embodiments, the adenine of a YA site comprises a modification altering the internucleoside linkage immediately 3’ of the sugar of the adenine. In some embodiments, the pyrimidine a YA site comprises a sugar modification, a base modification, an internucleoside linkage modification, or any combination thereof. In some embodiments, the adenine of a YA site comprise a sugar modification, a base modification, an internucleoside linkage modification, or any combination thereof. In some embodiments, the pyrimidine and the adenine of a YA site each comprise a sugar modification, a base modification, an internucleoside linkage modification, or any combination thereof.

[0125] In some embodiments, a YA site comprises a phosporothioate modification, a 2’- OMe modification, a 2’-fluoro modification, or any combination thereof. In some 32 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, the pyrimidine of a YA site comprise at least one of a phosphorothioate modification, a 2’-OMe modification, a 2’-H modification, an inosine modification, or a 2’- fluoro modification

[0126] In some embodiments, a YA site comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) modification. In some embodiments, a YA site comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) modification within an RNA duplex region that contains one or more YA sites.

[0127] In some embodiments, the 5’ and / or 3’ terminus of a guide sequence or a gRNA are modified (e.g., with any modification described herein).

[0128] In some embodiments, at least one of the seven nucleotides at the 3’ terminus region of a gRNA (i.e., the last seven nucleotides of the gRNA sequence) comprises a modification (e.g., any modification described herein). Throughout, this modification may be referred to as a “3’ end modification”. In some embodiments, the 3’ end modification comprises or further comprises any one or more of the following: a modified nucleotide selected from 2’-O-methyl (2’-O-Me) modified nucleotide, 2’-O-(2-methoxyethyl) (2’-O- moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or combinations thereof. In some embodiments, the 3’ end modification comprises or further comprises one PS linkage, wherein the linkage is between the last and second to last nucleotide. In some embodiments, the 3’ end modification comprises or further comprises two PS linkages between the last three nucleotides. In some embodiments, the 3’ end modification comprises or further comprises four PS linkages between the last four nucleotides. In some embodiments, the 3’ end modification comprises or further comprises PS linkages between any one or more of the last 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the gRNA comprising a 3’ end modification comprises or further comprises a 3’ tail, wherein the 3’ tail comprises a modification of any one or more of the nucleotides present in the 3’ tail. In some embodiments, the 3’ tail is fully modified. In some embodiments, the 3’ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotides, optionally where any one or more of these nucleotides are modified. In some embodiments, a gRNA is provided comprising a 3’ protective end modification. In some embodiments, the 3’ tail comprises between 1 and about 20 nucleotides, between 1 and about 15 nucleotides, between 1 and about 10 nucleotides, between 1 and about 5 nucleotides, between 1 and about 4 nucleotides, between 1 and about 3 nucleotides, and between 1 and about 2 nucleotides. In some embodiments, the gRNA does not comprise a 3’ tail. 33 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0129] In some embodiments, at least one of the seven nucleotides at the 5’ terminus region of a gRNA (i.e., the first seven nucleotides of the gRNA sequence) comprises a modification (e.g., any modification described herein). Throughout, this modification may be referred to as a “5’ end modification”. In some embodiments, both the 5’ and 3’ terminus regions (e.g., ends) of the gRNA are modified, e.g., the gRNA comprises both a 5’ end modification and a 3’ end modification. In some embodiments, only the 5’ terminus region of the gRNA is modified. In some embodiments, only the 3’ terminus region (plus or minus a 3’ tail) of the conserved portion of a gRNA is modified. In some embodiments, at least 2, 3, or 4 of the first 4 nucleotides of a gRNA at the 5' terminus region, and / or at least 2, 3, or 4 of the terminal 4 nucleotides of a gRNA at the 3' terminus region are modified. In some embodiments, at least 2, 3, or 4 of the first 4 nucleotides of a gRNA at the 5' terminus region are linked with phosphorothioate (PS) bonds. In some embodiments, the modification to the 5’ terminus and / or 3’ terminus comprises a 2’-O-methyl (2’-O-Me) or 2’-O-(2-methoxyethyl) (2’-O-moe) modification. In some embodiments, the modification comprises a 2’-fluoro (2’- F) modification to a nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) linkage between nucleotides. In some embodiments, the modification comprises an inverted abasic nucleotide. In some embodiments, the modification comprises a protective end modification. In some embodiments, the modification comprises a more than one modification selected from protective end modification, 2’-O-Me, 2’-O-moe, 2’-fluoro (2’-F), a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic nucleotide. In some embodiments, an equivalent modification is encompassed.

[0130] In some embodiments, a gRNA is provided comprising a 5’ end modification and a 3’ end modification. In some embodiments, the gRNA comprises modified nucleotides that are not at the 5’ or 3’ ends.

[0131] In some embodiments, a sgRNA is provided comprising an upper stem modification, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region. In some embodiments, a sgRNA is provided comprising an upper stem modification, wherein the upper stem modification comprises a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region. In some embodiments, an sgRNA is provided comprising an upper stem modification, wherein the upper stem modification comprises 1, 2, 3, 4, or 5 YA modifications in a YA site. In some embodiments, the upper stem modification comprises a 2’-OMe modified nucleotide, a 2’-O-moe modified nucleotide, a 2’-F modified nucleotide, and / or combinations thereof. 34 IPTS / 128687595.1Attorney Docket No. KVN-007WO Other modifications described herein, such as a 5’ end modification and / or a 3’ end modification may be combined with an upper stem modification.

[0132] In some embodiments, the sgRNA comprises a modification in the hairpin region. In some embodiments, the hairpin region modification comprises at least one modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, and / or combinations thereof. In some embodiments, the hairpin region modification is in the hairpin 1 region. In some embodiments, the hairpin region modification is in the hairpin 2 region. Exemplary hairpin 1 (“H1”) and hairpin 2 (“H2”) regions are shown in the “Exemplary spyCas9 sgRNA-1 (SEQ ID NO: 112)” sequence table below. In some embodiments, the hairpin modification comprises 1, 2, or 3 YA modifications in a YA site. In some embodiments, the hairpin modification comprises at least 1, 2, 3, 4, 5, or 6 YA modifications. Other modifications described herein, such as an upper stem modification, a 5’ end modification, and / or a 3’ end modification may be combined with a modification in the hairpin region.

[0133] In some embodiments, a gRNA comprises a substituted and optionally shortened hairpin 1 region, wherein at least one of the following pairs of nucleotides are substituted in the substituted and optionally shortened hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9. “Watson-Crick pairing nucleotides” include any pair capable of forming a Watson-Crick base pair, including A-T, A-U, T-A, U-A, C-G, and G-C pairs, and pairs including modified versions of any of the foregoing nucleotides that have the same base pairing preference. In some embodiments, the hairpin 1 region lacks any one or two of H1-5 through H1-8. In some embodiments, the hairpin 1 region lacks one, two, or three of the following pairs of nucleotides: H1-1 and H1- 12, H1-2 and H1-11, H1-3 and H1-10 and / or H1-4 and H1-9. In some embodiments, the hairpin 1 region lacks 1-8 nucleotides of the hairpin 1 region. In any of the foregoing embodiments, the lacking nucleotides may be such that the one or more nucleotide pairs substituted with Watson-Crick pairing nucleotides (H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9) form a base pair in the gRNA.

[0134] In some embodiments, the gRNA further comprises an upper stem region lacking at least 1 nucleotide, e.g., any of the shortened upper stem regions indicated in Table 7 of WO 2022 / 119275 or described elsewhere herein, which may be combined with any of the shortened or substituted hairpin 1 regions described herein.

[0135] In some embodiments, an sgRNA provided herein is a short-single guide RNAs (short-sgRNAs), e.g., comprising a conserved portion of an sgRNA comprising a hairpin 35 IPTS / 128687595.1Attorney Docket No. KVN-007WO region, wherein the hairpin region lacks at least 5-10 nucleotides or 6-10 nucleotides. In some embodiments, the 5-10 nucleotides or 6-10 nucleotides are consecutive.

[0136] In some embodiments, a short-sgRNA lacks at least nucleotides 54-58 (AAAAA) of the conserved portion of a spyCas9 sgRNA. In some embodiments, a short-sgRNA is a non-spyCas9 sgRNA that lacks nucleotides corresponding to nucleotides 54-58 (AAAAA) of the conserved portion of a spyCas9 as determined, for example, by pairwise or structural alignment.

[0137] In some embodiments, the short-sgRNA described herein comprises a conserved portion comprising a hairpin region, wherein the hairpin region lacks 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides. In some embodiments, the lacking nucleotides are 5-10 lacking nucleotides or 6-10 lacking nucleotides. In some embodiments, the lacking nucleotides are consecutive. In some embodiments, the lacking nucleotides span at least a portion of hairpin 1 and a portion of hairpin 2. In some embodiments, the 5-10 lacking nucleotides comprise or consist of nucleotides 54-58, 54-61, or 53-60 of SEQ ID NO: 112.

[0138] In some embodiments, the short-sgRNA described herein further comprises a nexus region, wherein the nexus region lacks at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in the nexus region). In some embodiments, the short-sgRNA lacks each nucleotide in the nexus region.

[0139] In some embodiments, the SpyCas9 short-sgRNA described herein comprises a sequence of NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA GGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGCU (SEQ ID NO: 114).

[0140] In some embodiments, the short-sgRNA described herein comprises a modification pattern as shown in SEQ ID NO: 115: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmUmGmC*mU (SEQ ID NO: 115), where A, C, G, U, and N are adenine, cytosine, guanine, uracil, and any ribonucleotide, respectively, unless otherwise indicated. An m is indicative of a 2’O-methyl modification, and an * is indicative of a phosphorothioate linkage between the nucleotides.

[0141] In certain embodiments, using SEQ ID NO: 112 (“Exemplary SpyCas9 sgRNA- 1”) as an example, the Exemplary SpyCas9 sgRNA-1 further includes one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 36 IPTS / 128687595.1Attorney Docket No. KVN-007WO 1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks a. any one or two of H1-5 through H1-8, b. one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 6-8 nucleotides, preferably 6 nucleotides; and a. one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112) or b. one or more of positions H1-6 through H1-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112); or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112); or B. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112); or C. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 112) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein 1. the modified nucleotide is optionally selected from a 2’-O-methyl (2’- OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) 37 IPTS / 128687595.1Attorney Docket No. KVN-007WO linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or 2. the modified nucleotide optionally includes a 2’-OMe modified nucleotide.

[0142] In certain embodiments, Exemplary SpyCas9 sgRNA-1, or an sgRNA, such as an sgRNA comprising Exemplary SpyCas9 sgRNA-1, further includes a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’- O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage between nucleotides. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide and a PS linkage between nucleotides.

[0143] In some embodiments, the gRNA described herein further comprises a nexus region, wherein the nexus region lacks at least one nucleotide.

[0144] In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally and / or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens and / or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with “dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (v) replacement or modification of the ribose-phosphate backbone (an exemplary backbone modification); (vi) modification of the 3' end or 5' end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, cap or linker (such 3' or 5' cap modifications may comprise a sugar 38 IPTS / 128687595.1Attorney Docket No. KVN-007WO and / or backbone modification); and (vii) modification or replacement of the sugar (an exemplary sugar modification).

[0145] Chemical modifications such as those listed above can be combined to provide modified gRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In some embodiments, every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all, or substantially all, of the phosphate groups of an gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 5' end of the RNA. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 3' end of the RNA.

[0146] In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in a modified gRNA are modified nucleosides or nucleotides.

[0147] In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the wholesale replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.

[0148] Examples of modified phosphate groups include phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.

[0149] Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates. 39 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0150] The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification. For example, the 2' hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents. In some embodiments, modifications to the 2' hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2'- alkoxide ion. Examples of 2' hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH2CH2O)nCH2CH2OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20. In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2' hydroxyl group with a fluoride. In some embodiments, the 2' hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2' hydroxyl can be connected, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge, to the 4' carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges. In some embodiments, the 2' hydroxyl group modification can included “unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0151] “Deoxy” 2' modifications can include hydrogen (i.e. deoxyribose sugars, e.g., at the overhang portions of partially dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2- amino (wherein amino can be, e.g., as described herein), - NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino as described herein.

[0152] The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form, e.g. L- nucleosides. 40 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0153] The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.

[0154] In embodiments employing a dual guide RNA, each of the crRNA and the tracrRNA can contain modifications. Such modifications may be at one or both ends of the crRNA and / or tracrRNA. In embodiments comprising an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments comprise a 5' end modification. Certain embodiments comprise a 3' end modification. In certain embodiments, one or more or all of the nucleotides in single stranded overhang of a gRNA molecule are deoxynucleotides.

[0155] In some embodiments, the gRNAs disclosed herein comprise one of the modification patterns disclosed in WO2018 / 107028 A1.

[0156] The terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-O-Me. The terms “fA,” “fC,” “fU,” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F. A “*” may be used to depict a PS modification. The terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond. The terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-O-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.

[0157] Exemplary spyCas9 sgRNA-1 (SEQ ID NO: 112)21 22 23 24 25 26 27 28 29 30 U31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 A41 IPTS / 128687595.1Attorney Docket No. KVN-007WO 49 50 51 52 53 54 55 56 57 58 59 60 A C U U G A A A A A G U H1-1 throu h H1-122 73 74 75 76 G G C A C C G A G U C G G U G C H21 h h H215

[0158] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo and may be used for delivery of the gRNAs, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNP compositions deliver nucleic acid, protein, or nucleic acid together with protein.

[0159] In some embodiments, the present disclosure provides a method for delivering any one of the gRNAs disclosed herein to a cell, wherein the one or more gRNAs are formulated as an LNP. In some embodiments, the LNP comprises a gRNA and an RNA (e.g., mRNA) encoding an RNA-guided DNA-binding agent, such as any Cas (e.g., Cas9) polypeptide described herein. In some embodiments, the RNA (e.g., mRNA) further comprises one or more regulatory sequences (e.g., translation initiation site) operably linked to the nucleotide sequence encoding the RNA-guided DNA-binding agent.

[0160] In some embodiments, an LNP formulation used in accordance with the present disclosure comprises an sgRNA:mRNA weight ratio of about 1:2 to 2:1, or about 1:2 to 1:1. In some embodiments, an LNP formulation used in accordance with the present disclosure comprises an sgRNA:mRNA weight ratio of about 1:1, 1:2, or 2:1. In some embodiments, an LNP formulation comprises an sgRNA:mRNA weight ratio of about 1:2.

[0161] In some embodiments, an LNP formulation used in accordance with the present disclosure comprises an sgRNA:mRNA molar ratio of about 10:1 to 80:1 (e.g., about 10:1 to 60:1, about 10:1 to 50:1, about 10:1 to 40:1, about 10:1 to 30:1, about 10:1 to 20:1, about 20:1 to 80:1, about 20:1 to 60:1, about 20:1 to 50:1, about 20:1 to 40:1, about 20:1 to 30:1, about 30:1 to 80:1, about 30:1 to 60:1, about 30:1 to 50:1, about 30:1 to 40:1, about 40:1 to 80:1, about 40:1 to 60:1, about 40:1 to 50:1, about 50:1 to 80:1, about 50:1 to 60:1, or about 60:1 to 80:1). In some embodiments, an LNP formulation used in accordance with the present disclosure comprises an sgRNA:mRNA molar ratio of about 20:1, 40:1, or 80:1. In some embodiments, an LNP formulation comprises an sgRNA:mRNA weight ratio of about 20:1.

[0162] In some embodiments, the present disclosure provides a composition comprising any one of the gRNAs disclosed herein and an LNP. In some embodiments, the composition 42 IPTS / 128687595.1Attorney Docket No. KVN-007WO further comprises an RNA-guided DNA-binding agent or an RNA encoding an RNA-guided DNA-binding agent. In some embodiments, the composition further comprises a Cas protein or an mRNA encoding a Cas protein. In some embodiments, the composition further comprises a Cas9 or an mRNA encoding Cas9.

[0163] In some embodiments, an LNP comprises cationic lipids. In some embodiments, a LNP comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate) or another ionizable lipid. See, e.g., lipids of WO2017 / 173054 and references described therein. In some embodiments, an LNP comprises a molar ratio of cationic lipid amine to RNA phosphate (N:P) of about 3, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, or 6.5. In some embodiments, an LNP comprises an N:P of about 6.0. In some embodiments, the term cationic and ionizable in the context of LNP lipids is interchangeable, e.g., wherein ionizable lipids are cationic depending on the pH.

[0164] In some embodiments, the gRNA compositions described herein, alone or encoded on one or more vectors, are formulated in or administered via an LNP; see e.g., WO 2017 / 173054 and WO 2019 / 067992. Vectors For Gene Editing

[0165] In other embodiments, the gRNAs and / or the sequences encoding an RNA-guided DNA-binding agent disclosed herein are provided in DNA or RNA vectors. In some embodiments, the provided vectors further comprise regulatory sequences, such as promoters and enhancers (e.g., any promoters or enhancers described herein). In some embodiments, a vector comprises a nucleic acid encoding an RNA-guided DNA-binding agent, e.g., any Cas protein described herein, such as Cas9. In some embodiments, a vector comprises one or more nucleotide sequences encoding a crRNA, a tracrRNA, or a crRNA and tracrRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding a sgRNA and an mRNA encoding an RNA-guided DNA-binding agent, which can be any Cas protein described herein, such as Cas9 or Cpf1. In some embodiments, a vector comprises one or more nucleotide sequences encoding a crRNA, a tracrRNA, and an mRNA encoding an RNA-guided DNA-binding agent, which can any Cas protein described herein, such as Cas9. In some embodiments, a Cas9 is from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, a nucleotide sequence encoding a crRNA, tracrRNA, or crRNA and tracrRNA (which may be a sgRNA) comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR / Cas system. 43 IPTS / 128687595.1Attorney Docket No. KVN-007WO Editing Efficacy

[0166] In some embodiments, the efficacy of a gRNA is determined when delivered or expressed together with other components (e.g., an RNA-guided DNA-binding agent) forming an RNP. In some embodiments, the gRNA is expressed together with an RNA- guided DNA-binding agent, such as a Cas protein, e.g., Cas9. In some embodiments, the gRNA is delivered to or expressed in a cell line that already stably expresses an RNA-guided DNA-binding agent, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase. In some embodiments the gRNA is delivered to a cell as part of a RNP. In some embodiments, the gRNA is delivered to a cell along with a mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.

[0167] As described herein, use of an RNA-guided DNA-binding agent and a gRNA disclosed herein can lead to DSBs, SSBs, and / or site-specific binding that results in nucleic acid modification in the DNA or pre-mRNA which can produce errors in the form of insertion / deletion (indel) mutations upon repair by cellular machinery. Many mutations due to indels alter the reading frame, introduce premature stop codons, or induce exon skipping and, therefore, produce a non-functional protein.

[0168] In some embodiments, the efficacy of particular gRNAs is determined based on in vitro models. In some embodiments, the in vitro model is T cell line. In some embodiments, the in vitro model is HEK293 T cells. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is a lymphoblastoid cell line. In some embodiments, the in vitro model is primary human T cells. In some embodiments, the in vitro model is primary human B cells. In some embodiments, the in vitro model is primary human peripheral blood lymphocytes. In some embodiments, the in vitro model is primary human peripheral blood mononuclear cells.

[0169] In some embodiments, the number of off-target sites at which a deletion or insertion occurs in an in vitro model is determined, e.g., by analyzing genomic DNA from the cells transfected in vitro with Cas9 mRNA and the gRNA. In some embodiments, such a determination comprises analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, the gRNA, and a donor oligonucleotide. Exemplary procedures for such determinations are provided in the working examples below.

[0170] In some embodiments, the efficacy of particular gRNAs is determined across multiple in vitro cell models for a gRNA selection process. In some embodiments, a cell line comparison of data with selected gRNAs is performed. In some embodiments, cross screening in multiple cell models is performed. 44 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0171] In some embodiments, the efficacy of a gRNA is evaluated by on target cleavage efficiency. In some embodiments, the efficacy of a gRNA is measured by percent editing at the target location, e.g., HLA-A, CIITA, or TRAC. In some embodiments, deep sequencing may be utilized to identify the presence of modifications (e.g., insertions, deletions) introduced by gene editing. Indel percentage can be calculated from next generation sequencing (NGS).

[0172] In some embodiments, the efficacy of a gRNA is measured by the number and / or frequency of indels at off-target sequences within the genome of the target cell type. In some embodiments, efficacious gRNAs used in accordance with the present disclosure produce indels at off target sites at very low frequencies (e.g., <5%) in a cell population and / or relative to the frequency of indel creation at the target site. Thus, the disclosure provides for gRNAs which do not exhibit off-target indel formation in the target cell type (e.g., T cells or B cells), or which produce a frequency of off-target indel formation of <5% in a cell population and / or relative to the frequency of indel creation at the target site. In some embodiments, the disclosure provides gRNAs which do not exhibit any off target indel formation in the target cell type (e.g., T cells or B cells). In some embodiments, gRNAs produce indels at less than 5 off-target sites, e.g., as evaluated by one or more methods described herein. In some embodiments, gRNAs produce indels at less than or equal to 4, 3, 2, or 1 off-target site(s) e.g., as evaluated by one or more methods described herein. In some embodiments, the off-target site(s) does not occur in a protein coding region in the target cell (e.g., T cells or B cells) genome.

[0173] In some embodiments, linear amplification is used to detect gene editing events, such as the formation of insertion / deletion (“indel”) mutations, translocations, and homology directed repair (HDR) events in target DNA. For example, linear amplification with a unique sequence-tagged primer and isolating the tagged amplification products (herein after referred to as “UnIT,” or “Unique Identifier Tagmentation” method) may be used.

[0174] In some embodiments, the efficacy of a gRNA is measured by the number of chromosomal rearrangements within the target cell type. Kromatid dGH assay may used to detect chromosomal rearrangements, including e.g., translocations, reciprocal translocations, translocations to off-target chromosomes, deletions (i.e., chromosomal rearrangements where fragments were lost during the cell replication cycle due to the editing event). In some embodiments, the target cell type has less than 10, less than 8, less than 5, less than 4, less than 3, less than 2, or less than 1 chromosomal rearrangement. In some embodiments, the target cell type has no chromosomal rearrangements. 45 IPTS / 128687595.1Attorney Docket No. KVN-007WO Chimeric Antigen Receptors

[0175] In some embodiments, an engineered T cell of the present disclosure comprises an engineered nucleic acid encoding an engineered polypeptide. In some embodiments, an engineered polypeptide is a chimeric antigen receptor (CAR) (e.g., any CAR described herein). In some embodiments, a chimeric antigen receptor (CAR) of the present disclosure comprises an extracellular domain, a transmembrane domain, and an intracellular domain. In some embodiments, an extracellular domain is or comprises an antigen-binding domain (e.g., a CD19 binding domain, such as an anti-CD19 scFv). In some embodiments, the extracellular domain is or comprises a means for binding CD19. In some embodiments, a transmembrane domain is or comprises a transmembrane domain or functional fragment thereof derived from any suitable cell membrane-associated polypeptide, e.g., obtained from a membrane-binding polypeptide or transmembrane polypeptide. In some embodiments, a transmembrane domain is or comprises a transmembrane domain or functional fragment thereof derived from a T cell receptor alpha chain, a T cell receptor beta chain, a CD3 zeta chain, a CD28 polypeptide, or a CD8 polypeptide (e.g., a CD8α polypeptide). In some embodiments, an intracellular domain is or comprises an intracellular signaling domain (e.g., any of intracellular signaling domains described herein, e.g., derived from a CD28 or CD3 polypeptide). In some embodiments, an intracellular signaling domain comprises one or more signaling sequences or motifs. In some embodiments, one or more signaling sequences, or signaling motifs, are essential for the functional signaling capacity of a polypeptide (e.g., an intracellular signaling domain). In some embodiments, a signaling sequence is a sequence derived from a CD3 polypeptide (e.g., a CD3 zeta polypeptide). In some embodiments, a signaling sequence is derived from a CD28 polypeptide. In some embodiments, a signaling sequence is or comprises a co-stimulatory domain (e.g., any co-stimulatory domain described herein, e.g., derived from a CD28 polypeptide). In some embodiments, a CAR of the present disclosure is a human CAR. Extracellular Domain

[0176] In some embodiments, an extracellular domain used in accordance with the present disclosure comprises an antigen-binding domain (e.g., any antigen-binding domain described herein). The extracellular domain can be or include a means for binding CD19 (e.g., human CD19). In some embodiments, an antigen-binding domain is or comprises an antibody sequence (e.g., an immunoglobulin) or antigen-binding fragment thereof (e.g., any 46 IPTS / 128687595.1Attorney Docket No. KVN-007WO antibody or antigen-binding fragment thereof described herein). Anticalins or other alternative scaffolds are also contemplated.

[0177] In some embodiments, the antigen-binding domain comprises one or more Fab, Fab’, F(ab’)2, Fv, domain antibody (dAb), single-chain antibody (scFv), chimeric antibody, diabody, triabody, tetrabody, scAb, or single domain antibody (e.g., VHH or VNAR) polypeptide sequences. In some embodiments, the antigen-binding domain comprises at least a portion of an immunoglobulin that is sufficient to confer specific antigen-binding to a polypeptide (e.g., an antibody fragment comprising an antigen-binding portion). In some embodiments, the antigen-binding domain comprises an scFv. In some embodiments, the scFv comprises a VH and VL domain of an antibody. In some embodiments, the scFv comprises a spacer sequence between the VH and the VL. In some embodiments, the scFv comprises a spacer sequence as set forth in SEQ ID NO: 68 between the VH and the VL. In some embodiments, the antigen-binding domain is humanized, or fully human (e.g., derived from a suitable human polypeptide). Exemplary methods of generating fully human antibodies are described in Lu et al., (2020) J. Biomed. Sci. (2020) 27(1):1.

[0178] In some embodiments, the antigen-binding domain binds to a target antigen (e.g., a polypeptide). In some embodiments, the antigen-binding domain binds specifically to a target antigen (e.g., a polypeptide). In some embodiments, the antigen-binding domain binds to a CD19 polypeptide (e.g., a CD19 polypeptide present at the surface of a cell, e.g., a B cell). In some embodiments, the antigen-binding domain binds specifically to a CD19 polypeptide. In some embodiments, the antigen-binding domain comprises an antibody, or antigen-binding fragment thereof, that binds to a CD19 polypeptide. In some embodiments, the antigen-binding domain comprises a scFv sequence that binds to a CD19 polypeptide (e.g., an anti-CD19 scFv).

[0179] It is generally understood that CD19 expression is largely restricted to B lymphocytes. CD19 has two N-terminal extracellular Ig-like domains separated by a non-Ig- like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. The CD19 protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signaling pathway and the subsequent release of intracellular stores of calcium ions. An example of a human CD19 polypeptide sequence includes, without limitation, NCBI reference sequence: NP_001171569.1, and fragments and derivatives thereof. 47 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0180] In some embodiments, an antigen-binding domain comprises a variable region of an anti-CD19 antibody. In some embodiments, an antigen-binding domain comprises a variable region of an anti-CD19 monoclonal antibody. In some embodiments, an antigen- binding domain comprises a variable region of a mouse or human anti-CD19 monoclonal antibody. An anti-CD19 monoclonal antibody can be obtained or derived from a subject (e.g., a mouse, a rat, a rabbit, a human, etc.) using any suitable method. In some embodiments, an antigen-binding domain comprises a light chain variable region and a heavy chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. In some embodiments, an antigen-binding domain comprises a light chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. In some embodiments, an antigen- binding domain comprises a heavy chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. The 47G4 antibody (described in U.S. Patent Application Publication No.2010 / 0104509) is one example of a human anti-CD19 monoclonal antibody that can be used in accordance with the present disclosure.

[0181] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively.

[0182] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 82, SEQ ID NO: 83, and SEQ ID NO: 62, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino 48 IPTS / 128687595.1Attorney Docket No. KVN-007WO acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 82, SEQ ID NO: 83, and SEQ ID NO: 62, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively.

[0183] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62, respectively. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62, respectively.

[0184] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 82, SEQ ID NO: 83, and SEQ ID NO: 62, respectively. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 82, SEQ ID NO: 83, and SEQ ID NO: 62, respectively.

[0185] In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, respectively.

[0186] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable 49 IPTS / 128687595.1Attorney Docket No. KVN-007WO domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 66, and the light chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66, and the light chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 66, and the light chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 66, and the light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 67.

[0187] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 66. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 66. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 66.

[0188] In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to 50 IPTS / 128687595.1Attorney Docket No. KVN-007WO SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 67. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 67.

[0189] In some embodiments, the antigen-binding domain that binds CD19 comprises a spacer sequence between two domains or components. In some embodiments, an antigen- biding domain comprises a spacer sequence between a heavy chain variable domain and a light chain variable domain. In some embodiments, a spacer comprises a sequence as set forth in SEQ ID NO: 68.

[0190] In some embodiments, the antigen-binding domain that binds CD19 comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 74. In some embodiments, the antigen-binding domain that binds CD19 comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 74. In some embodiments, the antigen-binding domain that binds CD19 comprises an amino acid sequence as set forth in SEQ ID NO: 74.

[0191] In some embodiments, the antigen-binding domain that binds CD19 is encoded by a nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 75. In some embodiments, the antigen-binding domain that binds CD19 is encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, an antigen-binding domain is encoded a nucleic acid sequence as set forth in SEQ ID NO: 75.

[0192] Other antigen-binding domains that bind CD19 can also be included in the CAR disclosed herein. Exemplary antigen-binding domains are described in International Application Publication No. WO2017062952 and U.S. Application Publication No. US20220220200.

[0193] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID 51 IPTS / 128687595.1Attorney Docket No. KVN-007WO NOs: 92, 93, and 94, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 95, 96, and 97, respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 86, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 87.

[0194] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 98, 99, and 100, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 101, 102, and 103, respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 88, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 89.

[0195] In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 104, 105, and 106, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 107, 108, and 109, respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 90, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 91.

[0196] In some embodiments, the extracellular domain of the CAR further comprises a hinge region. In some embodiments, a hinge region is positioned between (e.g., links together), an extracellular domain and a transmembrane domain. In some embodiments, the hinge region is a short sequence of amino acids that can facilitate structural flexibility 52 IPTS / 128687595.1Attorney Docket No. KVN-007WO between polypeptide domains, e.g., between an extracellular domain and a transmembrane domain (see, e.g. Woof et al., Nat. Rev. Immunol.4(2):89-99 (2004)). In some embodiments, a hinge region may include all, or a portion of, an extracellular region of any suitable transmembrane protein (e.g., CD8α).

[0197] In some embodiments, the hinge region is derived from a CD8α protein or a CD28 protein. In some embodiments, a hinge region is derived from a CD8α protein. In some embodiments, the hinge region is derived from a CD28 protein. In some embodiments, a hinge region is or comprises a hinge region or functional fragment thereof from a CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a CD8α protein. In some embodiments, the hinge region is derived from a human CD8α protein or a human CD28 protein. In some embodiments, the hinge region is derived from a human CD8α protein. In some embodiments, the hinge region is derived from a human CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a human CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a human CD8α protein.

[0198] In some embodiments, a hinge region comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 85. In some embodiments, a hinge region comprises an amino acid sequence as set forth in SEQ ID NO: 85.

[0199] In some embodiments, a hinge region is derived from the same polypeptide as a transmembrane domain. In some embodiments, a hinge region and a transmembrane domain are derived from a CD8 polypeptide. In some embodiments, a hinge region and a transmembrane domain are derived from a CD8α polypeptide. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 76. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 76. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence as set forth in SEQ ID NO: 76.

[0200] In some embodiments, a hinge region and transmembrane domain are encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 53 IPTS / 128687595.1Attorney Docket No. KVN-007WO 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 77. In some embodiments, a hinge region and transmembrane domain are encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 77. In some embodiments, a hinge region and transmembrane domain are encoded by a nucleic acid sequence as set forth in SEQ ID NO: 77. Transmembrane Domain

[0201] In some embodiments, the transmembrane domain of the CAR is derived from a natural source (e.g., a natural or wild-type polypeptide). In some embodiments, the transmembrane domain, as used in accordance with the present disclosure, is derived from any suitable transmembrane protein or polypeptide known in the art. In some embodiments, a transmembrane domain is derived from a CD3 epsilon polypeptide, a CD4 polypeptide, a CD5 polypeptide, a CD8 polypeptide, a CD9 polypeptide, a CD16 polypeptide, a CD22 polypeptide, a CD28 polypeptide, a CD33 polypeptide, a CD37 polypeptide, a CD45 polypeptide, a CD64 polypeptide, a CD80 polypeptide, a CD86 polypeptide, a CD134 polypeptide, a CD137 polypeptide, a CD154 polypeptide, a T cell receptor alpha chain polypeptide, a T cell receptor beta chain polypeptide, a T cell receptor zeta chain polypeptide, or any combination thereof. In some embodiments, a transmembrane is or comprises a transmembrane domain or functional fragment thereof from a CD3 epsilon polypeptide, a CD4 polypeptide, a CD5 polypeptide, a CD8 polypeptide, a CD9 polypeptide, a CD16 polypeptide, a CD22 polypeptide, a CD28 polypeptide, a CD33 polypeptide, a CD37 polypeptide, a CD45 polypeptide, a CD64 polypeptide, a CD80 polypeptide, a CD86 polypeptide, a CD134 polypeptide, a CD137 polypeptide, a CD154 polypeptide, a T cell receptor alpha chain polypeptide, a T cell receptor beta chain polypeptide, a T cell receptor zeta chain polypeptide, or any derivatives thereof and / or any combination thereof. In some embodiments, a transmembrane is synthetically derived, or engineered. In some embodiments, a synthetically derived or engineered transmembrane domain comprises predominantly hydrophobic residues (e.g., leucine, valine, etc.). In some embodiments, an engineered transmembrane domain is or comprises any engineered transmembrane domain known in the field.

[0202] The present disclosure appreciates that CD8 is a transmembrane glycoprotein that functions as a co-receptor for the T-cell receptor (TCR), and is expressed primarily on the surface of T-cells (e.g., cytotoxic T-cells). The most common form of CD8 exists as a dimer composed of a CD8α and CD8β chain. In some embodiments, a transmembrane domain is derived from a CD8α protein. In some embodiments, a transmembrane protein comprises an 54 IPTS / 128687595.1Attorney Docket No. KVN-007WO amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 70. In some embodiments, a transmembrane protein comprises an amino acid sequence as set forth in SEQ ID NO: 70.

[0203] The present disclosure further appreciates that CD28 is expressed on T-cells and provides co-stimulatory signals required for T-cell activation. CD28 is the receptor for CD80 (B7.1) and CD86 (B7.2). In some embodiments, a CAR of the present disclosure comprises a CD28 transmembrane domain. In some embodiments, the transmembrane protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 71. In some embodiments, a transmembrane protein comprises an amino acid sequence as set forth in SEQ ID NO: 71. Intracellular Signaling Domain

[0204] In some embodiments, an intracellular signaling domain of the CAR disclosed herein is derived from a polypeptide found in humans (e.g., an intracellular signaling domain or fragment thereof found in any suitable human polypeptide). In some embodiments, the intracellular signaling domain provided herein is derived from a 4-1BB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcεRI polypeptide (e.g., an FcεRI gamma chain polypeptide), an FcγRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, OX40 polypeptide, PD-1 polypeptide, or any derivatives thereof or any combination thereof. In some embodiments, the intracellular signaling domain is derived from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain is derived from a CD28 polypeptide. In some embodiments, the intracellular signaling domain is derived from a CD28 polypeptide and a CD3 zeta polypeptide.

[0205] In some embodiments, the intracellular signaling domain comprises at least one intracellular signaling domain or functional fragment thereof from a 4-1BB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcεRI polypeptide (e.g., an FcεRI gamma chain polypeptide), an FcγRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, OX40 polypeptide, PD-1 polypeptide, or any derivatives thereof or any combination thereof. In some embodiments, the intracellular signaling domain comprises an intracellular signaling 55 IPTS / 128687595.1Attorney Docket No. KVN-007WO domain or functional fragment thereof from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide and an intracellular signaling domain or functional fragment thereof from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises, from N-terminus to C-terminus, an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide and an intracellular signaling domain or functional fragment thereof from a CD3 zeta polypeptide.

[0206] In some embodiments, the intracellular signaling domain of the present disclosure comprises at least one signaling sequence from a 4-1BB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcεRI polypeptide (e.g., an FcεRI gamma chain polypeptide), an FcγRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, OX40 polypeptide, PD-1 polypeptide, or any combination thereof. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD28 polypeptide. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD28 polypeptide and at least one signaling sequence from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises, from N-terminus to C-terminus, at least one signaling sequence from a CD28 polypeptide and at least one signaling sequence from a CD3 zeta polypeptide.

[0207] In some embodiments, an intracellular signaling domain is or comprises at least one signaling sequence or signaling motif. In some embodiments, a signaling sequence (or signaling motif) comprises one or more (e.g., two, three, four, five, or more) co-stimulatory domains (e.g., any co-stimulatory domain described herein). In some embodiments, a signaling sequence comprises one co-stimulatory domain. In some embodiments, a signaling sequence comprises two co-stimulatory domains. In some embodiments, a signaling sequence comprises three co-stimulatory domains. In some embodiments, a signaling sequence comprises two or more of the same co-stimulatory domains. In some embodiments, a signaling sequence comprises two or more different co-stimulatory domains. 56 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0208] In some embodiments, a signaling sequence as used in accordance with the present disclosure is or comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs). In some embodiments, a signal sequence is or comprises a consensus sequence of YXXL / I, where Y is a tyrosine residue, L / I is a leucine or isoleucine residue, and X is any amino acid residue. In some embodiments, a signal sequence is or comprises a consensus sequences of YXXL / IX(6-8)YXXL, where Y is a tyrosine residue, L / I is a leucine or isoleucine residue, and X is any amino acid residue. In some embodiments, a signaling sequence comprises a YNMN motif. In some embodiments, a signaling sequence comprises at least one ITAM sequence from a CD3 polypeptide (e.g., a CD3 zeta polypeptide). In some embodiments, a signaling sequence comprises at least one ITAM sequence from a CD28 polypeptide.

[0209] It is understood that the most common intracellular signaling domain used in CAR therapies is an intracellular signaling domain of CD3 zeta (CD3ζ). CD3 zeta associates with T cell receptors to produce a signal and contains ITAMs. In some embodiments, an intracellular signaling domain is or comprises a CD3 zeta intracellular signaling domain. In some embodiments, an intracellular signaling domain comprises an intracellular signaling domain or a functional fragment thereof from a CD3 zeta polypeptide.

[0210] In some embodiments, an intracellular signaling domain comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 80. In some embodiments, an intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 80.

[0211] In some embodiments, an intracellular signaling domain is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 81. In some embodiments, an intracellular signaling domain is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 81.

[0212] In some embodiments, an intracellular signaling domain comprises a CD28 intracellular signaling domain. In some embodiments, an intracellular signaling domain comprises an intracellular signaling domain or a functional fragment thereof from a CD28 polypeptide. In some embodiments, a CD28 polypeptide intracellular signaling domain or functional fragment thereof comprises a co-stimulatory domain.

[0213] In some embodiments, an intracellular signaling domain disclosed herein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 57 IPTS / 128687595.1Attorney Docket No. KVN-007WO 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 78. In some embodiments, the intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 78.

[0214] In some embodiments, an intracellular signaling domain is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 79. In some embodiments, an intracellular signaling domain is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 79. Chimeric Antigen Receptors (CARs)

[0215] In some embodiments, a CAR of the present disclosure comprises an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises a signal peptide sequence (also referred to as a targeting signal, localization signal, localization sequence, leader sequence, or leader peptide), an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises, from N-terminus to C-terminus, an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises, from N-terminus to C-terminus, a signal peptide sequence, an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the signal peptide sequence is cleaved from the CAR during or after its insertion into a membrane (e.g., ER membrane) during synthesis of the CAR protein. In some embodiments, domains or components (e.g., extracellular domains, hinge regions, transmembrane domains, intracellular signaling domains, etc.) of a CAR are directly linked, or are contiguous. In some embodiments, domains or components of a CAR are not-directly linked, or are non-contiguous.

[0216] In some embodiments, a CAR as described herein comprises an intracellular signaling domain, wherein the intracellular signaling domain comprises: (a) a CD3 zeta intracellular signaling domain or functional fragment thereof; and (b) at least one of a 4-1BB, an OX40, or a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a 4-1BB intracellular signaling domain or functional fragment thereof, an OX40 intracellular signaling domain, and / or a CD28 intracellular signaling domain or functional fragment thereof is or comprises a co-stimulatory domain.

[0217] In some embodiments, a CAR of the present disclosure comprises: (a) a CD28 transmembrane domain; and (b) an intracellular signaling domain comprising: (i) a CD3ζ 58 IPTS / 128687595.1Attorney Docket No. KVN-007WO intracellular signaling domain or functional fragment thereof; and (ii) a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co-stimulatory domain.

[0218] In some embodiments, a CAR of the present disclosure comprises: (a) a CD8α transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a CD28, an FcεRI gamma chain, and / or a 4-1BB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8α transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a CD28, an FcεRI gamma chain, and a 4-1BB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8α transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) an FcεRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8α transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a 4-1BB intracellular signaling domain or functional fragment thereof. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co-stimulatory domain. In some embodiments, a FcεRI intracellular signaling domain or functional fragment thereof is or comprises a FcεRI co-stimulatory domain. In some embodiments, a 4-1BB intracellular signaling domain or functional fragment thereof is or comprises a 4-1BB co-stimulatory domain.

[0219] In some embodiments, a CAR of the present disclosure comprises (a) a CD8α transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof, and (ii) a CD27 and / or a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a CD27 intracellular signaling domain or functional fragment thereof is or comprises a CD27 co- stimulatory domain. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co-stimulatory domain.

[0220] In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a CD27, a 4-1BB, 59 IPTS / 128687595.1Attorney Docket No. KVN-007WO and / or an FcεRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a CD27, a 4-1BB, and an FcεRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a CD27 intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) a 4-1BB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3ζ intracellular signaling domain or functional fragment thereof; and (ii) an FcεRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CD27 intracellular signaling domain or functional fragment thereof is or comprises a CD27 co-stimulatory domain. In some embodiments, a FcεRI intracellular signaling domain or functional fragment thereof is or comprises a FcεRI co-stimulatory domain. In some embodiments, a 4-1BB intracellular signaling domain or functional fragment thereof is or comprises a 4-1BB co-stimulatory domain.

[0221] The present disclosure also includes functional variants of any of CAR, or CAR domain / component, described herein. CAR functional variants encompass, for example, variants of a CAR described herein (a parent CAR) that retains the ability to recognize a particular target cell to a similar extent, the same extent, or to a higher extent, as the parent CAR. In reference to a nucleic acid sequence encoding a parent CAR, a nucleic acid sequence encoding a functional variant of the CAR can be for example, about 10% identical, about 25% identical, about 30% identical, about 50% identical, about 65% identical, about 80% identical, about 90% identical, about 95% identical, or about 99% identical to the nucleic acid sequence encoding the parent CAR. In some embodiments, a parent CAR comprises an amino acid sequence as set forth in SEQ ID NO: 69 or 58. Alternatively or additionally, in some embodiments, a CAR functional variant comprises the amino acid sequence of a parent CAR with at least one non-conservative amino acid substitution. In some embodiments, a non-conservative amino acid substitution does not compromise or 60 IPTS / 128687595.1Attorney Docket No. KVN-007WO inhibit a biological activity of a CAR functional variant. In some embodiments, a non- conservative amino acid substitution may enhance a biological activity of a CAR functional variant, such that biological activity of the functional variant is increased relative to its parent CAR.

[0222] The present disclosure further provides for CARs comprising an extracellular domain directed to any target molecule of interest (e.g., comprising any of known antigen- binding domain, e.g., antibody, scFv, etc.), and further comprising any transmembrane domain described herein (including any hinge domain described herein), any intracellular signaling domain described herein (including any signal sequences or motifs, any co- stimulatory domains, etc., described herein), present in any combination.

[0223] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8α polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3ζ intracellular signaling domain or fragment thereof; and (ii) a human CD28 intracellular signaling domain or fragment thereof, wherein the CD28 intracellular signaling domain or fragment thereof is or comprises a co-stimulatory domain. In some embodiments, a CAR comprises: (a) a hinge region derived from a human CD8α polypeptide, (b) a transmembrane domain derived from a human CD8α polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3ζ intracellular signaling domain; and (ii) a human CD28 intracellular signaling domain. In some embodiments, a CAR comprises a sequence as set forth in SEQ ID NO: 84.

[0224] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8α polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3ζ intracellular signaling domain or fragment thereof; and (ii) a CD27 and / or a CD28 intracellular signaling domain or fragment thereof, wherein the CD27 and / or CD28 intracellular signaling domain or fragment thereof is or comprises a co- stimulatory domain.

[0225] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8α polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3ζ intracellular signaling domain or fragment thereof; and (ii) a human CD28, a human CD27, and / or an FcεRI gamma chain intracellular signaling domain or fragment thereof, wherein the human CD28, the human CD27, and / or the FcεRI gamma chain intracellular signaling domain or fragment thereof are or comprise a co-stimulatory domain. 61 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0226] In some embodiments, a CAR can comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8α polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3ζ intracellular signaling domain; and (ii) a human CD28 and / or an FcεRI gamma chain intracellular signaling domain, wherein the CD28 and / or the FcεRI gamma chain intracellular signaling domain or fragment thereof are or comprise a co-stimulatory domain.

[0227] In some embodiments, a CAR as described herein, further comprises a signal peptide sequence. In some embodiments, a signal peptide is positioned at the amino terminus of an extracellular domain (e.g., at the N-terminus of an antigen-binding domain). A signal peptide as used in accordance with the present disclosure may comprise any suitable signal peptide sequence. In some embodiments, a signal peptide sequence is a human granulocyte macrophage colony-stimulating factor (GM-CSF) receptor signal peptide sequence or a CD8α signal peptide sequence. In some embodiments, a CAR comprises a human scFv comprising a CD8α signal peptide sequence. In some embodiments, a signal peptide sequence comprises an amino acid sequence as set forth in SEQ ID NO: 72.

[0228] In some embodiments, a CAR comprises: (a) a CD8α hinge region comprising SEQ ID NO: 85, (b) a CD8α transmembrane domain comprising SEQ ID NO: 70, (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 78, and (d) a CD3ζ intracellular signaling domain comprising SEQ ID NO: 80. In some embodiments, a CAR comprises, from N-terminus to C-terminus: (a) a CD8α hinge region comprising SEQ ID NO: 85, (b) a CD8α transmembrane domain comprising SEQ ID NO: 70, (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 78, and (d) a CD3ζ intracellular signaling domain comprising SEQ ID NO: 80.

[0229] In some embodiments, a CAR comprises: (a) an antigen-binding domain comprising SEQ ID NO: 74, (b) a CD8α hinge region comprising SEQ ID NO: 85, (c) a CD8α transmembrane domain comprising SEQ ID NO: 70, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 78, and (e) a CD3ζ intracellular signaling domain comprising SEQ ID NO: 80. In some embodiments, a CAR comprises, from N-terminus to C- terminus: (a) an antigen-binding domain comprising SEQ ID NO: 74, (b) a CD8α hinge region comprising SEQ ID NO: 85, (c) a CD8α transmembrane domain comprising SEQ ID NO: 70, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 78, and (e) a CD3ζ intracellular signaling domain comprising SEQ ID NO: 80.

[0230] In some embodiments, a CAR comprises: (a) a CD8α signal peptide sequence comprising SEQ ID NO: 72, (b) an antigen-binding domain comprising SEQ ID NO: 74, (c) a 62 IPTS / 128687595.1Attorney Docket No. KVN-007WO CD8α hinge region as set forth in SEQ ID NO: 85, (d) a CD8α transmembrane domain as set forth in SEQ ID NO: 70, (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 78, and (f) a CD3ζ intracellular signaling domain as set forth in SEQ ID NO: 80. In some embodiments, a CAR comprises, from N-terminus to C-terminus: (a) a CD8α signal peptide sequence comprising SEQ ID NO: 72, (b) an antigen-binding domain comprising SEQ ID NO: 74, (c) a CD8α hinge region as set forth in SEQ ID NO: 85, (d) a CD8α transmembrane domain as set forth in SEQ ID NO: 70, (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 78, and (f) a CD3ζ intracellular signaling domain as set forth in SEQ ID NO: 80.

[0231] In some embodiments, a CAR having any of the combinations of transmembrane domain, intracellular domain(s), and optionally hinge domain, as described above, further comprises an extracellular domain that binds CD19 (e.g., human CD19). In some embodiments, the extracellular domain comprises a means for binding CD19. Exemplary CD19-binding domains are described in the “Extracellular Domain” subsection above.

[0232] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 97% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 69.

[0233] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 63 IPTS / 128687595.1Attorney Docket No. KVN-007WO 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 97% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 58. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 58.

[0234] In some embodiments, a CAR of the present disclosure is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 59. 64 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0235] It has been observed that T cells engineered to express a CD19-CAR that incorporates a 4-1BB costimulatory domain produced substantially higher background levels of IFNγ, in the absence CD19-expressing target cells, than T cells engineered to express a CD19-CAR that incorporates a costimulatory domain derived from CD28, CD27, or FcεRI gamma chain. Without wishing to be bound by theory, it is hypothesized that the higher background level of cytokine production is undesirable for treating autoimmune diseases. Therefore, in certain embodiments, a CAR disclosed herein does not comprise an intracellular T cell signaling domain derived from 4-1BB. Nucleic Acid Constructs For Transduction

[0236] The present disclosure further provides for an engineered nucleic acid, or nucleic acid construct, comprising a nucleic acid sequence that encodes any polypeptide described herein, e.g., any CAR described herein. In some embodiments, an engineered nucleic acid comprises a promoter operably linked to a nucleic acid sequence that encodes a CAR (e.g., any CAR described herein). Any appropriate promoter may be operably linked to any of the engineered nucleic acid sequences described herein. Non-limiting examples of promoters that may be used in accordance with the present disclosure include EF1a, SFFV, PGK, CMV, CAG, UbC, murine stem cell virus (MSCV), MND, EF1a hybrid promoters, CAG hybrid promoters, or derivatives or functional fragments thereof. In some embodiments, a promoter is an EF1a promoter. In some embodiments, promoter is a SFFV promoter. In some embodiments, a promoter is a PGK promoter. In some embodiments, a promoter is a CMV promoter. In some embodiments, a promoter is a CAG promoter. In some embodiments, a promoter is a UbC promoter. In some embodiments, a promoter is a MSCV promoter. In some embodiments, a promoter is a MND promoter.

[0237] In some cases, an engineered nucleic acid comprises sufficient cis-acting elements (e.g., a promoter and / or an enhancer) that supplement expression of an engineered nucleic acid sequence where the remaining elements needed for expression can be supplied by a host cell (e.g., a mammalian cell, e.g., a T cell) or in an in vitro expression system.

[0238] The present disclosure also provides for retrovirus (e.g., lentivirus) vectors comprising any engineered nucleic acid as described herein. Exemplary lentiviral vectors that may be used in accordance with the present disclosure include vectors derived from human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana Disease Virus (JDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV). 65 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0239] Retroviral (e.g., lentiviral) vectors typically are constructed such that the majority of sequences coding for the structural genes of the virus are deleted and replaced by a gene of interest or expression cassette of interest (e.g., an engineered nucleic acid as described here). Most often, the structural genes (i.e., gag, pol, and env), are removed from the retroviral backbone using genetic engineering techniques known in the art. This may include digestion with the appropriate restriction endonuclease or, in some instances, with Bal 31 exonuclease to generate fragments containing appropriate portions of the packaging signal. Accordingly, in some embodiments, a minimum retroviral vector comprises from 5’ to 3’: a 5’ long terminal repeat (LTR), a packaging signal, an optional exogenous promoter and / or enhancer, an exogenous gene of interest (or engineered nucleic acid), and a 3' LTR. In some embodiments, if no exogenous promoter is provided, gene expression may be driven by the 5' LTR, which is a weak promoter and requires the presence of Tat to activate expression. In many embodiments, structural genes can be provided in separate vectors for manufacture of the lentivirus, rendering the produced virions replication-defective. Specifically, with respect to lentivirus, the packaging system may comprise a single packaging vector encoding the Gag, Pol, Rev, and Tat genes, and a third, separate vector encoding the envelope protein Env (usually VSV‐G due to its wide infectivity). To improve the safety of the packaging system, the packaging vector can be split, expressing Rev from one vector, Gag and Pol from another vector. Tat can also be eliminated from the packaging system by using a retroviral vector comprising a chimeric 5’ LTR, wherein the U3 region of the 5’ LTR is replaced with a heterologous regulatory element.

[0240] Nucleic acids (e.g., genes) to be packaged into a retrovirus (e.g., a lentivirus) can be incorporated into the proviral backbone in several general ways. The most straightforward constructions are ones in which the structural genes of the retrovirus are replaced by a single gene which then is transcribed under the control of the viral regulatory sequences within the LTR. Retroviral vectors have also been constructed which can introduce more than one gene into target cells. Usually, in such vectors one gene is under the regulatory control of the viral LTR, while the second gene is expressed either off a spliced message or is under the regulation of its own, internal promoter.

[0241] Accordingly, nucleic acids (e.g., genes) to be packaged into a retrovirus are flanked by 5′ and 3′ LTRs, which serve to promote transcription and polyadenylation of the virion RNAs, respectively. The term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs which, in their natural sequence context, are direct repeats and contain U3, R and U5 regions. LTRs generally provide functions 66 IPTS / 128687595.1Attorney Docket No. KVN-007WO fundamental to the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. The LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals, and sequences needed for replication and integration of the viral genome. The U3 region contains the enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence. The R (repeat) region is flanked by the U3 and U5 regions. In certain embodiments, the R region comprises a trans-activation response (TAR) genetic element, which interacts with the trans-activator (tat) genetic element to enhance viral replication. This element is not required in embodiments wherein the U3 region of the 5′ LTR is replaced by a heterologous promoter.

[0242] In some embodiments, a retroviral vector comprises a modified 5′ LTR and / or 3′ LTR. Modifications of the 3′ LTR are often made to improve the safety of lentiviral or retroviral systems by rendering viruses replication-defective. In some embodiments, a retroviral vector is a self-inactivating (SIN) vector. As used herein, a SIN retroviral vector refers to a replication-defective retroviral vector in which the 3′ LTR U3 region has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. This is because the 3′ LTR U3 region is used as a template for the 5′ LTR U3 region during viral replication and, thus, the viral transcript cannot be made without the U3 enhancer-promoter. In some embodiments, a 3′ LTR is modified such that the U5 region is replaced, for example, with an ideal polyadenylation sequence. It should be noted that modifications to the LTRs such as modifications to the 3′ LTR, the 5′ LTR, or both 3′ and 5′ LTRs, are also included in some embodiments of the present disclosure.

[0243] In some embodiments, the U3 region of the 5′ LTR is replaced with a heterologous promoter to drive transcription of the viral genome during production of viral particles. Examples of heterologous promoters which can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters. Typical promoters are able to drive high levels of transcription in a Tat-independent manner. This replacement reduces the possibility of recombination to generate replication-competent virus, because there is no complete U3 sequence in the virus production system.

[0244] Adjacent to a 5′ LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient packaging of viral RNA into particles (the Psi site). As used herein, the term “packaging signal” or “packaging sequence” 67 IPTS / 128687595.1Attorney Docket No. KVN-007WO refers to sequences located within the retroviral genome which are required for encapsidation of retroviral RNA strands during viral particle formation (see e.g., Clever et al., 1995 J. Virology, 69(4):2101-09). The packaging signal may be a minimal packaging signal (also referred to as the psi [Ψ] sequence) needed for encapsidation of the viral genome.

[0245] In some embodiments, a retroviral vector (e.g., lentiviral vector) further comprises a FLAP. As used herein, the term “FLAP” refers to a nucleic acid whose sequence includes the central polypurine tract and central termination sequences (cPPT and CTS) of a retrovirus, e.g., HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Patent No. 6,682,907 and in Zennou et al. (2000) Cell 101:173. During reverse transcription, central initiation of the plus-strand DNA at the cPPT and central termination at the CTS lead to the formation of a three-stranded DNA structure: a central DNA flap. While not wishing to be bound by any theory, the DNA flap may act as a cis-active determinant of lentiviral genome nuclear import and / or may increase the titer of the virus. In some embodiments, retroviral vector backbones comprise one or more FLAP elements upstream or downstream of the heterologous genes of interest in the vectors. For example, in some embodiments, a transfer plasmid includes a FLAP element. In some embodiments, a vector of the present disclosure comprises a FLAP element isolated from HIV-1.

[0246] In some embodiments, a retroviral vector (e.g., lentiviral vector) further comprises an export element. In some embodiments, retroviral vectors comprise one or more export elements. The term “export element” refers to a cis-acting post-transcriptional regulatory element which regulates the transport of an RNA transcript from the nucleus to the cytoplasm of a cell. Examples of RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) RRE (see e.g., Cullen et al., (1991) J. Virol.65: 1053; and Cullen et al., (1991) Cell 58: 423) and the hepatitis B virus post-transcriptional regulatory element (HPRE). Generally, the RNA export element is placed within the 3′ UTR of a gene, and can be inserted as one or multiple copies.

[0247] In some embodiments, a retroviral vector (e.g., lentiviral vector) further comprises a posttranscriptional regulatory element. A variety of posttranscriptional regulatory elements can increase expression of a heterologous nucleic acid, e.g., woodchuck hepatitis virus posttranscriptional regulatory element (WPRE; see Zufferey et al., (1999) J. Virol., 73:2886); the posttranscriptional regulatory element present in hepatitis B virus (HPRE) (Huang et al., Mol. Cell. Biol., 5:3864); an optimized posttranscriptional regulatory element (oPRE; see Schambach et al., (2006) Gene Therapy 13, 641–45); and the like (Liu et al., (1995), Genes Dev., 9:1766). The posttranscriptional regulatory element is generally positioned at the 3′ 68 IPTS / 128687595.1Attorney Docket No. KVN-007WO end the heterologous nucleic acid sequence. This configuration results in synthesis of an mRNA transcript whose 5′ portion comprises the heterologous nucleic acid coding sequences and whose 3′ portion comprises the posttranscriptional regulatory element sequence. In some embodiments, vectors of the present disclosure lack or do not comprise a posttranscriptional regulatory element such as a WPRE or HPRE, because in some instances these elements increase the risk of cellular transformation and / or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in certain embodiments, vectors of the present disclosure lack or do not comprise a WPRE or HPRE as an added safety measure.

[0248] Elements directing the efficient termination and polyadenylation of the heterologous nucleic acid transcripts increase heterologous gene expression. Transcription termination signals are generally found downstream of the polyadenylation signal. Accordingly, in some embodiments, a retroviral vector (e.g., lentiviral vector) further comprises a polyadenylation signal. The term “polyadenylation signal” or “polyadenylation sequence” as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript by RNA polymerase H. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a polyadenylation signal are unstable and are rapidly degraded. Illustrative examples of polyadenylation signals that can be used in a vector of the present disclosure, include an ideal polyadenylation sequence (e.g., AATAAA, ATTAAA AGTAAA), a bovine growth hormone polyadenylation sequence (BGHpA), a rabbit β-globin polyadenylation sequence (rβgpA), or another suitable heterologous or endogenous polyadenylation sequence known in the art.

[0249] In some embodiments, a retroviral vector further comprises an insulator element. Insulator elements may contribute to protecting retrovirus-expressed sequences, e.g., therapeutic genes, from integration site effects, which may be mediated by cis-acting elements present in genomic DNA and lead to deregulated expression of transferred sequences (i.e., position effect; see, e.g., Burgess-Beusse et al., (2002) Proc. Natl. Acad. Sci., USA, 99:16433; and Zhan et al., 2001, Hum. Genet., 109:471). In some embodiments, a retroviral vector comprises an insulator element in one or both LTRs or elsewhere in the region of the vector that integrates into the cellular genome. Suitable insulators for use in the present disclosure include, but are not limited to, the chicken β-globin insulator (see Chung et al., (1993). Cell 74:505; Chung et al., (1997) Proc. Natl. Acad. Sci., USA 94:575; and Bell et al., 1999. Cell 98:387). Examples of insulator elements include, but are not limited to, an insulator from a β-globin locus, such as chicken HS4. 69 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0250] Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6 / V5-DESTTM(Thermo Fisher), pLenti6.2 / V5-DESTTM(Thermo Fisher), pLKO.1 (Plasmid #10878 at Addgene), pLKO.3G (Plasmid #14748 at Addgene), pSico (Plasmid #11578 at Addgene), pLJM1-EGFP (Plasmid #19319 at Addgene), FUGW (Plasmid #14883 at Addgene), pLVTHM (Plasmid #12247 at Addgene), pLVUT-tTR-KRAB (Plasmid #11651 at Addgene), pLL3.7 (Plasmid #11795 at Addgene), pLB (Plasmid #11619 at Addgene), pWPXL (Plasmid #12257 at Addgene), pWPI (Plasmid #12254 at Addgene), EF.CMV.RFP (Plasmid #17619 at Addgene), pLenti CMV Puro DEST (Plasmid #17452 at Addgene), pLenti-puro (Plasmid #39481 at Addgene), pULTRA (Plasmid #24129 at Addgene), pLX301 (Plasmid #25895 at Addgene), pHIV-EGFP (Plasmid #21373 at Addgene), pLV-mCherry (Plasmid #36084 at Addgene), pLionII (Plasmid #1730 at Addgene), pInducer10-mir-RUP- PheS (Plasmid #44011 at Addgene). These vectors can be modified to be suitable for therapeutic use. For example, a selection marker (e.g., puro, EGFP, or mCherry) can be deleted or replaced with a second exogenous gene of interest. Further examples of lentiviral vectors are disclosed in U.S. Patent Nos.7,629,153, 7,198,950, 8,329,462, 6,863,884, 6,682,907, 7,745,179, 7,250,299, 5,994,136, 6,287,814, 6,013,516, 6,797,512, 6,544,771, 5,834,256, 6,958,226, 6,207,455, 6,531,123, and 6,352,694, and PCT Publication No. WO2017 / 091786.

[0251] In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence encoding a CAR, wherein the nucleic acid sequence has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present 70 IPTS / 128687595.1Attorney Docket No. KVN-007WO disclosure comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 59. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence as set forth in SEQ ID NO: 59.

[0252] In certain embodiments, a lentivirus vector disclosed herein comprises a truncated 5’ LTR (e.g., with deletion of its U3 region), an HIV-1Ψ packaging sequence, a MSCV promoter operably linked to a nucleic acid encoding a CAR (e.g., any of the CARs as disclosed herein), and a truncated 3’ LTR (e.g., with deletion of its U3 region). In certain embodiments, the lentivirus vector further comprises a RRE, a cPPT / CTS, and / or an oPRE. In certain embodiments, the lentivirus vector comprises a truncated 5’ LTR (e.g., with deletion of its U3 region), an HIV-1Ψ packaging sequence, a RRE, a cPPT / CTS, a MSCV promoter operably linked to a nucleic acid encoding a CAR (e.g., any of the CARs as disclosed herein), an oPRE, and a truncated 3’ LTR (e.g., with deletion of its U3 region). In certain embodiments, the lentivirus vector is pseudotyped with VSV-G envelope protein. Methods Of Making Engineered T Cells

[0253] As described herein, the present disclosure provides for compositions and methods of making an engineered T cell (e.g., a CAR T cell) that allow for, among other things, increased engineered cell yield, and increased genetic modification efficiency (e.g., increased insertion of a nucleic acid encoding a CAR and increased knockout of genes involved in recipient rejection including HLA-A, CIITA, and TRAC). Indeed, the present disclosure encompasses the discovery, as shown by Example 2 below, that editing order for target genes HLA-A, CIITA, and TRAC is critical for knockout efficiency for each target, e.g., when engineering a T cell also includes a step of lentiviral transduction for delivering a nucleic acid encoding a CAR. The present disclosure further encompasses the discovery that LNP concentration used for delivering genetic editing systems that target HLA-A, CIITA, and TRAC influence knockout efficiency as well as insertion efficiency for a delivered nucleic acid encoding a CAR (e.g., via lentiviral transduction). In particular, a higher LNP concentration results in higher knockout efficiency but lower lentiviral transduction efficiency. Accordingly, the present disclosure provides methods of making an engineered T cell that incorporate separation of each genetic modification to be performed on the T cell 71 IPTS / 128687595.1Attorney Docket No. KVN-007WO into certain sequential steps that allow for yield, purity, and efficiency benefits. Also provided is an engineered T cell or a population of engineered T cells produced by the method.

[0254] The present disclosure provides, among other things, a method of making an engineered T cell, the method comprising introducing into a host T cell at least one gRNA (e.g., any gRNA described herein), an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent (e.g., any RNA-guided DNA-binding agent described herein, such as a Cas protein), and an engineered nucleic acid encoding a polypeptide (e.g. an engineered polypeptide, such as any CAR described herein). In some embodiments, the present disclosure provides a method of making an engineered T cell, the method comprising introducing into a host T cell a gRNA comprising a guide sequence that is complementary to an HLA-A gene sequence, a gRNA comprising a guide sequence that is complementary to a CIITA gene, a gRNA comprising a guide sequence that is complementary to a TRAC gene, an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent (e.g., any RNA-guided DNA-binding agent, including RNA-guided DNA endonuclease, as described herein), and a engineered nucleic acid encoding a polypeptide (e.g., an engineered polypeptide such as any CAR described herein). In some embodiments, at least one gRNA is introduced into a host T cell as part of an LNP. In some embodiments, an RNA-guided DNA-binding agent or nucleic acid encoding an RNA-guided DNA-binding agent is introduced into a host T cell as part of an LNP. In some embodiments, an engineered nucleic acid encoding a polypeptide is introduced into a host T cell in a lentiviral vector (e.g., via lentiviral transduction).

[0255] In some embodiments, a method of making an engineered T cell comprises steps of: (a) contacting a host T cell with a first LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to an HLA-A gene sequence (e.g., any HLA-A gRNA described herein); and (ii) a first RNA-guided DNA-binding agent or nucleic acid encoding the first RNA-guided DNA-binding agent; (b) transducing the host T cell with a lentiviral vector that delivers to the host T cell an engineered nucleic acid encoding a CAR (e.g., any CAR described herein); (c) contacting the host T cell with a second LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a CIITA gene sequence (e.g., any CIITA gRNA described herein); and (ii) a second RNA-guided DNA-binding agent or nucleic acid encoding the second RNA-guided DNA-binding agent; (d) contacting the host T cell with a third LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a TRAC gene sequence (e.g., any TRAC gRNA described herein); and (ii) 72 IPTS / 128687595.1Attorney Docket No. KVN-007WO a third RNA-guided DNA-binding agent or nucleic acid encoding the third RNA-guided DNA-binding agent, wherein the steps are taken in the order of (a) → (b) → (c) → (d).

[0256] In some embodiments, a method of making an engineered T cell comprises steps of: (a) contacting a host T cell with a first LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a CIITA gene sequence (e.g., any CIITA gRNA described herein); and (ii) a first RNA-guided DNA-binding agent or nucleic acid encoding the first RNA-guided DNA-binding agent; (b) transducing the host T cell with a lentiviral vector that delivers to the host T cell an engineered nucleic acid encoding a CAR (e.g., any CAR described herein); (c) contacting the host T cell with a second LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to an HLA-A gene sequence (e.g., any HLA-A gRNA described herein); and (ii) a second RNA-guided DNA-binding agent or nucleic acid encoding the second RNA-guided DNA-binding agent; (d) contacting the host T cell with a third LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a TRAC gene sequence (e.g., any TRAC gRNA described herein); and (ii) a third RNA-guided DNA-binding agent or nucleic acid encoding the third RNA-guided DNA-binding agent, wherein the steps are taken in the order of (a) → (b) → (c) → (d).

[0257] In some embodiments, a method of making an engineered T cell comprises steps of: (a) contacting a host T cell with a first LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to an HLA-A gene sequence (e.g., any HLA-A gRNA described herein); and (ii) an RNA encoding a first Cas protein; (b) transducing the host T cell with a lentiviral vector that delivers to the host T cell an engineered nucleic acid encoding a CAR (e.g., any CAR described herein); (c) contacting the host T cell with a second LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a CIITA gene sequence (e.g., any CIITA gRNA described herein); and (ii) an RNA encoding a second Cas protein; (d) contacting the host T cell with a third LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a TRAC gene sequence (e.g., any TRAC gRNA described herein); and (ii) an RNA encoding a third Cas protein, wherein the steps are taken in the order of (a) → (b) → (c) → (d).

[0258] In some embodiments, a method of making an engineered T cell comprises steps of: (a) contacting a host T cell with a first LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a CIITA gene sequence (e.g., any CIITA gRNA described herein); and (ii) an RNA encoding a first Cas protein; (b) transducing the host T cell with a lentiviral vector that delivers to the host T cell an engineered nucleic acid encoding a CAR (e.g., any CAR described herein); (c) contacting the host T cell with a second LNP 73 IPTS / 128687595.1Attorney Docket No. KVN-007WO comprising: (i) a gRNA comprising a guide sequence that is complementary to an HLA-A gene sequence (e.g., any HLA-A gRNA described herein); and (ii) an RNA encoding a second Cas protein; (d) contacting the host T cell with a third LNP comprising: (i) a gRNA comprising a guide sequence that is complementary to a TRAC gene sequence (e.g., any TRAC gRNA described herein); and (ii) an RNA encoding a third Cas protein, wherein the steps are taken in the order of (a) → (b) → (c) → (d).

[0259] In some embodiments, a nucleic acid encoding a first RNA-guided DNA-binding agent, a second RNA-guided DNA binding agent, and / or a third RNA-guided DNA-binding agent is an RNA. In some embodiments, a nucleic acid encoding a first RNA-guided DNA- binding agent, a second RNA-guided DNA binding agent, and / or a third RNA-guided DNA- binding agent is an mRNA. In some embodiments, a nucleic acid encoding a first RNA- guided DNA-binding agent, a second RNA-guided DNA binding agent, and / or a third RNA- guided DNA-binding agent is a modified mRNA (e.g., any modified mRNA described herein).

[0260] In some embodiments, a nucleic acid encoding a first Cas protein, a second Cas protein, and / or a third Cas protein is an mRNA. In some embodiments, a nucleic acid encoding a first Cas protein, a second Cas protein, and / or a third Cas protein is a modified mRNA (e.g., any modified mRNA described herein).

[0261] In some embodiments, the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent are the same. In some embodiments, at least two of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent are different. In some embodiments, at least one of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Cas protein (e.g., any Cas protein described herein). In some embodiments, each of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Cas protein (e.g., any Cas protein described herein). In some embodiments, at least one of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Cas9 protein (e.g., any Cas9 protein described herein). In some embodiments, each of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Cas9 protein (e.g., any Cas9 protein described herein). In some embodiments, at least one of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Spy 74 IPTS / 128687595.1Attorney Docket No. KVN-007WO Cas9 protein. In some embodiments, each of the first RNA-guided DNA-binding agent, the second RNA-guided DNA-binding agent, and the third RNA-guided DNA-binding agent is a Spy Cas9 protein.

[0262] In some embodiments, the first Cas protein, the second Cas protein, and the third Cas protein are the same. In some embodiments, at least two of the first Cas protein, the second Cas protein, and / or the third Cas protein are different. In some embodiments, at least one of the first Cas protein, the second Cas protein, and the third Cas protein is a Cas9 protein (e.g., any Cas9 protein described herein). In some embodiments, each of the first Cas protein, the second Cas protein, and the third Cas protein is a Cas9 protein (e.g., any Cas9 protein described herein). In some embodiments, at least one of the first Cas protein, the second Cas protein, and the third Cas protein is a Spy Cas9 protein. In some embodiments, each of the first Cas protein, the second Cas protein, and the third Cas protein is a Spy Cas9 protein.

[0263] In some embodiments, in a provided method of making an engineered T cell step (b) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20-28 hours, or about 22-26 hours) after initiation of step (a), step (c) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20-28 hours, or about 22-26 hours) after initiation of step (b), and step (d) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20-28 hours, or about 22-26 hours) after initiation of step (c). In some embodiments, step (b) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20-28 hours, or about 22-26 hours) after initiation of step (a). In some embodiments, step (c) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20- 28 hours, or about 22-26 hours) after initiation of step (b). In some embodiments, step (d) is initiated about 16-32 hours (e.g., about 18-30 hours, about 20-28 hours, or about 22-26 hours) after initiation of step (c). In some embodiments, step (b) is initiated about 24 hours after initiation of step (a), step (c) is initiated about 24 hours after initiation of step (b), and step (d) is initiated about 24 hours after initiation of step (c). In some embodiments, step (b) is initiated about 24 hours after initiation of step (a). In some embodiments, step (c) is initiated about 24 hours after initiation of step (b). In some embodiments, step (d) is initiated about 24 hours after initiation of step (c). In certain embodiments, each step terminates at the beginning of the next step, for example, by replacing the cell culture medium with fresh medium.

[0264] In some embodiments, a method of making an engineered T cell as provided herein further comprises a step of (e) expanding the T cells. In some embodiments, a method of making an engineered T cell further comprises a step of (e) depleting CD3+ cells. In some 75 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, a method of making an engineered T cell further comprises a step of (e) expanding the T cells; and (f) depleting CD3+ cells.

[0265] In some embodiments, a provided method further includes a step of contacting a host T cell with an effective amount of one or more agents that stimulates a CD3 / TCR complex in the absence of an agent that stimulates a costimulatory molecule (e.g., CD28) under conditions that allow for the stimulation of the host T cell. In other embodiments, a provided method further includes a step of contacting a host T cell with an effective amount of one or more agents that activate both a CD3 / TCR complex and a costimulatory molecule (e.g., CD28) under conditions that allow for the stimulation of the host T cell. Exemplary agents include a solid surface, such as a polymeric nanomatrix, coated with an anti-CD3 antibody and an anti-CD28 antibody, or TransAct™. In some embodiments, the further step of contacting a host T cell with an effective amount of one or more CD3-stimulation and / or CD28 stimulation agents (e.g., CD3-stimulation and CD28 stimulation agents) begins 16-48 hours (e.g., about 16-32, about 24-48, about 18-30 hours, about 20-28 hours, or about 22-26 hours) prior to initiation of step (b). In some embodiments, the further step of contacting a host T cell with an effective amount of one or more CD3-stimulation and / or CD28 stimulation agents begins prior to step (a), during step (a), or simultaneously with initiation of step (a). In certain embodiments, the further step of contacting a host T cell with an effective amount of one or more CD3-stimulation and / or CD28 stimulation agents (e.g., CD3- stimulation and CD28 stimulation agents) lasts beyond termination of step (a), termination of step (b), termination of step (c), or termination of step (d). For example, where the agent(s) that stimulate CD3 and CD28 are immobilized on a bead, it is understood that the bead may remain attached with a T cell throughout further steps until the T cell is detached from the bead, as a result of natural degradation of the protein agent(s).

[0266] In some embodiments, introducing an engineered nucleic acid (or a vector or plasmid comprising an engineered nucleic acid) to a host T cell comprises contacting the host cell with a lentiviral vector (e.g., any lentiviral vector described herein). Methods of introducing nucleic acid constructs into a cell (e.g., a eukaryotic cell) via lentiviral transduction are known in the art. As used herein, “transformed” and “transduced” are used interchangeably.

[0267] In some embodiments, an engineered nucleic acid is introduced to a cell using a lentiviral vector. In some embodiments, the lentiviral vector is used at a multiplicity of infection (MOI) of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 76 IPTS / 128687595.1Attorney Docket No. KVN-007WO 18, about 19, about 20, or greater. In some embodiments, the lentiviral vector is used at an MOI of about 1. In some embodiments, the lentiviral vector is used at an MOI of about 2. In some embodiments, the lentiviral vector is used at an MOI of about 3. In some embodiments, the lentiviral vector is used at an MOI of about 4. In some embodiments, the lentiviral vector is used at an MOI of about 5. In some embodiments, the lentiviral vector is used at an MOI of about 6. In some embodiments, the lentiviral vector is used at an MOI of about 7. In some embodiments, the lentiviral vector is used at an MOI of about 8. In some embodiments, the lentiviral vector is used at an MOI of about 9. In some embodiments, the lentiviral vector is used at an MOI of about 10.

[0268] In some embodiments, an engineered nucleic acid encodes a targeting receptor. A “targeting receptor” is a receptor present on the surface of a cell, e.g., a T cell, to permit binding of the cell to a target site, e.g., a specific cell or tissue in an organism. In some embodiments, the targeting receptor is a CAR (e.g., any CAR described herein). In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is an anti-CD19 CAR (e.g., any anti-CD19 CAR described herein).

[0269] As discussed herein, CARs are composed of at least four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T-cell signaling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, WO2018208837). A universal CAR (UniCAR) for recognizing various antigens (see, e.g., EP 2990416 A1) and a reversed universal CAR (RevCAR) that promotes binding of an immune cell to a target cell through an adaptor molecule (see, e.g., WO2019238722) are also contemplated. CARs can be targeted to any antigen to which an antibody can be developed and are typically directed to molecules displayed on the surface of a cell or tissue to be targeted. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR (e.g., a TRuC). (See Baeuerle et al. Nature Communications 2087 (2019).)

[0270] In many embodiments of the present disclosure an engineered T cell is contacted with an engineered nucleic acid encoding a CAR (e.g., any CAR described herein). In some embodiments, an engineered nucleic acid encodes an anti-CD19 CAR (e.g., any anti-CD19 CAR described herein). In some embodiments, the present disclosure provides an engineered T cell comprising a nucleic acid sequence encoding an amino acid sequence as set forth in SEQ ID NO: 58. In some embodiments, the present disclosure provides an engineered T cell comprising an engineered nucleic acid sequence as set forth in SEQ ID NO: 59. 77 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0271] As described herein, compositions and methods for reducing or eliminating expression of HLA-A, CIITA, and TRAC on the surface of a T cell by genetically modifying an HLA-A, CIITA, and TRAC gene sequence (e.g., using any gene editing system described herein), also include compositions and methods of delivering to the cell an exogenous or engineered nucleic acid encoding an engineered polypeptide (e.g., any CAR described herein) such that the engineered nucleic acid is incorporated at least in part into the genome of the T cell.

[0272] In some embodiments, an engineered nucleic acid (e.g., any engineered nucleic acid described herein) is inserted or integrated into the genome of the target cell (e.g., a T cell). In some embodiments, the engineered nucleic acid is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the engineered nucleic acid is integrated into the genome of the target cell by blunt end insertion. In some embodiments, the engineered nucleic acid is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the engineered nucleic acid is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the engineered nucleic acid is integrated into a HLA-A locus, CIITA locus, or TRAC locus. In some embodiments, the engineered nucleic acid is provided to the cell in a lipid nucleic acid assembly composition. In some embodiments, the lipid nucleic acid assembly composition is an LNP (e.g., any LNP described herein).

[0273] In some embodiments, an LNP formulation used in a method of the present disclosure comprises an ionizable lipid, cholesterol, DSPC and PEG. The chemical name of the ionizable lipid is ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propy1 octadeca-9,12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methy1)propy1 (9Z, 12Z)-octadeca-9, 12-dienoate), referred to herein as “Lipid A.” In some embodiments, an LNP formulation comprises Lipid A, cholesterol, DSPC, and PEG in a molar ratio of about 50:39.5:9:1.5. In some embodiments, an LNP formulation comprises Lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of about 50:38:9:3. In some embodiments, an LNP formulation comprises Lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of about 50:40:9:1.5.

[0274] In some embodiments, an LNP formulation used in accordance with the present disclosure comprises an sgRNA:mRNA ratio of about 1:1, 1:2, or 2:1. In some embodiments, an LNP formulation comprises an sgRNA:mRNA ratio of about 1:2. 78 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0275] In some embodiments, an LNP formulation comprises a total RNA content of about 0.25 mg / mL, 0.26 mg / mL, 0.27 mg / mL, 0.28 mg / mL, 0.29 mg / mL, 0.3 mg / mL, 0.31 mg / mL, 0.32 mg / mL, 0.33 mg / mL, 0.34 mg / mL, 0.35 mg / mL, 0.36 mg / mL, 0.37 mg / mL, 0.38 mg / mL, 0.40 mg / mL, 0.41 mg / mL, 0.42 mg.mL, 0.43 mg / mL, 0.44 mg / mL, or 0.45 mg / mL. In some embodiments, an LNP formulation comprises a total lipid content of about 0.50 mg / mL, 0.51 mg / mL, 0.52 mg / mL, 0.53 mg / mL, 0.54 mg / mL, 0.55 mg / mL, 0.56 mg / mL, 0.57 mg / mL, 0.58 mg / mL, 0.59 mg / mL, 0.60 mg / mL, 0.61 mg / mL, 0.62 mg / mL, 0.63 mg / mL, 0.64 mg / mL, 0.65 mg / mL, 0.66 mg / mL, 0.67 mg / mL, 0.68 mg / mL, 0.69 mg / mL, 0.70 mg / mL, 0.71 mg / mL, 0.72 mg / mL, 0.73 mg / mL, 0.74 mg / mL, 0.75 mg / mL, 0.76 mg / mL, 0.77 mg / mL, 0.78 mg / mL, 0.79 mg / mL, 0.80 mg / mL, 0.81 mg / mL, 0.82 mg / mL, 0.83 mg / mL, 0.84 mg / mL, 0.85 mg / mL, 0.86 mg / mL, 0.87 mg / mL, 0.88 mg / mL, 0.89 mg / mL, or 0.90 mg / mL.

[0276] In some embodiments, an LNP formulation is prepared in a TSS buffer. In some embodiments, an LNP formulation is prepared in a TSS buffer comprising 5% sucrose, 45 mM NaCl, 50 mM Tris, at pH 7.5.

[0277] In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a CIITA gene at a concentration of about 2 µg / mL, 2.5 µg / mL, 3 µg / mL, 3.5 µg / mL, 4 µg / mL, 4.5 µg / mL, 5 µg / mL, 5.5 µg / mL, 6 µg / mL, 6.5 µg / mL, 7 µg / mL, 7.5 µg / mL, or 8 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a CIITA gene at a concentration of about 2.5 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a CIITA gene at a concentration of about 5 µg / mL (total RNA content).

[0278] In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to an HLA-A gene at a concentration of about 2 µg / mL, 2.5 µg / mL, 3 µg / mL, 3.5 µg / mL, 4 µg / mL, 4.5 µg / mL, 5 µg / mL, 5.5 µg / mL, 6 µg / mL, 6.5 µg / mL, 7 µg / mL, 7.5 µg / mL, or 8 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to an HLA-A gene at a concentration of about 2.5 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to an HLA-A gene is contacted with the T cell at a concentration of about 5 µg / mL (total RNA content).

[0279] In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a TRAC gene at a concentration of about 2 µg / mL, 2.5 79 IPTS / 128687595.1Attorney Docket No. KVN-007WO µg / mL, 3 µg / mL, 3.5 µg / mL, 4 µg / mL, 4.5 µg / mL, 5 µg / mL, 5.5 µg / mL, 6 µg / mL, 6.5 µg / mL, 7 µg / mL, 7.5 µg / mL, or 8 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a TRAC gene at a concentration of about 2.5 µg / mL (total RNA content). In some embodiments, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a TRAC gene at a concentration of about 5 µg / mL (total RNA content).

[0280] In some embodiments, wherein the T cells are engineered in the order of (1) CIITA editing, (2) retrovirus (e.g., lentivirus) transfection, (3) HLA-A editing, and (4) TRAC editing, the T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a CIITA gene at a concentration of about 2.5 µg / mL (total RNA content), an LNP comprising a gRNA sequence that is complementary to a HLA-A gene at a concentration of about 5 µg / mL (total RNA content), and an LNP comprising a gRNA sequence that is complementary to a TRAC gene at a concentration of about 2.5 µg / mL (total RNA content).

[0281] In some embodiments, wherein the T cells are engineered in the order of (1) HLA- A editing, (2) retrovirus (e.g., lentivirus) transfection, (3) CIITA editing, and (4) TRAC editing, T cells are contacted with an LNP comprising a gRNA sequence that is complementary to a HLA-A gene at a concentration of about 2.5 µg / mL (total RNA content), an LNP comprising a gRNA sequence that is complementary to a CIITA gene at a concentration of about 5 µg / mL (total RNA content), and an LNP comprising a gRNA sequence that is complementary to a TRAC gene at a concentration of about 2.5 µg / mL (total RNA content).

[0282] In some embodiments, a gRNA used in accordance with a provided method comprises one or more sequences shown in Table A and / or Table D. In some embodiments, a gRNA used in accordance with a provided method is any gRNA described herein.

[0283] In some embodiments, a gRNA used in accordance with a provided method comprises a gRNA sequence (e.g., a guide sequence) that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in a target gene. In some embodiments, a gRNA sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human HLA-A gene. In some embodiments, a gRNA sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human CIITA gene. In some embodiments, a gRNA sequence is at least 99%, 98%, 97%, 80 IPTS / 128687595.1Attorney Docket No. KVN-007WO 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human TRAC gene.

[0284] In some embodiment, a gRNA used in accordance with a provided method comprises a gRNA sequence (e.g., a guide sequence) that is complementary to an HLA-A gene sequence. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 1- 30. In some embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-30. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 1. In some embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in SEQ ID NO: 1. In some embodiments, contacting with the gRNA results in modification of the HLA-A gene in a T cell in a genomic region according to a corresponding coordinate from human reference genome hg38 as shown in Table A. In some embodiments, contacting with the gRNA results in modification of the HLA-A gene in a T cell in the close vicinity of (e.g., within 10 nucleotides from) a corresponding genomic coordinate listed in Table A. In some embodiments, both alleles of HLA-A gene are edited in the T cell.

[0285] In some embodiments, a gRNA used in accordance with a provided method comprises a gRNA sequence (e.g., a guide sequence) that is complementary to a CIITA gene sequence. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 31-39. In some embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 31-39. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 34. In some embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in SEQ ID NO: 34. In some embodiments, contacting with the gRNA results in modification of the CIITA gene in a T cell in a genomic region according to a corresponding coordinate from human reference genome hg38 as shown in Table A. In some embodiments, contacting with the gRNA results in modification of the CIITA gene in a T cell in the close vicinity of (e.g., within 10 nucleotides from) a corresponding genomic coordinate listed in Table A. In some embodiments, both alleles of CIITA gene are edited in the T cell.

[0286] In some embodiments, a gRNA used in accordance with a provided method comprises a gRNA sequence (e.g., a guide sequence) that is complementary to a TRAC gene. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to any one of SEQ ID NOs: 40-54. In some 81 IPTS / 128687595.1Attorney Docket No. KVN-007WO embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 40-54. In some embodiments, a gRNA sequence comprises a nucleic acid sequence having at least 90%, at least 95%, or greater sequence identity to SEQ ID NO: 46. In some embodiments, a gRNA sequence comprises a nucleic acid sequence as set forth in SEQ ID NO: 46. In some embodiments, contacting with the gRNA results in modification of the TRAC gene in a T cell in a genomic region according to a corresponding coordinate from human reference genome hg38 as shown in Table A. In some embodiments, contacting with the gRNA results in modification of the TRAC gene in a T cell in the close vicinity of (e.g., within 10 nucleotides from) a corresponding genomic coordinate listed in Table A. In some embodiments, both alleles of TRAC gene are edited in the T cell.

[0287] A T cell (or host T cell) used to make an engineered T cell can be any T cell obtained from a donor source, such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupT1, etc., or a T cell obtained from a mammal. In some embodiments, a T cell used to make an engineered T cell can be selected from naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or sub-populations thereof. In some embodiments, a T cell used to make an engineered T cell can be a CD3+ cell. In some embodiments, a T cell can be CD4+, CD8+, or CD4+ and CD8+. In some embodiments, a T cell can be any type of T cell, e.g., CD4+ / CD8+ double positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), memory T cells, naive T cells, regulatory T cells, etc. In some embodiments, a T cell used to make an engineered T cell can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). In some embodiments, obtained T cells for making engineered T cells are substantially free of non-T cells. In some embodiments, a T cell is homozygous for HLA-B and homozygous for HLA-C.

[0288] The T cells can be obtained from various biological samples of a subject (e.g., a human subject). Non-limiting examples of biological sample include cells, tissue (e.g., tissue obtained by biopsy), blood, serum, plasma, or any sample derived therefrom. In certain embodiments, the sample is a whole blood sample or an apheresis (e.g., leukapheresis) sample obtained from the subject. In certain embodiments, the method comprises obtaining 82 IPTS / 128687595.1Attorney Docket No. KVN-007WO the sample from the subject. In certain embodiments, the method comprises having obtained the sample from the subject.

[0289] In certain embodiments, the T cells are isolated from the sample. Isolation of T cells may include an initial purification of T cells from a mixture of plasma, lymphocytes, platelets, red blood cells, monocytes, and granulocytes. Methods for isolation of T cells from a biological sample, such as a whole blood sample or a leukapheresis sample, are well- known. Exemplary methods may include leukapheresis, elutriation, density gradient centrifugation, enrichment by selection, and the like. For example, the method may include obtaining or having obtained a biological sample, such as a fresh, refrigerated, frozen, or cryopreserved leukapheresis product or alternative source of hematopoietic tissue, such as a whole blood sample, bone marrow sample, or a tumor or organ biopsy or removal (e.g., thymectomy) from an entity, such as a laboratory, hospital, or healthcare provider, and performing the aforementioned isolation steps to produce an enriched population of T cells (e.g., starting population of T cells) suitable for expression of a heterologous protein.

[0290] Furthermore, the purity of the T cell population can be increased by using one or more selection steps, such as negative selection or positive selection. Negative selection typically involves removal of undesired cell types from a mixed population of cells in a sample using one or more agents that selectively bind to the undesired cell type, whereas positive selection typically involves isolation of the desired cell population using one or more agents that selectively bind to the desired cell type. Enrichment of a T cell population by negative selection can be accomplished, for example, with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method is cell sorting and / or selection via negative magnetic immuno-adherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the negatively selected cells. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail can include antibodies to CD14, CD20, CDb, CD16, HLA-DR, and CD8. On the other hand, a positive selection step can be used to specifically select for the desired cell type. Positive selection of T cells can, in certain embodiments, include incubation of a mixed population of cells that contains the T cells with a CD3-binding agent (e.g., anti-CD3 antibody-conjugated beads) for a time sufficient for positive selection of the desired T cells.

[0291] In some embodiments, engineered T cells are made using a mixture of cells (e.g., a mixture of host cells). For example, a mixture of cells may be obtained (e.g., from a subject), and an engineered nucleic acid may be inserted into the mixture of cells such that a mixture of engineered cells is made. In some embodiments, a mixture of cells comprises a 83 IPTS / 128687595.1Attorney Docket No. KVN-007WO mixture of T cells (e.g., any T cells described herein). In some embodiments, a mixture of cells comprises CD4+ and / or CD8+ T cells. In some embodiments, a mixture of cells comprises CD4+ and CD8+ T cells. In some embodiments, a mixture of cells is obtained by enriching for CD4+ and CD8+ T cells, yielding an enriched mixture of CD4+ and CD8+ cells. In certain embodiments, the mixture of cells comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 20-30%, 20-40%, 20-50%, 20- 60%, 30-40%, 30-50%, or 30-60% of CD8+T cells (e.g., CD8+cytotoxic T cells) out of all T cells in the population. In certain embodiments, the mixture of cells further comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 1-70%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 30-40%, 30-50%, 30-60%, or 30-70% of CD4+T cells (e.g., CD4+helper T cells) out of all T cells in the population. In certain embodiments, the mixture of cells comprise CD8+T cells (e.g., CD8+cytotoxic T cells) and CD4+T cells (e.g., CD4+helper T cells) at a ratio of 1:5 to 5:1, 1:4 to 4:1, 1:3 to 3:1, 1:2 to 2:1, 1:5 to 2:1, 1:4 to 2:1, 1:3 to 1:1, or 1:2 to 1:1. In some embodiments, the mixture of cells comprise CD8+ T cells and CD4+ T cells at a ratio of about 1:2. In some embodiments, a host cell or mixture of host cells are expanded before introduction of an engineered nucleic acid or vector or plasmid comprising an engineered nucleic acid. In some embodiments, a host cell or mixture of host cells engineered by the method disclosed herein are useful as allogeneic cell therapy. Engineered Cells

[0292] The present disclosure provides, among other things, an engineered T cell comprising: (a) an engineered nucleic acid encoding a CAR (e.g., any CAR described herein), and (b) at least one genetic modification in each of a TRAC gene, a CIITA gene, and an HLA-A gene, wherein the at least one genetic modification eliminates or substantially reduces expression of the gene product.

[0293] In some embodiments, a genetic modification in a TRAC, CIITA, or HLA-A gene is located at or near (e.g., within 10 nucleotides from) a genomic coordinate shown in Table A. In some embodiments, both alleles of each gene is modified in the engineered T cell.

[0294] The methods of the present disclosure combine a series of steps to maximize the efficiency of both gene editing and lentivurs transfection, while minimizing undesirable genetic modifications. As such, the present disclosure also provides a population of engineered T cells in which at least 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 84 IPTS / 128687595.1Attorney Docket No. KVN-007WO 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the T cells include (a) the engineered nucleic acid encoding the CAR and (b) at least one genetic modification in each of a TRAC gene, a CIITA gene, and an HLA-A gene. In some embodiments, at least 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% of the T cells include (a) the engineered nucleic acid encoding the CAR and (b) at least one genetic modification in both allels of each of a TRAC gene, a CIITA gene, and an HLA-A gene.

[0295] In some embodiments, the genetic modification in the HLA-A gene is present in a genomic region according to a genomic coordinate from human reference genome hg38 as shown in Table A, corresponding to any one of SEQ ID NOs: 1-30. In some embodiments, the genetic modification of the HLA-A gene is present in the close vicinity of (e.g., within 10 nucleotides from) a genomic coordinate listed in Table A, corresponding to any one of SEQ ID NOs: 1-30. In some embodiments, the genetic modification in the HLA-A gene comprises a mutation in the genomic coordinate chr6:29942864-29942884. In some embodiments, the genetic modification in the HLA-A gene comprises a mutation in the close vicinity of (e.g., within 10 nucleotides from) the genomic coordinate chr6:29942864-29942884.

[0296] In some embodiments, the genetic modification in the CIITA gene is present in a genomic region according to a genomic coordinate from human reference genome hg38 as shown in Table A, corresponding to any one of SEQ ID NOs: 31-39. In some embodiments, the genetic modification of the CIITA gene is present in the close vicinity of (e.g., within 10 nucleotides from) a genomic coordinate listed in Table A, corresponding to any one of SEQ ID NOs: 31-39. In some embodiments, the genetic modification in the CIITA gene comprises a mutation in the genomic coordinate chr16:10906853-10906873. In some embodiments, the genetic modification in the CIITA gene comprises a mutation in the close vicinity of (e.g., within 10 nucleotides from) the genomic coordinate chr16:10906853-10906873.

[0297] In some embodiments, the genetic modification in the TRAC gene is present in a genomic region according to a genomic coordinate from human reference genome hg38 as shown in Table A, corresponding to any one of SEQ ID NOs: 40-54. In some embodiments, the genetic modification of the TRAC gene is present in the close vicinity of (e.g., within 10 nucleotides from) a genomic coordinate listed in Table A, corresponding to any one of SEQ ID NOs: 40-54. In some embodiments, the genetic modification in the TRAC gene comprises a mutation in the genomic coordinate chr14:22547524-22547544. In some embodiments, the 85 IPTS / 128687595.1Attorney Docket No. KVN-007WO genetic modification in the TRAC gene comprises a mutation in the close vicinity of (e.g., within 10 nucleotides from) the genomic coordinate chr14:22547524-22547544.

[0298] Any T cell described herein may be used as a host T cell for making engineered T cells. As used herein, a T cell or engineered T cell can be defined as a cell that expresses an αβ T cell receptor (“TCR” or “αβ TCR”) but not γδTCR, however in some embodiments, the TCR of a T cell may be genetically modified to reduce its expression (e.g., by genetic modification to the TRAC or TRBC genes), therefore expression of the protein CD3, which is a multi-subunit signaling complex that associates with the αβTCR, is also reduced. Thus, another T cell specific marker, CD5, may be used as a marker to identify a T cell by standard flow cytometry methods. Thus, a T cell may be referred to as CD5+. In some embodiments, a T cell is a cell that expresses a CD5+ marker and either a CD4+ or CD8+ marker. In some embodiments, the T cell is allogeneic.

[0299] In some embodiments, the T cell expresses the glycoprotein CD8 and therefore is CD8+ by standard flow cytometry methods and may be referred to as a “cytotoxic” T cell. In some embodiments, the T cell expresses the glycoprotein CD4 and therefore is CD4+ by standard flow cytometry methods and may be referred to as a “helper” T cell. CD4+ T cells can differentiate into subsets and may be referred to as a Th1 cell, Th2 cell, Th9 cell, Th17 cell, Th22 cell, T regulatory (“Treg”) cell, or T follicular helper cells (“Tfh”). Each CD4+ subset releases specific cytokines that can have either proinflammatory or anti-inflammatory functions, survival or protective functions. A T cell may be isolated from a subject by CD4+ or CD8+ selection methods.

[0300] In some embodiments, the T cell is a memory T cell. In the body, a memory T cell has encountered antigen. A memory T cell can be located in the secondary lymphoid organs (central memory T cells) or in recently infected tissue (effector memory T cells). A memory T cell may be a CD8+ T cell. A memory T cell may be a CD4+ T cell.

[0301] As used herein, a “central memory T cell” can be defined as an antigen- experienced T cell, and for example, may expresses CD62L and CD45RO. A central memory T cell may be detected as CD62L+ and CD45RO+ by Central memory T cells also express CCR7, therefore may be detected as CCR7+ by standard flow cytometry methods.

[0302] As used herein, an “early stem-cell memory T cell” (or “Tscm”) can be defined as a T cell that expresses CD27 and CD45RA, and therefore is CD27+ and CD45RA+ by standard flow cytometry methods. A Tscm does not express the CD45 isoform CD45RO, therefore a Tscm will further be CD45RO- if stained for this isoform by standard flow cytometry methods. A CD45RO- CD27+ cell is therefore also an early stem-cell memory T 86 IPTS / 128687595.1Attorney Docket No. KVN-007WO cell. Tscm cells further express CD62L and CCR7, therefore may be detected as CD62L+ and CCR7+ by standard flow cytometry methods. Early stem-cell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.

[0303] It is understood that a population of T cells can further comprise other cell types, for example, other lymphocytes derived from the blood. In some embodiments, T cells constitutes at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the population.

[0304] In some embodiments, the population of engineered T cells comprises a mixture of T cells having various features (e.g., any T cells described herein). In some embodiments, the population of engineered T cells comprises CD4+ and / or CD8+ T cells. In some embodiments, the population of engineered T cells comprises CD4+ and CD8+ T cells. In certain embodiments, the population of engineered T cells comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 20-30%, 20-40%, 20- 50%, 20-60%, 30-40%, 30-50%, or 30-60% of CD8+T cells (e.g., CD8+cytotoxic T cells) out of all T cells in the population. In certain embodiments, the population of engineered T cells further comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 1-70%, 10-20%, 10- 30%, 10-40%, 10-50%, 10-60%, 10-70%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 30- 40%, 30-50%, 30-60%, or 30-70% of CD4+T cells (e.g., CD4+helper T cells) out of all T cells in the population. In certain embodiments, the population of engineered T cells comprise CD8+T cells (e.g., CD8+cytotoxic T cells) and CD4+T cells (e.g., CD4+helper T cells) at a ratio of 1:5 to 5:1, 1:4 to 4:1, 1:3 to 3:1, 1:2 to 2:1, 1:5 to 2:1, 1:4 to 2:1, 1:3 to 1:1, or 1:2 to 1:1. In some embodiments, the population of engineered T cells comprise CD8+ T cells and CD4+ T cells at a ratio of about 1:2. Pharmaceutical Compositions

[0305] Also provided herein are compositions (e.g., pharmaceutical compositions) comprising any engineered T cell described herein described herein. In some embodiments, a provided pharmaceutical compositions can be formulated for intravenous administration. In some embodiments, a pharmaceutical composition of the present disclosure comprises any engineered T cell described herein with one or more pharmaceutically acceptable carriers, diluents, or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum 87 IPTS / 128687595.1Attorney Docket No. KVN-007WO hydroxide); and preservatives. Compositions of the present invention are in many embodiments formulated for intravenous administration.

[0306] Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials or an experienced medical practitioner. In some embodiments, the precise amount of a composition to be administered can be determined by a medical practitioner with consideration of individual differences in age, weight, tumor size, extent of infection or metastasis, and condition of the patient. Engineered T cells provided herein can be administered by using infusion techniques that are commonly known in immunotherapy, such as CAR-T therapy. Kits

[0307] Also provided herein are kits that include any of the compositions described herein. For example, a kit can include one or more of any of the nucleic acid constructs described herein. In other examples, a kit can include any of engineered T cell described herein or one or more doses of a composition including any engineered T cell described herein. In some embodiments, a kit can include instructions for performing any of the methods described herein. Therapeutic Methods

[0308] Any of the engineered cells and compositions described herein can be used in a method of treating a variety of diseases and disorders, as described herein. In some embodiments, the genetically modified cell (engineered cell) and / or population of genetically modified cells (engineered cells) and compositions may be used in methods of treating a variety of diseases and disorders. In some embodiments, a method of treating any one of the diseases or disorders described herein is encompassed, comprising administering any one or more composition described herein.

[0309] As described herein, engineered T cells of the present disclosure may be engineered from cells obtained from a donor, i.e., the cells to be engineered may be allogeneic. In some embodiments, the allogeneic donor T cells selected for engineering comprise matching HLA-B and HLA-C alleles with the cells of a recipient (e.g., a patient suffering from a disease or disorder, e.g., as described herein). In some embodiments, the 88 IPTS / 128687595.1Attorney Docket No. KVN-007WO allogeneic donor T cells are homozygous for HLA-B and HLA-C, thereby making HLA matching with a recipient easier. For example, in some embodiments, the donor T cells have a homozygous allele of HLA-B, and the recipient, either homozygous or heterozygous in HLA-B gene, has the HLA-B allele of the donor T cells. In some embodiments, the donor T cells have a homozygous allele of HLA-C, and the recipient, either homozygous or heterozygous in HLA-C gene, has the HLA-C allele of the donor T cells. In some embodiments, the donor T cells have a homozygous allele of HLA-B and a homozygous allele of HLA-C, and the recipient, either homozygous or heterozygous in HLA-B and HLA- C genes, has the HLA-B allele and the HLA-C allele of the donor T cells. Allogeneic T cells selected for matching HLA-B and HLA-C proteins may be used in any composition or method provided herein.

[0310] In some embodiments, the methods and compositions described herein may be used to treat diseases or disorders in need of delivery of a therapeutic agent. In some embodiments, the invention provides a method of providing an immunotherapy in a subject, the method including administering to the subject an effective amount of an engineered cell (or population of engineered cells) as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments.

[0311] In some embodiments, the methods comprise administering to a subject a composition comprising an engineered cell described herein as an adoptive cell transfer therapy.

[0312] In some embodiments of the methods, the method includes administering a lymphodepleting agent or immunosuppressant prior to administering to the subject an effective amount of the engineered cell (or engineered cells) as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments.

[0313] In some embodiments, a population of engineered cells may be used for immunotherapy. In some embodiments, the invention provides a method of treating a subject in need thereof that includes administering engineered cells prepared by a method described herein.

[0314] In some embodiments, the engineered cells can be used to treat cancer, infectious diseases, inflammatory diseases, autoimmune diseases, cardiovascular diseases, neurological diseases, ophthalmologic diseases, renal diseases, liver diseases, musculoskeletal diseases, or transplant rejections. In some embodiments, the engineered cells can be used in cell transplant, e.g., to the bone marrow. (See e.g., Deuse et al., Nature Biotechnology 37:252- 258 (2019).) In some embodiments, the present disclosure provides a method of treating an 89 IPTS / 128687595.1Attorney Docket No. KVN-007WO autoimmune disease, the method comprising administering to a subject in need thereof a therapeutically effective amount of engineered cells (e.g., engineered T cells) described herein. Exemplary autoimmune diseases include but are not limited to systemic lupus erythematosus, lupus nephritis, myasthenia gravis, Lambert-Eaton myasthenic syndrome, systemic sclerosis (a.k.a. scleroderma), multiple sclerosis, stiff person syndrome, autoimmune encephalitis (e.g., mediated by anti-DAGLA autoantibody), Sjogren’s syndrome, IgG4-related disease, and ANCA-associated vasculitis. In some embodiments, the present disclosure provides a method of reducing transplant (e.g., kidney transplant) rejection, the method comprising administering to a subject in need thereof a therapeutically effective amount of engineered cells (e.g., engineered T cells) described herein.

[0315] In some embodiments, the methods provide for administering the engineered T cells to a subject, wherein the administration is an injection. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is an intravenous injection or infusion. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is a single dose.

[0316] In some embodiments, the methods provide for reducing a sign or symptom associated of a subject’s disease treated with a composition disclosed herein. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than one week. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than two weeks. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than three weeks. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than one month.

[0317] In some embodiments, the methods provide for administering the engineered cells to an subject, and wherein the subject has a response to the administered cell that comprises a reduction in a sign or symptom associated with the disease treated by the cell therapy. In some embodiments, the subject has a response that lasts more than one week. In some embodiments, the subject has a response that lasts more than one month. In some embodiments, the subject has a response that lasts for at least 1-6 weeks. EXAMPLES

[0318] The following examples are put forth to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, 90 IPTS / 128687595.1Attorney Docket No. KVN-007WO and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their invention. Example 1. Preparation of Lipid Nanoparticles for Gene Editing and a Lentivirus Vector Encoding Hu19-CD828Z

[0319] This Example describes a method of preparing lipid nanoparticles (LNPs) that deliver nucleic acids encoding three CRISPR-Cas systems, and a lentivirus vector encoding an anti-CD19 CAR construct called Hu19-CD828Z.

[0320] Hu19-CD828Z was a fully human anti-CD19 CAR having an amino acid sequence of SEQ ID NO: 58. It included, from N-terminus to C-terminus, a single-chain variable fragment (scFv) of a fully human anti-CD19 monoclonal antibody called 47G4 (sequence described in U.S. Patent Application Publication No.2010 / 0104509), part of the extracellular region and all of the transmembrane region of human CD8α, the cytoplasmic (or intracellular) portion of human CD28, and the cytoplasmic (or intracellular) portion of human CD3 zeta. A lentivirus vector encoding Hu19-CD828Z was generated. This lentiviral vector, called KL-h198a28z, is a self-inactivating (SIN) vesicular stomatitis virus (VSV)-G pseudotyped 3rd generation lentiviral vector for expressing Hu19-CD828Z under an MSCV promoter (see FIG.12). The KL-h198a28z lentiviral vector was produced according to a standard protocol using HEK293T cells, which was transiently transfected with a state-of-the- art four-plasmid system, including a pLTG1292 plasmid for expressing a heterologous VSV- G protein under control of the cytomegalovirus (CMV) promoter.

[0321] Three LNPs were produced that target CIITA, HLA-A, and TRAC. Briefly, the RNA cargos of each LNP included a Cas9 mRNA and a single guide RNA (sgRNA) targeting CIITA, HLA-A, or TRAC. The sgRNA targeting CIITA was called G013675 and has the sequence of SEQ ID NO: 36. The sgRNA targeting HLA-A was called G018995 and has the sequence of SEQ ID NO: 3. The sgRNA targeting TRAC was called G013006 and has the sequence of SEQ ID NO: 48. The RNA cargos were dissolved in 25 mM citrate buffer, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL.

[0322] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NO: 56. When SEQ ID NO: 56 is referred to below with respect to RNAs, it is understood that T’s should be replaced with U’s (which were N1-methyl pseudouridines as described above). Messenger RNAs used in the Examples include a 5' cap and a 3' polyadenylation region, e.g., up to 100 nts. 91 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0323] The mRNA encoding Cas9 was capped, polyadenylated, and modified with N1- methyl pseudo-U by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing a T7 promoter, a sequence for transcription, and a polyadenylation sequence was linearized by incubating at 37°C for 2 hours with XbaI with the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and lx reaction buffer. The XbaI was inactivated by heating the reaction at 65°C for 20 min. The linearized plasmid was purified from enzyme and buffer salts. The IVT reaction to generate modified mRNA was performed by incubating at 37°C for 1.5-4 hours in the following conditions: 50 ng / μL linearized plasmid; 2-5 mM each of GTP, ATP, CTP, and N1-methyl pseudo-DTP (Trilink); 10-25 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase (NEB); 1 U / μL Murine RNase inhibitor (NEB); 0.004 U / μL Inorganic E. coli pyrophosphatase (NEB); and lx reaction buffer. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated for an additional 30 minutes to remove the DNA template. The mRNA was purified using a MegaClear Transcription Clean-up kit (ThermoFisher) or a RNeasy Maxi kit (Qiagen) per the manufacturers' protocols. Alternatively, the mRNA was purified through a precipitation protocol, which in some cases was followed by HPLC-based purification. Briefly, after the DNase digestion, mRNA is purified using LiCl precipitation, ammonium acetate precipitation and sodium acetate precipitation. For HPLC purified mRNA, after the LiCl precipitation and reconstitution, the mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol.39, No.21 el42). The fractions chosen for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above. In a further alternative method, mRNA was purified with a LiCl precipitation method followed by further purification by tangential flow filtration. RNA concentrations were determined by measuring the light absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis by Bioanlayzer (Agilent).

[0324] The lipid nucleic acid assemblies contained an ionizable lipid having the chemical name of ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propy1 octadeca-9,12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methy1)propy1 (9Z, 12Z)-octadeca-9, 12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a 50:39.5:9:1.5 molar ratio, respectively. The lipid nucleic acid assemblies were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6, and a ratio of gRNA to mRNA of 1:1 or 1:2 by weight. 92 IPTS / 128687595.1Attorney Docket No. KVN-007WO

[0325] LNP compositions were prepared using a cross-flow technique utilizing impinging jet mixing of the lipid in ethanol with two volumes of RNA solutions and one volume of water. The lipids in ethanol were mixed through a mixing cross with the two volumes of RNA solution. A fourth stream of water was mixed with the outlet stream of the cross through an inline tee (See, e.g., WO 2016010840, Figure 2). The LNP compositions were held for 1 hour at room temperature (RT), and further diluted with water (approximately 1:1 v / v). LNP compositions were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100kD MWCO) and buffer exchanged using PD-10 desalting columns (GE) into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS). Alternatively, the LNP's were optionally concentrated using 100 kDa Amicon spin filter and buffer exchanged using PD-10 desalting columns (GE) into TSS. The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNP was stored at 4°C or -80°C until further use. Example 2. Preparation of Engineered T Cells Deficient in CIITA, HLA-A, and TRAC and Incorporating a Lentivirus Vector Encoding Hu19-CD828Z

[0326] This Example describes a method of preparing a population of T cells by transfecting the T cells with lipid nanoparticles (LNPs) that deliver nucleic acids encoding three CRISPR-Cas systems and a lentivirus vector encoding an anti-CD19 CAR construct called Hu19-CD828Z.

[0327] The lentivirus vector (LV) and LNPs were contacted with T cells over a timeline from primary T cell collection to T cell harvest. Briefly, on Day 0 or Day 1, previously enriched CD8+and CD4+T cells were thawed following their prior isolation from peripheral blood mononuclear cell (PBMC) samples and activated. The T cells were activated using TransAct CD3 / CD28 beads on Day 1 and transfected under various conditions from Day 1 through Day 4. The T cells were expanded from Day 5 through up to Day 11. Residual CD3+cells were depleted from the population on Day 10 to remove any cells that continued to express TRAC.

[0328] Several conditions were tested and compared for LV transduction and LNP transfection. Briefly, the optimal timing for LV transduction relative to LNP transfection was tested. It was generally understood that pre-activation of T cells for 24-48 hours prior to LV transduction is required to achieve optimal rates of transgene integration. It was also understood that gene editing can be achieved with LNP transfection from the day of T cell activation (Day 1) through up to at least 3 days following (Day 4). In view of these factors, LV transduction was fixed at 24h post-activation, and we tested the efficiency of LV 93 IPTS / 128687595.1Attorney Docket No. KVN-007WO transduction at both low and high MOI in combination with LNP transfection in multiple conditions, according to Table 1 below. Following transfections, cells were expanded out to Day 9, at which time they were analyzed for CAR expression by flow cytometry as a readout of LV transduction efficiency. Table 1. Transfection conditions for genetically engineering T cells Day 1 Day 2 Day 3 Day 4 Condition 1: LV - Lentivirus (Low - - P P P P

[0329] As seen in FIG.1, LV transduction was highest in the absence of any LNP transfection. LV transduction decreased most dramatically when LNP was added on the same day as LV. A high MOI was unable to overcome the negative impact of LNP on CAR integration. These results led us to test further conditions for timing of LNP and LV where LV transduction was done on a separate day from LNP transfections.

[0330] The data above showed a negative impact of LNP transfection on LV transduction, but the tested conditions did not reveal whether this was specifically due to the LNP transfection on the day before or the day after LV transduction. To answer this question, we performed another experiment where LNPs were transduced both 24 h before and after LV transduction (as in the prior experiment), and compared this to LV transduction when all LNPs were given 24 h after LV transduction (Condition 2 versus Condition 3 in Table 2 below). Table 2. Transfection conditions for genetically engineering T cells 94 IPTS / 128687595.1Attorney Docket No. KVN-007WO Day 1 Day 2 Day 3 Condition 1 - Lentivirus -. , p p on reduced CAR expression as compared to LV transduction alone, in keeping with the previous data. However, when LNP transduction was delayed and carried out only after LV transduction was complete, minimal impact was seen on CAR expression. This suggests that LNP transfection 24 h prior to LV transduction has an inhibitory effect on viral integration. Without wishing to be bound by theory, it is hypothesized that LNP transfection impeded viral entry into the cells when delivered prior to the LV, whereas when LNP is given 24 h following LV transfection, LV entry may have occurred and thus no inhibitory effect was observed.

[0332] Inclusion of an additional control in this study (Condition 4 in Table 2), allowed us to also examine the impact of LV transduction on the efficiency of LNP editing. FIG.2B shows that LV transduction 24h prior to LNP transfection has an inhibitory effect on editing efficiency across all 3 target genes. This suggests that the hypothesized competition for cell entry between LV and LNP goes in both directions.

[0333] In addition to the results above, a number of other considerations informed the design of the next conditions tested in the design of the process. For example, to minimize the risk of chromosomal translocation between edit sites, knockout of the three endogenous genes was done step-wise with at least about 24 hours between any two edits. It was also understood that TRAC knockout early in the process may reduce T cell survival and proliferation, as these cells were expected to be less responsive to the T cell activation agent. As a result, the T cells deficient in TRAC expression may be outcompeted by other T cells during lengthy cell cultivation. It was also observed that editing efficiency decreases with increasing time from T cell activation. In other words, for any of the three target genes, LNP 95 IPTS / 128687595.1Attorney Docket No. KVN-007WO transfection on the day of T cell activation (Day 1) led to higher knockout rates than adding the same LNP on Day 3 of the process, which was higher editing still than adding on Day 4 (data not shown). Since we intended to deplete residual TRAC+unedited cells at the end of the production process, we chose to fix TRAC editing as the final edit on Day 4 to favor higher editing efficiencies for HLA-A and CIITA by transfecting those LNPs on Days 1 and 3. In addition, it was understood that transfection of the CIITA-targeting LNP G013675 and the HLA-A-targeting LNP G018995 should preferably be separated by at least 48 hours. In view of all the factors above, two specific orders of transfection were assessed, according to Table 3 below. Table 3. Transfection conditions for genetically engineering T cells Day 1 Day 2 Day 3 Day 4 Condition 1A CIITA-targeting Lentivirus HLA-A- TRAC-targeting g g g g g

[0334] Table 3 also includes the fold concentration of each LNP used on Day 1 and Day 3 of the process. Based on the results described above showing the competitive interplay between LNP transfection and LV transduction, we hypothesized that by adjusting the concentrations of LNP used in the manipulations 24 h before and after LV transduction, we could identify a balanced process that maximized both CAR integration and editing efficiency. LV concentration was fixed at MOI 10. LNPs used at Day 1 and Day 3 were tested at a concentration pre-determined to achieve optimal editing in prior titration experiments done in the absence of LV transduction (1x, 2.5 µg / mL of total RNA content), 96 IPTS / 128687595.1Attorney Docket No. KVN-007WO and at concentrations 2- and 4-fold higher (2x, 4x). Increasing LNP concentrations correlated with improved knock-out efficiencies for the targeted genes and did not impact the efficiency of CD3+depletion at the end of culture as seen in the high percentage of TRAC KO cells (FIG.3A). However, increasing the concentration of the Day 1 LNP had a dose-dependent negative impact on the efficiency of LV transduction as seen in the percentage of CAR+cells (FIG.3B). Thus, increasing the concentration of only the Day 3 LNP resulted in the optimal balance between LV transduction and LNP editing efficiencies to produce the highest frequency of triple knock-out CAR+cells in the final cell product.

[0335] In view of the results above, Condition 2B was selected for further studies. Example 3. Characterization of Genetically Engineered T cells

[0336] This Example assessed genetically engineered T cells produced by the method of Example 1 above, under Condition 2B. Factors specifically assessed included cell expansion, knockout efficiency, CAR expression, cytotoxic activity, resistance to host immune rejection in vitro and in vivo, genotoxic event, and oncogenic transformation. In Vitro CAR T Cell Functionality

[0337] Briefly, five lots of KYV-201 engineered T cells, expressing anti-CD19 CAR construct Hu19-CD828Z, were generated from CD4+and CD8+T cells isolated from healthy donor (HD) PBMCs under Condition 2B as described above. These conditions resulted in robust cell expansion, high knockout efficiency for all three target genes and suitable levels of CAR integration (FIG.4).

[0338] Three of the five lots were further tested in in vitro assays to demonstrate their functionality as CAR T cells. Additional T cell types were generated from the same donors as controls. These included mock edited / untransduced T cells, CAR alone (LV only) and 3KO (edited only) controls. T cells were co-cultured overnight with target cells. Target cells were either the human ALL cell line NALM6 (known to express high levels of CD19) or the human T lymphoblast cell line CEMC / C1 that does not express CD19, at Effector:Target (E:T) ratios ranging from 0.1:1 to 3:1 and in triplicate. Effector and target cells alone were included as negative controls. After 24 h co-incubation, the amount of cytokines in the supernatant and the number of live target cells were quantitated.

[0339] KYV-201 cells showed CAR-mediated cytotoxicity, cytokine release, and proliferation in a CD19-dependent manner. Cytotoxicity was demonstrated by robust and dose-dependent cytotoxicity against the CD19+NALM6 cell line and minimal cytotoxicity 97 IPTS / 128687595.1Attorney Docket No. KVN-007WO against the CEM / C1 CD19- cell line (FIGs.5A-5C). This cytotoxicity was in-line with that observed for unedited CAR T cells, suggesting that the LNP edits had no effect on CAR functionality.

[0340] All three lots of KYV-201 cells also showed CD19-mediated and dose-dependent production of interferon gamma (IFNγ) and IL-2, which are directly related to T cell activation and / or T cell-mediated cytotoxicity, upon co-culture with CD19+NALM6 cells but not with the CD19- CEM / C1 cells (FIGs.6A-6F).

[0341] For the target-dependent CAR-mediated proliferation studies, the same sets of KYV-201 cells and donor-matched control T cells were co-cultured for 96 hours with the same set of CD19+and CD19- target cells (as described herein). Effector and target cells alone were included as negative controls. After co-incubation, the frequency of Cell Trace Violet (CTV) dim proliferating effector cells was quantified. KYV-201 cells showed CAR- mediated and CD19-specific proliferation comparable to that of unedited CAR T cells (FIGs. 7A-7C).

[0342] The data demonstrate that KYV-201 T cells exhibit CAR-mediated and CD19- dependent cytotoxicity, cytokine release, and cellular proliferation as demonstrated by activity during co-culture with CD19+cancer cells (NALM6 cells) but not control CD19- cells (CEM / C1). The results from the cytotoxicity (FIGs.5A-5C), cytokine release (FIGs.6A-6F) and proliferation assay (FIGs.7A-7C) showed clear target-mediated response demonstrating that the activity of KYV-201 CAR T cells and unedited CAR T cell samples is comparable. In Vivo CAR T Cell Activity

[0343] As an extension of the in vitro functional data described herein, we next sought to demonstrate the function of KYV-201 CAR T cells as compared to unedited CAR T cells in an in vivo tumor model. Immunodeficient NSG mice were subcutaneously implanted with 3e6 CD19+NALM6 tumor cells in the rear flank. When the average tumor size reached 175 mm3, mice were randomized based on tumor size and CAR T cells were injected intravenously at doses of 1e6, 3e6 or 9e6 CAR+T cells, with 10 mice in each treatment group. Tumor-bearing mice receiving either no T cells or mock edited / untransduced wild- type (WT) T cells were included as control groups.

[0344] Following T cell transfer, tumor size was measured every 2 to 3 days to assess the effects of T cells on tumor growth. WT T cells had no effect on tumor growth (FIG.8A). Edited KYV-201 CAR T cells and unedited CAR T cells both had a minimal impact on tumor growth at the 1e6 CAR+T cell dose; however, tumor growth was significantly slowed at the 98 IPTS / 128687595.1Attorney Docket No. KVN-007WO 3e6 CAR+T cell dose and completely abrogated at the 9e6 CAR+T cell dose. At all doses, KYV-201 CAR T cells and unedited CAR T cells showed equivalent activity, demonstrating that editing has no impact on the in vivo functionality of KYV-201 CAR T cells.

[0345] To monitor the expansion and persistence of the CAR T cells in vivo, animals on study were bled on Day 9, 16 and 23 post-T cell transfer to measure the frequency of CAR+T cells in circulation. At the highest dose (9e6 CAR+T cells), peak detection of CAR+T cells occurred at Day 9 for both edited and unedited CAR T cells (FIG.8B). Cell numbers dropped at subsequent time points but were still detectable for this dose at Day 23. At the 3e6 CAR+T cell dose, kinetics were slightly delayed as compared to the high dose group, with peak detection occurring at Day 16 and then dropping to barely detectable levels by Day 23. No robust expansion was observed in the 1e6 CAR+T cell dose groups or in the WT T cell control group.

[0346] In another experiment, the in vivo activity of KYV-201 was assessed using a human CD19+ B cell acute lymphoblastic leukemia NSG xenograft mouse model. Female NSG mice were inoculated intravenously with 1×106NALM6 luciferase-tagged cells on Day -7. On Day 0, mice received one of three KYV-201 doses (0.3×106, 1×106, or 3×106CAR+T cells), or an equivalent dose of unedited CAR T cells via a single intravenous injection. Donor-matched mock-transduced T cells (Mock) were dosed as a negative control at an equivalent total T-cell number as the KYV-201 high dose. Total photon flux was measured every 3–4 days via bioluminescence imaging as a measure of tumor growth. Quantification of total photon flux is shown in FIG.13. No statistically significant differences were observed between KYV-201 and unedited CAR T at all doses tested by Tukey’s multiple comparison test (p>0.05).

[0347] Taken together, the impact of KYV-201 CAR T cells on tumor growth (FIGs.8A and 13) and their expansion and contraction in peripheral blood (FIG.8B) demonstrate an in vivo functionality that is indistinguishable from that of unedited CAR T control cells. Protection from Host Rejection of KYV-201 CAR T cells by HLA-A and CIITA Editing

[0348] We next tested KYV-201 cells in a series of in vitro assays to demonstrate the ability of edited cells to mitigate immune responses by allogeneic T and NK cells.

[0349] Three lots of KYV-201 engineered T cells (“donor”) were co-cultured overnight with allogeneic NK cells (“host”) in triplicate at Host:Donor ratios ranging from 1.25:1 to 10:1. WT unedited / untransduced T cells from the same donor as KYV-201 served as a negative control for background killing. As a positive control for T cell lysis, B2M KO cells 99 IPTS / 128687595.1Attorney Docket No. KVN-007WO were also generated from the same KYV-201 donor. B2M KO cells went through the same editing and transduction process as KYV-201, with the exception that the HLA-A edit was switched to an LNP targeting B2M, resulting in the loss of expression of all HLA Class I molecules from the cell surface in addition to the HLA Class II loss mediated by CIITA knock-out. As a result, the KYV-201 cells lost expression of HLA-A, all HLA Class II, and TRAC, whereas the B2M KO cells lost expression of all HLA Class I, all HLA Class II, and TRAC. As HLA Class I (including HLA-B and HLA-C) on target cells serves as an inhibitory signal to NK cells, the B2M KO cells were more sensitive to cytotoxicity of NK cells than KYV-201, which retained HLA-B and HLA-C expression. As a further positive control for the assay, K562 tumor cells, which are known to be effectively killed by NK cells, were also used as “donor” cells.

[0350] Following overnight co-culture, the number of live donor target cells was quantified by flow cytometry and normalized to target cells cultured alone to determine the percent cytolysis of the NK cells against the donor. NK cells showed high cytolytic activity against K562 cells as expected and also against B2M KO T cells, especially at high host to donor ratios (FIG.9A). In contrast, cytolytic activity against KYV-201 cells was minimal and overlapped with background levels seen against WT T cells. When data was further normalized to the background cytolysis seen against WT T cell controls, specific cytolysis against B2M KO T cells was significantly higher than that seen against KYV-201 cells (FIG. 9B). This suggests that the HLA-A knockout strategy employed by KYV-201 reduces HLA Class I expression without triggering the NK rejection mediated by the absence of HLA Class I.

[0351] In another experiment, KYV-201, unedited CAR T cells, and triple edited CAR-T cells lacking the CIITA, TRAC, and B2M genes were co-cultured overnight with allogeneic NK cells at four NK:T ratios. Percent survival was determined by flow cytometry. The percent (%) survival of donor cells was calculated as (Co-culture Sample / Corresponding Donor T cell only) ×100. As shown in FIG.14, no statistically significant differences were observed between KYV-201 and unedited CAR T at all ratios tested by Tukey’s multiple comparison test (p>0.05). In contrast, the CIITA, TRAC, and B2M triple edited CAR-T cells were substantially killed by the allogeneic NK cells. This result confirms that the HLA-A knockout strategy while retaining the expression of HLA-B and HLA-C protects the CAR-T cells from NK rejection.

[0352] While the persistence of HLA Class I molecules HLA-B and HLA-C protects KYV-201 cells from NK-mediated cytolysis, this approach leaves the possibility for KYV- 100 IPTS / 128687595.1Attorney Docket No. KVN-007WO 201 cells to be rejected via host T cell responses to alloantigens. The host T cell allo-response can be minimized by matching HLA-B and HLA-C between the host and donor. Protection of KYV-201 cells from alloreactive T cell-mediated rejection is demonstrated in a prime- challenge mixed lymphocyte reaction (MLR). Briefly, alloreactive T cells were pre-enriched from host PBMCs by a one week co-culture of host PBMCs with irradiated donor PBMCs at a 1:1 ratio. Alloreactive host T cells proliferate during this time and are subsequently enriched with pan-T cell isolation. These “primed” alloreactive host T cells were then “challenged” with KYV-201 T cells in a two day co-culture at Host:Donor ratios ranging from 0.25:1 to 2:1. Cytotoxic allo-rejection of the donor CAR T cells was determined by measuring the percent survival (as compared to donor CAR T cells cultured alone) by flow cytometry. Additional donor-matched T cell types tested as benchmarks for KYV-201 included CAR T cells with only the TRAC edit but not CIITA or HLA-A edits (TRAC KO), CAR T cells with B2M edit in lieu of HLA-A and thus carrying total HLA Class I and Class II disruption (B2M KO), and T cells that were autologous to the host and would thus elicit no rejection response.

[0353] As seen in the representative host:donor pair shown in FIG.10A, donor CAR T cells carrying only TRAC KO were efficiently killed by the primed host T cells. As anticipated, no response was seen against T cells autologous to the host. Rejection responses against B2M KO control T cells was highly attenuated as compared to TRAC KO T cells. Primed host T cell responses to KYV-201 CAR T cells were more similar to those seen against B2M KO CAR T cells than those against TRAC KO CAR T cells across 5 host-donor pairs tested (FIG.10B). These data demonstrate that the approach of knocking out CIITA and HLA-A combined with matching for remaining Class I molecules HLA-B and HLA-C results in effective protection of edited CAR T cells against alloreactive T cell-mediated rejection. KYV-201 CAR-Mediated Functionality in an Allogeneic Setting

[0354] Lastly, the ability of KYV-201 cells to deplete allogeneic primary B cells was tested in a prolonged co-culture of KYV-201 CAR T cells with primary B cell-containing PBMCs. Host PBMCs in this set-up contained both T cells and NK cells capable of mediating allo-responses, so this assay asked whether CAR T cell depletion of B cells was impeded by host recognition and rejection of the allogeneic cell product. Host PBMCs and KYV-201 or WT control donor T cells were separately labeled with different colors of Cell Trace Dye to monitor cell proliferation. Donor T cells and host PBMCs were co-cultured at multiple ratios 101 IPTS / 128687595.1Attorney Docket No. KVN-007WO for either 3 or 6 days and then assessed for host cell activation, donor T cell survival and cytolysis of host B cells by flow cytometry. While host T and NK cell activation was evident by their proliferation seen via Cell Trace dilution, any potential rejection of donor CAR T cells was masked by the concomitant activation and proliferation of the CAR T cells responding to the target B cells (data not shown). At the 8:1 PBMC:Donor T cell ratio, partial cytolysis of host B cells was seen at day 3 of co-culture and approached 100% by day 6 (FIG.11). These data demonstrate that the kinetics of KYV-201 killing of primary B cells outpaces a rejection response against the allogeneic CAR T cells.

[0355] In another experiment, KYV-201, triple edited T cells not transduced with a lentivirus vector encoding the anti-CD19 CAR, and B2M KO CAR T cells from 3 different donors were co-cultured for 6 days with allogeneic total PBMCs from healthy donors (HD) (n=3) or SLE patients (n=3) at a CAR-T cell to PBMC ratio of 1:30. Final CAR+T cell counts were determined by flow cytometry at the end of co-culture and fold explansion was calculated. As shown in FIG.15A, the KYV-201 cells underwent robust proliferation when co-cultured with PBMCs from either healthy donors or SLE patients. Cytotoxicity of the CAR-T cells against allogeneic primary B cells within PBMCs was determined by flow cytometry and calculated as % Cytotoxicity = (1 – Sample of interest B cell count / allogeneic B cells within PBMCs alone)×100. As shown in FIG.15B, the KYV-201 cells effectively killed over 80% of the allogeneic primary B cells in the PBMCs from either healthy donors or SLE patients. Lack of Genotoxic Events or Oncogenic Transformation in KYV-201

[0356] KYV-201 cells was cultured in the presence or absence of 200 IU / mL of recombinant human IL-2. Viable cell numbers were determined and plotted as fold expansion from starting cell number. As shown in FIG.16A, KYV-201 did not expand in the absence of cytokine. This result indicates that the KYV-201 cells did not include significant oncogenic transformation that would lead to IL-2 independent proliferation.

[0357] Genomic DNA derived from KYV-201 cells prepared using cells from multiple donors, or donor-matched unedited control T cells, was subjected to the ddPCR chromosomal translocation assay. Six potential TRAC, CIITA, and HLA-A translocation combinations were assessed using specific primer pairs, and the percentage of positive cells was calculated and plotted. As shown in FIG.16B, all events fell below a threshold frequency of 0.5%.

[0358] In addition, G-banding was performed on KYV-201 and donor-matched unedited T cells. 100 spreads were analyzed per sample and p-values were calculated by Fisher’s test. 102 IPTS / 128687595.1Attorney Docket No. KVN-007WO The results summarized in Table 4 revealed minimal levels of translocations or chromosomal abnormalities in KYV-201, suggesting a low risk of off-target editing. Table 4. Percentage of Cells with Karyotype Event Categories: Unedited KYV-201 p-value (Mean ± SD) (Mean ± SD)

[0359] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes. 103 IPTS / 128687595.1Attorney Docket No. KVN-007WO SEQUENCE TABLES Table A: Guide RNAs Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Se uence NO Se uence* s (h 38) 2 2 2 2104 IPTS / 128687595.1Attorney Docket No. KVN-007WO Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Sequence NO Sequence* s (hg38) 2 2 3105 IPTS / 128687595.1Attorney Docket No. KVN-007WO Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Sequence NO Sequence* s (hg38) 3 3 4 9106 IPTS / 128687595.1Attorney Docket No. KVN-007WO Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Sequence NO Sequence* s (hg38) 0 0 4107 IPTS / 128687595.1Attorney Docket No. KVN-007WO Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Sequence NO Sequence* s (hg38) 5 4 5 5108 IPTS / 128687595.1Attorney Docket No. KVN-007WO Guide SE Guide SE Exemplary SEQ Exemplary gRNA Genomic ID Q Sequenc Q gRNA Full ID Modified Coordinate ID e ID Sequence NO Sequence* s (hg38)Table B: Cas9 Sequences Name SEQ Sequence ID A C A A T C T G C G G T C C T G T A C G T C A A AIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO C G A C A G A T G A C G T C A G A G A G A G T A T A A A G C G T A G C A G C A G CIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO C A C A A G T A T T C C C A T G G G C A C G C C G A A A A C C T G G CIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO G T G C G A A C T C T C T G G A G G C G A C A G C C C A C G F F L K P I I L AIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO G G I K W K R Q II A G C G G A U U G U A G A U C U A A C A U C A A C U U U A A A U A U A CIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO U C A A U U A A A A A C A G A A A C C C C A C A G C G C U G A A A C G G U A G A G G A A U114 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO A G G G U A C GName SEQ Sequence ID R S G S E T G R R L T G T A C G G T G G A A115 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO C T C A T A A A G T Q S Q Q G I C116 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO M L Q G I C C G G C T A A C T T G C G G C C G117 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO A D K A C C G G R A R K K T K A C118 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO G D V119 IPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NOName SEQ Sequence ID C C C A m C A U A A m C A m A A m mIPTS / 128687595.1Attorney Docket No. KVN-007WO Name SEQ Sequence ID NO m AName SEQ Sequence ID121 IPTS / 128687595.1

Claims

Attorney Docket No. KVN-007WO CLAIMS 1. A population of engineered T cells, wherein at least 10% of the T cells each comprise: (a) an engineered nucleic acid encoding a chimeric antigen receptor (CAR) that comprises the amino acid sequence of SEQ ID NO: 58; and (b) a genetic modification in a TRAC gene, a genetic modification in a CIITA gene, and a genetic modification in an HLA-A gene, wherein the genetic modifications eliminate or substantially reduce the expression of the respective genes.

2. The population of engineered T cells of claim 1, wherein the genetic modification in the TRAC gene comprises a mutation in the genomic coordinate chr14:22547524-22547544.

3. The population of engineered T cells of claim 1 or 2, wherein the genetic modification in the CIITA gene comprises a mutation in the genomic coordinate chr16:10906853- 10906873.

4. The population of engineered T cells of any one of claims 1-3, wherein the genetic modification in the HLA-A gene comprises a mutation in the genomic coordinate chr6:29942864-29942884.

5. The population of engineered T cells of any one of claims 1-4, wherein the nucleic acid encoding the CAR is operably linked to a murine stem cell virus (MSCV) U3 promoter.

6. The population of engineered T cells of any one of claims 1-5, comprising a CD4+ T cell and a CD8+ T cell.

7. The population of engineered T cells of any one of claims 1-6, wherein at least 15%, at least 20%, at least 25%, or at least 30% the T cells each comprise (a) and (b) of claim 1.

8. A method of engineering a population of T cells, the method comprising steps of: (a) contacting the T cells with a first lipid nanoparticle (LNP) comprising: (i) a guide RNA (gRNA) sequence that is complementary to an HLA-A gene sequence; and 122 IPTS / 128687595.1Attorney Docket No. KVN-007WO (ii) an RNA encoding a first Cas polypeptide; (b) contacting the T cells with a lentivirus vector that comprises a nucleic acid encoding a CAR comprising the amino acid sequence of SEQ ID NO: 58; (c) contacting the T cells with a second LNP comprising: (i) a gRNA sequence that is complementary to a CIITA gene sequence; and (ii) an RNA encoding a second Cas polypeptide; (d) contacting the T cells with a third LNP comprising: (i) a gRNA sequence that is complementary to a TRAC gene sequence; and (ii) an RNA encoding a third Cas polypeptide, wherein the steps are taken in the order of (a) → (b) → (c) → (d) or (c) → (b) → (a) → (d), and in either order, the second step begins 16-32 hours after initiation of the first step, and the third step begins 16-32 hours after initiation of the second step, thereby to produce a population of engineered T cells.

9. The method of claim 8, wherein the first Cas polypeptide, the second Cas polypeptide, and / or the third Cas polypeptide are Cas9 polypeptides.

10. The method of claim 9, wherein the first Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide.

11. The method of claim 10, wherein the HLA-A gRNA comprises the guide sequence of SEQ ID NO:

1.

12. The method of claim 10 or 11, wherein the HLA-A gRNA comprises the nucleic acid sequence set forth in SEQ ID NO:

3.

13. The method of any one of claims 9-12, wherein the second Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide.

14. The method of claim 13, wherein the CIITA gRNA comprises the guide sequence of SEQ ID NO:

34. 123 IPTS / 128687595.1Attorney Docket No. KVN-007WO 15. The method of claim 13 or 14, wherein the CIITA gRNA comprises the nucleic acid sequence set forth in SEQ ID NO:

36.

16. The method of any one of claims 9-15, wherein the third Cas polypeptide is a Streptococcus pyogenes Cas9 polypeptide.

17. The method of claim 16, wherein the TRAC gRNA sequence comprises the guide sequence of SEQ ID NO:

46.

18. The method of claim 16 or 17, wherein the TRAC gRNA sequence comprises the nucleic acid sequence set forth in SEQ ID NO:

48.

19. The method of any one of claims 8-18, wherein the RNA encoding the first Cas polypeptide, the RNA encoding the second Cas polypeptide, and the RNA encoding the third Cas polypeptide are each a messenger RNA (mRNA).

20. The method of claim 19, wherein the gRNA and the mRNA in each LNP are at a weight ratio of about 1:

1.

21. The method of any one of claims 8-20, wherein the first LNP, the second LNP, and / or the third LNP are formulated with an amine-to-RNA-phosphate (N:P) ratio of about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6.0, or about 6.

5.

22. The method of claim 21, wherein the N:P ratio is about 6.

0.

23. The method of any one of claims 8-22, wherein the first LNP, the second LNP, and / or the third LNP comprise ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, cholesterol, DSPC, and PEG2k-DMG in a 50:39.5:9:1.5 molar ratio, respectively.

24. The method of any one of claims 8-23, wherein the steps are taken in the order of (a) → (b) → (c) → (d). 124 IPTS / 128687595.1Attorney Docket No. KVN-007WO 25. The method of claim 24, wherein the T cells are contacted with the first LNP, the second LNP, and the third LNP at concentrations of 2.5 µg / mL, 5 µg / mL, and 2.5 µg / mL respectively, of total RNA content.

26. The method of any one of claims 8-23, wherein the steps are taken in the order of (c) → (b) → (a) → (d).

27. The method of claim 26, wherein the T cells are contacted with the second LNP, the first LNP, and the third LNP at concentrations of 2.5 µg / mL, 5 µg / mL, and 2.5 µg / mL respectively, of total RNA content.

28. The method of any one of claims 8-27, wherein the lentivirus is contacted with the T cells at a multiplicity of infection (MOI) of 10.

29. The method of any one of claims 8-28, wherein the nucleic acid encoding the CAR is operably linked to a murine stem cell virus (MSCV) U3 promoter.

30. The method of any one of claims 8-29, wherein the population of engineered T cells comprise a CD4+ T cell and a CD8+ T cell.

31. The method of any one of claims 8-30, further comprising a step of: (e) contacting the T cells with one or more agents that activate CD3 and CD28.

32. The method of claim 31, wherein the the one or more agents that activate CD3 and / or CD28 comprise an anti-CD3 antibody, an anti-CD28 antibody, or both.

33. The method of claim 31 or 32, wherein step (e) begins 16-32 hours before initiation of step (b).

34. The method of any one of claims 8-33, further comprising steps of: (f) expanding the population of engineered T cells; and (g) depleting CD3+ cells from the expanded population. 125 IPTS / 128687595.1Attorney Docket No. KVN-007WO 35. The method of any one of claims 8-33, further comprising a step of: (f) depleting CD3+ cells from the population of engineered T cells.

36. A population of T cells produced by the method of any one of claims 8-35.

37. A pharmaceutical composition comprising the population of engineered T cells of any one of claims 1-7 or the population of T cells of claim 36.

38. The pharmaceutical composition of claim 37, wherein the T cells express a complex of an HLA-B and β2-microglobulinon on the plasma membrane.

39. The pharmaceutical composition of claim 37 or 38, wherein the T cells express a complex of an HLA-C and β2-microglobulinon on the plasma membrane.

40. The pharmaceutical composition of any one of claims 37-39, wherein the T cells are homozygous for HLA-B and HLA-C.

41. A method of treating a disease or disorder in a subject, the method comprising administering the pharmaceutical composition of any one of claims 37-40.

42. The method of claim 41, wherein the T cells are allogeneic to the subject.

43. The method of claim 41 or 42, wherein the T cells are administered by intravenous infusion.

44. The method of any one of claims 41-43, wherein the disease or disorder is an autoimmune diseases or disorder. 126 IPTS / 128687595.1