Engineered bacteria for improving soil quality
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- CROBIO LTD
- Filing Date
- 2024-08-30
- Publication Date
- 2026-07-08
AI Technical Summary
Current methods for improving soil quality, such as applying sugar bags, provide only transient and limited benefits, and can lead to imbalances in the soil microbiome and potential issues like pest attraction and pH alteration.
Genetically engineered bacteria that overexpress genes involved in the synthesis and secretion of extracellular polymeric substances (EPS), such as cellulose, are introduced into the soil. These bacteria increase water retention, enhance organic carbon sequestration, and promote plant health by converting sugars into cellulose, which acts as a sugar sink and gradually breaks down into glucose, sustaining soil health.
The engineered bacteria lead to a sustainable increase in soil sugar content, supporting a healthy soil microbiome, improving soil structure, and enhancing crop yields by maintaining continuous regeneration of soil health and productivity.
Smart Images

Figure IMGF000033_0001 
Figure IMGF000045_0001 
Figure IMGF000046_0001
Abstract
Description
[0001] ENGINEERED BACTERIA FOR IMPROVING SOIL QUALITY
[0002] Field of the Invention
[0003] The present invention relates to genetically engineered bacteria that are modified to produce an elevated level of extracellular polymeric substances, such as cellulose. The engineered bacteria of the invention find use in enhancing soil quality, specifically by increasing glucose levels in the soil in a sustainable manner thereby supporting a healthy soil microbiome.
[0004] Background
[0005] The soil microbiome plays a crucial role in influencing crop growth through various mechanisms such as nutrient cycling and availability, disease suppression, plant hormone production, stress tolerance and by supporting soil structure and aggregation.
[0006] Soil microbes are involved in the decomposition of organic matter and the cycling of nutrients. They break down complex organic compounds into simpler forms that can be readily absorbed by plants. For example, bacteria and fungi decompose dead plant material and animal waste, releasing nutrients such as nitrogen, phosphorus, and potassium back into the soil. These nutrients are essential for plant growth and development. Soil microbes also help in solubilizing and mineralizing nutrients that are otherwise locked up in the soil. Some microbes produce enzymes that break down organic matter and release bound nutrients, making them available for plant uptake. For instance, mycorrhizal fungi form symbiotic relationships with plant roots and enhance the absorption of nutrients, particularly phosphorus, from the soil.
[0007] Certain soil microbes are known as biocontrol agents. They can suppress plant pathogens and protect crops from diseases by competing with pathogenic organisms for resources, producing antimicrobial compounds, or inducing plant defenses. This helps maintain a healthy root system and prevents diseases that can negatively impact crop growth.
[0008] Soil microbes can produce or influence the production of plant growth-promoting hormones such as auxins, cytokinins, and gibberellins. These hormones regulate various physiological processes in plants, including cell division, elongation, and differentiation, which ultimately affect plant growth and development.
[0009] Some soil microbes can enhance a plant's tolerance to abiotic stresses such as drought, salinity and temperature extremes by improving the plant's water and nutrient uptake efficiency, by producing compounds that scavenge harmful free radicals, or by triggering stress response mechanisms in plants. Soil microbes contribute to the formation and stabilization of soil aggregates, which improve soil structure. Well-aggregated soil allows better root penetration, aeration, and water movement, facilitating nutrient uptake by plants. It also helps prevent soil erosion and improves water holding capacity.
[0010] Sugar and the Soil Microbiome
[0011] The sugar content of soil can affect the soil microbiome. Sugars are a carbon sources that can fuel metabolic activity and support the growth of microbial communities. This can lead to increased microbial biomass, higher rates of nutrient cycling, and faster decomposition of organic matter. Conversely, a decrease in sugar availability may limit microbial growth and metabolic activity. The sugar content of soil can also impact the types and abundance of microbial species present in the soil. Certain microbes, such as sugar-fermenting bacteria and fungi, thrive in sugar-rich environments. As a result, an increase in sugar content can support some populations of the microbial community.
[0012] Changes in the sugar content of soil may also indirectly affect the interactions between different microbial species. For example, sugar-rich environments can favor the growth of certain microbial groups, which may compete with or inhibit the growth of other microbial groups. This can alter the overall microbial community dynamics and impact the functional diversity of the soil microbiome.
[0013] Moreover, the sugar content of soil can influence plant-microbe interactions. Many plants release sugars and other carbon compounds through their roots, known as root exudates. These root exudates can attract specific microbial species, forming beneficial symbiotic relationships, such as mycorrhizal associations. Changes in sugar availability can affect the composition of root exudates, altering the recruitment of specific microbial species and potentially impacting plant-microbe interactions.
[0014] Sugars are an important component of the organic matter in the soil and higher sugar content can contribute to increased organic matter accumulation in the soil. Organic matter serves as a food source for soil microbes and promotes microbial diversity and activity. It also enhances soil structure and nutrient-holding capacity, which can further influence the composition and function of the soil microbiome.
[0015] Thus, the addition of glucose to soil can promote carbon fixation and bacterial diversity (Qi et al., 2022, which is hereby incorporated by reference in its entirety). In turn, this improves soil quality and can enhance crop yield. Currently, some farmers simply apply sugar bags to the soil to improve its quality in this way. However, this approach only provide limited benefits. Any improvement is only transient and does not typically extend to deeper levels beneath the surface. Moreover, adding sugar directly to the soil can potentially cause issues such as attracting pests or altering the soil pH.
[0016] A balanced and diverse soil microbiome can support healthy plant growth and sustainable soil fertility. Although some plants require certain levels of sugar availability for optimal growth, excessive sugar inputs through practices like excessive fertilization or the application of sugar bags can disrupt the soil microbiome and lead to imbalances in microbial populations. It is important to manage the sugar content of the soil in a sustainable and balanced manner.
[0017] Extracellular Polymeric Substances (EPS)
[0018] Extracellular Polymeric Substances (EPS) are mixtures of macromolecules produced by microorganisms, such as bacteria, algae and fungi. EPS play an important role in biofilm formation and are fundamental to the structure, stability, and function of microbial communities. Components of EPS can be of different classes of polysaccharides, lipids, nucleic acids, proteins, lipopolysaccharides, and minerals. Examples include alginate, cellulose, chitosan, dextran, galactosaminogalactan, N-acetylglucosamine (Glc-NAc), hyaluronic acid, levan, scleroglucan, schizophyllan and xanthan. In nature, the production and composition of EPS varies depending on the type of microorganisms and environmental conditions. Biofilms, which are communities of microorganisms encased in EPS, can be found in various natural settings including soil. One important EPS is cellulose.
[0019] Cellulose
[0020] Cellulose is a polysaccharide consisting of a linear chain of several hundred to many thousands of [3(1 — >4) linked D-glucose units. Cellulose is an important structural component of the primary cell wall of green plants, many forms of algae and the oomycetes. Additionally, some species of bacteria, principally of the genera Acetobacter, Sarcina ventriculi and Agrobacterium, secrete cellulose to firm biofilms. Bacterial cellulose is now produced for a variety of commercial applications including textiles, cosmetics, and food products, as well as medical applications. Expression of bacterial cellulose in bacteria has been described in the art. For example, Chinese patent application CN108060112, which is hereby incorporated by reference in its entirety, describes a bacterial cellulose producing bacterial strain, specifically, overexpression of a BcsB subunit in Acetobacter xylinum. Additionally, Buldum et al. (2018) , which is hereby incorporated by reference in its entirety, describes recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli. Florea et al. (2016), which is hereby incorporated by reference in its entirety, describes engineering control of bacterial cellulose production in Komagataeibacter rhaeticus using a genetic toolkit. WO2021 / 110856, which is hereby incorporated by reference in its entirety, discloses genetically engineered bacteria that can produce cellulose. The present invention has been devised in light of the above considerations.
[0021] Summary of the Invention
[0022] The present invention is based on the finding that overexpression of cellulose in root-associated bacteria helps to increase water retention around plant roots, improves organic carbon sequestration, and increases plant health e.g., by increasing root mass, rhizosheath mass, and reducing abiotic water stress.
[0023] An aspect of the invention provides a modified bacterium for producing cellulose. The modified bacterium may be modified to overexpress at least one endogenous gene involved in synthesis and / or secretion of cellulose. The bacterium may be modified to overexpress at least one of wssB, wssC, wssD, and wssE. In some embodiments, the bacterium is modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. In further embodiments, the bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
[0024] In some embodiments, the bacterium is a Pseudomonas bacterium, optionally Pseudomonas fluorescens. In a further embodiment, the bacterium is Pseudomonas fluorescens SBW25, Pseudomonas fluorescens F113, Pseudomonas fluorescens CHAO, Pseudomonas fluorescens Pf-5, or Pseudomonas fluorescens FW300 N2E2. In some embodiments, the bacterium is Pseudomonas fluorescens SBW25.
[0025] The bacterium may comprise a modified promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose (e.g., the overexpressed genes). In some embodiments, the bacterium is modified by the insertion of a promoter, as described herein. The inserted promoter may replace or disrupt the native promoter. The promoter may be from the same genus as the bacterium (e.g., Pseudomonas). The promoter may be from the same species as the bacterium (e.g., Pseudomonas fluorescens). The promoter may from the same strain as the bacterium (e.g., Pseudomonas fluorescens SBW25). In an example, the bacterium is Pseudomonas fluorescens and the promoter is p12445. The modified promoter may comprise a mutation in the sequence of the promoter. The mutation may result in increased expression of the downstream genes.
[0026] Another aspect provides a method of increasing production of cellulose in a bacterium compared to a reference bacterium. The method comprises a step of modifying the bacterium to overexpress at least one endogenous gene involved in synthesis and / or secretion of cellulose. The bacterium may be modifed as described herein. For example, the bacterium may be modified to overexpress at least one of wssB, wssC, wssD, and wssE. Also provided are methods of increasing water-retention around plant roots, methods of reducing water consumption in agriculture, and methods of capturing carbon using said engineered bacterium modified to overexpress at least one endogenous EPS (e.g., cellulose) synthesis and / or secretion gene. The genes may be from the wss operon, e.g., wssA, wssB, wssC, w / ssD, wssE, vvssF, wssG, wssH, wssl, and wssJ.
[0027] The invention also provides a method of improving plant health, for example, by increasing root mass, rhizosheath mass and reducing abiotic water stress using the engineered bacterium as described herein.
[0028] The inventor has also found that cellulose producing bacteria can contribute to a healthy soil microbiome by converting sugars exuded from plant roots into cellulose. This bacterial cellulose acts as a sugar sink, initially removing it from the immediate surroundings of the plant roots thereby stimulating further sugar exudation from the root. The inventors also expect that many other EPS will be able to act in a similar way.
[0029] Over a period of months, the EPS, e.g. cellulose, gradually breaks down into its sugar constituents.
[0030] These mechanisms result in a sustainable increase in soil sugar content, which supports a healthy soil microbiome.
[0031] Moreover, as the engineered bacteria colonise the root system (which extends approximately six feet deep into the soil) the EPS, e.g. cellulose, is broken down into glucose and overall soil health improves. This sustained release of glucose as a carbon source enhances microbial life and promotes plant growth, leading to continuous regeneration of soil health and productivity.
[0032] Thus, the invention also provides a method of increasing the sugar content in soil surrounding a plant root, by applying a composition comprising an EPS (e.g. cellulose) expressing bacteria to the soil.
[0033] Relatedly, the invention provides a method of increasing the diversity of the microbiota of soil surrounding a plant root, by applying a composition comprising an EPS expressing bacteria to the soil. The EPS may be cellulose.
[0034] There are several ways of assessing the diversity of the soil microbiome. In one embodiment, soil microbiome diversity is assessed via DNA sequencing and metagenomics. This involves extracting DNA from soil samples and sequencing the microbial genes present in the samples. Metagenomic analysis allows different microbial taxa to be identified and their abundance to be assessed. In one embodiment, soil microbiome diversity is assessed by 16S rRNA sequencing. This involves sequencing the 16S rRNA that is present in all bacteria and archaea. By sequencing the variable regions of this gene, various microbial taxa can be identified and their abundance estimated. In one embodiment, soil microbiome diversity is assessed by phospholipid fatty acid (PLFA) Analysis: PLFA analysis measures the phospholipid fatty acids present in microbial cell membranes. Different microbial groups have distinct fatty acid profiles, allowing the abundance of major microbial groups (e.g., bacteria, fungi, and protozoa) to be estimated. This gives a measure of overall microbial diversity. In one embodiment, soil microbiome diversity is assessed by denaturing gradient gel electrophoresis (DGGE) and / or terminal restriction fragment length polymorphism (T-RFLP). DGGE and T-RFLP are DNA fingerprinting techniques that provide information about the diversity of soil microbial communities. They do not provide detailed taxonomic information but can be useful for comparing community structures between different soil samples. In one embodiment, soil microbiome diversity is assessed by quantitative PCR (qPCR), which involves amplifying specific DNA sequences of target microbial groups using PCR and then quantifying their abundance. This provides information about the relative abundance of specific microbial taxa. In one embodiment, soil microbiome diversity is assessed by community level physiological profiling (CLPP). This technique assesses the functional diversity of soil microbial communities by measuring their ability to utilize different carbon sources and / or to grow on different substrates. It provides information about the potential metabolic capabilities of the microbial community.
[0035] In a further aspect, the invention provides the use of a genetically modified bacterium to increase sugar content in soil around plant roots, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose. In a related aspect, the invention provides the use of a genetically modified bacterium to increase the diversity of the microbiota of soil surrounding a plant root, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose.
[0036] In some embodiments, the EPS expressing bacteria is engineered to overexpress at least one protein involved in synthesis and / or secretion of the EPS, e g. cellulose. The EPS expressing bacteria may be modified to overexpress one or more genes involved in the production of the EPS. For instance, a cellulose expressing bacteria may be modified to overexpress a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene. In some embodiments, the cellulose expressing bacteria are further modified to overexpress a cmcAx gene and / or a bglAx gene. In some embodiments, the EPS expressing bacterium may be modified to overexpress at least one wssA, wssB. wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter as described herein.
[0037] The EPS (e.g. cellulose) expressing bacteria may comprise a modified promoter to overexpress the overexpressed genes, which may be endogenous to the bacteria. Preferably, the cellulose expressing bacteria comprises a modified promoter that overexpresses the overexpressed genes, which are endogenous to the cellulose expressing bacteria. For example, the wss operon in Pseudomonas sp. Alternatively, the modification comprises exogenous genes. For instance, the cellulose expressing bacteria may comprise a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene. The exogenous genes may further comprise an exogenous cmcAx gene and / or an exogenous bglAx gene. In some embodiments, the exogenous genes are heterologous. The genes may be isolated from K. xylinus.
[0038] In some embodiments, the EPS expressing bacteria is a root-associated bacterium. The expression of the genes may be regulated by a cell-density quorum sensing system.
[0039] In some embodiments, the EPS expressing bacteria is a plant growth-promoting rhizobacterium. The EPS expressing bacteria may be a Pseudomonas bacterium. In some embodiments, the Pseudomonas bacterium is a Pseudomonas fluorescens.
[0040] In another aspect, the invention provides an EPS, e.g. cellulose, expressing bacterium comprising a modified promoter that overexpresses one or more genes involved in the production of the EPS. For instance, a cellulose expressing bacteria may comprise a modified promoter that overexpresses a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene, which are endogenous to the cellulose expressing bacterium. As described herein, the bcs genes may be referred to as wss gene when present in Pseudomonas sp. Thus, in some embodiments, the bacterium is modifed to overexpress one or more wss genes. In some embodiments, the cellulose expressing bacterium is further modified to overexpress a cmcAx gene and / or a bglAx gene, which are endogenous to the cellulose expressing bacterium.
[0041] The bacteria are modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS relative to a reference bacterium, optionally wherein the EPS is cellulose, further optionally wherein the cellulose is bacterial cellulose. Preferably, the bacterium (and reference bacterium) is a root-associated bacterium.
[0042] In some embodiments, the overexpressed genes are endogenous to the bacteria. In some embodiments, the overexpressed genes are each from K. xylinus. In some embodiments, the genetically engineered bacterium is a root-associated bacterium, e.g., a plant growth-promoting rhizobacterium. In some embodiments, it is a Pseudomonas bacterium. In some embodiments, the rhizobacterium is not Komagataeibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus). In some embodiments, expression of the genes is regulated by a cell-density quorum sensing system. In some embodiments, a quorum sensing operon is inserted into the host cell. In some embodiments, the quorum sensing system comprises a gene encoding a sensor kinase and a gene encoding a response regulator. In further embodiments, the quorum sensing system further comprises a quorum sensing regulated promoter. In alternative embodiments, the quorum sensing system comprises a gene encoding a signalling molecule (autoinducer) and a gene encoding a transcriptional / response regulator. In further embodiments, the quorum sensing system further comprises a quorum sensing regulated promoter.
[0043] In some aspects, provided is a method of increasing production of EPS, e.g. cellulose, in a bacterium compared to reference bacteria, wherein the method comprises a step of modifying the bacteria to overexpress at least one protein involved in synthesis and / or secretion of the EPS. For instance, a cellulose expressing bacterium may be modified with exogenous genes comprising a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and a cop gene. In some embodiments, the bacteria are further modified with an exogenous cmc gene and / or an exogenous bg / gene. In some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssZt, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and w / ssJ. The bacterium may comprise a modified promoter. In some embodiments, the bacterium is a plant growthpromoting rhizobacterium.
[0044] The invention provides a genetically engineered bacterium for producing an EPS, e.g. cellulose, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS, e.g. cellulose. In some embodiments, the EPS produced by the genetically engineered bacterium is cellulose. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, a bacterium may be genetically modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the bacterium is modified to overexpress at least one, at least two, at least three, or at least four of the proteins involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the bacterium may be genetically modified to overexpress at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex. In some embodiments, production of an EPS, e.g. cellulose, is increased in the genetically modified bacterium compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be the same strain as the modified bacterium. In some embodiments, the bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species or same strain is a wild-type bacterium of the same species or same strain. In some embodiments, the genetically engineered bacterium is a root- associated bacterium.
[0045] In some embodiments, the genetically engineered bacterium of the invention is modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the genetically engineered bacterium may overexpress a cellulose synthase complex. In some embodiments, the genetically modified bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the genetically modified bacterium may be modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In other embodiments, overexpression of at least one protein involved in synthesis and / or secretion of the EPS (eg. cellulose) is achieved by increasing transcription and / or translation of the at least one protein involved in synthesis and / or secretion of the EPS. For instance, overexpression of at least one protein of a cellulose synthase complex may be achieved by increasing transcription and / or translation of the at least one protein of an endogenous cellulose synthase complex. An increase in the transcripton and / or translation of the at least one protein may be achieved by modifying the promoter (i.e., by the insertion of a different promoter or by mutating the native promoter) as described herein.
[0046] In some embodiments, the genetically modified bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the genetically modified bacterium may be modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the bacterium is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the bacterium may be modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex. In some embodiments, the genetically engineered bacterium is modified with at least one of the following genes of the bcs operon: bcsA\ bcsB; bcsC; and / or bcsD. In further embodiments, the exogenous nucleic acid comprises a bcs operon. In another further embodiment, the bcs operon encodes four protein subunits BcsA, BcsB, BcsC, and BcsD. In some embodiments, the exogenous nucleic acid further comprises at least one of the following genes or operon: cmcAx gene; ccpAx gene; bglAx gene; pgm gene; galU gene; cdg operon; and / or dgc gene. In some embodiments, the exogenous nucleic acid comprises a bcs operon, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the exogenous nucleic acid comprises a bcs operon, a cmc gene, a ccp gene, a bgl gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the exogenous nucleic acid consists of a bcs operon, a cmc gene, a ccp gene, a bgl gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the bcs operon, cmc gene, ccp gene, bgl gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus.
[0047] In some embodiments, the bacterium is selected from Pseudomonas fluorescens, and Bacillus megaterium. In a further embodiment, the bacterium is Pseudomonas fluorescens. In another further embodiment, the bacterium is Pseudomonas fluorescens SBW25. In another further embodiment, the bacterium is Pseudomonas fluorescens F113. In another further embodiment, the bacterium is Pseudomonas fluorescens CHAO. In another further embodiment, the bacterium is Pseudomonas fluorescens Pf-5. In another further embodiment, the bacterium is Pseudomonas fluorescens FW300 N2E2.
[0048] In some embodiments, the EPS, e.g. cellulose, produced by the genetically engineered bacterium of the invention is secreted outside of the cell. In a further embodiment, the secreted EPS,e .g. cellulose, forms a network outside of the cell. In some embodiments, the secreted network forms around plant roots. In some embodiments, the secreted EPS, e.g. cellulose, network increases water retention around plant roots. In some embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant.
[0049] In a second aspect of the invention, a method of increasing production of an EPS, e.g. cellulose, in a bacterium compared to a reference bacterium, wherein the method comprises a step of modifying the bacterium to overexpress at least one protein involved in synthesis and / or secretion of the EPS is provided. In some embodiments, the bacterium is modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS (e.g. cellulose). For instance, the bacterium may be modified to overexpress at least one proteion from a cellulose synthase complex. In some embodiments, the reference bacterium is of the same species as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species is a wild-type bacterium of the same species. In some embodiments, the genetically engineered bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the genetically engineered bacterium may be modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS, for instance at least one protein from a cellulose synthase complex, is integrated into the genome of the bacterium. In some embodiments, the EPS is cellulose. In some embodiments, the cellulose is bacterial cellulose. In some embodiments the exogenous nucleic acid comprises a bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of cmcAx gene, ccpAx gene, bglAx gene, pgm gene, a galU gene, a cdg operon, and a dgc gene. In some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter. In some embodiments, the engineered bacterium is a root-associated bacterium.
[0050] In a third aspect of the invention, a vector comprising an exogenous nucleic acid that encodes at least one protein involved in the synthesis and / or secretion of an EPS, for instance at least one protein from a cellulose synthase complex, is provided. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon, and a dgc gene. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the exogenous nucleic acid of the vector consists of a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus. In some embodiments, the vector is an isolated vector. In some embodiments, the genes are heterologous.
[0051] In a fourth aspect, the invention provides a method of producing a genetically engineered bacterium for producing an EPS, e.g. cellulose, wherein the method comprises a step of modifying the bacterium with an exogenous nucleic acid that encodes at least one protein involved in the synthesis and / or secretion of the EPS, for instance at least one proein from a cellulose synthase complex, comprising: a) isolating a bacterium; and b) introducing the vector of the invention into the bacterium. In some embodiments, the bacterium is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins involved in the synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the bacterium is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex. In some embodiments, the genetically engineered bacterium is a bacterium. In further embodiments, the genetically engineered bacterium is a root-associated bacterium.
[0052] Another aspect provides a vector comprising a promoter. The promoter sequence may be inserted upstream of the cellulose synthase genes of interest (e.g., wss operon) and be capable of driving expression of said genes. The promoter may be an inducible promoter or a constitutive promoter. The promoter may be a strong promoter. The promoter may be from the same genus as the modified bacterium, from the same species as the modified bacterium, or the same strain as the modified bacterium. Also provided is a method of modifying a bacterium for increasing production of cellulose, comprising: a) isolating a bacterium; and b) introducing the vector comprising the promoter into the bacterium.
[0053] In some embodiments, the vector comprising said promoter is integrated into the genome.
[0054] In some embodiments, the vector of the invention is introduced into the bacterium by electroporation. In some embodiments, the vector of the invention is introduced into the bacterium by transfection.
[0055] In some embodiments, the exogenous nucleic acid encoding at least one protein involved in the synthesis and / or secretion of an EPS, for instance at least one protein from a cellulose synthase complex, is integrated into the genome of the bacterium. In some embodiments, at least one, at least two, at least three, or at least four of the proteins involved in the synthesis and / or secretion of an EPS is integrated into the genome of the bacteriaum. For instance, at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex is integrated into the genome of the bacterium. In some embodiments, the vector of the invention is introduced into the bacterium such that two copies, three copies, or four copies and so on are integrated into the genome of the bacterium to increase the copy number of that gene or genes. In some embodiments, cellulose production of an EPS, e.g. cellulose, is increased in the genetically modified bacterium compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species or strain. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium is a wildtype bacterium of the same species or strain. In some embodiments, the EPS is cellulose. In some emodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex. In a fifth aspect, provided is a genetically engineered bacterium obtainable by the method of producing a genetically engineered bacterium for producing an EPS, e.g. cellulose. In another aspect, the invention provides an isolated genetically engineered bacterium of the invention. In an alternative aspect of the invention, provided is a population comprising the genetically engineered bacterium of the invention. In further embodiments, the genetically engineered bacterium is a root-associated bacterium.
[0056] In another aspect, the invention provides a composition comprising the genetically engineered population of bacteria of the invention. In some embodiments, the composition is applied to a plant in a liquid formulation. In alternative embodiments, the composition is applied to a plant as an inoculum. In some embodiments, the inoculants are peat-based formulations. In further embodiments, the formulations are used to coat seeds or pellets for sowing in furrows. In some embodiments, the genetically modified bacterium of the invention is delivered to plants in microbeads. In further embodiments, the microbeads are alginate microbeads. In some embodiments, the composition further comprises a fertiliser and / or a biofertiliser. In some embodiments, the composition is applied to a plant after planting but before harvest of said plant. In some embodiments, the composition is applied to the soil before planting a plant. In further embodiments, the genetically engineered bacterium is a root-associated bacterium.
[0057] In some embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant. In further embodiments, the genetically engineered bacterium is a root-associated bacterium.
[0058] In another aspect, the invention provides a plant comprising the genetically engineered bacterium of the invention, the isolated genetically engineered bacterium of the invention, the population of genetically engineered bacteria of the invention, or the composition of the invention, wherein the genetically engineered bacterium, isolated genetically engineered bacterium, or the population of genetically engineered bacteria is associated with the plant roots. In further embodiments, the genetically engineered bacterium is a root-associated bacterium.
[0059] Another aspect of the invention provides use of a genetically modified bacterium in agriculture, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose.
[0060] In some embodiments, provided is a genetically modified bacterium comprising one or more heterologous genes. For instance, the genetically modified bacterium may comprise a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of vvssZt, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wss / , and wssJ. The bacterium may comprise a modified promoter. In further embodiments, the bacterium is a plant growth promoting rhizobacterium.
[0061] In some aspects, the invention provides a genetically engineered root-associated bacterium for producing an EPS, e.g. cellulose, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS. In some embodiments, the EPS produced by the genetically engineered root-associated bacterium is cellulose. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the bacterium may be genetically modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the bacteria is modified to overexpress at least one, at least two, at least three, or at least four proteins involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the bacteria may be modified to overexpress at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex. In some embodiments, production of an EPS (e.g. cellulose) is increased in the genetically modified bacterium compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be the same strain as the modified bacterium. In some embodiments, the bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species or same strain is a wild-type bacterium of the same species or same strain.
[0062] In some embodiments, the genetically engineered root-associated bacterium of the invention is modified to overexpress a protein involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the genetically engineered root-associated bacterium of the invention may be modified to overexpress a cellulose synthase complex. In some embodiments, the genetically modified bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the genetically modified bacterium may be modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In other embodiments, overexpression of at least one protein involved in synthesis and / or secretion of an EPS (e.g. cellulose) is achieved by increasing transcription and / or translation of the at least one protein involved in synthesis and / or secretion of the EPS. For instance, overexpression of at least one protein of a cellulose synthase complex may be achieved by increasing transcription and / or translation of the at least one protein of an endogenous cellulose synthase complex.
[0063] In some embodiments, the genetically modified root-associated bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS. For instance, the genetically modified root-associated bacteria may be modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the bacterium is modified to with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four proteins involved in synthesis and / or secretion of an EPS. For instance, the bacteria may be modified to with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex. In some embodiments, the genetically engineered bacterium is modified with at least one of the following genes of the bcs operon: bcsA] bcsB; bcsC; and / or bcsD. In further embodiments, the exogenous nucleic acid comprises a bcs operon. In another further embodiment, the bcs operon encodes four protein subunits BcsA, BcsB, BcsC, and BcsD. In some embodiments, the exogenous nucleic acid further comprises at least one of the following genes or operon: cmcAx gene; ccpAx gene; bglAx gene; pgm gene; galU gene; cdg operon; and / or dgc gene. In some embodiments, the exogenous nucleic acid comprises a bcs operon, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the exogenous nucleic acid comprises a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the exogenous nucleic acid consists of a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus. In other embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter, as described herein.
[0064] In some embodiments, the root-associated bacterium is selected from Pseudomonas fluorescens, and Bacillus megaterium. In a further embodiment, the root-associated bacterium is Pseudomonas fluorescens. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens SBW25. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens F113. In another further embodiment, the root- associated bacterium is Pseudomonas fluorescens CHAO. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens Pf-5. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens FW300 N2E2. In some embodiments, the EPS, e.g. cellulose, produced by the genetically engineered root- associated bacterium of the invention is secreted outside of the cell. In a further embodiment, the secreted EPS, e.g. cellulose, forms a network outside of the cell. In some embodiments, the secreted network forms around plant roots. In some embodiments, the secreted EPS, e.g. cellulose, network increases water retention around plant roots. In some embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant.
[0065] In a further aspect of the invention, a method of increasing production of an EPS, e.g. cellulose, in a root-associated bacterium compared to a reference root-associated bacterium, wherein the method comprises a step of modifying the bacterium to overexpress at least one protein involved in synthesis and / or secretion of the EPS. In some embodiments, the bacterium is modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the reference bacterium is of the same species as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species is a wild-type bacterium of the same species. In some embodiments, the genetically engineered root-associated bacterium is modified with an exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS (e.g. cellulose). For instance, the genetically engineered root-assocaited bacterium is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of an EPS is integrated into the genome of the root-associated bacterium. For instance, the exogenous nucleic acid encoding at least one protein from a cellulose synthase complex may be integrated into the genome of the root- associated bacterium. In some embodiments, the EPS is cellulose. In some embodiments, the cellulose is bacterial cellulose. In some embodiments the exogenous nucleic acid comprises a bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of cmcAx gene, ccpAx gene, bglAx gene, pgm gene, a galU gene, a cdg operon, and a dgc gene. In another example, the bacterium is modified to increase expression of the endogenous cellulose synthase and / or secretion genes. Thus, in some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssZt, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter.
[0066] In an aspect of the invention, a vector comprising an exogenous nucleic acid that encodes at least one protein involved in synthesis and / or secretion of an EPS is provided. For instance, the exogenous nucleic acid may encode at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon, and a dgc gene. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the exogenous nucleic acid of the vector comprises a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the exogenous nucleic acid of the vector consists of a bcs operon, a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon and a dgc gene. In some embodiments, the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus. In some embodiments, the vector is an isolated vector.
[0067] In another aspect, the invention provides a method of producing a genetically engineered root- associated bacterium for producing an EPS, e.g. cellulose, wherein the method comprises a step of modifying the bacterium with an exogenous nucleic acid that encodes at least one protein involved in synthesis and / or secretion of the EPS, for instance at least one protein from a cellulose synthase complex, comprising: a) isolating a root-associated bacterium; and b) introducing the vector of the invention into the root-associated bacterium.
[0068] In some embodiments, the bacteria is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins involved in synthesis and / or secretion of the EPS. For instance, the bacteria may be modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex.
[0069] In some embodiments, the vector of the invention is introduced into the root-associated bacterium by electroporation. In some embodiments, the vector of the invention is introduced into the root-associated bacterium by transfection. In some embodiments, the exogenous nucleic acid encoding at least one protein involved in synthesis and / or secretion of the EPS is integrated into the genome of the root-associated bacterium. For instance, the exogenous nucleic acid encoding at least one protein from a cellulose synthase complex may be integrated into the genome of the root-associated bacterium. In some embodiments, at least one, at least two, at least three, or at least four proteins involved in synthesis and / or secretion of an EPS complex is integrated into the genome of the root-associated bacterium. For instance, at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex may be integrated into the genome of the root-associated bacterium. In some embodiments, the vector of the invention is introduced into the bacterium such that two copies, three copies, or four copies and so on are integrated into the genome of the bacterium to increase the copy number of that gene or genes. In some embodiments, production of an EPS, e.g. cellulose, is increased in the genetically modified bacterium compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species or strain. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium is a wild-type bacterium of the same species or strain. In some embodiments, the EPS is cellulose. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex.
[0070] In a further aspect, provided is a genetically engineered root-associated bacterium obtainable by the method of producing a genetically engineered root-associated bacterium for producing an EPS, e.g. cellulose. In another aspect, the invention provides an isolated genetically engineered root-associated bacterium of the invention. In an alternative aspect of the invention, provided is a bacterial population comprising the genetically engineered root-associated bacterium of the invention.
[0071] In another aspect, the invention provides a bacterial composition comprising the genetically engineered root-associated bacterial population of the invention. In some embodiments, the composition is applied to a plant in a liquid formulation. In alternative embodiments, the composition is applied to a plant as a bacterial inoculum. In some embodiments, the bacterial inoculants are peat-based formulations. In further embodiments, the formulations are used to coat seeds or pellets for sowing in furrows. In some embodiments, the genetically modified bacterium of the invention is delivered to plants in microbeads. In further embodiments, the microbeads are alginate microbeads. In some embodiments, the bacterial composition further comprises a fertiliser and / or a biofertiliser. In some embodiments, the bacterial composition is applied to a plant after planting but before harvest of said plant. In some embodiments, the bacterial composition is applied to the soil before planting a plant. In some embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant.
[0072] In another aspect, the invention provides a plant comprising the genetically engineered root- associated bacteria of the invention, the isolated genetically engineered root-associated bacterium of the invention, the population of genetically engineered root-associated bacteria of the invention, or the bacterial composition of the invention, wherein the genetically engineered root-associated bacterium, isolated genetically engineered root-associated bacterium, or the population of genetically engineered root-associated bacteria is associated with the plant roots. In some embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant. Another aspect of the invention provides use of a genetically modified root-associated bacterium in agriculture, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose.
[0073] In some embodiments, the methods described herein result in an increase in plant viability.
[0074] In some embodiments of the invention, the root-associated bacterium is genetically modified with an exogenous nucleic acid. For instance, the root-associated bacterium may comprise one or more heterologous genes, wherein the genes are selected from: a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter.
[0075] In some aspects, the invention provides a genetically modified bacterium for producing an EPS, e.g. cellulose, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS. In some embodiments the genetically modified bacterium is modified with an exogenous bcs operon, wherein the bcs operon comprises a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. In some embodiments, provided is a genetically engineered bacterium, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of and EPS, e.g. cellulose, and wherein the genetically modified bacterium is modified with one or more heterologous genes. For instance, the genetically modified bacterium may comprise a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and optionally a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the bacterium is not Komagataeibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus).
[0076] In some embodiments of the invention, the bacterium is genetically modified with an exogenous nucleic acid comprising one or more heterologous genes. For instance, the genetically modified bacterium may comprise a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and / or a bglAx gene.
[0077] In some aspects, the invention provides a genetically engineered plant growth-promoting rhizobacterium for producing an EPS, e.g. cellulose, wherein the rhizobacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS. In some embodiments, the rhizobacterium is modified with an exogenous nucleic acid comprising a bcs operon, wherein the bcs operon comprises a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. In some embodiments, the exogenous nucleic acid further comprises at least a ccpAx gene. In some embodiments, the exogenous nucleic acid further comprises a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the genes are heterologous. In some embodiments of the invention, the rhizobacterium is genetically modified with an exogenous nucleic acid comprising one or more heterologous genes, wherein the genes are selected from: a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium. The bacterium may be modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter, as described herein.
[0078] In some embodiments, provided is a genetically engineered plant growth-promoting rhizobacterium for producing an EPS, e.g. cellulose, wherein the rhizobacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of cellulose, and wherein the genetically modified rhizobacterium is modified with one or more heterologous genes. For instance, the genetically modified rhizobacterium may comprise a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and optionally a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the rhizobacterium is not Komagataeibacter xylinus (also known as A cetobacterxylinum and Gluconacetobacter xylinus).
[0079] In some embodiments, the genetically engineered bacterium or root-associated bacterium is applied to a plant after planting but before harvest of said plant. In some embodiments, the genetically engineered bacterium or root-associated bacterium is applied to the soil before planting a plant. In some embodiments, the genetically engineered bacterium or root-associated bacterium is applied to the seed of a plant before planting.
[0080] Also provided is a method comprising: (a) isolating a bacterium; and (b) modifying the bacterium to overexpress at least one gene involved in synthesis and / or secretion of cellulose. The method may be for producing a modified bacterium. The method may comprise the step of modifying the bacterium to overexpress at least one of wssB, wssC, wssD, and wssE. The bacterium may be modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ, optionally wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
[0081] The method may comprise the step of modifying the bacterium by modifying the promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose (e.g., the overexpressed genes). In some embodiments, the method comprises the step of modifying the bacterium by inserting a promoter, e.g., in the genome of the bacterium. Suitable promoters are described herein. The method may comprise the step of introducing a vector comprising a promoter sequence, as described herein. Alternatively, the method may comprise the step of modifying the promoter by mutating the sequence of the promoter. The method may further comprise step (c): generating a composition comprising the modfied bacterium produced by step (b). The composition may comprise components suitable for administration to soil surrounding a plant root.
[0082] The method may further comprise the step of applying the modified bacterium or composition to the soil surrounding a plant or plant root. The step of adding the bacterium to the soil may result in the advantageous effects, such as increasing in water retention, carbon capture, diversity of microbiota etc., as described herein. Thus, in some embodiments, introduction of the modified bacterium to the soil may (i) increase water-retention, (ii) reduce water consumption, (iii) increase carbon capture, (iv) increase sugar content in the soil and / or (v) increase the diversity of the microbiota of the soil.
[0083] The invention includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.
[0084] Summary of the Figures
[0085] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:
[0086] Figure 1 . A depiction of the genetic crossover from the shuttle vector (pEX18Ap) containing the bacterial cellulose genes of interest onto the chromosome of P. fluorescens, such as P. fluorescens SBW25, at locus -6-.
[0087] Figure 2. A depiction of the genetic crossover from the Mini CTX1 vector containing the bacterial cellulose genes of interest onto the chromosome of P. fluorescens at the attb site (attB
[0088] - 5’ TGAGTTCGAATCTCACCGCCTCCGCCATAT 3’) (SEQ ID NO: 1).
[0089] Figure 3. A depiction of a construct comprising the cellulose synthesis genes cmcAx, ccpAx, BcsA, BcsB, BcsC, BcsD and BglAx, and GFP as a reporter gene. In this particular example, the construct also comprises a pBAD promoter and a pBAD terminator.
[0090] Figure 4. a) A depiction of a construction comprising Pseudomonas synxantha strain 2-79 chromosome - the phzI / R operon. b) A depiction of the construct comprising for insertion into the host bacterium, for example Pseudomonas fluorescens.
[0091] Figure 5. a) A depiction of a construct comprising Pseudomonas putida strain KT2440 chromosome rox quorum sensing system, b) A depiction of a construct comprising the KT2440 QS-system for recombinant protein production in Pseudomonas, utilizing the regions upstream of the roxS / roxR-regulated genes shown in Figure 5c. c) A depiction of a construct for insertion into the host bacterium, for example Pseudomonas fluorescens.
[0092] Figure 6. A depiction of the construct for the insertion of a promoter into the genome of SBW25 using homologous recombination. The upstream 500bp overhang region is highlighted with annotated base pair locations.
[0093] Figure 7. A depiction of the construct for the insertion of a promoter into the genome of SBW25 using homologous recombination. The promoter region is highlighted with annotated basepair locations.
[0094] Figure 8. A depiction of the construct for the insertion of a promoter into the genome of SBW25 using homologous recombination. The downstream 500bp overhang region is highlighted with annotated base pair locations.
[0095] Figure 9. A depiction of the construct for the insertion of a selective marker into the genome of SBW25 using homologous recombination. The construct is composed of Fragment 1, 2 and 3.
[0096] Detailed Description of the Invention
[0097] Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
[0098] The present invention provides genetically engineered bacteria such as a root-associated bacterium for producing an EPS, e.g. cellulose, wherein the genetically engineered root- associated bacterium is genetically modified to increase production of the EPS relative to a reference bacterium, typically of the same species. Typically, the genetically engineered root- associated bacterium are modified to overexpress proteins required for synthesis and / or secretion of the EPS (e.g. cellulose), preferably a cellulose synthase complex.
[0099] As used herein “root-associated” bacterium or bacteria refers to a bacterium / bacteria that live on the plant root or surrounding the plant root. In some embodiments, the bacteria are “root- associated”, referring to a bacteria that lives on the plant root or surrounding the plant root. In further embodiments, the root-associated bacteria are Rhizobacteria. The root-associated bacteria may form symbiotic relationships with plants, promoting plant growth. (Such plant growth-promoting rhizobacteria are termed PGPR.) Without being bound by theory it is anticipated that once the root-associated bacteria are detached from the root, the bacterium would be unable to sustain viability, and so are unlikely to survive in the wider environment thereby preventing the spread of the genetically modified bacteria in the environment. Examples of root-associated bacteria include, but are not limited to, Agrobacterhim radiohacter, Bacillus acidocaldarms, Bacillus acidoterresiris, Bacillus agri, Bacillus aizawai, Bacillus albolactis, Bacillus alcalophilus, Bacillus alvei, Bacillus aminoglucosidicus, Bacillus aminovorans, Bacillus amylolyticus (also known as Paenibacilhis amylolyticus), Bacillus amyloliquefacieris, Bacillus aneiirinolyticus, Bacillus atropkaeus, Bacillus azotoformans, Bacillus badius, Bacillus cereus (synonyms: Bacillus endorhythmos, Bacillus medusa), Bacillus chiiinosporus, Bacillus circulans, Bacillus coagulans, Bacillus endoparasiticus, Bacillus fastidiosus, Bacillus firmus, Bacillus kurstaki, Bacilhis lacticola, Bacilhis laclimorbus, Bacillus laciis, Bacillus laierospoms (also known as Brevibacillus laterosporus), Bacillus lautus, Bacillus leniimorbus, Bacillus lenius, Bacillus licheniformis, Bacillus maroccanus, Bacillus megaterium, Bacillus meiiens, Bacillus mycoides, Bacillus natto, Bacillus nematocida, Bacillus nigrificans, Bacillus nigrum, Bacillus pantothenticus, Bacillus papillae, Bacillus psychrosaccharolyticus, Bacillus pumilus, Bacillus siamensis, Bacillus smithii, Bacillus sphaericus, Bacillus subiilis, Bacillus thuringiensis, Bacillus tmiflagellatus, Bradyrhizobium japonicum, Brevibacillus brevis, Brevibacillus laterosporus (formerly Bacillus laterosporus), Chromobacterium suhisugae, Delflia acidovorans, Lactobacillus acidophilus, Lysobacter antibioticus, Lysobacter enzymogenes, Paenibacilhis alvei, Paenibacillus polymyxa, Paenibacillus popilliae (formerly Bacillus popilliae ), Pantoea agglomerans, Pasteuria penetrans (formerly Bacillus penetrans), Pasteuria usgae, Pectobacterium carotovorum (formerly Erwinia carotovord), Pseudomonas aeruginosa, Pseudomonas aureofaciens, Pseudomonas cepacia (formerly known as Burkholderia cepacia), Pseudomonas chlororaphis, Pseudomonas fluorescens, Pseudomonas proradix, Pseudomonas putida, Pseudomonas syringae, Serraiia entomophila, Serratia marcescens, Streptomyces colombiensis, Streptomyces galbus, Streptomyces goshikiensis, Streptomyces griseoviridis, Streptomyces lavendulae, Streptomyces prasinus, Streptomyces saraceticus, Streptomyces venezuelae, Xanthomonas campestris, Xenorhabdus luminescens, Xenorhabdus nematophila, Rhodococcus globerulus AQ719 (NRRL Accession No. B-21663), Bacillus sp. AQ175 (ATCC Accession No. 55608), Bacillus sp. AQ 177 (ATCC Accession No. 55609), Bacillus sp. AQ178 (ATCC Accession No. 53522), and Streptomyces sp. Strain NRRL Accession No. B-30145.
[0100] In some embodiments, the bacterium Pseudomonas fluorescens or Bacillus megaterium. In a further embodiment, the bacterium is Pseudomonas fluorescens. In preferred embodiments, the bacterium is Pseudomonas fluorescens SWB25. In another further embodiment, the bacterium is Pseudomonas fluorescens F113. In another further embodiment, the bacterium is Pseudomonas fluorescens CHAO. In another further embodiment, the bacterium is Pseudomonas fluorescens Pf-5. In another further embodiment, the bacterium is Pseudomonas fluorescens FW300 N2E2.
[0101] Rhizobacteria colonise the surface of the root, or superficial intercellular space of the host plant, often forming root nodules. In some embodiments, the root-associated bacteria are plant growth-promoting rhizobacteria (PGPR). Some common examples of PGPR genera exhibiting plant growth promoting activity are: Pseudomonas, Azospirillum, Bacillus, etc. Other known PGPRs include Mesorhizobium ciceri, Burkholderia ambifaria, Mycobacterium phlei, and G. diazotrophicus It is known by the skilled person that PGPR describes soil bacteria that colonise the roots of plants and enhance plant growth. PGPR is not intended to cover bacteria which have a pathogenic effect on the plant, for example, deleterious rhizobacteria (DRB). Six strains of rhizobacteria have been identified as being DRB, these include: the genera Enterobacter, Klebsiella, Citrobacter, Flavobacterium, Achromobacter, and Arthrobacter.
[0102] In some embodiments, the bacterium is a gram-negative bacterium. In some embodiments, the bacterium is a Pseudomonas genus bacterium. In some embodiments, the bacterium is not Komagataeibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus).
[0103] In some embodiments, the bacterium is selected from the following Pseudomonas fluorescens strains: Pseudomonas fluorescens CHAO (CP043179.1); Pseudomonas fluorescens F113 (CP003150.1); Pseudomonas fluorescens FW300 N2E2 (CP015225.1); Pseudomonas fluorescens Pf-275 (CP031648.1); Pseudomonas fluorescens Pf-5 (CP000076.1);
[0104] Pseudomonas fluorescens PfO-1 (CP000094.2); Pseudomonas fluorescens FR1 (CP025738.1); Pseudomonas fluorescens DR133 (CP048607.1); and Pseudomonas fluorescens 2P24 (CP025542.1). Strains CHAO and Pf-5 are now considered to belong to a novel bacterial species Pseudomonas protegens, which are widespread Gram-negative, plant-protecting bacteria. However, in the art these particular strains (CHAO and Pf-5) are also referred to as strains of Pseudomonas fluorescens. Thus, in some instances the bacterium is Pseudomonas protegens, particularly with reference to the strains CHAO and Pf-5. In a further embodiment, the bacterium is a Pseudomonas fluorescens F113.
[0105] Extracellular Polymeric Substances (EPS)
[0106] In some embodiments, EPS comprises one or more of a polysaccharide, a lipid, a nucleic acid, a protein, a lipopolysaccharide, and / or a mineral. In some embodiments, the polysaccharide is alginate, cellulose, chitosan, dextran, galactosaminogalactan, N-acetylglocosamine (Glc-Nac), hyaluronic acid, levan, scleroglucan, schizophyllan or xanthan. In some embodiments, the polysaccharide is cellulose. In some embodiments, EPS is cellulose.
[0107] The terms “increased EPS production” and “increasing production of EPS” are used herein to describe a greater amount of EPS produced in a genetically engineered bacterium compared to a reference bacterium, respectively, optionally of the same strain or species. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species. The increase in EPS production may be 2-fold, 3-fold, 4-fold, 5-fold, 6-fold and so on, compared to a reference bacterium. The quantity of EPS produced by the genetically engineered bacteria can be quantified by techniques that determine the weight of the dried and / or wet EPS biomass. It is anticipated that the genetically engineered bacterium of the invention will produce an increased dried and / or wet weight of an EPS, e.g. cellulose, biomass compared to a reference bacterium, respectively.
[0108] Cellulose
[0109] In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose produced by the genetically modified bacteria is secreted outside of the cell. Without being bound by theory, it is considered that bacterial cellulose has different properties from plant cellulose and is characterised by high purity, strength, moldability and increased water holding ability. It has been demonstrated that plant cellulose has a water retention value of around 60%, while bacterial cellulose has a water retention value of 1000% of the cellulose sample weight (Klemm, et al. 2001). In some embodiments, the secreted bacterial cellulose forms a network around the plant roots. In some embodiments, the bacterial cellulose network forms a spongy network. In some embodiments, the cellulose network is produced around plant roots.
[0110] The terms “increased cellulose production” and “increasing production of cellulose” are used herein to describe a greater amount of cellulose produced in a genetically engineered bacterium compared to a reference bacterium, respectively, optionally of the same strain or species. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species. The increase in cellulose production may be 2-fold, 3-fold, 4-fold, 5-fold, 6-fold and so on, compared to a reference bacterium. The quantity of cellulose produced by the genetically engineered bacteria can be quantified by techniques that determine the weight of the dried and / or wet cellulose biomass. It is anticipated that the genetically engineered bacterium of the invention will produce an increased dried and / or wet weight of cellulose biomass compared to a reference bacterium, respectively. Bacterial cellulose may be quantified as described by Jozala A. F., et al. 2014 (which is incorporated by reference). For example, the bacterial cellulose can be collected, rinsed in distilled water, and immersed in NaOH 1 N at 60°C for 90min to remove attached cells. The bacterial cellulose may then be washed in distilled water and dried at 50°C for 24h to evaluate the bacterial cellulose yield concentration in mg mL-1(mass(mg) of BC / volume (mL)) of culture medium).
[0111] Synthesis and secretion of cellulose
[0112] The synthesis of bacterial cellulose is a multistep process that involves two main mechanisms: the synthesis of uridine diphosphate (UDP-glucose), followed by the polymerisation of glucose into long and unbranched chains by cellulose synthase. The proteins described herein are proteins that are involved in the synthesis and / or secretion of cellulose. In some embodiments, the bacteria is modified to overexpress at least one, at least two, at least three, at least four, at least five, at least six, at least, seven, at least eight, at least nine, at least ten, at least eleven, or at least twelve of the proteins involved in synthesis and / or secretion of cellulose.
[0113] The bacterial cellulose biosynthesis (bcs) operon encoding a cellulose synthase complex for cellulose biosynthesis and secretion was initially identified in Komagataeibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus). In some embodiments, the bacterium is genetically modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the bacteria is modified to overexpress at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex.
[0114] K. xylinus has been identified as the most efficient bacterial cellulose producer among cellulose producer species. Specifically bacterial cellulose produced by Komagataeibacter species, displays unique properties, including high mechanical strength, high water absorption capacity, high crystallinity, and an ultra-fine and highly pure fibre network structure (Vandamme, et al. 1998). Without being bound by theory, it is anticipated that genetic modification of a bacterium or root-associated bacteria with the cellulose synthesis proteins of K. xylinus will result in an increased and more efficient production of cellulose.
[0115] In some embodiments, the genetically engineered bacterium or root-associated bacterium is genetically modified with an exogenous nucleic acid that encodes at least one protein from a bacterial cellulose synthase complex. In some embodiments, the genetically engineered bacterium or root-associated bacterium is modified with at least one protein from a cellulose synthase complex from K. xylinus. For the purposes of the invention, the components of the cellulose synthase complex are described herein.
[0116] For the purposes of this invention, “a bcs operon” encodes four protein subunits BcsA, BcsB, BcsC, and BcsD that form a cellulose synthase complex. The bcs genes (e.g., bcsA, bcsB, bcsC, and bcsD) were initially identified in Komagataeibacter (Acetobacter) xylinus. Many other bacterial species also contain cellulose synthesis and / or secretion genes e.g., E. coli, P. fluorescens, etc. These homologous cellulose synthesis and / or secretion genes are generally known in the art as bcs genes, but may also have additional names such as wss genes. For example, WssB is also known as BcsA, WssC is also know as BcsB, and WssE is also known as BcsC.
[0117] The BcsA subunit, located on the cytoplasmic face of the inner membrane possesses a catalytic [3-1 ,4-glycosyltransferase domain responsible for polymerising monomers of uridine diphosphoglucose (UDP-glucose) into p-1,4-glucan chains of cellulose. The activity of the catalytic domain is regulated by the allosteric activator of bacterial cellulose synthesis, bis- (3'— >5')-cyclic diguanylate. BcsB binds to BcsA in the periplasm by a single C-terminal transmembrane helix, where it stabilises BcsA and guides glucan chains through the periplasmic space using two carbohydrate-binding domains. Secretion of bacterial cellulose from the periplasm to the extracellular environment is believed to be facilitated through the action of BcsC, which is predicted to form a pore in the outer membrane of K. xylinus based on its structure. Consistent with the view that BcsC is an outer membrane porin, is the observation that BcsC is essential for in vivo, but not in vitro bacterial cellulose synthesis. Finally, crystallisation of bacterial cellulose is achieved through the action of BcsD, a cylindrical octameric periplasmic protein that contains four spiral channels that facilitates hydrogen bonding of four glucan chains during export through BcsC. Furthermore, it has been demonstrated in K. xylinus that BcsC mutants were unable to produce cellulose fibrils, whereas BcsD mutants produced -40% less cellulose than the wild-type (Wong et ai. 1990). Bacterial cellulose is distinguished from its plant equivalent by a high crystallinity index. Specifically, K. xylinus produces two crystalline allomorphs of bacterial cellulose known as cellulose I and cellulose II, which requires the cellulose synthase-associated BcsD subunit. This subunit has been characterised as coupling cellulose polymerisation and crystallisation.
[0118] In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress at least one of the genes bcsA, bcsB, bcsC, and bcsD. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a bcsA gene and a bcsB gene. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a bcsA gene and a bcsB gene, and at least one of a bcsC gene and a bcsD gene. In further embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress at least bcsA, bcsB and bcsD. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a bcs operon. In further embodiments, the bcsA, bcsB, bcsC, bcsD, and bcs operon are each isolated from K. xylinus. cmcAx (also known as bcsZ) is located upstream of the bcs operon and encodes endo-p-1 ,4- glucanase that has cellulose-hydrolysing ability. It has been demonstrated that in small amounts, exogenous CmcAx enhances bacterial cellulose production of K. xylinus, while endogenous overexpression of cmcAx increases bacterial cellulose yield. Without being bound by theory, it is anticipated that the cellulose hydrolysing activity of CmcAx may exert a regulatory effect on bacterial cellulose biosynthesis. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a cmcAx gene. In some embodiments, the bacterium is modified with a cmc gene. In further embodiments, the cmcAx gene is isolated from K. xylinus. ccpAx (also known as bcsH) is located in the same upstream operon as cmcAx, which encodes the cellulose-complementing protein (ccpAx) that is required for in vivo bacterial cellulose biosynthesis. CcpAx has been demonstrated to interact with BcsD in the periplasm. It is considered that this unique organisation might account for the extremely high activity of K.xylinus. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a ccpAx gene. In some embodiments, the bacterium is modified with a ccp gene. In further embodiments, the ccpAx gene is isolated from K. xylinus.
[0119] Downstream of the BC synthesis operon is bglAx (also known as bglxA) encoding 0- glucosidase, which is secreted and has the ability to hydrolyse more than three p-1 ,4-glucose units (cellotriose). It has been demonstrated that whilst this enzyme is not essential for bacterial cellulose production, disruption of the bglAx gene causes a decrease in bacterial cellulose production (Tajima et al., 2001 ; Kawano et al., 2002). In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a bglAx gene. In some embodiments, the bacterium is modified with a bgl gene. In further embodiments, the bglAx gene is isolated from K. xylinus.
[0120] Phosphoglucomutase, also referred to as celB, is responsible for catalysing the interconversion between glucose-1 -phosphate (G-1-P) and glucose-6-phosphate (G-6-P). Without being bound by theory, it is thought that the conversion of G-6-P to G-1-P facilitates the production of cellulose. Phosphoglucomutase has been demonstrated to be essential in the formation of extracellular cellulose, as pgm mutants are unable to produce cellulose. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a pgm gene. In further embodiments, the pgm gene is isolated from K. xylinus.
[0121] UTP-glucose-1-phoshate is an enzyme involved in carbohydrate metabolism, and synthesises UDP-glucose from glucose-1 -phosphate (G-1-P) and UTP. UDP-glucose is a key component in the production of cellulose. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a galU gene. In further embodiments, the galU gene is isolated from K. xylinus.
[0122] Diguanylate cyclase is an enzyme that catalyses 2 GTP into 2 diphosphate and cyclic GMP. This may be introduced into a bacterial cell as a gene deg or as the edg operon. The edg operon comprises cyclic di-GMP phosphodiesterase (pdeA) and diguanylate cyclase (deg). Diguanylate cyclase, catalyses the formation of cyclic di-GMP and phosphodiesterase A catalyses the degradation. Without being bound by theory, cyclic di-GMP is considered to be an allosteric activator of bacterial cellulose synthesis. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention is modified to overexpress a deg gene and / or a edg operon. In further embodiments, the deg gene and edg operon are each isolated from K. xylinus.
[0123] In some embodiments, the genetically engineered bacterium, or root-associated bacterium is modified to overexpress at least one or more genes selected from the group comprising: a bcsA gene; a bcsB gene; a bcsC gene; a bcsD gene; a cmcAx gene; a ccpAx gene; a bglAx gene; a pgm gene; a galU gene; a edg operon; and a dgc gene.
[0124] In some embodiments the genetically engineered bacterium, or root-associated bacterium is modified to overexpress the bes operon and at least one of the following genes or operon: a) cmcAx gene; b) ccpAx gene; c) bglAx gene; d) pgm gene; e) galU gene; f) edg operon; and / or g) c / gc gene.
[0125] In further embodiments, the genetically engineered bacterium, or root-associated bacterium further comprises at least one, at least two, at least three, at least four, at least five, or at least six of the genes or operon as described by a) to g). In some embodiments, the genetically engineered bacterium, or root-associated bacterium further comprises the genes and operon of a) to g). In some embodiments, the genetically engineered bacterium, or root-associated bacterium further consists of the genes and operon of a) to g). In some embodiments, the genetically modified bacterium, or root-associated bacteria of the invention comprise the bes operon and at least the cmcAx gene, ccpAx gene, and bglAx gene. In some embodiments, the genetically modified bacterium, or root-associated bacteria of the invention comprise the bes operon and at least the cmc gene, ccp gene, and bgl gene. In some embodiments, the genetically modified bacterium, or root-associated bacteria of the invention consist of the bes operon and at least the cmcAx gene, ccpAx gene, and bglAx gene. In some embodiments, the genetically modified bacterium, or root-associated bacteria of the invention consist of the bes operon and at least the cmc gene, ccp gene, and bgl gene. In some embodiments, the genes are heterologous. In some embodiments, a bacterium, or root-associated bacterium comprising an endogenous bcs operon that does not comprise all of BcsA, BcsB, BcsC, and BcsD, may be modified with at least one of the genes of the bcs operon (bcsA, bcsB, bcsC, bcsD). Typically, the bacterium would be modified with a bcs gene which is does not normally express. For example, Pseudomonas fluorescens SBW25 expresses only BcsA, BcsB and BcsC of the bcs operon, and thus according to the invention would be modified to express BcsD. In some embodiments, the root-associated bacteria Pseudomonas fluorescens SBW25 is modified with an exogenous nucleic acid that comprises bcsD.
[0126] Without being bound by theory, it is anticipated that the bcs operon and any combination of the cmcAx gene, ccpAx gene, bglAx gene, pgm gene, the galU gene, the deg gene and / or the edg operon will facilitate the synthesis and secretion of cellulose in the host bacterium. In some embodiments, the genetically engineered bacterium, or root-associated bacterium of the invention may comprise multiple copies of any of the genes or operons described herein.
[0127] In some aspects, the invention relates to the incorporation of cellulose synthesising genes (preferably cmcAX, ccpAX, bcsA, bcsB, bcsC, bscD, and / or bglxA) into a foreign host present in the soil. In some aspects, the invention provides a bacterium genetically modified to overexpress at least one protein involved in synthesis and / or secretion of cellulose, wherein the genetically modified bacterium is modified with one or more heterologous genes, wherein the genes comprise a bcsA gene, a bcsB gene, a bcsC gene, and / or a bcsD gene. In some embodiments, the genes comprise a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. In some embodiments, the genes further comprise a cmcAx gene, a ccpAx gene, and / or a bglAx gene.
[0128] In some embodiments, the genetically modified bacterium is genetically modified with an exogenous nucleic acid comprising a bcs operon, wherein the bcs operon comprises a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. In some embodiments, the genetically modified bacterium is further modified with an exogenous nucleic acid comprising at least one of a cmcAx gene, a ccpAx gene, and a bglAx gene.
[0129] In some aspects, the invention provides a genetically engineered bacterium for producing cellulose, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of cellulose, wherein the genetically modified bacterium is modified to overexpress at least one or more exogenous genes, wherein the exogenous genes are selected from the group comprising: a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and optionally a ccpAx gene. In some embodiments, the bacterium is a root-associated bacterium. In some aspects, provided is a genetically engineered bacterium, comprising one or more heterologous genes coding for production of cellulose, wherein the genes are bcsA, bcsB, bcsC and / or bcsD. In some embodiments, the genes are bcsA, bcsB, bcsC and bcsD. In some embodiments, the genes further comprise a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, bacterium is a root-associated bacterium. In some embodiments, the genes are each isolated from K. xylinus.
[0130] In some embodiments, the genetically engineered bacterium further comprises a gene encoding green fluorescent protein (GFP). Without being bound by theory, providing a host cell that expresses GFP is considered to help with tracking the genetically modified bacteria in the environment. Accordingly, in some embodiments, the genetically engineered bacterium, comprises one or more heterologous genes coding for production of cellulose, wherein the genes are bcsA, bcsB, bcsC and / or bcsD, and further comprises a gene encoding GFP.
[0131] Synthesis and secretion of cellulose in Pseudomonas fluorescens
[0132] In some embodiments of the invention, the engineered bacterium is P. fluorescens. The P. fluorescens may be Pseudomonas fluorescens SBW25. The bacterium may be modified to overexpress at least one gene involved in synthesis of cellulose.
[0133] In Pseudomonas species (e.g., P. fluorescens), the cellulose synthesis machinery is encoded by the wss operon, which generally comprises wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl and wssJ.
[0134] It is thought that the core synthase may comprise WssBCDE. WssB (also known as BcsA) is a cellulose synthase subunit thought to be catalytically active subunit responsible for the polymerisation of UDP-Glucose into cellulose. WssC (also known as BcsB), WssD (also known as BcsZ or cmcAx), and WssE (also known as BcsC) are also a cellulose synthase subunits. The cellulose acetylation activity is thought to be produced by WssFGHI. WssF-l are each thought to be a cellulose synthase-associated acetylation subunits. WssF is considered to play a role in presenting acyl groups to WssGHI. WssG, WssH, and Wssl are thought to be a AlgF- like protein involved in the acetylation of cellulose. Finally, WssA (also known as bcsQ) and WssJ are thought to be MinD-like ATPases having a role in cellular localisation (e.g., at the cell poles) of the Wss complex.
[0135] The engineered bacterium described herein may comprise at least one wss gene or wss-like gene. The engineered bacterium may comprise wssA-J or wss-like operon. The engineered bacterium may be Pseudomonas fluorescens. In some embodiments, the bacterium may be Pseudomonas fluorescens SBW25. In some embodiments, the bacterium may be a wrinkly spreader (WS) mutant of Pseudomonas fluorescens SBW25. In some embodiments, the cellulose is modified by acetylation. For example, the modified bacterium may be capable of acetylating either the 2, 3, or 6 carbon positions of individual glucose residues that are (3-1 ,4-linked into a cellulose polymer. The cellulose polymer may be partially acetylated. The level of acetylation may be at least 5%, 10%, 15%, or 20%, but less than 50%. In some embodiments, the level of acetylation may be less than 25%. In some embodiments, the level of acetylation is around 15%.
[0136] In some embodiments, the bacterium is modified to overexpress at least one of wssB, wssC, and wssE. The bacterium may be modified to overexpress wssB, wssC and wssE (also known as bcsA, bcsB, and bcsC). In some embodiments, the bacterium is modified to overexpress at least one of wssB, wssC, wssD and wssE (also known as bcsA, bcsB, bcsZ and bcsC). The bacterium may be modified to overexpress wssB, wssC, wssD and wssE. As described above, it is thought that WssBCDE relates to the core cellulose synthase. The bacterium may also be modified to overexpress at least one of wssB, wssC, wssD, wssE, wssE, wssG, wssH, and wss / . Finally, the bacterium may be modified to overexpress at least one of wssA, wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl and wssJ. In some embodiments, the bacterium is modified to overexpress wssA, wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl and wssJ. The bacterium may be a root-associated bacterium, such as Pseudomonas fluorescens. The wss genes may be endogenous to the bacterium. In some embodiments, the bacterium is Pseudomonas fluorescens and the wss genes are endogenous to the bacterium.
[0137] The genetically engineered bacterium, or root-associated bacterium of the invention is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose. In some embodiments, the genetically engineered bacterium, or root- associated bacterium of the invention is modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the bacterium is modified to overexpress one or more bcs genes. The bacterium may be modified to overexpress wss genes.
[0138] The term “overexpression” as used herein is where the protein(s) of interest is expressed in the bacterium at a higher level than the level at which it is expressed in a reference bacterium, optionally a comparable wild-type bacterium, respectively, typically of the same strain or species. Overexpression may include but is not limited to constitutive or induced expression. In some embodiments, the bacterium does not endogenously express the protein(s) of interest, any level of expression of that protein in the bacteria cell is deemed an “overexpression” of that protein for purposes of the present invention. Overexpression may also include increased expression of endogenous genes (e.g., by modification / mutation of a promoter or introduction of a promoter such as a strong promoter). In the present invention, the terms “overexpression of at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose” or “overexpression at least one protein from a cellulose synthase complex”, mean that the at least one of the proteins that are involved in the synthesis of an EPS, e.g. cellulose, is expressed in the bacteria at a higher level than the level of which it is expressed in a comparable reference bacterium, respectively. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium is an unmodified bacterium. In some embodiments, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be of the same strain as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be of the same strain as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species as the modified bacterium.
[0139] Overexpression can be achieved in any way known to a skilled person in the art. In general, it can be achieved by increasing transcription / translation of the gene, e.g. by increasing the copy number of the gene or by altering or modifying regulatory sequences (e.g., a promoter) or sites associated with expression of a gene. For example, overexpression can be achieved by introducing one or more copies of the polynucleotide encoding the gene of interest operably linked to regulatory sequences (e.g. a promoter). The gene may be operably linked to a strong constitutive promoter and / or strong ubiquitous promoter in order to reach high expression levels. Such promoters can be endogenous promoters or recombinant promoters. Alternatively, it is possible to remove regulatory sequences such that expression becomes constitutive. One can substitute the native promoter of a given gene with a heterologous promoter which increases expression of the gene or leads to constitutive expression of the gene. Typically, genome editing methods such as CRISPR, TALENs, and Zinc Finger Nucleases can be used according to the invention to achieve overexpression of cellulose synthesis and / or secretion proteins. For example, CRISPR genome editing may be used to remove regulatory sequence(s), resulting in constitutive expression of the gene of interest. EPS synthesis and / or secretion proteins (e.g. proteins of the cellulose synthase complex and its associated proteins) may be overexpressed by more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or more than 300% by the host cell compared to the host cell prior to engineering when cultured under the same conditions.
[0140] In one embodiment, overexpression of EPS, e.g. cellulose, synthesis and secretion genes is achieved by altering or modifying regulatory sites associated with expression of a gene. In another embodiment, overexpression of EPS, e.g. cellulose, synthesis and secretion genes is achieved by increasing the copy number of a EPS, e.g. cellulose, synthesis and secretion gene. In a further embodiment, the bacterium, or root-associated bacterium is modified with an exogenous nucleic acid comprising one or more EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, the bacteria are modified with one or more separate exogenous nucleic acids comprising one or more EPS synthesis and secretion genes. In some embodiments, the exogenous nucleic acid is incorporated into a self-replicating plasmid within the bacterium. In an alternative embodiment, the exogenous nucleic acid is incorporated into the genome of the bacterium. In some embodiments, expression of the gene(s) of interest is transient. In some embodiments, expression of the gene(s) of interest is stable.
[0141] Detection of overexpression can be achieved in any way known to a skilled person in the art. Examples include, but are not limited to, detecting the proteins (machinery) for synthesis of an EPS, e.g. cellulose synthase complex, by techniques such as Western Blot, qRT-PCT, and flow cytometry, or detecting the quantity of cellulose produced by the genetically engineered bacteria by techniques such as determining the weight of the dried and / or wet EPS, e.g. cellulose, biomass.
[0142] In some embodiments, an exogenous nucleic acid is introduced into the bacterium, or root- associated bacterium. In this specification, a nucleic acid may be any nucleic acid (DNA or RNA) having a nucleotide sequence having a specified degree of sequence identity to the genes of the bcs operon, a cmcAx gene; a ccpAx gene; a bglxA gene; a pgm gene; a galU gene; a cdg operon; and / or a dgc gene isolated from K. xylinus and to an RNA transcript of any one of these sequences, to a fragment of any one of the preceding sequences or to the complementary sequence of any one of these sequences or fragments. The specified degree of sequence identity may be from at least 60% to 100% sequence identity. More preferably, the specified degree of sequence identity may be one of at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. In this specification, “an exogenous nucleic acid” refers to a nucleotide sequence that is foreign e.g. not endogenous to its host cell.
[0143] The term “endogenous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that occurs naturally in the host cell.
[0144] The term “heterologous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that does not naturally occur in the host cell. In preferred embodiments, the exogenous nucleic acid is a heterologous nucleic acid.
[0145] The term “recombinant,” when used in reference to a subject cell, nucleic acid, protein or vector, indicates that the subject has been modified from its native state. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, or express native genes at different levels or under different conditions than found in nature. Recombinant nucleic acids differ from a native sequence by one or more nucleotides and / or are operably linked to heterologous sequences, e.g., a heterologous promoter in an expression vector. Recombinant proteins may differ from a native sequence by one or more amino acids and / or are fused with heterologous sequences. The engineered bacterium may be considered a recombinant bacterium. In one embodiment, the bacterial cells are genetically engineered by introducing an expression cassette or vector comprising an exogenous nucleic acid sequence encoding the machinery for EPS, e.g. cellulose, synthesis and secretion, e.g. cellulose synthase complex, into said cells. The nucleic acid sequence may be operably linked to one or more control sequences that direct the expression of said nucleic acid in the bacteria cells. The control sequence may include a promoter that is recognised by the bacterial cell. The promoter contains transcription control sequences that mediate the expression of the machinery for the synthesis of EPS, e.g. cellulose. The promoter may be any polynucleotide that shows transcription activity in the bacterial cells including mutant, truncated, and hybrid promoters. The promoter may be a constitutive or inducible promoter, preferably a constitutive promoter. The control sequence may also include appropriate transcription initiation, termination, and enhancer sequences. In some embodiments, the expression cassette comprises, or consists of, a nucleic acid sequence that encodes the machinery for EPS, e.g. cellulose, synthesis and secretion operably linked to a transcriptional promoter and a transcription terminator.
[0146] A “vector” as used herein is an oligonucleotide molecule (DNA or RNA) used as a vehicle to transfer foreign genetic material into a cell. The vector may be an expression vector for expression of the foreign genetic material in the cell. Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the gene sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be according to the invention. Suitable vectors include plasmids, binary vectors, viral vectors and artificial chromosomes (e.g. yeast artificial chromosomes). In some embodiments, the vector of the invention is an isolated vector. An “expression cassette” as used herein is a distinct component of vector DNA consisting of a gene and regulatory sequence to be expressed in a host cell. An expression cassette typically comprises one or more genes and the sequences controlling their expression. The vector may also comprise a promoter for insertion into the bacterium. In this example, an “expression cassette” may comprise a promoter sequence.
[0147] As used herein, a “constitutive promoter” is a promoter which is active under most conditions and / or during most development stages. There are several advantages to using constitutive promoters in expression vectors used in biotechnology, such as: high level of production of proteins used to select transgenic cells or organisms; high level of expression of reporter proteins or scorable markers, allowing easy detection and quantification; high level of production of a transcription factor that is part of a regulatory transcription system; production of compounds that requires ubiquitous activity in the organism; and production of compounds that are required during all stages of development. Alternatively, a non-constitutive promoter can be used. As used herein, a "non-constitutive promoter" is a promoter which is active under certain conditions. In embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter is a sugar-induced promoter. In some embodiments, the promoter is an arabinose inducible promoter.
[0148] As used herein, a “strong promoter” is a promoter which promotes strong or very high levels of transcription from downstream DNA. A strong promoter may have a better affinity to the binding site of RNA polymerase or other transcription activators which facilitate increased transcription. When using a strong promoter expression of the gene(s) downstream of said promoter are higher than expression levels achieved using the native promoter (i.e., the promoter found in wild type bacteria).
[0149] In preferred embodiments, the vector is a vector that when introduced into the bacterial cell, is integrated into the genome and replicated together with the chromosome into which it has been integrated. In some embodiments, the integration of the genes encoding the machinery for cellulose synthesis will be integrated into the nonessential locus of a chromosome. A nonlimiting example of a nonessential locus of a chromosome is locus -6-, on the 6.6Mbp chromosome of SBW25 (Rainey and Bailey, 1996) using the methodology shown by BAILEY et al., 1995 (which is incorporated by reference). Typically, insertion of the gene(s) of interest is mediated by site-directed homologous recombination. In some embodiments, insertion of the gene of interest is mediated by CRISPR genome editing. Typically, a CRISPR knock-in is mediated by homologous directed repair (HDR). Without being bound by theory, it is anticipated that extra metabolic activity from expressing novel gene sequences and environmental variability are safeguards against uncontrolled genetically modified bacteria multiplication in the environment. For example, a bacterium that produces increased amounts of an EPS, e.g. cellulose may only survive in environments that support its multiplication, such as growing in and around a plant root. If the genetically modified bacteria grow in an unfavourable environment, the extra metabolic burden of producing increased amounts of an EPS, e.g. cellulose will lead to reduced viability of the genetically modified bacteria in the wider environment, thereby improving the safety of the genetically modified bacteria.
[0150] A counter selectable marker may be used in the expression system. An example of selectable markers include the sucrose sensitivity system wherein the vector encodes sacB. Examples of suitable vectors include, but are not limited to, recombinant integrating or non-integrating vectors. Examples of vectors include pGEX series of vectors, pET series of vectors, and the pEX series of vectors. In some embodiments, the pEX18Ap vector is used. In some embodiments, a mini CTX1 vector is used. In some embodiments, a pFLP2 vector is used. A pFLP2 is an excision vector that can be used to remove unwanted sequence. In some embodiments, the insertion site in the host bacterium is attb defined by SEQ ID NO: 1 :
[0151] TGAGTTCGAATCTCACCGCCTCCGCCATAT.
[0152] In this specification the term “operably linked” may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a nucleotide coding sequence under the influence or control of the regulatory sequence. Thus a regulatory sequence is operably linked to a selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of a nucleotide coding sequence which forms part or all of the selected nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired protein or polypeptide.
[0153] In some embodiments, the bacterium according to the invention is modified with a cmcAx gene, having the nucleic acid sequence as defined by SEQ ID NO: 2.
[0154] In some embodiments, the bacterium is modified with a cmcAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 2.
[0155] In some embodiments, the bacterium according to the invention is modified with a ccpAx gene, having the nucleic acid sequence as defined by SEQ ID NO: 3.
[0156] In some embodiments, the bacterium is modified with a ccpAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 3.
[0157] In some embodiments, the bacterium according to the invention is modified with a bcs operon, comprising a bcsA gene, a bcsB gene, a bcsC gene and a bcsD gene, having the nucleic acid sequence as defined by SEQ ID NO: 4.
[0158] In some embodiments, the bacterium is modified with a bcs operon, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 4. In some embodiments, the bacterium according to the invention is modified with a gfp gene having the nucleic acid sequence as defined by SEQ ID NO: 5.
[0159] In some embodiments, the bacterium is modified with a gfp gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 5.
[0160] In some embodiments, the bacterium according to the invention is modified with a bglAx gene having the nucleic acid sequence as defined by SEQ ID NO: 6.
[0161] In some embodiments, the bacterium is modified with a bglAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 6.
[0162] In some embodiments, the bacterium is modified with a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 2, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 3, a bcs operon having at least 65% nucleic acid sequence identity to SEQ ID NO: 4, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 5, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 6.
[0163] In some embodiments, the bacterium according to the invention is modified with a PhIZ quorum sensing promoter having the nucleic acid sequence as defined by SEQ ID NO: 7.
[0164] In some embodiments, the bacterium is modified with a PhIZ quorum sensing promoter, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 7.
[0165] In some embodiments, the bacterium according to the invention is modified with a Rox quorum sensing promoter having the nucleic acid sequence as defined by SEQ ID NO: 8.
[0166] In some embodiments, the bacterium is modified with a Rox quorum sensing promoter, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 8.
[0167] In some embodiments, the bacterium according to the invention is modified with a AfmR quorum sensing promoter having the nucleic acid sequence as defined by SEQ ID NO: 9.
[0168] In some embodiments, the bacterium is modified with a AfmR quorum sensing promoter, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 9.
[0169] In some embodiments, the bacterium according to the invention is modified with a cmcAx gene having the nucleic acid sequence as defined by SEQ ID NO: 10.
[0170] In some embodiments, the bacterium is modified with a cmcAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 10.
[0171] In some embodiments, the bacterium according to the invention is modified with a ccpAx gene having the nucleic acid sequence as defined by SEQ ID NO: 11.
[0172] In some embodiments, the bacterium is modified with a ccpAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 11.
[0173] In some embodiments, the bacterium according to the invention is modified with a bcsA gene having the nucleic acid sequence as defined by SEQ ID NO: 12.
[0174] In some embodiments, the bacterium is modified with a bcsA gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 12.
[0175] In some embodiments, the bacterium according to the invention is modified with a bcsB gene having the nucleic acid sequence as defined by SEQ ID NO: 13. In some embodiments, the bacterium is modified with a bcsB gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 13.
[0176] In some embodiments, the bacterium according to the invention is modified with a bcsC gene having the nucleic acid sequence as defined by SEQ ID NO: 14.
[0177] In some embodiments, the bacterium is modified with a bcsC gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 14.
[0178] In some embodiments, the bacterium according to the invention is modified with a bcsD gene having the nucleic acid sequence as defined by SEQ ID NO: 15.
[0179] In some embodiments, the bacterium is modified with a bcsD gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 15.
[0180] In some embodiments, the bacterium according to the invention is modified with a gfp gene having the nucleic acid sequence as defined by SEQ ID NO: 16.
[0181] In some embodiments, the bacterium is modified with a gfp gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 16.
[0182] In some embodiments, the bacterium according to the invention is modified with a bglAx gene having the nucleic acid sequence as defined by SEQ ID NO: 17.
[0183] In some embodiments, the bacterium is modified with a bglAx gene, having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 17.
[0184] In some embodiments, the bacterium is modified with a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 10, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 11, a bcsA gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 12, a bcsB gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 13, a bcsC gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 14, a bcsD gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 15, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 16, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 17. In further embodiments, a promoter having at least 65% nucleic acid sequence identity to SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9, is operably linked to a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 10, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 11, a bcsA gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 12, a bcsB gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 13, a bcsC gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 14, a bcsD gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 15, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 16, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO: 17.
[0185] In some embodiments, the bacterium according to the invention is modified by SEQ ID NO: 18.
[0186] In some embodiments, the bacterium is modified with a nucleic acid having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 18.
[0187] The above sequences can be combined and used in any order.
[0188] Overexpression of endogenous genes
[0189] In an aspect, the invention provides an engineered bacterium for producing extracellular polymeric substances (EPS), wherein the bacteria is modified to overexpress at least one endogenous EPS synthesis and / or secretion gene. The EPS may be cellulose. Thus, in some aspects, provided is an engineered bacterium for producing cellulose, wherein the bacterium is modified to overexpress at least one endogenous cellulose synthesis and / or secretion gene. For example, the engineered bacterium may be modified to overexpress at least one gene from the wss operon, e.g., wss4, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ. The bacterium may comprise a modified promoter. In the context of the present invention, the term “modified promoter” encompasses modification, alteration or mutation of the existing, e g., native promoter, but also insertion of a promoter (e.g., a strong promoter) which is capable of driving expression of the relevant genes. The term also encompasses bacteria where increased expression of the relevant genes is being driven by a promoter which is not the same (e.g., not identical) to the native promoter for that gene.
[0190] In the context of this embodiment, the native promoter is the promoter which is naturally found in an unmodified bacterium and which drives expression of the cellulose synthesis and / or secretion genes. For example, in Pseudomonas fluorescens SBW25, the native promoter is the natural promoter which drives expression of the wss genes (“the wss promoter”).
[0191] In the context of the invention, a promoter is considered to be a region or sequence where the transcription machinery are capable of binding to initiate transcription of downstream genes. Promoters are capable of being recognised by particular RNA polymerases. The promoter or promoter sequence may comprise a core promoter, a UP element, and / or a transcription start site. The core promoter may comprise the -35 and -10 regions. Without wishing to be bound by theory, the UP elements are considered to interact with the alpha-subunit of an RNA polymerase. The promoter or promoter sequence may further comprise additional nucleotides / nucleotide sequences located upstream and / or downstream of the core promoter that are anticipated as being important for promoter function.
[0192] In some embodiments, the modified promoter is capable of driving increased expression of the desired genes compared to a reference bacterium.
[0193] In some embodiments, expression of endogenous genes involved in the synthesis and / or the secretion of extracellular polymeric substances, such as cellulose, is increased. Expression of the endogenous genes (e.g., bcs genes) may be increased by modifying or altering the regulatory sequences upstream of the relevant gene. For example, the native promoter upstream of the relevant gene or operon may be modified or replaced with another promoter to increase expression. The promoter may be an inducible promoter or a constitutive promoter. The promoter may be a strong promoter. The bacterium may be modified by the introduction of a promoter (e.g., strong promoter) upstream of the relevant gene or operon.
[0194] The bacterium may be modified by the insertion of a functional promoter upstream of the genes involved in synthesis and / or secretion of cellulose. For example, bcs genes. In some embodiments, overexpression of one or more wss genes is achieved by the upstream insertion of a promoter. The promoter is capable of driving increased expression of the cellulose synthesis and / or secretion genes. The promoter may be modified by a mutation. The mutation may be capable of making the promoter a strong promoter or constitutive promoter. The mutation may result in a strong constitutive promoter. The mutation may make the promoter inducible, for example an autoinducible promoter or a sugar inducible promoter as described herein. The mutation may result in a strong inducible promoter. The mutation may result in a modified promoter capable of driving increased expression of the relevant downstream genes compared to a reference bacterium (i.e., without a mutated promoter). The mutation may increase the binding affinity of an RNA polymerase.
[0195] In some embodiments, the bacterium is modified such that expression of the wss genes is driven by a different promoter (i.e., a promoter other than the native wss promoter). The promoter may be a strong promoter. The promoter may be a constitutive promoter or an inducible promoter. For example, in some embodiments, the wss operon promoter is replaced by another promoter, such as an inducible or constitutive promoter. The wss operon promoter may be replaced by a strong promoter.
[0196] In some embodiments, the promoter is an inducible promoter. For example, the promoter is induced by the use of benzoic acid derivates. Suitable benzoic derivatives may include 3- methylbenzoate (m-toluate), Salicylate, Acetyl salicylic acid (ASA), 3-methylsalicylate, 5- methoxysalicylate, Benzoate, 2-methylbenzoate, 4-chlorobenzoate, 4- methoxybenzoate, 3- chlorobenzoate, 4-methylbenzoate, 5-methylsalicylate, 2-chlorobenzoate, 2,3- dimethylbenzoate, 2-methoxybenzoate, 3-fluorobenzoate, 2-fluorobenzoate, 4-ethylbenzoate, 3- bromobenzoate, 4-fluorobenzoate, 4-bromobenzoate, 2,5-dimethylbenzoate, 3,4- dichlorobenzoate, anthranilate, 2-acetylsalicylate, 3-iodobenzoate, 4-iodobenzoate, 3- methoxybenzoate, 3,4-dimethylbenzoate, 2-bromobenzoate and 4-methylsalicylate. In some embodiments, the promoter may be a xylose-inducible promoter. In some embodiments, the promoter is a mannitol-inducible promoter, an arabitol-inducible promoter or a glucitol-inducible promoter. The inducible promoter may be induced by mannitol. Mannitol is naturally produced by numerous organisms including plants, fungi, brown algae, yeasts and bacteria, and as a result is thought to be the most abundant sugar alcohol in nature. In some embodiments, the promoter is an anthranilate inducible promoter or a benzoate inducible promoter (as described in Retailack DM et al. (2006)). The inducible promoters may be isolated from a Pseudomonas bacterium.
[0197] In some embodiments, the promoter is an auto-inducible promoter. For example, the promoter may be a cell density-dependent auto-inducible promoter. The cell density-dependent autoinducible promoter may be based on a quorum sensing system as described herein, for example, the RoxS / RoxR quorum sensing system (see Meyers A et a!. 2019). The promoter may be inducible and a strong promoter (e.g., a “strong inducible promoter”). In some embodiments, the promoter may be auto-inducible and a strong promoter (e.g., a “strong auto-inducible promoter”). The promoter may be constitutive and a strong promoter (e.g., a “strong inducible promoter”), for example as described in Jing X et al (2018). Example Pseudomonas strong and constitutive promoters from Jing X et al. (2018) are shown in Table 1 below.
[0198] The native wss promoter may not be removed but may be destroyed or disrupted by the insertion of the promoter (e.g., strong and / or constitutive promoter). In some embodiments, the wss promoter is replaced or disrupted by the insertion of a promoter from a bacterium of the same genus as the engineered bacterium (e.g., Pseudomonas). In some embodiments, the wss promoter is replaced or disrupted by the insertion of a promoter from a bacterium of the same species as the engineered bacterium (e.g., Pseudomonas fluorescens). The wss promoter is replaced or disrupted by the insertion of a promoter from a bacterium of the same strain as the engineered bacterium (e.g., Pseudomonas fluorescens SBW25). The promoter may originate from an alternative location within the genome of the bacterium of the same genus, species or strain.
[0199] In some embodiments, the promoter is isolated from a bacterium from the Pseudomonas genus. The promoter sequence may be isolated from Pseudomonas putida, Psuedomonas fluorescens, Pseudomonas protegens, or Pseudomonas stutzeri. In some examples, the promoter sequence may be isolated from P. protegens Pf-5, Pseudomonas stutzeri DSM4166, or P. Fluorescens DSM50106.
[0200] Suitable promoters include, but are not limited to, the Table of promoters provided below.
[0201] Table 1 : Promoters. Where indicated, bold = -35 and -10 regions and italics = RBS binding sites. Full references provided under the heading “References” below.
[0202] The bacterium may be modified by insertion of a sequence comprising a promoter. The regulatory sequences, such as the promoter, upstream of the relevant gene(s) may be replaced by a sequence. In some embodiments, the sequence is from the same genus as the bacterium. The sequence may be from the same species or strain as the bacterium.
[0203] In some embodiments, the bacterium is modified with a sequence having at least 70% identity to the amino acid sequence of SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, or SEQ ID NO: 53. In some embodiments, the bacterium is modified with a sequence having having at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to the amino acid sequence of any one of SEQ ID NOs: 21 to 53. In some embodiments, the bacterium is modified with a sequence as defined by SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28,
[0204] SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO:
[0205] 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID
[0206] NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45,
[0207] SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO:
[0208] 51, SEQ ID NO: 52, or SEQ ID NO: 53.
[0209] In some embodiments, the bacterium is modified with a promoter having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleic acid sequence identity to SEQ ID NO: 50. In some embodiments, the promoter is isolated from Pseudomonas stutzeri. The bacterium may be modified with the promoter p12445 (SEQ ID NO: 50).
[0210] In some embodiments, expression of the relevant gene, genes or operon is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to a reference bacterium. The increase in expression may be at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold and so on, compared to a reference bacterium.
[0211] Production of cellulose may be increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to a reference bacterium. The increase in cellulose production may be at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold and so on, compared to a reference bacterium (e.g., an unmodified bacterium).
[0212] Quorum sensing system
[0213] In some embodiments, expression of the EPS, e.g. cellulose, synthesis genes is regulated by a cell-density quorum sensing promoter. In further embodiments, the expression of the EPS, e.g. cellulose, synthesis genes (e.g., wss genes) is regulated by a cell-density quorum sensing system. In further embodiments, the quorum sensing system is under the control of a constitutive promoter. In further embodiments, the quorum sensing system regulates the promoter controlling expression of the genes disclosed herein. Without being bound by theory, it is anticipated that the use of a quorum sensing system controls the expression of the EPS, e.g. cellulose, synthesis genes such that once the bacteria colonise the rhizosphere to a concentration threshold, the promoter is switched on and the EPS, e.g. cellulose, synthesis will begin. Quorum sensing (QS) is defined as the ability to detect and to respond to cell population density by gene regulation. As an example, bacteria can use quorum sensing to regulate phenotype expressions such as biofilm formation, virulence factor expression, motility, bioluminescence, nitrogen fixation, sporulation etc, which coordinate their behaviour. This function is based on the local density of the bacterial population in the immediate environment. In some embodiments, a quorum sensing operon is inserted into the host cell.
[0214] In some examples, gram-positive bacteria use the autoinducing peptide (AIR) as an autoinducer, which acts as a signalling molecule. When a high-concentration of AIP is detected in the local environment, the AIP binds to a receptor to active a kinase. The kinase then phosphorylates a transcription factor, which then regulates transcription of gene(s). This is known as a two-component system. Thus, in some embodiments, a two-component system is used. In some embodiments, a two-component system comprises a sensor kinase (which detects the signalling molecule) and a response regulator (which regulates gene expression).
[0215] In another example, gram-negative bacteria produce N-acyl homoserine lactones (AHL) as a signalling molecule. Typically, these AHLs bind directly to transcription factors to regulate gene expression. In some embodiments, a one-step process is used. It is known that some gramnegative bacteria also utilise a two-component system.
[0216] In some embodiments, the genes disclosed herein are regulated by a cell density-dependent auto-inducible promoter. In some embodiments, the EPS, e.g. cellulose, synthesis and / or secretion genes disclosed herein are under the control of a cell-density quorum sensing promoter. It is anticipated that when the bacteria colonise the rhizosphere and reach a threshold density, the EPS, e.g. cellulose, synthesising genes are switched on.
[0217] In some embodiments, the quorum sensing system comprises a gene encoding a sensor kinase and a gene encoding a response regulator. In further embodiments, the quorum sensing system further comprises a quorum sensing regulated promoter. In some embodiments, a nucleic acid comprising a gene encoding a sensor kinase and a gene encoding a response regulator is operably linked to a constitutive promoter. In further embodiments, a RoxS / RoxR quorum sensing system is used. In some embodiments, a RoxS / RoxR operon is inserted into the host cell. In alternative embodiments, the quorum sensing system comprises a gene encoding a signalling molecule (autoinducer) and a gene encoding a transcriptional / response regulator. In further embodiments, the quorum sensing system further comprises a quorum sensing regulated promoter. In some embodiments, a nucleic acid comprising a gene encoding a signalling molecule and a gene encoding a transcriptional / response regulator is operably linked to a constitutive promoter. In further embodiments, a PhzR / Phzl quorum sensing system is used. In some embodiments, a PhzR / Phzl operon is inserted into the host cell. In some embodiments, the quorum sensing system activates the target gene promoter. In further embodiments, the response regulator binds to the target gene promoter.
[0218] QS-based auto-inducible promoter systems, specifically the RoxS / RoxR Quorum Sensing (QS) system of bacteria, is described in Meyers A, et al. 2019. The RoxS / RoxR quorum sensing system is a two-component system formed by a sensor histadine kinase (RoxS) and a response regulator (RoxR). It is anticipated that RoxS will result in the phosphorylation of RoxR, this phosphorylated RoxR will then regulate the expression of the EPS, e.g. cellulose, synthesis and secretion genes disclosed herein, by binding to a putative RoxR recognition element. In some embodiments, a RoxS / RoxR quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a quorum sensing dependent RoxS / RoxR-promoter is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a rox quorum sensing regulated promoter is used to control expression of the genes described herein. In some embodiments, a quorum sensing dependent RoxS / RosR-promoter is operably linked to a nucleic acid encoding the genes disclosed herein. In some embodiments, the quorum sensing dependent RoxS / RosR-promoter is operably linked to the endogenous cellulose synthesis / secretion genes (e.g., the wss operon). In some embodiments, the promoter comprises a RoxR recognition element.
[0219] Also described is the PhzR / Phzl quorum sensing system. This system comprises the transcriptional regulator PhzR and the AHL synthase Phzl. In some embodiments, a PhzR / Phzl quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a quorum sensing dependent PhzR / PhzI-promoter is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a phz quorum sensing regulated promoter is used to control expression of the genes described herein. In some embodiments, a quorum sensing dependent PhzR / Phzi- promoter is operably linked to a nucleic acid encoding the genes disclosed herein. In some embodiments, a quorum sensing dependent PhzR / PhzI-promoter controls expression of the endogenous cellulose synthesis / secretion genes (e.g., the wss operon).
[0220] In further embodiments, the quorum sensing system is under the control of a constitutive promoter. This can be seen in Figures 4 and 5.
[0221] In some embodiments, a RhlR / Rhll quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a RhlR / Rhll operon is inserted into the host cell. In the Rhll / R system, rhll directs the synthesis of N- (butanoyl)-homoserine lactone (C4-HSL), which then interacts with the cognate RhIR, influencing transcription of target genes. In some embodiments, a quorum sensing dependent RhlR / Rhll-promoter is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a rhl quorum sensing regulated promoter is used to control expression of the genes described herein. In some embodiments, a quorum sensing dependent RhlR / Rhll-promoter is operably linked to a nucleic acid encoding the genes disclosed herein. In some embodiments, a quorum sensing dependent RhlR / Rhll-promoter controls expression of the endogenous cellulose synthesis / secretion genes (e.g., the wss operon).
[0222] In some embodiments, a Luxl / LuxR quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a Luxl / LuxR operon is inserted into the host cell. In some embodiments, a Lux / LuxR quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a quorum sensing dependent Luxl / LuxR-promoter is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a lux quorum sensing regulated promoter is used to control expression of the genes described herein. In some embodiments, a quorum sensing dependent Luxl / LuxR- promoter is operably linked to a nucleic acid encoding the genes disclosed herein. In some embodiments, a quorum sensing dependent Luxl / LuxR-promoter controls expression of the endogenous cellulose synthesis / secretion genes (e.g., the wss operon).
[0223] In some embodiments, a Afml / AfmR quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a Afml / AfmR operon is inserted into the host cell. In some embodiments, a Afml / AfmR quorum sensing system is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a quorum sensing dependent Afml / AfmR-promoter is used to control the expression of the EPS, e.g. cellulose, synthesis and secretion genes. In some embodiments, a afm quorum sensing regulated promoter is used to control expression of the genes described herein. In some embodiments, a quorum sensing dependent Afml / AfmR- promoter is operably linked to a nucleic acid encoding the genes disclosed herein. In some embodiments, a quorum sensing dependent Afml / AfmR-promoter controls expression of the endogenous cellulose synthesis / secretion genes (e.g., the wss operon).
[0224] Without wishing to be bound by theory, the quorum sensing system may act as a biosafety element. The genetically engineered bacteria of the invention are anticipated to colonise the rhizosphere environment of the plant of interest because the plant and bacterium live in a beneficial symbiotic relationship. In this exemplary biosafety system, the expression of an EPS, e.g. cellulose, may only be achieved when the concentration of bacteria is high. Therefore, when the genetically engineered bacteria of the invention are not present in their optimal rhizosphere environment, the EPS, e.g. cellulose, genes would not be expressed, and the genetically engineered bacterium would act as a wild-type strain.
[0225] In some embodiments, the heterologous EPS, e.g. cellulose, synthesis and / or secretion genes are regulated by a quorum sensing system. In some embodiments, the heterologous EPS, e.g. cellulose, synthesis and / or secretion genes are regulated by a quorum sensing regulated promoter.
[0226] In some embodiments, the quorum sensing system regulated promoter is operably linked to the nucleic acid encoding one or more of the exogenous genes of the invention, wherein expression of said genes is regulated by the quorum sensing system. In some embodiments, the exogenous genes comprise a bcsA gene; a bcsB gene; a bcsC gene; a bcsD gene; a cmc gene; a ccp gene; a bgl gene; a pgm gene; a galU gene; a cdg operon; and a dgc gene. In further embodiments, the genes a heterologous. In some embodiments, the quorum sensing system regulated promoter controls or drives expression of the endogenous cellulose synthesis / secretion genes (e.g., the wss operon).
[0227] Compositions
[0228] An aspect of the invention provides a composition comprising an engineered bacterium as described herein. The composition may be added to the soil surrounding a plant root as a liquid formulation, or as an inoculum, for example, as a peat-based formulation. The composition may be used to coat seeds.
[0229] In some embodiments, the genetically modified bacterium of the invention is delivered to plants as an inoculum that can be directly added to the soil. In some embodiments, the genetically modified bacterium of the invention is delivered to plants as a bacterial inoculum that can be directly added to the soil. In another embodiment, the genetically modified bacterium of the invention is delivered to plants as a liquid formulation that can be directly added to the soil. In some embodiments, the microbial or bacterial inoculants are peat-based formulations. In further embodiments, the peat-based formulations are used to coat seeds or pellets for sowing in furrows. In some embodiments, the genetically modified bacterium of the invention is delivered to plants in microbeads. In further embodiments, the microbeads are alginate microbeads. It is anticipated that these alginate microbeads encapsulate the bacteria and protect them against environmental stresses and release them into the soil gradually when soil microorganisms degrade the polymers.
[0230] Typically, the genetically modified bacteria of the invention can be applied in combination with biofertilisers. A “biofertiliser” as used herein is a substance which contains living microorganisms which promotes plant growth by increasing the supply availability of primary nutrients to the host plant. Biofertilisers may add nutrients to the plant by nitrogen fixations, solubilising phosphorous, and stimulating plant growth through the synthesis of growthpromoting substances. Biofertilisers do not contain any chemicals which are harmful to the living soil. Examples include, Rhizobium, Azotobacter, Azospirilium and blue green algae (BGA). Additional examples include strains such as Pantoea agglomerans strain P5 or Pseudomonas putida strain P13, which are known in the art to solubilise phosphate from organic or inorganic phosphate sources. It is anticipated that the genetically modified bacteria of the invention can be used in combination with such biofertilisers. In some embodiments, the genetically modified bacteria of the invention may administered to the soil in combination with a biofertiliser in a single composition. In some embodiments, the genetically modified bacteria of the invention may administered to the soil in combination with more than one biofertiliser in a single composition. In another embodiment, the genetically modified bacteria of the invention are administered separately to the biofertiliser / biofertilisers.
[0231] In some embodiments, the genetically modified bacterium of the invention is delivered to plants in combination with a fertiliser in a single composition. In some embodiments, the genetically modified bacterium of the invention is delivered to plants in combination with more than one fertiliser in a single composition. In another embodiment, the genetically modified bacterium of the invention is administered separately to the fertiliser / fertilisers. As used herein a “fertiliser” is any material of natural or synthetic origin that are used to improve plant growth and yield.
[0232] In some embodiments, the composition of the invention is delivered to plants in microbeads. In further embodiments, the microbeads are alginate microbeads. Typically, alginate is the most common polymer material for the encapsulation of bacteria for various industrial microbiological purposes, but other algal polysaccharides may be used (Bashan, Y., et al. 2002). The main advantages associated with alginate preparations are their non-toxic nature (reducing the impact to the local environment), degradation in the soil, their slow release of bacteria into the soil, and almost unlimited shelf life (Bashan Y et al. 2002). In some embodiments, the microbeads are applied as wet microbeads. In some embodiments, the microbeads are applied as dry microbeads. In some embodiments, the microbeads are between 100pm and 500pm in diameter. In a preferred embodiment, the microbeads are between 100pm and 200pm in diameter. It is anticipated that a microbead of between 100pm and 500pm in diameter will be able to hold >106CFU bead-1, which is sufficient to inoculate a seed. In some embodiments, the composition of the invention is delivered to plants as macrobeads. In further embodiments, the macrobeads are alginate macrobeads. It is anticipated that the alginate macrobeads behave in a similar manner to microbeads. In some embodiments, the macrobeads are between 1mm and 5mm in diameter. In a further embodiment, the macrobeads are between 1mm and 3mm in diameter.
[0233] In some embodiments, the microbial or bacterial composition is applied to a plant after planting but before harvest of said plant. In some embodiments, the microbial or bacterial composition is applied to the soil before planting a plant. In some embodiments, the plant is a crop plant. In some embodiments, the composition is used to coat seeds or pellets for sowing in furrows.
[0234] Without being bound by theory, it is anticipated that the genetically engineered bacterium, or root-associated bacterium according to the invention will colonise the roots of plants following inoculation onto seeds and result in enhanced plant growth. The following steps outline the colonisation process: a) inoculation onto seed, b) multiplication in the spermosphere (region surrounding the seed) in response to seed exudates, c) attachment to the root surface, and d) colonisation of the developing root system.
[0235] In some embodiments, the bacteria are stored as a dried formula and delivered to soil as a liquid broth.
[0236] Methods
[0237] In one aspect of the invention, a method of increasing soil quality and microbiome diversity around plant roots is provided. The method comprising applying the genetically engineered bacterium, or root-associated bacteria of the invention to the surrounding soil of the plant. In some embodiments, soil quality and microbiome diversity around plant roots is improved relative to the same plant(s) in the same conditions but without the bacterium of the invention. In some embodiments, the increase in soil quality and microbiome diversity can be measured by 16S rRNA sequencing, e.g. as outlined at Example 4.2. In some embodiments, the diversity of the soil microbiome is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
[0238] Provided are methods of improving plant health by applying the modified bacterium as described herein. For example, the method may increase root mass, increase rhizosheath mass and / or reduce abiotic water stress. Root mass may be determined by measuring the dry weight (e.g., in g) of plant roots. Rhizosheath mass may be determined by isolating the rhizosheath soil, drying it and then measuring the weight (e.g., in g). In some embodiments, the root mass and / or rhizosheath mass is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. The increase may be at least 2-fold, 3-fold, 4-fold or 5-fold. A reduction in abiotic water stress may be measured by determining the water potential of a leaf (e.g., using a Scholander pressure chamber). Abiotic water stress may be reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
[0239] In some embodiments, the increase in water- retention can be measured by an increase in soil water content. Soil water content can be calculated on a gravimetric or volumetric basis, as known in the art. In some embodiments, the soil water content is increased at least 2-fold, 3- fold, 4-fold, 5-fold, 6-fold and so on.
[0240] In some embodiments, water consumption e.g., in agriculture, is reduced. In some embodiments, the amount of water used is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and so on.
[0241] In some embodiments, cellulose production by the microorganism or bacterium results in increased carbon sequestration in the surrounding soil. In some embodiments, the carbon captured is increased at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold and so on.
[0242] The above effects may be measured compared to an untreated control and / or treatment with a reference bacterium.
[0243] As described herein, the invention provides a method of increasing the sugar content in soil surrounding a plant root, by applying a composition comprising an EPS (e.g. cellulose) expressing bacteria to the soil.
[0244] Relatedly, the invention also provides a method of increasing the diversity of the microbiota of soil surrounding a plant root, by applying a composition comprising an EPS expressing bacteria to the soil. The EPS may be cellulose.
[0245] The bacterium may be modified as described herein. In addition to the method steps described in this application, the method may further comprise a step of preparing a composition comprising the EPS expressing bacteria. The method may comprise the step of preparing a composition comprising the EPS expressing bacterium and one or more plant-promoting components, such as nitrogen, phosphorous, and / or potassium. The method may comprise the step of preparing a composition comprising the EPS expressing bacterium and a biofertilizer (e.g., as described herein) or a fertilizer (e.g., as described herein). The method may comprise the step of formulating the composition, for example, as a liquid formulation. The composition and formulations may be as described herein. Such method steps may be carried out prior to applying the composition to the soil. Plants
[0246] In some embodiments of the invention, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, a soy plant, a sugarcane plant, a maize plant, a potato plant, a tomato plant, tobacco plant, and a cassava plant. In further embodiments, the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant.
[0247] An aspect of the invention provides a plant comprising the genetically engineered bacterium, or root-associated bacteria of the invention. In some embodiments, the plant comprises the isolated genetically engineered root-associated bacterium of the invention, the population of genetically engineered root-associated bacteria of the invention, or the bacterial composition of the invention. In some embodiments, the genetically engineered root-associated bacterium, isolated genetically engineered root-associated bacterium, or the population of genetically engineered root-associated bacteria is associated with the plant roots. In some embodiments, the genetically engineered root-associated bacterium grows on the plant roots. In some embodiments, the genetically engineered bacterium, or root-associated bacterium grows in the soil surrounding plant roots.
[0248] Uses
[0249] In some aspects, the invention provides use of a genetically modified bacterium in agriculture, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS, e.g. cellulose.
[0250] In some embodiments, the genetically engineered bacterium is an isolated genetically engineered bacterium of the invention, a population of genetically engineered bacteria of the invention, or a composition of the invention.
[0251] In some embodiments, the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of EPS, e.g. cellulose, wherein the genetically modified bacterium is modified with an exogenous nucleic acid. For instance, the genetically modified bacterium may be modified with a bcs operon, wherein the bcs operon comprises a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. In further embodiments, the exogenous nucleic acid further comprises a ccpAx gene. In some embodiments, the exogenous nucleic acid further comprises a cmcAx gene, a ccpAx gene, and a bglAx gene. In further embodiments, the genes are heterologous.
[0252] In some embodiments, the bacterium is genetically modified with one or more heterologous genes. For instance, the bacteria may be genetically modified with one or more genes selected from: a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and a bglAx gene. In some embodiments, the genes are each isolated from K. xylinus. In some embodiments, the genetically engineered bacterium is a root-associated bacterium. In some embodiments, the genetically engineered bacterium is a plant growth-promoting rhizobacterium.
[0253] In some embodiments, the bacterium is genetically modifed to overexpress at least one endogenous gene involved in synthesis and / or secretion of an EPS (e.g., cellulose), as described herein. The endogenous genes may be wssA, wssS, wssC, wssD, wssE, wssF, wssG, wssH, wss / , and / or wssJ.
[0254] The features disclosed in the foregoing description, or in the following numbered embodiments or claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.
[0255] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.
[0256] For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.
[0257] Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0258] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0259] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example + / - 10%.
[0260] Numbered embodiments
[0261] 1 . A genetically engineered bacterium for producing an extracellular polymeric substance (EPS), wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of the EPS.
[0262] 2. The genetically engineered bacterium carding to embodiment 1 , wherein the EPS is cellulose.
[0263] 3. The genetically engineered bacterium according to embodiment 2, wherein the cellulose is bacterial cellulose.
[0264] 4. The genetically engineered bacterium according to embodiment 2 or embodiment 3, wherein cellulose production is increased in the genetically modified bacterium compared to a reference bacterium.
[0265] 5. The genetically engineered bacterium according to any one of the preceding embodiments, wherein the genetically modified bacterium is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex.
[0266] 6. The genetically engineered bacterium according to embodiment 5, wherein the exogenous nucleic acid comprises a bcs operon.
[0267] 7. The genetically engineered bacterium according to embodiment 6, wherein the exogenous nucleic acid further comprises at least one of the following genes or operon: a) cmcAx gene; b) ccpAx gene; c) bglAx gene; d) pgm gene; e) galU gene; f) cdg operon; and / or g) dgc gene. 8. The genetically engineered bacterium according to embodiment 6, wherein the exogenous nucleic acid further comprises a cmcAx gene, a ccpAx gene, and a bglAx gene.
[0268] 9. The genetically engineered bacterium according to any one of embodiments 6 to embodiment 8, wherein the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus.
[0269] 10. The genetically engineered bacterium according to any one of the preceding embodiments, wherein the bacterium is a bacterium, optionally wherein the bacterium is Pseudomonas fluorescens.
[0270] 11. The genetically engineered bacterium according to any one of embodiments 2 to 10, wherein the cellulose is secreted outside of the cell.
[0271] 12. The genetically engineered bacterium according to embodiments 11 , wherein the secreted cellulose forms a network outside of the cell.
[0272] 13. The genetically engineered bacterium according to embodiments 12, wherein the secreted cellulose network contributes to a sustained improvement in soil quality, sugar content and / or microbiome diversity around plant roots.
[0273] 14. The genetically engineered bacterium according to embodiments 13, wherein the plant is a cereal plant, a corn plant, a rice plant, a wheat plant, or a soy plant.
[0274] 15. A method of increasing production of an EPS in a bacterium compared to a reference bacterium, wherein the method comprises a step of modifying the bacterium to overexpress at least one protein involved in synthesis and / or secretion of the EPS.
[0275] 16. The method of increasing production of an EPS according to embodiment 15, wherein the EPS is cellulose.
[0276] 17. The method of increasing production of an EPS according to embodiment 16, wherein the bacterium is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. 18. A vector comprising an exogenous nucleic acid that comprises a bcs operon and at least one of a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon, and a dgc gene.
[0277] 19. A method of producing a genetically engineered bacterium for producing an EPS, wherein the method comprises a step of modifying the bacterium to overexpress at least one protein involved in synthesis and / or secretion of th EPS comprising: a) isolating a bacterium; and b) introducing a vector comprising an exogenous nucleic acid comprising at least one of the genes selected from the group comprising: a bcsA gene; a bcsB gene; a bcsC gene; a bcsD gene; a cmcAx gene; a ccpAx gene; a bglAx gene; a pgm gene; a galU gene; a cdg operon; and a dgc gene, into the bacterium.
[0278] 20. A genetically engineered bacterium obtainable by the method of embodiment 19.
[0279] 21. An isolated genetically engineered bacterium according to any one of embodiments 1 to 14 or embodiment 20.
[0280] 22. A population comprising the genetically engineered bacterium according to any one of embodiments 1 to 14 or embodiment 20.
[0281] 23. A composition comprising the genetically engineered population of embodiment 22.
[0282] 24. The composition according to embodiment 23, wherein the composition further comprises a fertiliser and / or a biofertiliser.
[0283] 25. A method of increasing soil quality, sugar content and / or microbiome diversity around plant roots, comprising applying a genetically engineered bacterium to soil surrounding a plant root, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0284] 26. The method according to embodiment 25, wherein the bacterium is selected from the genetically engineered bacterium according to any one of embodiments 1 to 14 or embodiment 20, the isolated genetically engineered bacterium of embodiment 21 , the population of genetically engineered bacteria of embodiment 22, or the composition of embodiments 23 or 24. 27. A method of reducing fertilizer consumption in agriculture, comprising applying a genetically engineered bacterium to soil surrounding a plant root, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0285] 28. The method according to embodiment 27, wherein the bacterium is selected from the genetically engineered bacterium according to any one of embodiments 1 to 14 or embodiment 20, the isolated genetically engineered bacterium of embodiment 21 , the population of genetically engineered bacteria of embodiment 22, or the composition of embodiments 23 or 24.
[0286] 29. A plant comprising the genetically engineered bacterium according to any one of embodiments 1 to 14 or embodiment 20, the isolated genetically engineered bacterium of embodiment 21 , the population of genetically engineered bacteria of embodiment 22, or the composition of embodiments 23 or 24, wherein the genetically engineered bacterium, isolated genetically engineered bacterium, or the population of genetically engineered bacteria is associated with the plant roots.
[0287] 30. Use of a genetically modified bacterium in agriculture, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0288] 31. The use according to embodiment 30, wherein the EPS is cellulose.
[0289] 32. Use of a genetically modified bacterium to increase soil quality, sugar content and / or microbiome diversity around plant roots, wherein the bacterium is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0290] 33. The use according to embodiment 32, wherein the EPS is cellulose. Examples
[0291] EXAMPLE 1 - Engineering of the root-associated bacteria
[0292] 1. Bacterial strains and plasmids
[0293] Komagataeibacter xylinus DSM 2325 will be obtained from DSMZ (Braunschweig, Germany). Exemplary bacterial strains and plasmids are listed in Table 2.
[0294] K. xylinus is a member of the acetic acid bacteria, a group of Gram-negative aerobic bacteria that produce acetic acid during fermentation. K. xylinus is unusual among the group in also producing cellulose.
[0295] 2. Gene manipulation
[0296] For genetic manipulation purposes, E. coli TOP10 cells will be used. E. coli cells will be cultivated in Luria-Bertani (LB) medium (Invitrogen, Carlsbad, CA) at 37°C with 225rpm orbital shaking. LB will be supplemented with antibiotics (50 pg / ml ampicillin) when needed for plasmid maintenance. All DNA manipulations will be conducted according to standard protocols (Sambrook, J., 2001).
[0297] Pseudomonas fluorescens strain SBW25 (Rainey and Bailey, 1996), will be utilised as a host for insertion of the bacterial biosynthetic cellulose machinery. A nonessential locus -6-, on the 6.6- Mbp chromosome of SBW25 will be chosen, as previously demonstrated (Rainey and Bailey, 1996) and the methodology shown by (BAILEY et al., 1995). Two fragments flanking the -6- locus (~200bp) will be amplified by conducting PCR with P. fluorescens genomic DNA; the genomic DNA will be prepared using genomic DNA extraction kit from Promega (Madison, Wl). The upstream and downstream flanking fragment will be amplified by PCR. The upstream and downstream regions of the -6- locus, bcs operon, pgm (phosphoglucomutase), galU (UTP- glucose-1 -phosphate), cdg operon, and dgc standalone gene (Table 3.) from K. xylinus (Jang et al., 2019) will be ligated into the pEX18Ap vector at the EcoRI restriction enzyme site using the In-fusion HD cloning kit (Clontech laboratories, Inc., mountain view, CA), resulting in the pEX- bcs vector. This plasmid will be transformed into E. coli TOP10 cells for the amplification and identification of the modified pEX-bcs plasmid. The purified plasmid will then be introduced into the -6- locus chromosomal site in P. fluorescens by electroporation, for the expression of the bcs bacterial biosynthetic cellulose machinery.
[0298] 3. Growth conditions of engineered strains
[0299] The following conditions will be used for the visual verification of the successful bacterial biosynthetic cellulose machinery expression into P. fluorescens. Following this, greenhouse and field trials will be used for the optimisation of cellulose production in a model system. Nutrient broth media will be used for all cellulose synthesis production experiments using flasks containing: 3.0g / L meat extract, 10.0g / L peptone (enzymatic digest of casein), 5.0g / L sodium chloride, pH 7. Cells will be incubated for 5 days at 30°C under static conditions. The media will be supplemented with various carbohydrates for optimisation. Routine experimental optimisation of this protocol can be performed to adjust the specific parameters for best results according to particular field conditions.
[0300] Table 2. Description of the bacterial species and plasmids.
[0301] Table 3. Description of the genes essential for biosynthetic cellulose synthesis production in Komagataeibacter xylinus that will be used for the genetic modification in Pseudomonas fluorescens.
[0302] EXAMPLE 2 - Application of the genetically modified bacteria
[0303] The genetically modified bacteria will be delivered in biodegradable microbeads (microballs) containing a nutrient source which will be supplemented in currently commercially available biofertilisers.
[0304] In this example a method of inoculating plants (or seeds) with the genetically modified bacterium of the invention is described using alginate microbeads. These alginate microbeads encapsulate the bacteria and protect them against environmental stresses and release them into the soil gradually when soil microorganisms degrade the polymers. The raw material, kelp macroalga (Macrocystis pyrifera), is a renewable marine resource of great abundance in the Pacific Ocean.
[0305] 1. Microbead formation
[0306] The microbeads may be produced using a device as described in Bashan et al. 2002, or any other suitable device. Typically, the microbeads produced will be around 100 to 200 pm in diameter. The bacteria of the invention will be cultured as described above and then the bacterial suspension will be mixed with 2% sodium alginate (CICIMAR, La Paz, Mexico), optionally skim milk without Ca may also be added to the alginate-bacterial suspension to produce beads that are more biodegradable. This suspension will then be pressurised at 10-15 psi using a commercial air compressor. Then the bacterial suspension will be forced to pass through a 222-pm-daimeter capillary exit, which will create a fine spray of miniature droplets. The mist will then be collected using a stainless steel flask rotating at 40rpm containing 0.1 M CaCh to solidify the microbeads. The microbeads will then be allowed to cure in CaCh solution for 30mins. The wet microbeads will then be extracted from the CaCh solution, and then rinsed in 500ml saline solution (0.85% (w / v) NaCI) four times under aseptic conditions. Optionally the microbeads can be transferred into bacterial culture medium (in growth conditions) to allow for bacterial multiplication. The microbeads will then be separated from the suspension by filtration using Whatman filter paper, and rinsed three times with 500ml saline solution.
[0307] 2. Drying procedures
[0308] Optionally, the microbeads may be dried before applying them to soil, plant roots, and / or seeds. In this drying method, 10g of microbeads can be placed as a thin layer on filter paper in a Petri dish and dried at 38±1°C for 48h. Then the dry microbeads can be collected in a hermetically sealed container with silica gel until they are used. Alternatively, dry microbeads may be prepared by standard lyophilisation.
[0309] The wet and / or dry microbeads comprising the genetically modified root-associated bacteria will then be applied to the soil, plant roots, and / or seeds.
[0310] EXAMPLE 3 - Engineering of the root-associated bacteria
[0311] 1. Bacterial strains and plasmids
[0312] This method will use the Komagataeibacter xylinus CGMCC 2955 strain and the Mini CTX1 vector and the pFLP2 excision vector to remove unwanted sequences.
[0313] 2. Gene manipulation
[0314] As before, for genetic manipulation purposes, E. coli TOP10 cells will be used. E. coli cells will be cultivated in Luria-Bertani (LB) medium (Invitrogen, Carlsbad, CA) at 37°C with 225rpm orbital shaking. LB will be supplemented with antibiotics (50 pg / ml ampicillin) when needed for plasmid maintenance. All DNA manipulations will be conducted according to standard protocols (Sambrook, J., 2001).
[0315] Pseudomonas strains CHAO, F113, FW300 N2E2 and Pf-5 will be utilised as a host for insertion of the bacterial biosynthetic EPS machinery. The target insertion site in the genome of these strains is the attB site (SEQ ID NO 1: TGAGTTCGAATCTCACCGCCTCCGCCATAT). The EPS synthesis genes (cmcAx, ccpAx, BcsA, BcsA, BcsC, BcsD, BglAx) will be inserted using a Mini CTX1 vector and a pFLP2 (Flp recombinase) vector. In this example, GFP will also be inserted as a reporter gene, this can be see in Figure 3. A quorum sensing operon can also be added to the Pseudomonas strains to regulate the promoter controlling cellulose synthase gene expression (see Figure 4). The quorum sensing operon, such as the PhzI / PhzR operon, will be under the control of a constitutive promoter.
[0316] 3. Method
[0317] Conjugations
[0318] Recipient Pseudomonas strains, as well as E. coli donor and helper strains, were grown in 3 ml LB (with antibiotic when appropriate) at 37°C with rolling for about 8 h. One milliliter of each culture was centrifuged at 8,000 * g for 2 min in microcentrifuge tubes. The culture supernatants were aspirated, cell pellets were resuspended in 1 ml LB, and cell suspensions were centrifuged. Aspiration, resuspension, and centrifugation were repeated. The supernatant was aspirated and cell pellets were resuspended in 35 pl LB. Cell suspensions were spotted onto LB agar and incubated at 37°C overnight. The cells were scraped off and resuspended in LB and serially diluted 10-fold, and 100 pl of each dilution was spread on Vogel-Bonner minimal medium (VBMM; 10 mM sodium citrate tribasic, 9.5 mM citric acid, 57 mM potassium phosphate dibasic, 17 mM sodium ammonium phosphate, 1 mM magnesium sulfate, 0.1 mM calcium chloride, pH 7.0) agar with antibiotic (gentamicin or tetracycline) and incubated at 37°C overnight. Chromosomal integration of miniTn7 was confirmed by PCR with oligonucleotide primers.
[0319] Electroporations
[0320] Recipient Pseudomonas strains will be grown in 3 ml LB in duplicate at 37°C with rolling for about 8 h. The two 3-ml cultures will then be pooled and dispensed into four microcentrifuge tubes. The cultures will be centrifuged at 8,000 x g for 2 min. Each cell pellet will then be resuspended in 1 ml 300 mM sucrose and centrifuged twice. The four cell pellets will then be resuspended and pooled in a total of 300 pl of 300 mM sucrose. One hundred microliters of each suspension will be transferred to 1-mm-gap-width electroporation cuvettes. One hundred nanograms of pFLP2 plasmid will be added to each suspension. Cells will be electroporated at 1 ,800 V in an Eppendorf electroporator 2510. Nine hundred microliters of LB will be added to each electroporation. Recovery cultures will then incubated at 37°C with rolling for 1 h. Cultures can be serially diluted 10-fold, spread on LB agar with antibiotic (carbenicillin), and incubated at 37°C overnight.
[0321] Excision of antibiotic resistant cassette by Flp-FRT recombination
[0322] Recipient Pseudomonas strains containing chromosomal gentamicin resistance cassette flanked by FRT recombination sites were electroporated with pFLP2 plasmid. Transformants were streaked on LB with carbenicillin, as well as on LB with gentamicin, to screen for excision of the gentamicin resistance cassette by Flp recombination. Gentamicin-sensitive transformants were streaked from LB with carbenicillin to LB with 5% sucrose. Strains that have the pFLP2 plasmid are sucrose sensitive, while those that have lost the plasmid are sucrose resistant. Sucrose-resistant colonies were streaked on LB, LB with gentamicin, and LB with carbenicillin to confirm both excision of the gentamicin resistance cassette and loss of the pFLP2 plasmid.
[0323] EXAMPLE 4 - Protocol for trial of genetically modified Pseudomonas fluorescens
[0324] 1. Experimental design
[0325] Maize plants (cultivar Pioneer P7892) will be raised in 24 cell module trays, using seeds, and then similarly-sized plants will be transplanted at the 3-4 leaf stage into ~10L pots containing equal weight of commercially available sandy loam soil packed at the same bulk-density. Pots will be inoculated with one of nine inoculum treatments (Table 4). The control inoculum will consist of a mock inoculation using an equivalent volume of growth or other media lacking bacteria.
[0326] Five pot replicates will be used for each inoculum treatment. These will be arranged in five blocks (each of the nine treatments represented in each block) in a randomised block design on glasshouse benching, allowing data analysis to be conducted by Analysis of Variance (ANOVA). Environmental data will be captured in the glasshouse control system (temperature, relative humidity, solar radiation, set points).
[0327] Pots will be watered by hand daily according to the two treatments below, and will be fed twice a week with Hoagland’s solution once they have reached 8-10 leaves, or beginning when they have clearly exhausted the nutrients available in the pot. Feed solution will replace irrigation treatments given to reach field capacity, and volume of feed will be the same for all treatments, topped up with water to field capacity. Pest and diseases may be controlled with appropriate fungicides and insecticides.
[0328] To determine whether the genetically modified Pseudomonas fluorescens promote increased diversity of the soil microbiome, samples from the test and control soil will be collected and measured for microbiome diversity. Microbiome diversity is measured by 16S rRNA sequencing.
[0329] Pots will be spaced at 30 cm spacings in two rows arranged on 1 m wide benches. The glasshouse compartment will be heated to 25 / 20°C day / night and supplementary illumination will be provided by high-pressure sodium lamps on a 16 / 8 hour day / night cycle. Maize has optimal growth at 25°C (broad optimum between 21 and 27°C). Five replicate pots will be used for all treatments except for “No Pseudomonas” treatment where 10 replicates will be used (as all lines will be compared to this baseline). There will be two irrigation treatments.
[0330] Total number of pots = [(5 reps x 8 inocula) + (10 reps x 1 inoculum)] x 2 treatments = 100
[0331] Bench area = 1 x 6 m2and 1 x 9 m2(30 cm x 100, two rows on a 1 m wide bench, split over two benches containing either 2 or 3 “blocks”). Guard plants will be installed at the ends of each row (total of 8 plants) to reduce edge effects.
[0332] Table 4: Inoculum treatments
[0333] 2. Measurements
[0334] Microbial colonisation of the rhizosphere:
[0335] A ~10g sample of macerated soil / roots from the water capacity experiment (one sample per pot at harvest) will be mixed with water or buffer solution, and then filtered. Serial dilutions will be plated onto the appropriate selective media, and then incubated for 48 hrs at 25°C. Colony forming units (cfus) will be counted and cfu ml’1calculated. A positive control would consist of inoculum applied to a sample of non-inoculated soil immediately prior to extraction (done at time of pot inoculation).
[0336] Three replicates per treatment and three serial dilutions plus controls = (3 reps x 9 inocula x 2 irrigation treatments x 3 dilutions) + (8 control inoculations x 3 replicates x 3 dilutions) = 162 + 72 = 234 plates.
[0337] Microbiome diversity (16S rRNA seq) 16S rDNA sequences have long been used as a taxonomic gold standard in determining the phylogenies of bacterial species. Here, they will be used to classify bacterial strains in the soil around the rhizosphere of plants and thus determine the microbiome diversity in the soil.
[0338] To this end, soil samples will be collected from the rhizosphere of plants by removing the plant from the soil, and lightly shaking to remove loosely attached soil. Soil that is strongly attached to the root will be harvested by placing it in 30mL of autoclaved phosphate buffer solution (PBS). The soil in PBS will be vortexed at maximum speed for 30 seconds, forming a soil slurry. The soil slurry will be filtered through a 100um cell strainer into a fresh sterile tube and then centrifuged to precipitate soil particles. The pellet will be resuspended and centrifuged again before being collected into a 1.5mL centrifuge tube. Soil genomic DNA extraction will be performed using the MoBio soil DNA extraction kit as per the manufacturer’s instructions. PCR amplification reactions will be carried out using primers for the V3-V4 variable region of the 16s rRNA gene with adapter overhangs attached to the primers.
[0339] PCR reaction mixes (final concentration) will be set up as follows: 1X Q5 reaction buffer, 200 pM dNTPs, 0.5 pM forward primer, 0.5 pM reverse primer, <1 ,000ng template DNA, 0.02 U / Q5 high-fidelity DNA polymerase, nuclease-free water. The first cycle will be run at 98°C for 30 seconds, followed by 35 cycles of 98°C for 10 sec, 55°C for 30 seconds and 72°C for 30 seconds, followed by a final extension at 72°C for 2 minutes.
[0340] To confirm PCR-based identification results, a comparative 16S rDNA sequence analysis will be performed. All PCR amplicons will be purified and eluted in Tris / HCI (10 mM, pH 8.5) prior to sequencing to remove dNTPs, polymerases, salts, and primers. Once the library preparation is complete, the libraries will be loaded onto the MiSeq system and output data will be analysed using the MiSeq reporter software. The resulting sequences will be aligned and compared with those stored in GenBank by using BLAST alignment software (NCBI).
[0341] The comparison of the 16S rRNA gene sequences will allow differentiation between organisms in the soil at the genus level across all major phyla of bacteria, in addition to classifying strains at multiple levels, including the species and subspecies levels.
[0342] Carbon content of the soil:
[0343] A ~20g sample of soil will be taken from the rhizosphere at harvest (prior to macerating soil / roots for the water capacity experiment), and any root fragments will be removed by sieving at 2mm. Total organic carbon (TOC) will be measured by elemental analyser following hydrochloric acid treatment to remove carbonates. One sample per pot = 100 samples. Positive control analysis will also be conducted on soil mixed with cellulose (produced in the water capacity experiment) = 20 samples.
[0344] Plant health: a) During plant growth, plant height and leaf number will be measured at weekly intervals using methods defined by agronomy practices.
[0345] Briefly, height will be defined as “from the soil surface to the highest point of the arch of the uppermost leaf whose tip is pointing down”. Leaf number will be recorded using three rapid methods:
[0346] 1 . Number of leaf tips that have emerged from the whorl.
[0347] 2. Number of leaves, starting from the lowest leaf and finishing with the last leaf that has arched over (leaf tip pointing down).
[0348] 3. Number of leaves with visible collars (i.e. leaves emerged from the whorl). b) Leaf chlorophyll content will be measured with a leaf chlorophyll meter (CCM-200) at weekly intervals on a standard leaf (e.g. uppermost arched leaf, two readings per leaf) validated with a standard curve (acetone extraction and spectrophotometer). 3 weeks x 200 measurements = 600. c) At plant harvest, the total aboveground matter will be chopped, bagged and dried at 80°C until fully dried. Dry weights per plant will be recorded (100 measurements).
[0349] Plant mineral content may also be measured using standard techniques.
[0350] EXAMPLE 5 - Modification of Pseudomonas fluorescens SBW25 with constitutive promoter
[0351] This example uses lambda red recombination genes located on a plasmid within the Pseudomonas fluorescens SBW25 strain to introduce p12445, a constitutive promoter from the Pseudomonas species (i.e., Pseudomonas stutzeri) into the chromosome to drive expression of the native cellulose genes of SBW25 (i.e., wss genes).
[0352] The method comprises two steps. First, a fragment (SEQ ID NO: 19) containing a kanamycin resistance gene and the sacB gene, which causes sensitivity to sucrose, can be introduced into the chromosome and tested on kanamycin plates without sucrose. Second, the fragment (SEQ ID NO: 20) containing the desired promoter (p12445; SEQ ID NO: 50) may be swapped onto the chromosome in place of the kanR / sacB fragment and this is selected for on sucrose plates. Cellulose production can then be quantified. 1. Methods 1.1. Culturing E.coli strains were grown at 37⁰C in LB media with required antibiotics at 250 rpm. Pseudomonas strains were grown at 30⁰C in LB media with required antibiotics at 250 rpm. Tetracycline working concentration in this example was 10ng / µl, Kanamycin working concentration was 50ng / µl (20ng / µl for chromosomal), and Ampicillin working concentration was 100ng / µl. 1.2. Lambda plasmid creation pgRNA Fragment – 3114bp Reaction R R d F R D P N Protocol 9 9 6 7 7 4°C - ∞ 1 cycle Lambda gene fragment – 5068bp Reaction Reagent Amount R d F R D P N Protocol 9 967 7 4 Nebuilder to create pgRNA – Lambda Both fragments were digested with Dpn1 as per the recommended protocol to ensure minimum te R N L p Nuclease free water Up to 20µl The nebuilder reaction was incubated at 50°C for 1 hour before taking 3µl and mixing it with Top10 E.coli electrocompetent cells. The cells underwent electroporation using 1.8kv, 25µF and 200Ω. The time constant was 4.9ms. The cells were then plated on LB agar plates containing 10ng / µl tetracycline. Plates were incubated overnight at 37°C. Colony PCR Screening Due to potential template carry over, 50 colonies were screened using colony PCR to detect pgRNA-lambda. The protocol was as follows: Colonies were picked and suspended in 10µl of nuclease free water. This was heated to 98°C for 10 minutes before taking 5µl and using that as template for the PCR reaction. Reaction R R d F R D P N Protocol 9 967 7 4 A band of 667bp signalled a positive colony and the strain was stored at -80°C. Creation of electrocompetent SBW25 cells SBW25 was cultured up to the exponential phase and then centrifuged at 4800rpm for 10 minutes at 4°C to pellet the cells. The supernatant was discarded and the cells were suspended in an amount of 4°C 10% glycerol equal to the discarded supernatant (culture volume). This process was repeated again to total 2 glycerol washes before pouring off the supernatant and letting the cells resuspend in the remaining 10% glycerol (less than 1ml).50µl aliquots were created and stored at -80°C for future use. Transfer of pgRNA-lambda to SBW25 The plasmid was isolated from the above E.coli strain using an Invitrogen plasmid kit and the extracted plasmid was then electroporated into competent SBW25 cells using 2.5kv, 20µF, 200Ω. The constant was 5.1ms. sacB / kanR Plasmid Creation KanR / sacB fragments R R d F R D fr P p N P 9 96 0°C – 30 seconds35 cycles 7 7 4 Rea ent Fra ment 3 – 867b R G d F R D fr P p N Protocol 9 9 7 7 4 N R Nebuilder mastermix 10µl Fragment 1 1µl F F P N The nebuilder reaction was incubated at 50°c for 1 hour before taking 3µl and mixing it with Top10 E.coli electrocompetent cells. The cells underwent electroporation using 1.8kv, 25µF and 200Ω. The time constant was 4.8ms. The cells were plated on LB agar plates containing 100ng / µl ampicillin and 50ng / µl kanamycin. Plates were incubated overnight at 37°C. Transformation of kanR / sacB fragment into lambda positive SBW25 PCR kanR / sacB fragment – 4234bp R R d F R D k P p N Using suitable primers a 4234bp fragment was amplified from the puc19 vector ready for Dpn1 digest followed by PCR clean up and then electroporation into the lambda positive SBW25 strain. Electroporation of sacB / kanR fragment into SBW25(λ+) The sacB / kanR fragment (SEQ ID NO: 19) was electroporated into competent SBW25(λ+) cells (2.5kv / 20µF / 200Ω) and the cells were suspended in LB broth with 0.1% arabinose incubated at 30°c for ≈2 hours @250rpm. The suspension was then plated on LB agar containing 0.1% arabinose with 10ng / µl tetracycline and 20ng / µl kanamycin. Although electroporation seemed successful (≈5ms) no kanamycin resistant colonies appeared on the plates. Insertion of the promoter
[0353] Once the sacB / kanR fragment is inserted into the chromosome and verified with PCR. The next stage to be performed is another lambda recombination and replace the sacB / kanR fragment with a housekeeping promoter (p12445) to drive the cellulose genes. The p12445 fragment (SEQ ID NO: 20) can be amplified with 20F forward primer (SEQ ID NO: 57) and 4253R reverse primer (SEQ ID NO: 58), shown below.
[0354] 20F Forward Primer - 5 ' CGGCGGCCAATGGTAAGAAT 3 ' 4235R Reverse Primer - 5 ' TTGGCGGGTGTCGGGGCTGGCTTAAGCAAAACCGCGCTCGGGC 3 '
[0355] Sequences
[0356] SEQ ID NO: 1:
[0357] TGAGTTCGAATCTCACCGCCTCCGCCATAT
[0358] SEQ ID NO: 2:
[0359] ATGCTGTTGGATTTTATGAAGCTGCAAAAACAGGTATCCGGAATGGGACGTCGTTCTTTCCTGTCTGTCATGGCGGC AGCTGGCAGTATTCCTTTCCTTTCTACCGCCCTGGCCGCGGATGACCCGGCCATAAACGCGCAATGGGCCATCTTCC GCGCCAAGTATTTCCACCCCGACGGCCGTATCATCGACACAGGCAACAGTGGCGAATCCCATAGCGAGGGGCAGGGC TACGGCATGCTTTTCGCCGCGACGGCGGGTGATCAGGCCACGTTCGAGGCCATGTGGTCCTGGACACGCGCCAACCT GCAGCACAAGACCGATGCCCTGTTCTCCTGGCGCTATCTGGACGGGCATAACCCGCCGGTCGCGGACAAGAACAACG CGACGGATGGCGACCTGCTGATAGCCCTGGGTCTGGTCCGTGCCGGACGGCTGTGGAAGCGCGCTGACTATATTCAG GATGCTATAGCCATCTATGGCGACGTGCTGAAGCTCATGACCCTGCAGGTCGGTCCCTATCTGGTGCTTCTGCCCGG CGGCGTGGGGTTTGCCACCAAGGATTCGGTCACGCTCAACCTGTCCTATTATGTCATGCCCTCGCTCATGCAGGCCT TCGCGCTGACGGGCGACGCACGCTGGCAGAAGGTGATGGGAGATGGTCTGATCATCATAAACCAGGGGCGATTCGGG GAGTGGAAGCTCCCGCCTGACTGGCTTTCGATCAACCGCCAGAACGGGCATTTCTCCATAGCCAATGGCTGGCCGCC GCGATTCTCCTATGATGCGATTCGCGTGCCGCTGTATCTTTACTGGGCGCATATGCTGTCGCCGGACCTGCTGGCCG ACTTTACCCGCTTCTGGAACCATTTCGGGGCATCGGCCCTGCCGGGGTGGATTGACCTGACCAATGGTGCCCGCTCG CCCTACAATGCGCCACCGGGCTATCTGGCCGTGGCGACATGTTCCGGCCTGTCATCCGCCGGTGGGTTGCCAACCCT GGACAAGGCGCCGGATTATTATTCGGCTGCCCTGACATTGCTGGTTTATATTGCCCGTGGTGAGGGAGGTGGAATGT GA
[0360] SEQ ID NO: 3:
[0361] GCATGGATATGGACAATCCGCAGGACGTGACGCGCATGCTCTCCAGCGGTTATGGCCTGAGCGGGGAGGGGTTCCAC TACCATTCCTTCACGCGTCCCGTCATGCTGGACATGACCCCGGAACTGCCCCACGATTCCGTGGACGATACAGAGCA TCATCTCGACGATAACGTCACCGAACACGAATCCGCCCCGGCAACGGCACCGGTGTTCGTGTTCGATGCGGCACCTG AGCCTGCGGCACCACCTGTTGTTGCCGAGGCCGCGCCACCGCCACCTCCTCCGCCGCCGCCAGAGCCTGCGCCTCCT GAGCCGCCGCCCGCACCGCCACCCTATACGCCGGTTGTAACCCACGTGCCGCCGCCGCCGCCCGTGGAGGAAACGCC GGTACCCGAACCCGTGGCTGAAGCGGCTGCACCTGCAAGGCCCCGGCCCGTGCCGCCGGCGCAGCCCGCGCCGGACA TGGCATCGACGGGCGGGCGTGAACGGCGCGGGCTTCAGCCTTTTACCACGCCGCGTACGCCATCCGAGCCGCCGGTG
[0362] TCTTCACGTGCGGCCGCACCGGCCACGCCCTTCGTCCAGGCAGATGACTGGGCGCCGGTGCCAAAGGCCCAGCAGCG
[0363] TCGCGGCCAGCGTCCGACCGGGCCTGGTTTCTTCTTTGCCAAGGGGAATGACCGGGTTGCGACTGCCCGGCTGTTCC
[0364] AGCCGGTGGCAGTGGCCCGTCCTGCTTCCAAACCTGACTCCAAGGTGACCACGATGACCAAATTCGACAAGACCGCA
[0365] CAGAATGCCCCCACGGGGCGTCGTCCTGCGCCATCTGACAATTCGCCAACACTGACGGAAGTTTTCATGACACTGGG
[0366] CGGTCGTGCCACCGACCGGCTGGTGCCCAAGCCCAGCCTGCGTGACGCGCTGCTGCGCAAGCGTGAGGAAGAAACCG GGCAATCCTGA
[0367] SEQ ID NO: 4:
[0368] AATGTCAGAGGTTCAGTCGTCAGCGCCCGCGGAAAGTTGGTTTGATCGCCTTTCCAACAAGATACTGTCACTGCGCG
[0369] GTGCCAGTTATATCGTTGGGGCAATAGGCCTGTGCGCCCTGCTTGCCGCGACCACGGTTATGCTGTCGGTAAATGAA
[0370] CAGCTGATTGTGGCATTAGTGTGCGTTGTGGTCTTTTTTATCGTCGGTCGGCGCAAAAGCCGTCGGACGCAGATATT
[0371] TCTCGAGGTGCTTTCGGCGCTGGTGTCCCTGCGTTATCTGACGTGGCGGCTGACCGAAACACTGGATTTCGATACAT
[0372] GGCTCCAGGGTACATTGGGGGTCACGCTGCTTCTGGCGGAACTGTACGCGCTGTACATGCTGTTCCTCAGCTATTTC
[0373] CAGACCATTTCCCCCCTGCACCGCGCGCCGCTGCCCCTGTCTCCCAATCCGGAAGACTGGCCCACGGTCGACATCTT
[0374] CATCCCGACCTATGACGAAAGCCTGGGCATCGTGCGTCTGACGGTGCTGGGCGCGCTTGGTATCGACTGGCCACCGG
[0375] ACAAGGTGAACGTCTATATCCTTGATGACGGCAAGCGTGAGGAATTCGCCCGCTTTGCCGAAGAATGCGGTGCCCGC
[0376] TACATTGCCCGTCCCGATAACGCGCATGCCAAGGCCGGTAACCTGAACTACGCCATTCAGCATACAAGTGGCGAATA
[0377] CATCCTGATTCTGGACTGCGATCACATCCCGACCCGTGCGTTCCTGCAGATCTCGATGGGATGGATGGTCGAGGACA
[0378] AGAAGATCGCCCTGATGCAGACGCCGCATCACTTCTATTCCCCCGATCCTTTCCAGCGTAACCTGGCCGTCGGTTAC
[0379] CGCACGCCGCCTGAAGGCAACCTGTTCTATGGTGTCATTCAGGATGGCAACGACTTCTGGGATGCGACCTTCTTCTG
[0380] TGGTTCCTGTGCCATCCTGCGCCGCAAGGCCATCGAAGAGATCAATGGTTTCGCAACCGAGACCGTGACGGAAGATG
[0381] CCCATACCGCCCTGCGCATGCAGCGCAGGGGGTGGTCGACCGCCTATCTGCGCATTCCGCTGGCCAGCGGGCTGGCG
[0382] ACGGAGCGCCTGGTCACGCATATCGGGCAGCGTATGCGCTGGGCCCGTGGCATGTTCCAGATCTTCCGCGTGGATAA
[0383] TCCCATGCTGGGGCCGGGCCTGAAGCTGGGGCAGCGGCTTTGCTATCTTTCGGCCATGACGTCGTTCTTCTTCGCCA
[0384] TTCCGCGTGTCATCTTCCTTGCCTCCCCGCTGGCCTTCCTTTTCTTCAGCCAGAATATCATCGCGGCCTCCCCCCTG
[0385] GCGGTGCTGGCCTACGCCATTCCCCACATGTTCCATTCCGTTGCCACGGCGGCAAAGGTGAACAAGGGATGGCGCTA
[0386] TTCATTCTGGAGTGAAGTGTACGAAACCGTCATGGCGCTGTTCCTGGTGCGGGTGACCATCGTCACGATGATGTTCC
[0387] CCTCGAAGGGCAAGTTCAACGTGACGGAAAAAGGTGGCGTTCTGGAGAACGAGGAATTCGACCTTGGTGCCACATAT
[0388] CCGAACATCATCTTTGCGGTCATCATGGCGATTGGCCTGATGCGCGGGCTGTTTGCCCTGGCCTTCCAGCATCTGGA
[0389] CATAATTTCAGAGCGTGCCTACGCACTCAACTGTGTCTGGTCCGTGATCAGTCTCATCATCCTGCTTGCGGCCATTG
[0390] CCGTCGGCCGTGAGACCAAGCAGATCCGCCACAGCCATCGTGTCGATGCGCGAATTCCGGTAACGGTTTATGATTAC
[0391] GAAGGGAATTCCAGCCATGGCATCACGCAGGACGTGTCCATGGGTGGTGTGGCCATTCATATGCCGTGGCGCAATGT
[0392] GACACCGGACCAGCCGGTGCAGACCGTTGTCCACGCCGTGCTGGATGGTGAGGTGGTCAATCTCCCCGCTACCATGA
[0393] TCCGCTGTGCGAATGGCAAGGCGGTCTTTACCTGGAACATCACCTCCCTCCCGATTGAAGCCTCTGTCGTCCGGTTC
[0394] GTGTTCGGTCGCGCCGATGCCTGGCTGCAGTGGAATGATTACGAGCATGATCGGCCGTTGCGAAGCCTGTGGAGCCT
[0395] GATCCTCAGCATCAAGGCGCTGTTCCGCAAGAAGGGTCGGATGATGATCCATAGTCGCCCGCAAAATAAACCCATTG
[0396] CACTGCCTGTTGAGCGCAGGGAGCCAACAAGCAGTCAGGGTGGTCAGAAACAGGAAGGAAAGATCAGTCGTGCGGCC
[0397] TCGTGATATGAAAATGGTGTCCCTGATCGCGCTGCTGGTCTTTGCAACGGGAGCGCAGGCTGCGCCGGTTGCATCCA
[0398] AAGCGCCAGCCCCGCAGCCTGCGGGCGATAACCTGCCGCCCCTGCCCGCCGCGGCACCGGCCGCCGCGGCAGCCCCG
[0399] GCCGGGCAGCAGCCTGCTGGCGCCGCCAGTGCGGCACCTGCCGTCGATCCGGCCGCTGCCAGCGCCGCCGATGCCAT GGTGGACAATGCGGAGAATGCGACCGGCGTCGGTTCGGATGTGGCGACCGTGCATACCTATTCCCTGCGCGAACTTG
[0400] GCGCGGAGAACGCGCTGACCATGCGTGGCGCGGCCCCCCTGCAGGGGCTGCAGTTCGGTATTCCGGGCGACCAGCTC
[0401] GTCACCTCGGCGCGGCTTGTCGTGTCGGGTGCGATGTCACCCAATCTCCAGCCCGATAACAGCGCGGTCACGATTAC
[0402] GCTGAACGAGCAGTATATCGGCACGCTCCGGCCTGACCCGTCACATCCGGCCTTTGGTCCGCTTTCCTTTGACATCA
[0403] ACCCCATCTTCTTTGTCAGCGGCAACCGGCTGAACTTCAATTTCTCGGCAGGGTCGAAAGGATGCACCGACCCGAGC
[0404] AACGGATTGCAGTGGGCCAGCGTGTCCGAGCATTCGGAACTGCAGATCACCACCATACCGCTTCCTCCCCGTCGTCA
[0405] GCTGTCGCGGCTGCCGCAGCCGTTCTTTGACAAGAACGTAAGGCAGAAGACGGTCATTCCGTTCGTCCTTGCACAGA
[0406] CATTTGATGCTGAAGTGCTCAAGGCTTCCGGCATCCTGGCGTCCTGGTTCGGCCAGCAGACCGATTTCCGCGGCGTG
[0407] AACTTCCCCGTATTTTCCACCATTCCGCAGACAGGCAATGCCGTTGTGGTGGGTGTTGCCGATGAACTGCCTTCCGC
[0408] GCTGGGGCGTCCGGCCATCAGCGGGCCGACCCTGATGGAAGTGGCCAACCCGTCCGATCCCAATGGCACGATCCTGC
[0409] TGGTAACGGGCCGGGACCGCGATGAAGTCATTACCGCAAGCAAGGGCATAGGCTTCAGCTCCAGCACGCTGCCGGTT
[0410] GCCGCGCGCATGGATGTGGCGCCGATTGACGTGGCCCCCCGCGCCCCCAACGACGCGCCGTCCTTCATCCCGACCAG
[0411] CCGGCCTGTCCGGCTGGGTGAACTGGTGCCGGTCAGTGCCCTGCAGGGCGAAGGCTATACCCCCGGCGTGCTTTCCG
[0412] TGGCGTTCCGCACGGCGCCTGACCTGTATACCTGGCGCGACCGGCCGTACAAGCTGAACGTGCGCTTCCGGGCGCCC
[0413] GACGGGCCGATCGTGGACCTGGCGCGTTCGCATCTGGACGTTGGTATCAACAATACCTACCTGCAGTCCTATTCCCT
[0414] GCATGAAAAGGACAGTGTGGTCGACCAGCTGGTCCAGCGTTTTGGCGGCCGGGGCCAGACCAGTGGCGTGCAGCAGC
[0415] ATACGCTGACCATTCCGCCGTGGATGGTGTTCGGTCAGGATCAGCTGCAGTTCTATTTTGATGCGGCCCCCCTGACC
[0416] CAGCCCGGCTGCCGTCCCGGCCCCAGCCTGATCCACATGTCGGTTGATCCGGATTCCACGATCGACCTGTCCAACGC
[0417] CTATCACATCACGCGCATGCCCAATCTGGCCTACATGGCCAGCGCGGGGTATCCGTTCACCACCTATGCCGACCTGT
[0418] CGCACTCGGCCGTGGTGCTGCCGGACCATCCCAATGGTACGGTTGTCAGCGCCTATCTTGACCTGATGGGCTTCATG
[0419] GGGGCGACGACGTGGTATCCCGTCTCGGGTCTGGACATCGTTTCCGCGGATCATGTGAATGATGTGGCGGACCGGAA
[0420] CCTGATCGTCCTGTCCACGCTGGCCAATAGCGGGGAGGTTTCCTCCCTGCTGTCGAACTCGTCGTACCAGATTGCCG
[0421] ACGGGCGCCTGCACATGGGGATGCGCTCCACCCTGAGTGGGGTGTGGAACATCTTCCAGGACCCGATGGCCGCCATC
[0422] AACAATACCCATCCGACCGAGGTCGAGACGACCCTGAGCGGTGGCGTGGGCGCGATGGTGGAAGCGGAATCCCCGCT
[0423] GGCATCCGGACGCACGGTTCTTGCCCTGCTCTCGGCTGACGGGCAGGGGCTGGACAATCTGGTCCAGATCCTCGGGC
[0424] AGCGTAAGAACCAGGCCAAGATTCAGGGCGACCTGGTGCTTGCCCATGGGGATGACCTGACATCGTACCGCAGTTCG
[0425] CCCCTTTATACCGTTGGCACGCTGCCGATGTGGCTCATGCCGGACTGGTATATGCATAACCATCCCGTTCGCGTGAT
[0426] CGTGGTGGGGCTGTTCGGATGCCTGCTGGTTGTGGCCGTGCTGGTTCGTGCCCTGTTGCGGCATGCACTGTTCCGCC
[0427] GGCGGCAGCTGCAGGAAGAAAGGCAGAAATCGTGAGCATGAACAGACGCTACGTCTTTTCCCTTTCTGCCGGCCTGC
[0428] TTGCCAGCAGTTGCATGACCGTGCTGGTGGCGGTGCCACTGGCGCGCGCGCAGCAGGCCTCCACGGCCATGACCGGT
[0429] ACCCAGGCTTCGGGCGGGTCGGCGGCGCCACGGCAGATCCTGCTGCAGCAGGCCCGGTTCTGGCTTCAGCAGCAGCA
[0430] GTATGACAATGCCCGTCAGGCCCTGCAGAATGCCCAGCGCGTGGCGCCGGATGCGCCGGATGTCCTGGAGGTACAGG
[0431] GCGAATACCAGACGGCGATCGGCAACCGGGAAGCGGCAGCCGATACGCTGCGCCACCTCCAGCAGGTTGCGCCCGGC
[0432] AGTACGGCCGCCAACAGCCTGAGTGACCTGTTGCACGAGCGTTCCATCTCGACATCCGACCTGTCGCAGGTGCGTTC
[0433] CCTTGCCGCATCCGGGCATAACGCGCAGGCGGTGCAGGGGTACCAGAAGCTGTTCAATGGCGGTAAGCCGCCGCATT
[0434] CGCTTGCGGTGGAATATTACCAGACCATGGCAGGCGTTCCGGCCGAATGGGATCAGGCCCGGGCCGGGCTTGCCGGT
[0435] ATCGTGGCATCCAATCCACAGGATTATCATGCCCAGCTCGCATTTGCGCAGGCGCTGACCTATAATACGGCGACCCG
[0436] TATGGAAGGTCTGGCGCGGCTCAAGGACCTGCAGGGTTTCCGCAGCCAGGCTCCGGTCGAGGCTGCGGCCGCCAGCC
[0437] AGTCCTACCGGCAGACGCTGAGCTGGCTGCCGGTAACGCCCACCACGCAGCCGCTCATGCAGCAGTGGCTGGATAGC
[0438] CATCCCAATGATACCGAACTGCGTGAGCATATGGTCCACCCGCCCGGCGGCCCGCCGGACAAGGCGGGTCTTGCGCG
[0439] TCAGGCGGGTTATCAGCAGCTGAATGCCGGCCGTATTGCCGCAGCCGAGCAGTCCTTCCAGTCCGCGTTACAGATCA
[0440] ATTCCCATGATGCCGATTCACTTGGCGGCATGGGACTGGTCAGCATGCGGCAGGGTGACGCAGCCGAAGCCCGCCGC TATTTCCAGGAAGCGATGGCGGCCGATCCCAAGACGGCGGATCGCTGGCGCCCGGCCCTGGCCGGCATGGAAATCAG
[0441] CGGTGACTATGCCGCGGTCCGCCAGCTTATTGCCGCCCACCAGTATGATGCGGCCAAGCAGCGCCTGTCCGCGCTGG
[0442] CACGCCAGTCCGGCCAGTTTACCGGCGCCACGCTCATGCTGGCCGACCTGCAGCGCACGACCGGCCAGATGGGTGCG
[0443] GCGGAGCAGGAATACCAGTCCGTTCTGGCACGCGACCCGAACAGCCAGCTTGCCCTGATGGGACTGGCGCGGGTGGA
[0444] GATGGCGCAGGGCAAGACGGCGGAAGCCCGCCAGCTGCTGTCGCGTGTCGGATCGCAGTATGCGACCCAGGTCGGGG
[0445] AAATCGAGGTGACGGGCCTTATGGCCGCCGCCTCGCAGACATCGGATTCCGCGCGCAAGGTCTCGATCCTGCGCGAA
[0446] GCCATGGCCCAGGCACCGCGTGACCCATGGGTGCGGATCAATCTGGCCAATGCCCTGCAGCAGCAGGGGGACATGGC
[0447] GGAAGCCAATCGGGTCATGCAGCCCATCCTGTCCAATCCCGTGACGGCGCAGGACCGGCAGGCCGGTATCCTGTTTA
[0448] CCTATGGCAGTGGCAATGATGCGATGACACGCCGCCTGCTGGCTGGCCTGTCGCCCGAGGACTATTCCCCCGCCATC
[0449] CATGCCATTGCGACGGAAATGGAGATCAAGCAGGATCTGGCCAGCCGCCTGTCCATGGTGGCGAACCCGGTTCCGCT
[0450] GATCCGTGAAGCCCTTTCGCCGCCCGACCCGACGGGCGCGCGTGGCGTGGCCGTGGCTGATCTGTTCCGTCAGCGTG
[0451] GCGACATGATTCATGCCCGCATGGCCCTGCGCATTGCCTCGACCCGCACGCTCGATCTTTCGGCGGACCAGCGTCTG
[0452] GCCTACGCCACCGAATACATGAAGATCAGCAACCCGGTTGCGGCCGCCCGCCTGCTGGCCCCGCTGGGTGACGGCAG
[0453] TGGCACGGGGGCGGGCAATGCCCTGCTTCCCGAGCAGGTACAGACGCTGCAGCAGCTGCGCATGGGGATTGCCGTGG
[0454] CCCAGTCCGACCTGCTGAACCAGCGCGGCGATCAGGCGCAGGCATACGATCACCTTGCTCCGGCCCTGCAGGCCGAT
[0455] CCGGAAGCGACATCGCCCAAACTGGCGCTGGCGCGGCTTTACAATGGTCAGGGCAAGTCCGGCAAGGCGCTGGAAAT
[0456] CGATCTGGCCGTGCTGCGGCACAACCCGCAGGATCTGGATGCGCGCCAGGCAGCGGTGCAGGCTGCCGTCAATAGCG
[0457] GCCGCAAGAGCCTGGCCACCCGCCTTGCCATGGATGGTGTGCAGGAAAGCCCGATGGATGCGCGTGCCTGGCTGGCC
[0458] ATGGCCGTGGCCGATCAGGCCGATGGCCATGGCCACCGGACCATCAGTGACCTGCGCCGCGCCTATGACCTGCGTCT
[0459] GCAGCAGGTGGAAGGCACGCGGGCGGTGGCAAGCGGGACGGGTGAGCAGGAATCGCTTGAACCCCCGTCCAGCAACC
[0460] CGTTTCGCCACCATGGCTATGGACGCCAGACGGAACTGGGCGCACCGGTTACGGGTGGCTCCTACAGCATGGAGGCA
[0461] ACGTCTCCCGAAGCATCGGACCAGATGCTGTCCTCCATCGCCGGGCAGATCACCACGCTGCGGGAAAACCTGGCCCC
[0462] CTCCATCGATGGCGGTCTGGGGTTCCGGTCGCGTTCGGGTGAGCACGGCATGGGCCGCCTGACCGAAGCGAACATTC
[0463] CCATCGTGGGGCGCCTGCCGCTGCAGGCGGGTGAGTCCAGCCTGACCTTCTCGATCACGCCAACCATGATCTGGTCG
[0464] GGACAGCTCAATACCGGTTCGGTCTATGATGTGCCGCGCTTTGGCACCGACATGGCAACACAGGCGTATAACCAGTA
[0465] CGTCAGTTACATAAGCCAGAACAATTCCAGCAGCACCCTGCATAGCGAACTTGTCAAGGGTGGCGAGGCCGAGGCCG
[0466] GTTTTGCGCCAGACGTGCAGTTCGGCAACAGCTGGGTGCGGGCGGACCTGGGGGCATCGCCCATCGGCTTCCCCATC
[0467] ACCAACGTACTGGGCGGTGTGGAATTCTCGCCGCGTGTCGGACCGGTTACCTTCCGCGTCAGCGCGGAACGCCGCTC
[0468] CATCACCAACAGCGTGCTGTCCTATGGTGGCATGCGCGACCCCAACTACAACACGACACTGGGCCGCTATGCCCGCC
[0469] AGCTTTATGGCAAGGAGCTGAGTTCCCAGTGGAGTGAGGAATGGGGCGGGGTCGTGACCAACCACTTCCATGGTCAG
[0470] GTTGAGGCAACGCTGGGCAACACCATCGTATATGGTGGCGGTGGCTATGCCATCCAGACCGGCAAGCATGTGCAGCG
[0471] CAATGACGAGCGCGAGGCGGGCATCGGTGTCAACACGCTGGTCTGGCACAATGCCAACATGCTGGTCCGCATCGGTG
[0472] TCAGCCTGACCTATTTCGGCTATGCCAACAACCAGGACTTCTATACCTACGGGCAGGGTGGCTACTTCTCGCCGCAA
[0473] TCCTATTACGCGGCGACCGTACCCATCCGGTATGCGGGGCAGCACAAGCGGCTGGACTGGGACGTGACGGGCAGCGT
[0474] TGGCTACCAGGTGTTCCATGAACACTCGTCCCCATTCTTCCCGACGTCTTCCCTGCTGCAGTCTGGCGCGCAGTACA
[0475] TTGCTGACTCGTATGTGCAGAACGCAACCAGTTCCGACTATCTCTCACAGGAGACGGTCAACAGCGCCTATTATCCC
[0476] GGAGATAGTATTGCTAGTCTTACGGGTGGCTTCAATGCTAGGGTAGGGTATCGATTTACACACAATCTTCGTCTTGA
[0477] TCTGTCGGGGCGCTGGCAGAAGGCCGGTAACTGGACTGAAAGCGGCGCCATGATTTCCGCACACTATCTTATTATGG
[0478] ACCAGTAATGACAACTTTCAACGCAAAACCGGACTTTTCCCTGTTCCTGCAGGCCCTCTCCTGGGAGATTGATGATC
[0479] AGGCCGGGATCGAGGTGAGGAATGACCTGTTGCGCGAGGTCGGTCACGGCATGGCCGGTCGGCTGCAGCCTCCGCTG
[0480] TGCAACACCATTCATCAGCTGCAGATCGAGCTGAACTCGCTGCTGGCCATGATCAACTGGGGCTATGTGCAGCTTGA
[0481] ACTGCTGCCCGAGGACCATGCCATGCGCATCGTCCATGAGGACCTGCCCCAGGTGGGCAGCGCGGGCGAGCCGGCCG GCACATGGCTGGCCCCCGTGCTCGAAGGGCTGTATGGCCGCTGGATCACGTCGCAGCCGGGTGCCTTTGGCGATTAT GTCGTCACCCGCGATGTGGATGCGGAGGATCTCAACTCCGTTCCCAGCCAGACGATCATCCTGTACATGCGCACCCG CAGCAGCAGCAACT GA
[0482] SEQ ID NO: 5:
[0483] AGAAGGAGATATACATATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTG ATGTTAATGGGCACAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTT ATTTGCACTACTGGAAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTC AAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTA TATTTTACAAAGATGACGGGAACTACAAATCACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTCGTTAATAGAATT
[0484] GAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACACAA T GT AT AC AT CAT GG C AGAC AAAC AAAAGAAT G GAAT CAAAGT T AAC T T CAAAAT T AGAC ACAAC AT T GAAGAT G GAA GCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC CTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGC TGCTGGGATTACACATGGCATGGATGAACTATACAAATAA
[0485] SEQ ID NO: 6:
[0486] AAGGAGGAACAAGCCGCATGAAACCATCCCGCAAGTCATTCCTGCTTTCCGCCGTGGCGTGGGGGCTGGTGGCCGCG CTGCCCGCCCATGCCCGCCACGCGGCCACGGCTGGTGACCCGGCCGATGACCAGGCGCGGCAGGTGCTCGCGCATAT GAGCCTTCAGGACAAGATGGCCCTTCTGTTCAGTGTGGACGGGGGCGGCTTCAATGGCAGTGTCGCACCTCCGGGGG GCTTGGGTTCGGCGGCGTATCTGCGTGCCCCGGCGGGTTCGGGCCTGCCGGACCTGCAGATATCGGATGCGGGGCTT GGCGTGCGCAACCCCGCGCATATCCGGCCCAATGGTGCGGCGGTTTCCCTGCCATCGGGTCTGGCCACGGCCAGCAC ATGGGATGTGGACATGGCCCGGCAGGCAGGTGAAATGATCGGGCGCGAGGCCTGGCTGAGCGGGTTCAACATCCTGC TGGGCGGTGGTGCCGACCTGACGCGCGACCCGCGTGGCGGCCGCAATTTTGAATATGCGGGGGAAGACCCGCTCCAG ACCGGGCGGATGGTGGGCAGCACCATTGCCGGCATCCAGTCGCAGCATGTGATTTCCACGCTCAAGCATTACGCGAT GAACGACCTTGAGACATCGCGCATGACCATGAGTGCCGATATCGACCCCGTAGCCATGCGTGAGAGCGACCTGCTGG GTTTCGAGATTGCGATTGAAACCGGGCATCCCGGTTCCGTCATGTGTTCGTACAACCGGGTGAATGACCTGTATGCG TGTGAAAACCCGTACCTGCTGAACACGACGCTGAAGCAGGACTGGCATTACCCCGGCTTTGTCATGTCCGACTGGGG CGCCACGCATTCCTCCGCCCGTGCGGCGCTGGCGGGACTGGATCAGGAATCGGCTGGTGACCATGCCGATGCGCGCC CCTATTTCACCGCTCTGTTGGCGGCGGATGTAAAGGCGGGGCGTGTGCCCGTCGCCCGTATTGACGACATGGCGCAG CGCATTGTCCGCTCCCTGTTCGCGGCGGGGCTGGTGGCCCATCCGCCGCAGCGCGGGCCGCTGGATGTGGTGACCGA CACCCTTGTGGCCCAGCGTGATGAGGAAGAAGGCGCGGTTCTGCTGCGCAACGAAGGGGGTATCCTGCCGCTTTCCC CCACCGCGCGCATCGCGGTCATTGGCGGGCATGCCGATGCGGGCGTGATCTCGGGCGGGGGGTCCAGCCAGGTCGAT CCCATCGGGGGTGAGGCGGTCAAGGGACCGGGCAAGAAGGAATGGCCGGGTGATCCGGTCTATTTCCCGTCATCCCC GCTCAAGGCCATGCGGGCCGAGGCCCCCAACGCGCACATCACCTATGAATCCGGCACCAATATCGCCGCCGCCGTGC GCGCCGCGCGGGCGGCCGATGTGGCGGTCGTGTATGCAACGCAGTTCACCTTCGAGGGGATGGACGCGCCCAGCATG CACCTTGATGCCAATGCCGACGCGCTGATCACAGCCGTGGCCGCGGCCAACCCGCGTACCGTGGTGGTGATGGAAAC CGGCGACCCGGTGCTCATGCCATGGAACAGCAGCGTTGCGGGCGTGCTGGAGGCATGGTTCCCCGGTTCCGGCGGTG GGCCGGCCATTGCACGCCTGCTGTTTGGCAAGGTTGCGCCCTCGGGCCACCTGACCATGACCTTCCCGCAGGCGGAA AGCCAGCTGGCCCATCCCGATATTGCCGGTGTGACGGCGGACAACGTGTTCGAGATGCAGTTCAAGACCGATCAGGA ACTGGTCTATGACGAAGGCAGCGACGTGGGCTACCGCTGGTTTGACCGCAACCATCTCAAGCCGCTCTATCCCTTCG GTTACGGTCTGACCTACACCACGTTCAGCACCGATGGCCTGGCGGTGCACAGGCATCATGATGCGGTGACGGTCACC
[0487] TTTACCGTACATAATACCGGCAACCGCCCCGGTGTGGATGTGCCGCAGGTCTATGTGGGCCTGCCCGATGGCGGGGC
[0488] ACGCAGGCTGGCGGGCTGGCAGCGGGTCAGTCTGGCACCGGGTGAAAGCCGTGCGGTGACGGTACAGCTTGATCCGC
[0489] GCCTGCTGGCGCATTTTGACGGGAAGAAGGACCGCTGGAGCATTCCTTCGGGCACATTCCGGCTGTGGCTTGGCACG
[0490] TCCGCCACGGATGACAGCCAGCAGGCAAGCCTGCACCTGTCCGGTCGCACCTTCGCGCCCTGA
[0491] SEQ ID NO: 7:
[0492] CTGGATTCCTGCTCGAACTCTTCGCGCCTCGTTTGCACTCCAGCCCCGCCGACCACACCAGCCCGCCCTACAAGATC
[0493] TTGTAGTCGCTAACCCTCCACAAGTCCTCTATAAAAAACCGCACTTCCCCCCTCCCCCAAGGAATCCCCTGCCATGC
[0494] ACATGGAAGAACACGCCCTGAGCGCGATGGACGACGAACTGAAACTGATGCTGGGCCGTTTCCGCCACGAGCAGTTC
[0495] GTGGAGAAGTTGGGGTGGCGGCTGCCTATCCCTCCGCACCAAGCAGGCTACGAGTGGGACCAATATGATACCGAACA
[0496] CGCCCGCTACTTGCTGGCCTTCAACGAGCACCGCAGCATCGTAGGTTGTGCCCGATTGATCCCCACTACCTTCCCGA
[0497] ATCTGCTGGAGGGGGTGTTTTCCCATGCCTGCGCGGGGGCCCCACCTCGGCACCCTGCGATATGGGAGATGACTCGC
[0498] TTCACCACCAGGGAGCCGCAGTTAGCGATGCCCCTCTTCTGGAAAACCCTTAAGACCGCAAGCCTCGCCGGCGCCGA
[0499] CGCAATCGTGGGCATCGTGAACAGCACAATGGAGCGTTACTATAAAATCAATGGCGTGAAATACGAGCGGCTTGGCA
[0500] GCGTGATAGACCATCAGAACGAAAAGATTCTCGCGATCAAATTGAGCGCCCATCGAGAACACCACCGTGGTGCGAGA
[0501] CTTCCAAGCGGCTTTACGAGCGAAGCCCTTTTGGAGGAAACCGCGTAGTAACGGCCGAGTCGTCCTCTTGGGCGACT
[0502] CGGCGCAGCAGATGAACCTTAGATATAACCCAGCGCTACCGCGTAGCTGACAGCCTGCACTCGATTCGAGGCGCCAA
[0503] TCTTCCTTTGGATATTGCGGTGATGGTAGTTCACCGTGTCTGTGCACACGCCCATAATAACGCCGATCTCCTCCGAG
[0504] GTTTTTCCGTCGGCGGTCCACCGGAGCACGTCGCATTCGCGCTCGGAGAATTCTACATCGGTGTTAAAGGCGCGGAC
[0505] GTCGGTTTCCAGGGCGGAAATCTTCTCCAGCGCGGCGGCAGCGAAGGCCTTGGTAACGGGCTTCAGGGCTTCGAACT
[0506] CCTGTAGCGAGATGGCATTGTCTTTCCGTGCGAGAGACAGGACACCCACGCGACCTTGTGTGTTAAACGACGGTTGG
[0507] GCAAGGCCATGGCAAAGGCTGCTGTCATTCGCCTCGCTCCACAGATCCGGGCAGTTCCTAAAGAGTTCGTTCGACCA
[0508] GAGGATGGGGGCGGAACTCACCTTGGAGTGTTTAACGGTGGGGTCAATCAGCGCATAGTTTGCGGCCTGATAGCGCT
[0509] GCAGCCAATGTTCTGGATAGTTACCGTACATATAGGTTTTAGGCCTCATGAAAGGCGTCACCGAGCACATGCCATAG
[0510] GCAAAGAAGTCGAATCGCAGCTCGCGCAGCGCCCGCAAGGCCACCACGGTAAATTCCTCCATGTTCATGGCCTGCGC
[0511] AAAGATGCTGTAGAAATAGGCGTCCCATCCCAACAGCTGGCCCAGTTCCATTTTGAACACCTATAACACTCCAAGGG
[0512] AGTCGTGAGACTAAACCAACCTGAGCGCCTGTCAACTGCCAAAATCAACGGTCATAGACTGCTTCGCACTAGCGACA
[0513] TGTTTTTTATGTCTAACCCAACTAACTAGCCATAGGCCACTGTTTATCAGCCGACGAATGAGCCTGCCTATTCATAA
[0514] TAATGCAACACTCCCTCCGACCGATCGCGCCCGCCCTGGGCCACTACAAGATCTGGTAGTTCCAAGCCCCAGAAACG
[0515] CAGGTGTATAAACGACACCGCACAAAACGATCAGTGCAAAACAGTTCAAGCATTGTCATTCGTCGCATGCAATTATA
[0516] TAATTATATAATTGATTGCGCGTAATTTCAGTCAACTAAGGAGAACACTGCCTAGCTA
[0517] SEQ ID NO: 8:
[0518] GCCTCCTTTCGTGTTTCGCAGCGGCCTGAGCGAGTGCCGCTGATCACTGAAAAAACAAAAGCCGGGACGGTAATGCG
[0519] CCCCGGCTTTTGTTTGAGCCGATGAAAACCCTGCCAAGAGTAAAACACCGGATCAGCTTCAACGTAGCACGGCACCT
[0520] GCAAGCCGCCACCCTGCGACGGTTCGCCGCACCCTGCCAGCCAGACCGGTAGATGAAGCCCTGACACCGCACATGCG
[0521] TCAGAACGTCGCACCTGACAGGGATAACCAGGCTCTTATAATCTGCCTTCCAATAAAAAACCTGAGAGGTCGGTCAT SEQ ID NO: 9:
[0522] AACAGAATATAGCGCGCCAGCGTATCGTGACTTACCAACTTGGTGGGTCGGCAGCTATGTATCCACGTGCTTAGGCA
[0523] TAATAAAAATCTTGCATCGTCTTCGCCTATCCCTGAAGGTGAAGTAATCCTGAAATATAATGAGTTCATGACATGGA
[0524] TTCCCGACTCAAGTACTCGGACTTCATTCCCGCGGATGAAAGCAAGAGTAACGTGTGCCTCAAACTGGAGCTGGAAA
[0525] AACTGCTGGGCGACCTGCAAGGCGCTAGCTACGCCTACTTTGCCGCCCCGCGTAACCGGGAAGTGGCGCCGCTTATC
[0526] GTGTCCAACTACCCGGCCCGATGGCTGAAGGCGTACAAGAACGCGAATTATCACCTGATCGATCCCATCATCCACCA
[0527] CGGATTAAAGAGCTGCGCCCCCTTCTCCTGGAGCGACGCCTTGCAGGCGGCCCCGTGTGAACGCAGCCGTGAGCTGT
[0528] TCCGGAGGAGCAGTCAATACCGCATCTGCACGGGGGCGACTTTCACCCTCCACGACGCCGGGGGCATGTTCAGTTCC
[0529] CTCTCGCTGTGTAACAGCGGCCCTCAGGCCGAGTTCGAACGCCGTATGGCGGACCAGCAGGGCCACTTGCAGATGGC
[0530] GCTTATCCGCTTTCATGGCCGTCTGCTGTCCCTGCGCGCAATGGACGAACTGTTTCCGGAACCACAGACTGGCCCGC
[0531] TGTCGGCCCGCGAGTTGGGCGTGCTCAAGTGGGTCATGATGGGCAAGGCGTATCGGGAGATTGCCGTCATCTGCGCG
[0532] ATTTCAGAACGAACCGTCAAATTTCACATGAGCAACATCAGCGGGAAACTGCAGGTGTGCAACGCCAAACAGGCCGT
[0533] ATATGAGGCGCAACGGCAGGGCATCTTGTAGTCAGGCCGAGATCCGCTGCGGCTCGCACAGCGCAGTTTCCAGAGGA
[0534] TTCAGCCGTTGCGGCCAGGTATCCAGCCGGGTCGAGGAGAGCGGGCACTTTCGGGCAATGTTGCTGAGCAAGCGTTG
[0535] TCGGTTCGCATCGGACACCGGCATGTCCAGCAACAGCACCTTTTCACCCGGGGCAGCCTCACCCACGTCCAGAATTT
[0536] CATAATGCCAGCCCGCGTTCCGCACAATACGGCCCATGGCGTTCGACACGACAGTGATGATGCTCTCCAGTCCGCTG
[0537] TGCGCAGCGTGGTTGTGCATACACAAAAGCAGCATCTCGGTCAGGGGCAGATGCGCCAGGCCCAGCTGACGTGACCG
[0538] AGTTTTGTCGACGAAGAAACGGCTACTCTCTGCCATCAATGCCTGCTTAGGCGGTTCGCAGCTGAAGAAGCCGCGGA
[0539] ACGGGCCTTCGACCATATACGGGTCCAGCGTGTTGATCAACCTCAGACCGGCCAGCGGGACGTTCTTCCAGGTGCCT
[0540] ACGAGATAGGTCGTACGCTCATTATCGTACTCGTCGAACTCGATGTCGTCACGAACGTTCACCTTCCAGTTCAAGCG
[0541] GTCGGCAAAAACTTCTTTACGCAGGCCGTACAGGTCGGCCACCCACGCGTGGGGCGTGGGGCTGTAGTCGAGTGCAT
[0542] GAAACTCGATGGATTCCATAGTGTTAAAGTTCTTCCGTGGGCTATGGTCAGTACTAAGGATTGGGCTCGCGCAGTTT
[0543] GCGGAGAGTCAACTTGCGTTGTGCGGCGCTTGTTATTATAACAATGTCTGTCCGATGACAACCTGTACTTAGGTGCA
[0544] GGTACAGGTTGTATGAACTGATTTTCATCTCGCACTTCGCCATCTGTACCTAGATACAGTTGTCCTGCCTGGGCAAT
[0545] TGCGACAACTTATGCCGGGCAGTGGTTAAGCCTTCAATGACACCGCGAAGATGAGCTTTTAATGTTGGACGTTTGTT
[0546] CCAACTAACGGGTTCATGGCTTGTACTTGCGAGTACCCCACTTGCCTTAATCGTCGAATATGCCAATGACAGTCTGA
[0547] GTGTCTGGATCAGGCTTCTTCACGCTGCGTGGCATCTCCAGCCAAGACATCGAAACAGGGAAGATCAGCTA
[0548] SEQ ID NO: 10:
[0549] ATGCTGCTGGATTTTATGAAGTTGCAGAAGCAGGTGAGCGGTATGGGGAGGAGGAGTTTCCTTTCCGTCATGGCCGC
[0550] CGCTGGTAGCATTCCATTTTTGAGTACGGCCCTGGCGGCCGACGATCCGGCTATCAACGCGCAGTGGGCTATCTTTA
[0551] GGGCGAAATATTTCCATCCCGACGGTCGCATAATTGATACGGGGAATTCTGGCGAAAGCCATAGTGAAGGTCAAGGC
[0552] TACGGCATGTTGTTCGCGGCCACCGCAGGTGACCAAGCGACATTCGAGGCCATGTGGAGCTGGACCCGGGCGAACCT
[0553] GCAGCATAAGACCGACGCCCTGTTTTCGTGGCGCTACCTAGACGGCCATAATCCGCCCGTCGCCGACAAAAACAACG
[0554] CGACTGACGGCGACCTGCTGATCGCCCTGGGCCTGGTTCGCGCGGGCCGCCTTTGGAAGCGCGCCGACTACATCCAG
[0555] GATGCGATTGCCATATATGGCGACGTTCTCAAACTCATGACCCTGCAAGTCGGGCCGTATCTCGTCCTCCTTCCGGG
[0556] CGGGGTCGGCTTCGCTACCAAAGACAGCGTCACACTGAACCTGAGCTATTATGTGATGCCTAGCTTGATGCAGGCCT
[0557] TCGCCCTGACCGGTGATGCGCGTTGGCAAAAGGTGATGGGGGATGGCCTCATTATTATTAACCAGGGCCGGTTCGGC
[0558] GAATGGAAGCTGCCTCCTGACTGGCTGTCCATCAACCGTCAGAACGGCCATTTCAGCATCGCCAACGGCTGGCCGCC
[0559] GCGCTTTAGCTACGACGCTATCCGCGTCCCGCTCTACCTCTATTGGGCCCATATGCTGAGCCCGGACCTCCTGGCTG
[0560] ATTTTACACGCTTTTGGAACCACTTTGGAGCATCCGCTCTGCCGGGCTGGATCGACTTGACCAACGGTGCGCGTTCT CCCTACAACGCCCCGCCGGGGTACTTGGCCGTCGCGACCTGCAGTGGCCTGTCGTCGGCAGGGGGTTTGCCGACCCT
[0561] AGATAAAGCTCCAGACTACTACTCTGCGGCCTTGACGCTCCTCGTGTACATTGCGCGCGGTGAGGGTGGTGGTATGT GA
[0562] SEQ ID NO: 11 :
[0563] ATGGACATGGACAACCCACAGGATGTTACTCGCATGCTGAGCAGCGGATACGGCCTGAGTGGTGAAGGCTTCCACTA
[0564] TCATTCCTTCACTCGCCCGGTAATGCTTGACATGACCCCAGAGCTGCCGCATGATAGCGTGGATGATACTGAACATC
[0565] ATTTGGACGATAATGTGACCGAACATGAGAGCGCACCTGCCACGGCCCCAGTTTTCGTTTTTGATGCCGCCCCGGAA
[0566] CCAGCAGCCCCGCCGGTCGTGGCTGAGGCTGCCCCACCGCCACCTCCGCCACCTCCTCCTGAACCTGCCCCGCCCGA
[0567] ACCCCCGCCCGCCCCACCGCCGTACACACCGGTTGTGACGCATGTGCCTCCTCCGCCGCCGGTGGAAGAGACTCCGG
[0568] TGCCCGAACCAGTAGCCGAAGCAGCCGCGCCAGCTAGACCGCGCCCAGTTCCGCCGGCACAGCCGGCCCCCGACATG
[0569] GCAAGCACCGGCGGCCGTGAACGCCGGGGCTTGCAGCCCTTCACGACCCCTCGCACGCCAAGCGAGCCGCCTGTATC
[0570] AAGTCGGGCCGCCGCACCGGCTACCCCGTTCGTCCAGGCCGACGATTGGGCGCCCGTGCCGAAAGCGCAGCAACGAC
[0571] GCGGGCAGCGCCCGACCGGCCCTGGGTTTTTCTTCGCCAAGGGCAACGATCGCGTGGCAACGGCTCGGCTGTTTCAA
[0572] CCGGTGGCCGTGGCACGCCCTGCCTCCAAGCCCGACAGTAAGGTGACTACAATGACCAAGTTTGACAAAACCGCGCA
[0573] GAACGCGCCCACCGGCCGTCGCCCTGCCCCGTCAGATAACTCTCCGACGTTGACCGAAGTGTTCATGACACTCGGCG
[0574] GTCGTGCGACCGACCGCCTGGTGCCGAAGCCTAGCCTGCGCGATGCGTTGCTCCGGAAGAGGGAAGAAGAAACCGGC CAAAGCTAA
[0575] SEQ ID NO: 12:
[0576] ATGAGCGAAGTCCAATCAAGTGCGCCCGCCGAAAGCTGGTTCGATCGGTTGTCGAATAAAATCTTGAGCTTGCGGGG
[0577] CGCCTCGTACATCGTGGGCGCCATCGGCTTGTGCGCGTTGCTCGCCGCCACCACGGTGATGCTGAGCGTCAACGAGC
[0578] AGCTGATCGTCGCCCTGGTATGCGTGGTGGTGTTCTTCATCGTGGGCAGGCGTAAGAGCCGTCGCACACAGATCTTC
[0579] CTGGAGGTCCTGAGCGCGCTGGTGTCTCTGAGGTATCTGACTTGGCGCCTTACCGAAACCCTTGACTTCGACACCTG
[0580] GCTGCAAGGCACCCTGGGCGTGACCTTGTTGCTGGCGGAACTGTACGCGCTGTATATGCTGTTCCTGTCGTACTTCC
[0581] AGACCATCTCTCCGCTGCATCGTGCACCTCTGCCCCTGAGCCCGAACCCCGAAGATTGGCCAACGGTAGACATATTC
[0582] ATCCCCACCTACGACGAAAGCCTGGGGATAGTCCGCTTGACCGTCTTGGGTGCACTGGGTATCGACTGGCCGCCTGA
[0583] TAAGGTAAACGTCTATATCCTGGACGACGGCAAACGGGAGGAATTTGCTCGCTTTGCCGAAGAATGTGGGGCGCGAT
[0584] ACATCGCTCGCCCCGATAACGCCCACGCCAAAGCGGGCAACCTCAACTATGCTATCCAGCACACCTCTGGCGAGTAC
[0585] ATCCTGATTCTGGACTGCGACCACATCCCCACCCGCGCTTTCCTCCAAATCTCCATGGGGTGGATGGTCGAAGATAA
[0586] AAAGATCGCCCTGATGCAGACGCCACACCACTTCTACTCGCCGGACCCGTTCCAGCGAAACTTGGCCGTGGGGTATA
[0587] GGACACCACCGGAGGGCAACCTCTTCTACGGCGTGATCCAGGACGGTAACGACTTCTGGGACGCAACATTTTTCTGT
[0588] GGCTCGTGCGCCATCTTGCGCCGGAAAGCTATCGAAGAAATCAACGGCTTCGCCACCGAAACGGTCACCGAGGACGC
[0589] GCATACCGCACTGCGGATGCAGCGCCGCGGGTGGTCGACCGCGTATCTGCGTATCCCTCTGGCCTCGGGCCTTGCAA
[0590] CGGAGCGCTTAGTGACCCATATTGGCCAGCGCATGCGCTGGGCCCGCGGGATGTTCCAAATCTTCAGAGTGGACAAT
[0591] CCTATGCTGGGCCCAGGCTTGAAGCTGGGCCAACGCCTGTGTTACCTCTCTGCCATGACGTCGTTTTTCTTTGCCAT
[0592] CCCACGCGTTATTTTCCTGGCGTCGCCGCTGGCCTTTCTGTTCTTCAGCCAGAATATCATTGCAGCCTCGCCGTTGG
[0593] CCGTCCTCGCGTATGCCATCCCGCACATGTTCCATAGCGTGGCCACCGCGGCGAAAGTGAACAAGGGCTGGAGATAT
[0594] TCGTTCTGGTCTGAAGTTTACGAAACCGTGATGGCTCTGTTCCTTGTCCGCGTGACCATCGTCACAATGATGTTCCC
[0595] TTCGAAAGGCAAGTTTAACGTAACCGAGAAAGGCGGCGTCCTGGAAAACGAAGAGTTTGACCTAGGTGCCACCTATC CGAACATCATCTTCGCCGTCATCATGGCAATCGGACTGATGCGGGGTCTGTTCGCGTTGGCGTTCCAACATCTGGAC
[0596] ATTATTAGCGAGCGCGCCTACGCGCTGAACTGTGTCTGGAGCGTGATTTCCCTCATCATCCTGCTTGCGGCCATTGC
[0597] AGTGGGGCGGGAGACAAAGCAGATACGCCACAGCCACCGGGTTGACGCGCGCATCCCGGTGACCGTGTATGATTATG
[0598] AAGGGAATAGCTCGCACGGCATCACCCAGGACGTGTCGATGGGCGGGGTTGCTATCCACATGCCCTGGCGCAACGTG
[0599] ACACCCGACCAGCCGGTCCAAACCGTGGTACACGCCGTGTTGGACGGGGAGGTTGTTAACCTGCCGGCGACCATGAT
[0600] TCGGTGCGCCAACGGTAAGGCCGTTTTCACCTGGAACATTACGTCCTTGCCTATTGAAGCCAGCGTGGTCCGCTTCG
[0601] TGTTCGGCCGCGCAGATGCCTGGTTACAGTGGAACGACTACGAGCACGACCGCCCCCTTCGTAGCCTGTGGAGCCTG
[0602] ATCCTGTCTATCAAGGCACTGTTTCGCAAGAAGGGTCGCATGATGATCCACAGTCGGCCGCAGAATAAACCCATTGC
[0603] TCTGCCGGTGGAACGTCGTGAACCGACGTCGTCCCAAGGAGGTCAGAAACAGGAGGGAAAAATCAGCCGCGCGGCCT CTTGA
[0604] SEQ ID NO: 13:
[0605] ATGGGAGGAAGTATGAAAATGGTGAGCCTGATCGCGCTGCTGGTATTCGCCACCGGTGCTCAAGCGGCCCCAGTGGC
[0606] CTCGAAGGCGCCGGCCCCTCAACCGGCCGGTGATAACCTCCCTCCGTTGCCAGCAGCCGCCCCCGCGGCGGCAGCTG
[0607] CTCCTGCTGGTCAACAGCCCGCTGGTGCGGCCAGCGCCGCCCCAGCAGTTGACCCAGCGGCCGCCAGTGCCGCCGAT
[0608] GCTATGGTGGACAACGCCGAGAACGCCACGGGGGTGGGCTCTGATGTCGCCACCGTGCATACCTACTCGCTGCGCGA
[0609] ACTGGGAGCCGAAAACGCCCTAACCATGCGCGGTGCGGCCCCGTTGCAAGGTCTGCAGTTTGGCATCCCGGGCGATC
[0610] AGTTGGTGACTTCCGCGCGCCTGGTCGTATCGGGCGCCATGAGCCCCAACTTGCAACCGGACAATTCCGCCGTCACC
[0611] ATTACCCTGAACGAACAGTATATCGGAACCTTGCGCCCGGACCCGTCGCACCCGGCCTTCGGTCCGCTGTCGTTCGA
[0612] CATTAACCCAATCTTCTTCGTGAGCGGCAACCGGTTGAATTTCAACTTTTCGGCAGGCTCCAAGGGCTGCACCGATC
[0613] CATCCAACGGCTTGCAGTGGGCCAGCGTGAGTGAACACTCCGAGCTCCAGATTACCACAATCCCGTTGCCGCCGCGC
[0614] CGCCAACTGAGCCGGCTGCCCCAGCCCTTCTTCGATAAAAACGTGCGCCAGAAAACAGTCATCCCGTTTGTTCTGGC
[0615] CCAAACCTTCGATGCCGAAGTGCTGAAGGCCTCGGGAATCTTGGCCAGCTGGTTCGGGCAGCAAACGGATTTCCGGG
[0616] GTGTGAACTTCCCCGTCTTTTCAACGATCCCCCAGACCGGCAACGCCGTGGTAGTGGGCGTGGCTGATGAACTGCCA
[0617] AGCGCACTGGGCCGCCCTGCGATTTCCGGTCCGACCCTGATGGAGGTGGCCAACCCGAGCGACCCTAACGGTACCAT
[0618] CTTGCTGGTGACAGGCCGGGACCGCGACGAGGTGATCACGGCCAGCAAGGGTATTGGCTTCAGCAGCAGCACCCTGC
[0619] CGGTGGCCGCACGCATGGATGTGGCCCCTATTGACGTGGCCCCGAGAGCTCCGAACGATGCACCGAGCTTTATCCCC
[0620] ACGAGCCGCCCGGTCCGTCTGGGCGAACTGGTCCCGGTTAGTGCCCTCCAAGGTGAAGGCTACACACCAGGCGTCCT
[0621] CTCGGTCGCCTTCCGCACGGCGCCGGATCTGTATACCTGGCGTGACCGTCCATACAAATTGAATGTGCGCTTCCGTG
[0622] CGCCGGATGGCCCCATCGTGGATCTCGCCCGTTCACACCTGGACGTGGGGATCAACAACACGTACCTCCAGTCCTAT
[0623] AGTCTGCACGAAAAAGACTCGGTGGTGGACCAACTCGTGCAGCGATTTGGCGGGCGTGGCCAAACCTCAGGTGTCCA
[0624] GCAGCATACCCTGACCATCCCTCCCTGGATGGTGTTTGGCCAGGACCAGCTGCAGTTCTACTTCGATGCCGCGCCAC
[0625] TAACCCAGCCGGGCTGCCGCCCGGGCCCGTCGCTCATCCACATGTCCGTTGACCCGGACAGCACCATCGACCTGAGT
[0626] AATGCCTACCACATCACACGGATGCCGAATCTGGCCTACATGGCTAGTGCGGGCTACCCCTTCACCACTTACGCCGA
[0627] CCTCTCCCATTCCGCCGTGGTCCTGCCGGACCACCCCAATGGCACCGTGGTGTCGGCGTATCTGGATCTGATGGGCT
[0628] TTATGGGCGCCACCACGTGGTACCCCGTCAGCGGTTTGGACATCGTGTCCGCGGATCATGTGAATGATGTGGCAGAC
[0629] CGGAACTTGATTGTGCTGAGTACCCTCGCCAACTCAGGCGAGGTCAGCAGCTTGCTGTCGAATAGTTCCTACCAGAT
[0630] CGCCGATGGCCGGCTCCACATGGGGATGCGCTCTACGTTGTCCGGCGTGTGGAACATCTTCCAAGACCCGATGGCGG
[0631] CCATCAATAACACCCACCCGACAGAAGTGGAAACCACCCTGTCGGGTGGTGTTGGCGCGATGGTAGAGGCAGAAAGT
[0632] CCGCTCGCCAGCGGCCGCACCGTGTTGGCACTGCTGAGCGCCGATGGCCAGGGCTTGGACAATTTGGTACAGATCCT
[0633] GGGCCAACGCAAGAACCAAGCGAAGATCCAAGGCGATCTGGTGCTGGCACATGGCGACGACCTGACCTCGTATCGTA GTAGCCCGTTGTACACCGTGGGCACCCTGCCGATGTGGCTCATGCCGGATTGGTATATGCACAACCACCCGGTGCGC
[0634] GTGATCGTCGTCGGCCTCTTCGGCTGCTTGCTTGTAGTCGCCGTGCTTGTCCGAGCCTTGCTGCGCCACGCTTTATT
[0635] CCGCCGCCGGCAGCTCCAGGAGGAGCGACAAAAGTCGTAA
[0636] SEQ ID NO: 14:
[0637] ATGAATCGTCGCTATGTGTTCAGCCTGTCTGCGGGCCTGCTCGCCAGTAGCTGCATGACTGTGCTGGTGGCGGTACC
[0638] GCTGGCCCGTGCTCAACAGGCTTCGACCGCCATGACTGGGACCCAGGCGAGCGGCGGCAGCGCTGCACCGCGGCAAA
[0639] TCCTGTTGCAACAAGCGCGCTTCTGGCTTCAGCAGCAGCAGTACGACAACGCCCGCCAGGCGTTGCAGAACGCACAA
[0640] CGCGTGGCGCCCGACGCCCCGGACGTGCTGGAGGTGCAGGGTGAGTATCAGACCGCTATCGGCAACCGCGAGGCCGC
[0641] CGCCGACACCCTCCGTCACCTGCAGCAGGTCGCCCCGGGTTCCACCGCCGCCAACAGCTTGAGCGACCTCCTGCATG
[0642] AACGCTCCATCAGCACCAGTGACCTGAGCCAGGTCCGCAGCCTGGCCGCCTCGGGGCATAACGCCCAAGCCGTCCAG
[0643] GGCTACCAGAAGTTGTTTAACGGGGGTAAACCGCCCCACAGCCTCGCGGTGGAATATTACCAAACCATGGCCGGCGT
[0644] CCCGGCGGAGTGGGATCAGGCGCGGGCGGGCCTGGCTGGTATCGTGGCCAGCAACCCCCAAGATTACCACGCCCAGT
[0645] TGGCCTTCGCGCAGGCGCTGACCTACAACACCGCCACCCGTATGGAAGGTCTGGCCCGACTGAAGGACTTGCAGGGC
[0646] TTTCGTTCGCAGGCGCCCGTGGAAGCCGCTGCAGCTAGCCAGAGTTACCGTCAGACCCTGAGCTGGCTGCCGGTCAC
[0647] CCCCACTACCCAGCCGTTGATGCAGCAGTGGCTGGATTCCCATCCGAATGACACTGAACTTCGCGAGCACATGGTTC
[0648] ACCCTCCGGGCGGTCCCCCGGACAAAGCAGGTCTGGCCCGCCAGGCCGGCTACCAGCAGCTGAACGCGGGCCGGATT
[0649] GCCGCCGCTGAGCAGTCCTTCCAGTCGGCGCTGCAAATCAACAGCCACGACGCCGACTCCTTGGGTGGCATGGGCCT
[0650] GGTGTCGATGCGCCAAGGCGACGCAGCAGAGGCCCGGCGTTACTTCCAGGAAGCTATGGCCGCCGACCCCAAAACCG
[0651] CCGATCGTTGGCGCCCTGCCCTGGCAGGGATGGAGATCAGCGGTGACTACGCTGCCGTTCGCCAGTTGATCGCAGCT
[0652] CACCAGTACGATGCCGCCAAGCAAAGGCTGTCGGCGCTGGCACGTCAGTCCGGCCAATTCACCGGGGCGACGCTCAT
[0653] GCTCGCCGACCTGCAGCGGACCACCGGTCAGATGGGCGCCGCAGAACAGGAGTACCAGAGCGTACTGGCCCGGGACC
[0654] CTAACTCACAACTTGCGCTCATGGGCTTGGCCCGCGTTGAAATGGCGCAGGGTAAGACAGCCGAAGCCCGTCAATTG
[0655] CTCTCCCGCGTCGGTAGCCAGTATGCTACACAAGTCGGCGAGATCGAAGTTACAGGTTTGATGGCCGCCGCCAGCCA
[0656] AACAAGCGACTCGGCGCGTAAAGTAAGCATTTTGCGCGAAGCTATGGCCCAGGCTCCCCGTGATCCTTGGGTGCGTA
[0657] TCAATTTGGCGAATGCCCTTCAGCAACAAGGTGACATGGCGGAAGCAAACCGCGTGATGCAGCCTATCCTGAGCAAC
[0658] CCAGTCACCGCTCAAGATCGCCAAGCGGGCATCCTGTTCACATACGGTAGTGGCAACGACGCGATGACCCGCCGCCT
[0659] GTTGGCTGGGCTGTCCCCAGAGGATTATAGTCCAGCAATTCACGCCATAGCTACCGAGATGGAGATCAAACAAGATC
[0660] TGGCCAGTCGCCTGAGCATGGTGGCTAACCCAGTCCCATTGATTCGAGAGGCCCTGAGTCCTCCGGACCCCACCGGT
[0661] GCCCGTGGAGTCGCGGTGGCGGACCTGTTTCGCCAGCGTGGTGACATGATCCATGCCCGAATGGCTTTACGCATTGC
[0662] TAGCACGAGAACCTTGGACTTGAGCGCTGACCAACGCCTGGCCTACGCGACCGAATACATGAAGATCTCCAATCCGG
[0663] TCGCCGCAGCGAGGTTATTGGCCCCGCTCGGGGATGGTAGTGGAACCGGCGCTGGCAACGCACTGTTGCCGGAACAG
[0664] GTTCAAACCCTTCAACAACTTCGGATGGGGATTGCCGTCGCACAGTCCGATTTGCTTAATCAGCGTGGGGACCAAGC
[0665] TCAGGCCTACGACCATTTGGCCCCGGCTTTGCAGGCCGACCCCGAAGCGACCTCACCGAAATTAGCGCTGGCTCGAC
[0666] TCTATAATGGTCAGGGGAAATCAGGGAAAGCTCTGGAAATCGACTTGGCGGTGCTCCGTCACAACCCCCAAGACTTG
[0667] GACGCCAGACAAGCGGCGGTGCAAGCCGCCGTCAACTCCGGCCGAAAGAGTCTGGCGACGCGGCTGGCTATGGACGG
[0668] GGTGCAAGAGAGCCCCATGGATGCCCGCGCATGGTTGGCCATGGCCGTGGCCGATCAAGCCGATGGACACGGCCATC
[0669] GTACTATCAGTGATCTCCGGCGCGCGTACGATTTGCGATTGCAACAGGTTGAGGGCACCCGTGCAGTGGCATCCGGT
[0670] ACCGGTGAACAGGAAAGCCTGGAACCCCCTAGCTCGAACCCGTTCCGCCATCACGGGTACGGCCGGCAGACTGAGTT
[0671] GGGCGCGCCCGTGACAGGCGGTTCGTACTCGATGGAAGCGACCTCCCCTGAGGCGAGTGATCAAATGCTGTCCAGCA
[0672] TCGCCGGCCAGATCACCACCCTGAGAGAGAACCTGGCACCCTCCATAGACGGAGGCCTGGGGTTCCGTTCGCGTAGC GGCGAACACGGCATGGGCCGGCTGACCGAGGCGAACATCCCGATCGTCGGGAGGCTCCCGCTGCAGGCCGGCGAATC
[0673] CTCCCTCACCTTCTCCATCACCCCGACCATGATCTGGTCAGGCCAACTGAATACTGGCAGCGTTTATGACGTTCCGC
[0674] GCTTTGGCACCGACATGGCCACCCAGGCATACAACCAGTACGTCAGCTACATCAGCCAGAATAACAGCAGCAGTACC
[0675] CTGCACTCGGAGTTGGTTAAGGGCGGGGAAGCCGAAGCGGGCTTCGCCCCGGACGTCCAGTTCGGCAATTCGTGGGT
[0676] GCGTGCCGACTTGGGGGCAAGCCCGATAGGCTTTCCTATCACGAACGTACTGGGCGGTGTGGAGTTCAGCCCCCGCG
[0677] TGGGACCCGTGACGTTCCGTGTCAGTGCAGAACGCCGTTCGATCACCAACTCTGTCCTTTCGTACGGCGGCATGCGC
[0678] GACCCGAACTACAACACCACGCTGGGTCGATATGCCCGCCAGCTGTACGGCAAAGAACTGAGCTCCCAGTGGAGTGA
[0679] AGAGTGGGGCGGCGTTGTCACCAACCATTTTCATGGCCAAGTGGAGGCCACTCTGGGGAACACCATCGTGTACGGTG
[0680] GCGGGGGCTACGCGATTCAAACCGGTAAGCACGTCCAGCGAAATGACGAACGTGAGGCCGGTATCGGCGTCAACACT
[0681] TTGGTGTGGCACAACGCCAACATGCTGGTCCGGATAGGCGTCAGCCTGACCTACTTCGGCTATGCGAACAATCAAGA
[0682] TTTTTACACCTACGGTCAAGGCGGCTACTTCTCACCGCAATCCTACTACGCCGCTACTGTGCCGATCCGCTATGCCG
[0683] GCCAGCACAAGCGCCTGGACTGGGATGTCACCGGCTCCGTGGGTTACCAAGTTTTCCACGAACACTCTAGTCCGTTC
[0684] TTCCCGACATCGTCGCTGCTGCAATCCGGCGCCCAATACATCGCGGACAGCTACGTCCAAAACGCAACCTCGTCTGA
[0685] CTACCTCAGTCAGGAAACCGTCAACTCCGCCTACTACCCGGGCGACAGCATCGCCTCGTTGACCGGTGGATTTAATG
[0686] CACGCGTCGGCTACCGCTTCACGCACAATCTGCGTCTGGACCTGAGCGGTCGGTGGCAAAAGGCCGGGAACTGGACC
[0687] GAAAGCGGTGCGATGATCTCCGCCCATTACCTGATCATGGATCAGTAA
[0688] SEQ ID NO: 15:
[0689] ATGACCACCTTCAATGCAAAACCCGACTTCTCCCTGTTTCTGCAGGCCCTGAGCTGGGAAATCGATGACCAGGCCGG
[0690] TATCGAGGTCCGTAACGATCTGCTGCGAGAAGTGGGGCACGGCATGGCGGGTCGCTTGCAACCTCCGCTCTGCAACA
[0691] CCATTCATCAACTCCAGATCGAACTGAATTCCCTGTTGGCCATGATCAACTGGGGCTATGTGCAACTGGAACTGCTG
[0692] CCAGAAGATCATGCTATGCGTATTGTACACGAGGATCTGCCCCAGGTTGGCTCCGCCGGCGAACCAGCGGGCACCTG
[0693] GTTGGCCCCTGTCCTGGAAGGTCTGTACGGCCGCTGGATCACCTCGCAGCCGGGTGCCTTTGGCGATTATGTGGTCA
[0694] CCCGCGACGTCGATGCCGAGGACCTCAATAGCGTGCCGTCCCAAACCATCATACTGTACATGCGGACCCGGTCGTCG TCTAACTAGATCA
[0695] SEQ ID NO: 16:
[0696] ATGGGGGAGGTTCGGATGTCCAAAGGCGAGGAACTGTTCACTGGTGTGGTCCCCATCTTGGTGGAATTGGATGGTGA
[0697] TGTTAACGGCCATAAGTTCTCGGTGTCGGGTGAAGGCGAGGGCGACGCTACCTATGGTAAACTGACTTTGAAGTTTA
[0698] TCTGCACCACCGGCAAACTGCCCGTGCCTTGGCCGACGCTGGTGACGACCTTCAGCTATGGAGTCCAGTGCTTCTCG
[0699] CGCTACCCCGACCACATGAAACAGCACGATTTCTTCAAGTCCGCGATGCCGGAGGGGTATGTTCAGGAGCGTACTAT
[0700] CTTTTACAAAGACGATGGGAATTACAAGAGCCGCGCCGAAGTGAAATTCGAAGGCGATACCTTGGTCAATCGCATCG
[0701] AGCTGAAGGGCATTGACTTCAAGGAAGATGGCAACATCCTGGGTCATAAAATGGAATACAACTACAACAGCCACAAC
[0702] GTGTATATCATGGCCGATAAACAGAAAAATGGCATAAAGGTCAACTTCAAAATCCGTCATAACATCGAGGATGGCAG CGTCCAGTTGGCCGACCACTACCAGCAGAACACTCCAATTGGCGACGGCCCCGTCCTGTTGCCGGACAACCACTACT
[0703] TGTCAACCCAGAGCGCGCTGTCGAAAGACCCCAATGAGAAGCGGGATCATATGATCCTTCTGGAGTTCGTGACGGCC
[0704] GCGGGTATCACCCATGGCATGGACGAGCTGTACAAGTAA SEQ ID NO: 17:
[0705] ATGAAACCGAGCCGCAAAAGCTTTCTGCTCAGTGCCGTGGCATGGGGCCTCGTCGCTGCCCTGCCGGCACACGCCCG
[0706] TCACGCTGCCACCGCTGGCGACCCGGCGGACGATCAGGCCCGTCAAGTTCTGGCCCATATGTCCCTCCAAGACAAGA
[0707] TGGCCCTGCTGTTTTCTGTTGACGGCGGGGGCTTTAACGGCAGCGTCGCCCCGCCTGGCGGTCTTGGCAGCGCCGCC
[0708] TATCTCCGTGCTCCTGCTGGTAGCGGCCTTCCGGATCTGCAGATATCCGACGCGGGTCTGGGCGTTCGCAACCCCGC
[0709] CCACATCCGTCCAAATGGGGCCGCTGTGAGCCTGCCGTCCGGCCTCGCCACCGCCAGTACTTGGGATGTCGATATGG
[0710] CACGTCAGGCAGGCGAAATGATCGGGCGCGAAGCTTGGTTGAGTGGCTTTAACATCCTGCTGGGTGGGGGCGCCGAC
[0711] CTGACACGCGATCCCCGCGGCGGGCGCAACTTCGAGTACGCGGGTGAAGATCCGCTGCAGACGGGTCGCATGGTCGG
[0712] TAGCACCATCGCGGGAATCCAGTCCCAGCACGTCATCAGCACCTTGAAACACTACGCAATGAACGATCTGGAAACGT
[0713] CACGGATGACGATGTCCGCCGACATCGATCCGGTTGCAATGCGCGAAAGCGACCTGCTCGGCTTCGAAATCGCTATC
[0714] GAAACCGGCCATCCTGGCTCGGTGATGTGCAGCTACAATCGCGTGAACGACCTGTACGCGTGCGAGAACCCGTACCT
[0715] GCTGAACACCACCCTGAAACAAGATTGGCATTACCCGGGCTTTGTGATGTCGGACTGGGGTGCCACCCATTCCAGTG
[0716] CCCGCGCGGCGTTGGCCGGTCTGGACCAGGAGTCCGCGGGCGACCATGCCGACGCACGTCCGTACTTCACCGCCTTG
[0717] CTGGCGGCCGACGTGAAAGCCGGCCGCGTACCCGTGGCCCGCATTGATGACATGGCCCAGCGCATCGTCCGCAGCCT
[0718] GTTCGCGGCTGGCCTGGTAGCACATCCGCCGCAGCGCGGTCCTCTGGATGTCGTGACCGATACACTGGTGGCTCAAC
[0719] GTGATGAAGAGGAAGGCGCCGTGCTGCTGCGCAACGAAGGCGGCATCCTGCCCCTGAGCCCGACCGCTCGTATCGCC
[0720] GTCATCGGCGGCCATGCCGATGCGGGCGTAATCTCGGGTGGGGGTAGTAGTCAGGTGGACCCGATTGGCGGGGAGGC
[0721] GGTTAAGGGCCCGGGTAAAAAGGAGTGGCCAGGGGACCCGGTGTATTTCCCTAGCTCGCCGCTGAAAGCAATGCGTG
[0722] CGGAGGCGCCGAACGCACATATTACCTACGAGAGCGGGACCAATATCGCAGCCGCCGTGCGCGCCGCCCGGGCCGCC
[0723] GATGTTGCCGTTGTTTACGCGACCCAGTTCACCTTCGAGGGGATGGATGCCCCTAGTATGCACCTCGACGCTAACGC
[0724] GGATGCACTGATCACCGCCGTTGCTGCCGCGAACCCACGAACCGTCGTTGTGATGGAAACAGGCGACCCGGTGCTGA
[0725] TGCCGTGGAATAGCTCCGTCGCAGGTGTCTTGGAAGCATGGTTCCCTGGCTCGGGCGGCGGGCCCGCCATCGCCCGC
[0726] CTGCTGTTTGGCAAGGTCGCGCCCAGCGGGCATCTGACGATGACTTTTCCGCAGGCCGAATCCCAACTTGCGCACCC
[0727] AGATATAGCCGGCGTGACGGCTGACAATGTGTTCGAGATGCAGTTCAAGACCGATCAGGAGCTGGTGTACGATGAAG
[0728] GCAGTGACGTGGGGTATCGCTGGTTTGACCGTAACCACCTGAAGCCGCTGTACCCTTTCGGCTACGGTCTGACCTAC
[0729] ACCACCTTCTCCACCGACGGCCTTGCGGTGCATCGCCACCACGATGCGGTCACCGTGACCTTCACCGTGCACAACAC
[0730] CGGCAACCGTCCAGGCGTGGATGTCCCGCAAGTATACGTGGGGCTGCCGGACGGCGGTGCACGGCGCTTAGCTGGCT
[0731] GGCAGCGGGTGTCATTGGCTCCGGGCGAGAGTCGCGCTGTAACCGTCCAGTTGGACCCGCGCTTGTTGGCCCACTTC
[0732] GACGGCAAGAAAGATCGCTGGTCCATCCCGTCCGGTACCTTTCGTCTGTGGCTGGGGACCTCGGCCACTGACGATTC
[0733] GCAGCAGGCCAGTCTGCACTTGTCAGGCCGGACCTTCGCCCCGTGA
[0734] SEQ ID NO: 18:
[0735] AAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTA
[0736] ACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAA
[0737] TCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGAT
[0738] TAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGA
[0739] ATTAACCATGCTGTTGGATTTTATGAAGCTGCAAAAACAGGTATCCGGAATGGGACGTCGTTCTTTCCTGTCTGTCA
[0740] TGGCGGCAGCTGGCAGTATTCCTTTCCTTTCTACCGCCCTGGCCGCGGATGACCCGGCCATAAACGCGCAATGGGCC
[0741] ATCTTCCGCGCCAAGTATTTCCACCCCGACGGCCGTATCATCGACACAGGCAACAGTGGCGAATCCCATAGCGAGGG
[0742] GCAGGGCTACGGCATGCTTTTCGCCGCGACGGCGGGTGATCAGGCCACGTTCGAGGCCATGTGGTCCTGGACACGCG
[0743] CCAACCTGCAGCACAAGACCGATGCCCTGTTCTCCTGGCGCTATCTGGACGGGCATAACCCGCCGGTCGCGGACAAG AACAACGCGACGGATGGCGACCTGCTGATAGCCCTGGGTCTGGTCCGTGCCGGACGGCTGTGGAAGCGCGCTGACTA
[0744] TATTCAGGATGCTATAGCCATCTATGGCGACGTGCTGAAGCTCATGACCCTGCAGGTCGGTCCCTATCTGGTGCTTC
[0745] TGCCCGGCGGCGTGGGGTTTGCCACCAAGGATTCGGTCACGCTCAACCTGTCCTATTATGTCATGCCCTCGCTCATG
[0746] CAGGCCTTCGCGCTGACGGGCGACGCACGCTGGCAGAAGGTGATGGGAGATGGTCTGATCATCATAAACCAGGGGCG
[0747] ATTCGGGGAGTGGAAGCTCCCGCCTGACTGGCTTTCGATCAACCGCCAGAACGGGCATTTCTCCATAGCCAATGGCT
[0748] GGCCGCCGCGATTCTCCTATGATGCGATTCGCGTGCCGCTGTATCTTTACTGGGCGCATATGCTGTCGCCGGACCTG
[0749] CTGGCCGACTTTACCCGCTTCTGGAACCATTTCGGGGCATCGGCCCTGCCGGGGTGGATTGACCTGACCAATGGTGC
[0750] CCGCTCGCCCTACAATGCGCCACCGGGCTATCTGGCCGTGGCGACATGTTCCGGCCTGTCATCCGCCGGTGGGTTGC
[0751] CAACCCTGGACAAGGCGCCGGATTATTATTCGGCTGCCCTGACATTGCTGGTTTATATTGCCCGTGGTGAGGGAGGT
[0752] GGAATGTGAGCATGGATATGGACAATCCGCAGGACGTGACGCGCATGCTCTCCAGCGGTTATGGCCTGAGCGGGGAG
[0753] GGGTTCCACTACCATTCCTTCACGCGTCCCGTCATGCTGGACATGACCCCGGAACTGCCCCACGATTCCGTGGACGA
[0754] TACAGAGCATCATCTCGACGATAACGTCACCGAACACGAATCCGCCCCGGCAACGGCACCGGTGTTCGTGTTCGATG
[0755] CGGCACCTGAGCCTGCGGCACCACCTGTTGTTGCCGAGGCCGCGCCACCGCCACCTCCTCCGCCGCCGCCAGAGCCT
[0756] GCGCCTCCTGAGCCGCCGCCCGCACCGCCACCCTATACGCCGGTTGTAACCCACGTGCCGCCGCCGCCGCCCGTGGA
[0757] GGAAACGCCGGTACCCGAACCCGTGGCTGAAGCGGCTGCACCTGCAAGGCCCCGGCCCGTGCCGCCGGCGCAGCCCG
[0758] CGCCGGACATGGCATCGACGGGCGGGCGTGAACGGCGCGGGCTTCAGCCTTTTACCACGCCGCGTACGCCATCCGAG
[0759] CCGCCGGTGTCTTCACGTGCGGCCGCACCGGCCACGCCCTTCGTCCAGGCAGATGACTGGGCGCCGGTGCCAAAGGC
[0760] CCAGCAGCGTCGCGGCCAGCGTCCGACCGGGCCTGGTTTCTTCTTTGCCAAGGGGAATGACCGGGTTGCGACTGCCC
[0761] GGCTGTTCCAGCCGGTGGCAGTGGCCCGTCCTGCTTCCAAACCTGACTCCAAGGTGACCACGATGACCAAATTCGAC
[0762] AAGACCGCACAGAATGCCCCCACGGGGCGTCGTCCTGCGCCATCTGACAATTCGCCAACACTGACGGAAGTTTTCAT
[0763] GACACTGGGCGGTCGTGCCACCGACCGGCTGGTGCCCAAGCCCAGCCTGCGTGACGCGCTGCTGCGCAAGCGTGAGG
[0764] AAGAAACCGGGCAATCCTGAAATGTCAGAGGTTCAGTCGTCAGCGCCCGCGGAAAGTTGGTTTGATCGCCTTTCCAA
[0765] CAAGATACTGTCACTGCGCGGTGCCAGTTATATCGTTGGGGCAATAGGCCTGTGCGCCCTGCTTGCCGCGACCACGG
[0766] TTATGCTGTCGGTAAATGAACAGCTGATTGTGGCATTAGTGTGCGTTGTGGTCTTTTTTATCGTCGGTCGGCGCAAA
[0767] AGCCGTCGGACGCAGATATTTCTCGAGGTGCTTTCGGCGCTGGTGTCCCTGCGTTATCTGACGTGGCGGCTGACCGA
[0768] AACACTGGATTTCGATACATGGCTCCAGGGTACATTGGGGGTCACGCTGCTTCTGGCGGAACTGTACGCGCTGTACA
[0769] TGCTGTTCCTCAGCTATTTCCAGACCATTTCCCCCCTGCACCGCGCGCCGCTGCCCCTGTCTCCCAATCCGGAAGAC
[0770] TGGCCCACGGTCGACATCTTCATCCCGACCTATGACGAAAGCCTGGGCATCGTGCGTCTGACGGTGCTGGGCGCGCT
[0771] TGGTATCGACTGGCCACCGGACAAGGTGAACGTCTATATCCTTGATGACGGCAAGCGTGAGGAATTCGCCCGCTTTG
[0772] CCGAAGAATGCGGTGCCCGCTACATTGCCCGTCCCGATAACGCGCATGCCAAGGCCGGTAACCTGAACTACGCCATT
[0773] CAGCATACAAGTGGCGAATACATCCTGATTCTGGACTGCGATCACATCCCGACCCGTGCGTTCCTGCAGATCTCGAT
[0774] GGGATGGATGGTCGAGGACAAGAAGATCGCCCTGATGCAGACGCCGCATCACTTCTATTCCCCCGATCCTTTCCAGC
[0775] GTAACCTGGCCGTCGGTTACCGCACGCCGCCTGAAGGCAACCTGTTCTATGGTGTCATTCAGGATGGCAACGACTTC
[0776] TGGGATGCGACCTTCTTCTGTGGTTCCTGTGCCATCCTGCGCCGCAAGGCCATCGAAGAGATCAATGGTTTCGCAAC
[0777] CGAGACCGTGACGGAAGATGCCCATACCGCCCTGCGCATGCAGCGCAGGGGGTGGTCGACCGCCTATCTGCGCATTC
[0778] CGCTGGCCAGCGGGCTGGCGACGGAGCGCCTGGTCACGCATATCGGGCAGCGTATGCGCTGGGCCCGTGGCATGTTC
[0779] CAGATCTTCCGCGTGGATAATCCCATGCTGGGGCCGGGCCTGAAGCTGGGGCAGCGGCTTTGCTATCTTTCGGCCAT
[0780] GACGTCGTTCTTCTTCGCCATTCCGCGTGTCATCTTCCTTGCCTCCCCGCTGGCCTTCCTTTTCTTCAGCCAGAATA
[0781] TCATCGCGGCCTCCCCCCTGGCGGTGCTGGCCTACGCCATTCCCCACATGTTCCATTCCGTTGCCACGGCGGCAAAG
[0782] GTGAACAAGGGATGGCGCTATTCATTCTGGAGTGAAGTGTACGAAACCGTCATGGCGCTGTTCCTGGTGCGGGTGAC
[0783] CATCGTCACGATGATGTTCCCCTCGAAGGGCAAGTTCAACGTGACGGAAAAAGGTGGCGTTCTGGAGAACGAGGAAT
[0784] TCGACCTTGGTGCCACATATCCGAACATCATCTTTGCGGTCATCATGGCGATTGGCCTGATGCGCGGGCTGTTTGCC CTGGCCTTCCAGCATCTGGACATAATTTCAGAGCGTGCCTACGCACTCAACTGTGTCTGGTCCGTGATCAGTCTCAT
[0785] CATCCTGCTTGCGGCCATTGCCGTCGGCCGTGAGACCAAGCAGATCCGCCACAGCCATCGTGTCGATGCGCGAATTC
[0786] CGGTAACGGTTTATGATTACGAAGGGAATTCCAGCCATGGCATCACGCAGGACGTGTCCATGGGTGGTGTGGCCATT
[0787] CATATGCCGTGGCGCAATGTGACACCGGACCAGCCGGTGCAGACCGTTGTCCACGCCGTGCTGGATGGTGAGGTGGT
[0788] CAATCTCCCCGCTACCATGATCCGCTGTGCGAATGGCAAGGCGGTCTTTACCTGGAACATCACCTCCCTCCCGATTG
[0789] AAGCCTCTGTCGTCCGGTTCGTGTTCGGTCGCGCCGATGCCTGGCTGCAGTGGAATGATTACGAGCATGATCGGCCG
[0790] TTGCGAAGCCTGTGGAGCCTGATCCTCAGCATCAAGGCGCTGTTCCGCAAGAAGGGTCGGATGATGATCCATAGTCG
[0791] CCCGCAAAATAAACCCATTGCACTGCCTGTTGAGCGCAGGGAGCCAACAAGCAGTCAGGGTGGTCAGAAACAGGAAG
[0792] GAAAGATCAGTCGTGCGGCCTCGTGATATGAAAATGGTGTCCCTGATCGCGCTGCTGGTCTTTGCAACGGGAGCGCA
[0793] GGCTGCGCCGGTTGCATCCAAAGCGCCAGCCCCGCAGCCTGCGGGCGATAACCTGCCGCCCCTGCCCGCCGCGGCAC
[0794] CGGCCGCCGCGGCAGCCCCGGCCGGGCAGCAGCCTGCTGGCGCCGCCAGTGCGGCACCTGCCGTCGATCCGGCCGCT
[0795] GCCAGCGCCGCCGATGCCATGGTGGACAATGCGGAGAATGCGACCGGCGTCGGTTCGGATGTGGCGACCGTGCATAC
[0796] CTATTCCCTGCGCGAACTTGGCGCGGAGAACGCGCTGACCATGCGTGGCGCGGCCCCCCTGCAGGGGCTGCAGTTCG
[0797] GTATTCCGGGCGACCAGCTCGTCACCTCGGCGCGGCTTGTCGTGTCGGGTGCGATGTCACCCAATCTCCAGCCCGAT
[0798] AACAGCGCGGTCACGATTACGCTGAACGAGCAGTATATCGGCACGCTCCGGCCTGACCCGTCACATCCGGCCTTTGG
[0799] TCCGCTTTCCTTTGACATCAACCCCATCTTCTTTGTCAGCGGCAACCGGCTGAACTTCAATTTCTCGGCAGGGTCGA
[0800] AAGGATGCACCGACCCGAGCAACGGATTGCAGTGGGCCAGCGTGTCCGAGCATTCGGAACTGCAGATCACCACCATA
[0801] CCGCTTCCTCCCCGTCGTCAGCTGTCGCGGCTGCCGCAGCCGTTCTTTGACAAGAACGTAAGGCAGAAGACGGTCAT
[0802] TCCGTTCGTCCTTGCACAGACATTTGATGCTGAAGTGCTCAAGGCTTCCGGCATCCTGGCGTCCTGGTTCGGCCAGC
[0803] AGACCGATTTCCGCGGCGTGAACTTCCCCGTATTTTCCACCATTCCGCAGACAGGCAATGCCGTTGTGGTGGGTGTT
[0804] GCCGATGAACTGCCTTCCGCGCTGGGGCGTCCGGCCATCAGCGGGCCGACCCTGATGGAAGTGGCCAACCCGTCCGA
[0805] TCCCAATGGCACGATCCTGCTGGTAACGGGCCGGGACCGCGATGAAGTCATTACCGCAAGCAAGGGCATAGGCTTCA
[0806] GCTCCAGCACGCTGCCGGTTGCCGCGCGCATGGATGTGGCGCCGATTGACGTGGCCCCCCGCGCCCCCAACGACGCG
[0807] CCGTCCTTCATCCCGACCAGCCGGCCTGTCCGGCTGGGTGAACTGGTGCCGGTCAGTGCCCTGCAGGGCGAAGGCTA
[0808] TACCCCCGGCGTGCTTTCCGTGGCGTTCCGCACGGCGCCTGACCTGTATACCTGGCGCGACCGGCCGTACAAGCTGA
[0809] ACGTGCGCTTCCGGGCGCCCGACGGGCCGATCGTGGACCTGGCGCGTTCGCATCTGGACGTTGGTATCAACAATACC
[0810] TACCTGCAGTCCTATTCCCTGCATGAAAAGGACAGTGTGGTCGACCAGCTGGTCCAGCGTTTTGGCGGCCGGGGCCA
[0811] GACCAGTGGCGTGCAGCAGCATACGCTGACCATTCCGCCGTGGATGGTGTTCGGTCAGGATCAGCTGCAGTTCTATT
[0812] TTGATGCGGCCCCCCTGACCCAGCCCGGCTGCCGTCCCGGCCCCAGCCTGATCCACATGTCGGTTGATCCGGATTCC
[0813] ACGATCGACCTGTCCAACGCCTATCACATCACGCGCATGCCCAATCTGGCCTACATGGCCAGCGCGGGGTATCCGTT
[0814] CACCACCTATGCCGACCTGTCGCACTCGGCCGTGGTGCTGCCGGACCATCCCAATGGTACGGTTGTCAGCGCCTATC
[0815] TTGACCTGATGGGCTTCATGGGGGCGACGACGTGGTATCCCGTCTCGGGTCTGGACATCGTTTCCGCGGATCATGTG
[0816] AATGATGTGGCGGACCGGAACCTGATCGTCCTGTCCACGCTGGCCAATAGCGGGGAGGTTTCCTCCCTGCTGTCGAA
[0817] CTCGTCGTACCAGATTGCCGACGGGCGCCTGCACATGGGGATGCGCTCCACCCTGAGTGGGGTGTGGAACATCTTCC
[0818] AGGACCCGATGGCCGCCATCAACAATACCCATCCGACCGAGGTCGAGACGACCCTGAGCGGTGGCGTGGGCGCGATG
[0819] GTGGAAGCGGAATCCCCGCTGGCATCCGGACGCACGGTTCTTGCCCTGCTCTCGGCTGACGGGCAGGGGCTGGACAA
[0820] TCTGGTCCAGATCCTCGGGCAGCGTAAGAACCAGGCCAAGATTCAGGGCGACCTGGTGCTTGCCCATGGGGATGACC
[0821] TGACATCGTACCGCAGTTCGCCCCTTTATACCGTTGGCACGCTGCCGATGTGGCTCATGCCGGACTGGTATATGCAT
[0822] AACCATCCCGTTCGCGTGATCGTGGTGGGGCTGTTCGGATGCCTGCTGGTTGTGGCCGTGCTGGTTCGTGCCCTGTT
[0823] GCGGCATGCACTGTTCCGCCGGCGGCAGCTGCAGGAAGAAAGGCAGAAATCGTGAGCATGAACAGACGCTACGTCTT
[0824] TTCCCTTTCTGCCGGCCTGCTTGCCAGCAGTTGCATGACCGTGCTGGTGGCGGTGCCACTGGCGCGCGCGCAGCAGG
[0825] CCTCCACGGCCATGACCGGTACCCAGGCTTCGGGCGGGTCGGCGGCGCCACGGCAGATCCTGCTGCAGCAGGCCCGG TTCTGGCTTCAGCAGCAGCAGTATGACAATGCCCGTCAGGCCCTGCAGAATGCCCAGCGCGTGGCGCCGGATGCGCC
[0826] GGATGTCCTGGAGGTACAGGGCGAATACCAGACGGCGATCGGCAACCGGGAAGCGGCAGCCGATACGCTGCGCCACC
[0827] TCCAGCAGGTTGCGCCCGGCAGTACGGCCGCCAACAGCCTGAGTGACCTGTTGCACGAGCGTTCCATCTCGACATCC
[0828] GACCTGTCGCAGGTGCGTTCCCTTGCCGCATCCGGGCATAACGCGCAGGCGGTGCAGGGGTACCAGAAGCTGTTCAA
[0829] TGGCGGTAAGCCGCCGCATTCGCTTGCGGTGGAATATTACCAGACCATGGCAGGCGTTCCGGCCGAATGGGATCAGG
[0830] CCCGGGCCGGGCTTGCCGGTATCGTGGCATCCAATCCACAGGATTATCATGCCCAGCTCGCATTTGCGCAGGCGCTG
[0831] ACCTATAATACGGCGACCCGTATGGAAGGTCTGGCGCGGCTCAAGGACCTGCAGGGTTTCCGCAGCCAGGCTCCGGT
[0832] CGAGGCTGCGGCCGCCAGCCAGTCCTACCGGCAGACGCTGAGCTGGCTGCCGGTAACGCCCACCACGCAGCCGCTCA
[0833] TGCAGCAGTGGCTGGATAGCCATCCCAATGATACCGAACTGCGTGAGCATATGGTCCACCCGCCCGGCGGCCCGCCG
[0834] GACAAGGCGGGTCTTGCGCGTCAGGCGGGTTATCAGCAGCTGAATGCCGGCCGTATTGCCGCAGCCGAGCAGTCCTT
[0835] CCAGTCCGCGTTACAGATCAATTCCCATGATGCCGATTCACTTGGCGGCATGGGACTGGTCAGCATGCGGCAGGGTG
[0836] ACGCAGCCGAAGCCCGCCGCTATTTCCAGGAAGCGATGGCGGCCGATCCCAAGACGGCGGATCGCTGGCGCCCGGCC
[0837] CTGGCCGGCATGGAAATCAGCGGTGACTATGCCGCGGTCCGCCAGCTTATTGCCGCCCACCAGTATGATGCGGCCAA
[0838] GCAGCGCCTGTCCGCGCTGGCACGCCAGTCCGGCCAGTTTACCGGCGCCACGCTCATGCTGGCCGACCTGCAGCGCA
[0839] CGACCGGCCAGATGGGTGCGGCGGAGCAGGAATACCAGTCCGTTCTGGCACGCGACCCGAACAGCCAGCTTGCCCTG
[0840] ATGGGACTGGCGCGGGTGGAGATGGCGCAGGGCAAGACGGCGGAAGCCCGCCAGCTGCTGTCGCGTGTCGGATCGCA
[0841] GTATGCGACCCAGGTCGGGGAAATCGAGGTGACGGGCCTTATGGCCGCCGCCTCGCAGACATCGGATTCCGCGCGCA
[0842] AGGTCTCGATCCTGCGCGAAGCCATGGCCCAGGCACCGCGTGACCCATGGGTGCGGATCAATCTGGCCAATGCCCTG
[0843] CAGCAGCAGGGGGACATGGCGGAAGCCAATCGGGTCATGCAGCCCATCCTGTCCAATCCCGTGACGGCGCAGGACCG
[0844] GCAGGCCGGTATCCTGTTTACCTATGGCAGTGGCAATGATGCGATGACACGCCGCCTGCTGGCTGGCCTGTCGCCCG
[0845] AGGACTATTCCCCCGCCATCCATGCCATTGCGACGGAAATGGAGATCAAGCAGGATCTGGCCAGCCGCCTGTCCATG
[0846] GTGGCGAACCCGGTTCCGCTGATCCGTGAAGCCCTTTCGCCGCCCGACCCGACGGGCGCGCGTGGCGTGGCCGTGGC
[0847] TGATCTGTTCCGTCAGCGTGGCGACATGATTCATGCCCGCATGGCCCTGCGCATTGCCTCGACCCGCACGCTCGATC
[0848] TTTCGGCGGACCAGCGTCTGGCCTACGCCACCGAATACATGAAGATCAGCAACCCGGTTGCGGCCGCCCGCCTGCTG
[0849] GCCCCGCTGGGTGACGGCAGTGGCACGGGGGCGGGCAATGCCCTGCTTCCCGAGCAGGTACAGACGCTGCAGCAGCT
[0850] GCGCATGGGGATTGCCGTGGCCCAGTCCGACCTGCTGAACCAGCGCGGCGATCAGGCGCAGGCATACGATCACCTTG
[0851] CTCCGGCCCTGCAGGCCGATCCGGAAGCGACATCGCCCAAACTGGCGCTGGCGCGGCTTTACAATGGTCAGGGCAAG
[0852] TCCGGCAAGGCGCTGGAAATCGATCTGGCCGTGCTGCGGCACAACCCGCAGGATCTGGATGCGCGCCAGGCAGCGGT
[0853] GCAGGCTGCCGTCAATAGCGGCCGCAAGAGCCTGGCCACCCGCCTTGCCATGGATGGTGTGCAGGAAAGCCCGATGG
[0854] ATGCGCGTGCCTGGCTGGCCATGGCCGTGGCCGATCAGGCCGATGGCCATGGCCACCGGACCATCAGTGACCTGCGC
[0855] CGCGCCTATGACCTGCGTCTGCAGCAGGTGGAAGGCACGCGGGCGGTGGCAAGCGGGACGGGTGAGCAGGAATCGCT
[0856] TGAACCCCCGTCCAGCAACCCGTTTCGCCACCATGGCTATGGACGCCAGACGGAACTGGGCGCACCGGTTACGGGTG
[0857] GCTCCTACAGCATGGAGGCAACGTCTCCCGAAGCATCGGACCAGATGCTGTCCTCCATCGCCGGGCAGATCACCACG
[0858] CTGCGGGAAAACCTGGCCCCCTCCATCGATGGCGGTCTGGGGTTCCGGTCGCGTTCGGGTGAGCACGGCATGGGCCG
[0859] CCTGACCGAAGCGAACATTCCCATCGTGGGGCGCCTGCCGCTGCAGGCGGGTGAGTCCAGCCTGACCTTCTCGATCA
[0860] CGCCAACCATGATCTGGTCGGGACAGCTCAATACCGGTTCGGTCTATGATGTGCCGCGCTTTGGCACCGACATGGCA
[0861] ACACAGGCGTATAACCAGTACGTCAGTTACATAAGCCAGAACAATTCCAGCAGCACCCTGCATAGCGAACTTGTCAA
[0862] GGGTGGCGAGGCCGAGGCCGGTTTTGCGCCAGACGTGCAGTTCGGCAACAGCTGGGTGCGGGCGGACCTGGGGGCAT
[0863] CGCCCATCGGCTTCCCCATCACCAACGTACTGGGCGGTGTGGAATTCTCGCCGCGTGTCGGACCGGTTACCTTCCGC
[0864] GTCAGCGCGGAACGCCGCTCCATCACCAACAGCGTGCTGTCCTATGGTGGCATGCGCGACCCCAACTACAACACGAC
[0865] ACTGGGCCGCTATGCCCGCCAGCTTTATGGCAAGGAGCTGAGTTCCCAGTGGAGTGAGGAATGGGGCGGGGTCGTGA
[0866] CCAACCACTTCCATGGTCAGGTTGAGGCAACGCTGGGCAACACCATCGTATATGGTGGCGGTGGCTATGCCATCCAG ACCGGCAAGCATGTGCAGCGCAATGACGAGCGCGAGGCGGGCATCGGTGTCAACACGCTGGTCTGGCACAATGCCAA
[0867] CATGCTGGTCCGCATCGGTGTCAGCCTGACCTATTTCGGCTATGCCAACAACCAGGACTTCTATACCTACGGGCAGG
[0868] GTGGCTACTTCTCGCCGCAATCCTATTACGCGGCGACCGTACCCATCCGGTATGCGGGGCAGCACAAGCGGCTGGAC
[0869] TGGGACGTGACGGGCAGCGTTGGCTACCAGGTGTTCCATGAACACTCGTCCCCATTCTTCCCGACGTCTTCCCTGCT
[0870] GCAGTCTGGCGCGCAGTACATTGCTGACTCGTATGTGCAGAACGCAACCAGTTCCGACTATCTCTCACAGGAGACGG
[0871] TCAACAGCGCCTATTATCCCGGAGATAGTATTGCTAGTCTTACGGGTGGCTTCAATGCTAGGGTAGGGTATCGATTT
[0872] ACACACAATCTTCGTCTTGATCTGTCGGGGCGCTGGCAGAAGGCCGGTAACTGGACTGAAAGCGGCGCCATGATTTC
[0873] CGCACACTATCTTATTATGGACCAGTAATGACAACTTTCAACGCAAAACCGGACTTTTCCCTGTTCCTGCAGGCCCT
[0874] CTCCTGGGAGATTGATGATCAGGCCGGGATCGAGGTGAGGAATGACCTGTTGCGCGAGGTCGGTCACGGCATGGCCG
[0875] GTCGGCTGCAGCCTCCGCTGTGCAACACCATTCATCAGCTGCAGATCGAGCTGAACTCGCTGCTGGCCATGATCAAC
[0876] TGGGGCTATGTGCAGCTTGAACTGCTGCCCGAGGACCATGCCATGCGCATCGTCCATGAGGACCTGCCCCAGGTGGG
[0877] CAGCGCGGGCGAGCCGGCCGGCACATGGCTGGCCCCCGTGCTCGAAGGGCTGTATGGCCGCTGGATCACGTCGCAGC
[0878] CGGGTGCCTTTGGCGATTATGTCGTCACCCGCGATGTGGATGCGGAGGATCTCAACTCCGTTCCCAGCCAGACGATC
[0879] ATCCTGTACATGCGCACCCGCAGCAGCAGCAACTGAAGAAGGAGATATACATATGAGTAAAGGAGAAGAACTTTTCA
[0880] CTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTCTCTGTCAGTGGAGAGGGTGAA
[0881] GGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTACCTGTTCCATGGCCAACACT
[0882] TGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGA
[0883] GTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAATCACGTGCTGAA
[0884] GTCAAGTTTGAAGGTGATACCCTCGTTAATAGAATTGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCT
[0885] TGGACACAAAATGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAG
[0886] TTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATT
[0887] GGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAA
[0888] GAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAAA
[0889] AGGAGGAACAAGCCGCATGAAACCATCCCGCAAGTCATTCCTGCTTTCCGCCGTGGCGTGGGGGCTGGTGGCCGCGC
[0890] TGCCCGCCCATGCCCGCCACGCGGCCACGGCTGGTGACCCGGCCGATGACCAGGCGCGGCAGGTGCTCGCGCATATG
[0891] AGCCTTCAGGACAAGATGGCCCTTCTGTTCAGTGTGGACGGGGGCGGCTTCAATGGCAGTGTCGCACCTCCGGGGGG
[0892] CTTGGGTTCGGCGGCGTATCTGCGTGCCCCGGCGGGTTCGGGCCTGCCGGACCTGCAGATATCGGATGCGGGGCTTG
[0893] GCGTGCGCAACCCCGCGCATATCCGGCCCAATGGTGCGGCGGTTTCCCTGCCATCGGGTCTGGCCACGGCCAGCACA
[0894] TGGGATGTGGACATGGCCCGGCAGGCAGGTGAAATGATCGGGCGCGAGGCCTGGCTGAGCGGGTTCAACATCCTGCT
[0895] GGGCGGTGGTGCCGACCTGACGCGCGACCCGCGTGGCGGCCGCAATTTTGAATATGCGGGGGAAGACCCGCTCCAGA
[0896] CCGGGCGGATGGTGGGCAGCACCATTGCCGGCATCCAGTCGCAGCATGTGATTTCCACGCTCAAGCATTACGCGATG
[0897] AACGACCTTGAGACATCGCGCATGACCATGAGTGCCGATATCGACCCCGTAGCCATGCGTGAGAGCGACCTGCTGGG
[0898] TTTCGAGATTGCGATTGAAACCGGGCATCCCGGTTCCGTCATGTGTTCGTACAACCGGGTGAATGACCTGTATGCGT
[0899] GTGAAAACCCGTACCTGCTGAACACGACGCTGAAGCAGGACTGGCATTACCCCGGCTTTGTCATGTCCGACTGGGGC
[0900] GCCACGCATTCCTCCGCCCGTGCGGCGCTGGCGGGACTGGATCAGGAATCGGCTGGTGACCATGCCGATGCGCGCCC
[0901] CTATTTCACCGCTCTGTTGGCGGCGGATGTAAAGGCGGGGCGTGTGCCCGTCGCCCGTATTGACGACATGGCGCAGC
[0902] GCATTGTCCGCTCCCTGTTCGCGGCGGGGCTGGTGGCCCATCCGCCGCAGCGCGGGCCGCTGGATGTGGTGACCGAC
[0903] ACCCTTGTGGCCCAGCGTGATGAGGAAGAAGGCGCGGTTCTGCTGCGCAACGAAGGGGGTATCCTGCCGCTTTCCCC
[0904] CACCGCGCGCATCGCGGTCATTGGCGGGCATGCCGATGCGGGCGTGATCTCGGGCGGGGGGTCCAGCCAGGTCGATC
[0905] CCATCGGGGGTGAGGCGGTCAAGGGACCGGGCAAGAAGGAATGGCCGGGTGATCCGGTCTATTTCCCGTCATCCCCG
[0906] CTCAAGGCCATGCGGGCCGAGGCCCCCAACGCGCACATCACCTATGAATCCGGCACCAATATCGCCGCCGCCGTGCG
[0907] CGCCGCGCGGGCGGCCGATGTGGCGGTCGTGTATGCAACGCAGTTCACCTTCGAGGGGATGGACGCGCCCAGCATGC ACCTTGATGCCAATGCCGACGCGCTGATCACAGCCGTGGCCGCGGCCAACCCGCGTACCGTGGTGGTGATGGAAACC
[0908] GGCGACCCGGTGCTCATGCCATGGAACAGCAGCGTTGCGGGCGTGCTGGAGGCATGGTTCCCCGGTTCCGGCGGTGG
[0909] GCCGGCCATTGCACGCCTGCTGTTTGGCAAGGTTGCGCCCTCGGGCCACCTGACCATGACCTTCCCGCAGGCGGAAA
[0910] GCCAGCTGGCCCATCCCGATATTGCCGGTGTGACGGCGGACAACGTGTTCGAGATGCAGTTCAAGACCGATCAGGAA
[0911] CTGGTCTATGACGAAGGCAGCGACGTGGGCTACCGCTGGTTTGACCGCAACCATCTCAAGCCGCTCTATCCCTTCGG
[0912] TTACGGTCTGACCTACACCACGTTCAGCACCGATGGCCTGGCGGTGCACAGGCATCATGATGCGGTGACGGTCACCT
[0913] TTACCGTACATAATACCGGCAACCGCCCCGGTGTGGATGTGCCGCAGGTCTATGTGGGCCTGCCCGATGGCGGGGCA
[0914] CGCAGGCTGGCGGGCTGGCAGCGGGTCAGTCTGGCACCGGGTGAAAGCCGTGCGGTGACGGTACAGCTTGATCCGCG
[0915] CCTGCTGGCGCATTTTGACGGGAAGAAGGACCGCTGGAGCATTCCTTCGGGCACATTCCGGCTGTGGCTTGGCACGT
[0916] CCGCCACGGATGACAGCCAGCAGGCAAGCCTGCACCTGTCCGGTCGCACCTTCGCGCCCTGATGCCTGGCGGCAGTA
[0917] GCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCC CAT GCGAGAGTAGGGAACT GCCAGGCAT CAAATAAAACGAAAGGCT CAGT CGAAAGACT GGGCCTT
[0918] SEQ ID NO: 19: acggagcagggttcgtgggcggcggccaatggtaagaatgagctgcgcacagatggcgtgcgttcgccggatgtgta cacctataagctgctggacgcagacactgttcactatgtgagtgtggcatcggaccccaccagcgattgccaggacg actaccagttcaccgagcgccgtgtccgctgacaaggcaggtttgcttcaaaaccgggcactcgggtgcccggccgt cacaagtttcaactcccttgcgcgcacgtgcccgcacctttctcgtagtccaatacctgtttttgccgggcgtgagc atcagcagcaaaagcctacagcctgactgcgatcaatttggtctagttaatggggcgtatcttccaggctcagcagg tttagcgctctggaggtgtctgccctgtgtcattcggcgtgggttttgcttcgtcgtcttggctgcctgcgcagcga tatacgggccgtggctttgcgggcggttgcggatcgaccacatatacctgccgttcactattatttagtgaaatgag atattatgatattttctgaattgtgattaaaaaggcaactttatgcccatgcaacagaaactataaaaaatacagag aatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaaca aaagaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttg ttactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttggcgtcaccccttacatatttta ggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagta cataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcac tgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaagccatataaggaaacatacggcatttcc catattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagttcctgagttcgattc gtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaaacgctgacggca ctgtcgcaaactatcacggctaccacatcgtctttgcattagccggagatcctaaaaatgcggatgacacatcgatt tacatgttctatcaaaaagtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcga caaattcgatgcaaatgattctatcctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacg gaaaaatccgtttattctacactgatttctccggtaaacattacggcaaacaaacactgacaactgcacaagttaac gtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaac gtatcaaaatgtacagcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcact acgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaactgaagatggctaccaaggcgaagaa tctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcga taaaaaacgcacggctgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaag tgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgcgcgaacgtctttaaaatgaacggcaaa tggtatctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaacgatatttacatgcttgg ttatgtttctaattctttaactggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatc ctaacgatgtaacctttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctat atgacaaacagaggattctacgcagacaaacaatcaacgtttgcgcctagcttcctgctgaacatcaaaggcaagaa aacatctgttgtcaaagacagcatccttgaacaaggacaattaacagttaacaaataacgcatcctcacgataatat ccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttctgttatccgaa atccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgcacaaagcatcttctgttg agttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtttgtgccaataccagtagcatga acaataaaactgtctgcttacataaacagtaatacaaggggtgttctatttgacggctagctcagtcctaggtacag tgctagcgtacaaggggtgctgtatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggat gctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaa gcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagac taaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactc accactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgc gctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtc tcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcct gttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctc acttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgat accaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatat ggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaacgcatcctcacgat aatatccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttctgttat ccgaaatccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgcacaaagcatcttc tgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtttgtgccaataccagtag gtgagtcgagcagatgacatttcaaaactattcaacaagctgggtgccaacccgagtggctaccgcgagatcgactt cgtccacgagttcatcgaggacgatgtagaggtcctggaaaccccggcggtcgttcgagccctgcctgtgattgaag cgccgtcagcgcctttgctgcgtctgttggaagagctgagccaaggcgaagccgaccacctgcagccgcccgaagtg gtggaagggcgggacggtgaggtgtactcggagcattccagccccaacgtcgtggtggttgtctcggtaaaaggcgg cgttggccgcagcaccctgactgccgcgattgccagtggtttgcagcgtcaggggcgcccggcactggccctggacc tggacccgcaaaacgccctgcgccaccacttgtgcctcggtctcgacatgcccggcgtgggcgcgaccagcttgctc aatgaaagctgggaagcgctgcccgagcgcggttttgc
[0919] SEQ ID NO: 20: acccaagcttttctcacactcgccccttttttcgaccagcaagggtaggattcttctcttactgccgaagggtctaa ctcggcaatcttgtccaaactaaaggaagccccatatgaaacggactctctccctgtccctcgtcctcctcaccgcc gctctcggcgcgtgctccacccatcagtcggccaacgaccccgcgctggttggcacttggaaaggcttgcgcaccga gaccggtaaatgccagttcctgtcgtggaccaataccctcaagcctgacggtcgtttcgttattaccttctaccgcg atgcgcagcagacgcaggtgatccagacggagcagggttcgtgggcggcggccaatggtaagaatgagctgcgcaca gatggcgtgcgttcgccggatgtgtacacctataagctgctggacgcagacactgttcactatgtgagtgtggcatc ggaccccaccagcgattgccaggacgactaccagttcaccgagcgccgtgtccgctgacaaggcaggtttgcttcaa aaccgggcactcgggtgcccggccgtcacaagtttcaactcccttgcgcgcacgtgcccgcacctttctcgtagtcc aatacctgtttttgccgggcgtgagcatcagcagcaaaagcctacagcctgactgcgatcaatttggtctagttaat ggggcgtatcttccaggctcagcaggtttagcgctctggaggtgtctgccctgtgtcattcggcgtgggttttgctt cgtcgtcttggctgcctgcgcagcgatatacgggccgtggctttgcgggcggttgcggatcgacCACGGCGGCCCGT CGAAGGATTTGTCGAGCAACTGATTCTAGCAGGTCGATTACCGATCAATTGGCAGTCGGCTGGCCCACCACGCTCGG
[0920] TGCAGGTCAAAAAACGAGACACCACCCTCACTCAAACAAGAGTTTGACTTCGGTATTCGACTAGTGGCCATCAAACC
[0921] GTTAGGATTCGGCTGCCCGCCTGAACAATAATCCGGCGGGCCGGAAGTGGTAAGACGTTTTGTAGCCTAACGAGACT
[0922] ATCGAACAAACCACTCCTGACCTTGACGCCCCGGCCCTAAAGACTAAGGTCTAAAGGCTGAAACAATGATGAAATGT
[0923] TTTATTGCATGTCGCCGTAAGAGCGACCTTCAGAGCATCATCCAACGAGGAGAACAAGAAgtgagtcgagcagatga catttcaaaactattcaacaagctgggtgccaacccgagtggctaccgcgagatcgacttcgtccacgagttcatcg aggacgatgtagaggtcctggaaaccccggcggtcgttcgagccctgcctgtgattgaagcgccgtcagcgcctttg ctgcgtctgttggaagagctgagccaaggcgaagccgaccacctgcagccgcccgaagtggtggaagggcgggacgg tgaggtgtactcggagcattccagccccaacgtcgtggtggttgtctcggtaaaaggcggcgttggccgcagcaccc tgactgccgcgattgccagtggtttgcagcgtcaggggcgcccggcactggccctggacctggacccgcaaaacgcc ctgcgccaccacttgtgcctcggtctcgacatgcccggcgtgggcgcgaccagcttgctcaatgaaagctgggaagc gctgcccgagcgcggttttgccgggtgccgcctggtggcattcggtgctaccgaccacgagcagcaacagagcctga atcgctggctgggccaggatgacgaatggctgagcaaacgcttggccggcctcaaattgaacggccaggacaccgtg atcatcgacgtcccggccggcaataccgtgtacttcagccaagccatgtcggtcgccgacgcagtgctggtagtggt gcagccggacgtggcgtccttcagcacgctcgatcagatggacagcgtgctcaagccctctctcaatcgcaaaaaaa cgccacgacgcttctatgtgatcaaccaactggacggtgcccaccgcttcagcctggacatggccgaggtgttcaag acccgcctgggtgctgccctgttggggacggtccaccgcgaccccgcgttcagcgaagcccaggcctacgggcgtga tccccttgaccccaccgtcaacagtatcggcagccaggacatccatgccctgtgccgcgcattgctcgaacgaatcg actcggacctcccatga
[0924] SEQ ID NOs: 21 to 53 are shown in Table 1.
[0925] SEQ ID NO: 54: acggagcagggttcgtgggcggcggccaatggtaagaatgagctgcgcacagatggcgtgcgttcgccgg atgtgtacacctataagctgctggacgcagacactgttcactatgtgagtgtggcatcggaccccaccag cgattgccaggacgactaccagttcaccgagcgccgtgtccgctgacaaggcaggtttgcttcaaaaccg ggcactcgggtgcccggccgtcacaagtttcaactcccttgcgcgcacgtgcccgcacctttctcgtagt ccaatacctgtttttgccgggcgtgagcatcagcagcaaaagcctacagcctgactgcgatcaatttggt ctagttaatggggcgtatcttccaggctcagcaggtttagcgctctggaggtgtctgccctgtgtcattc ggcgtgggttttgcttcgtcgtcttggctgcctgcgcagcgatatacgggccgtggctttgcgggcggtt gcggatcgaccacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaat tgtgattaaaaaggcaactttatgcccatgcaacagaaactataaaaaatacagagaatgaaaagaaaca gatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaagagg aaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttg ttactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttggcgtcaccccttaca tattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcaga ccgctaacacagtacataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacag tattaacctttactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaa gccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacagcaa aaaaatgaaaaatatcaagttcctgagttcgattcgtccacaattaaaaatatctcttctgcaaaaggcc tggacgtttgggacagctggccattacaaaacgctgacggcactgtcgcaaactatcacggctaccacat cgtctttgcattagccggagatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaaagtc ggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgatgcaa atgattctatcctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacggaaaaat ccgtttattctacactgatttctccggtaaacattacggcaaacaaacactgacaactgcacaagttaac gtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacg gaaaaacgtatcaaaatgtacagcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgct gagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaactgaa gat
[0926] SEQ ID NO: 55: ggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaag aaagtcaaaaacttctgcaaagcgataaaaaacgcacggctgagttagcaaacggcgctctcggtatgat t gage taaacgatgattacacactgaaaaaagt gat gaaaccgct gat tgcatctaacacagtaacagat gaaattgaacgcgcgaacgtctttaaaatgaacggcaaatggtatctgttcactgactcccgcggatcaa aaatgacgattgacggcattacgtctaacgatatttacatgcttggttatgtttctaattctttaactgg cccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaaccttt acttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctatatgacaaaca gaggattctacgcagacaaacaatcaacgtttgcgcctagcttcctgctgaacatcaaaggcaagaaaac atctgttgtcaaagacagcatccttgaacaaggacaattaacagttaacaaataacgcatcctcacgata atatccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttc tgttatccgaaatccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgc acaaagcatcttctgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcag gtttgtgccaataccagtagcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgtt ctatttgacggctagctcagtcctaggtacagtgctagcgtacaaggggtgctgtatgagccatattcaa cgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcg ataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttct gaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaa tttatgcctcttccgaccatcaagcattt tat ccgt act cctgatgat goat ggttactcaccactgcga tccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgct ggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtattt cgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgta atggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgt cactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgtt ggacgagtcggaatcgcagaccgataccaggatcttgccatcc SEQ ID NO: 56: tatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataa tcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaacgcatcctcacgataata tccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttctgt tatccgaaatccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgcaca aagcatcttctgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtt tgtgccaataccagtaggtgagtcgagcagatgacatttcaaaactattcaacaagctgggtgccaaccc gagtggctaccgcgagatcgacttcgtccacgagttcatcgaggacgatgtagaggtcctggaaaccccg gcggtcgttcgagccctgcctgtgattgaagcgccgtcagcgcctttgctgcgtctgttggaagagctga gccaaggcgaagccgaccacctgcagccgcccgaagtggtggaagggcgggacggtgaggtgtactcgga gcattccagccccaacgtcgtggtggttgtctcggtaaaaggcggcgttggccgcagcaccctgactgcc gcgattgccagtggtttgcagcgtcaggggcgcccggcactggccctggacctggacccgcaaaacgccc tgcgccaccacttgtgcctcggtctcgacatgcccggcgtgggcgcgaccagcttgctcaatgaaagctg ggaagcgctgcccgagcgcggttttgc
[0927] SEQ ID NO: 57:
[0928] CGGCGGCCAATGGTAAGAAT
[0929] SEQ ID NO: 58:
[0930] TTGGCGGGTGTCGGGGCTGGCTTAAGCAAAACCGCGCTCGGGC
[0931] References
[0932] A number of publications are cited above in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Full citations for these references are provided below. The entirety of each of these references is incorporated herein.
[0933] Bae, S. O. et al. (2004) ‘Features of bacterial cellulose synthesis in a mutant generated by disruption of the diguanylate cyclase 1 gene of Acetobacter xylinum BPR 200T, Applied Microbiology and Biotechnology, 65(3), pp. 315-322. doi: 10.1007 / s00253-004-1593-7.
[0934] BAILEY, M. J. et al. (1995) ‘Site directed chromosomal marking of a fluorescent pseudomonad isolated from the phytosphere of sugar beet; stability and potential for marker gene transfer.’, Molecular Ecology, 4(6), pp. 755-764. doi: 10.1111 / j.1365-294X.1995.tb00276.x.
[0935] Bashan, Y., et al. (2002) ‘Alginate microbeads as inoculant carriers for plant growth-promoting bacteria’. Biol Fertil Soils, 35, 359-368.
[0936] Baynham, P. J. et al. (2006) ‘The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili’, Journal of Bacteriology, 188(1), pp. 132-140. doi: 10.1128 / JB.188.1.132-140.2006.
[0937] Brautaset, T. et al. (1994) ‘Nucleotide sequence and expression analysis of the Acetobacter xylinum phosphoglucomutase gene’, Microbiology, 140(5), pp. 1183-1188. doi: 10.1099 / 13500872-140-5-1183.
[0938] Buldum, G. et al. (2018). ‘Recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli’. Bioprocess Biosyst Eng; 41(2): 265-279. doi: 0.1007 / s00449-017- 1864-1.
[0939] Florea, M. et al. (2016). ‘Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose producing strain’. PNAS; 113(24): E3431-40.
[0940] Jang, W. D. et al. (2019) ‘Genomic and metabolic analysis of Komagataeibacter xylinus DSM 2325 producing bacterial cellulose nanofiber ’, Biotechnology and Bioengineering, (July), pp. 1- 10. doi: 10.1002 / bit.27150. Jozala, A. F., et al. (2014) ‘Bacterial cellulose production by Gluconacetobacter xylinus by employing alternative culture media’. Appl Microbiol Biotechnol; 99(3): 1181-90. Doi: 1007 / S00253-014-6232-3.
[0941] Kawano, S., et al. (2008). ‘Regulation of endoglucanase gene (cmcax) expression in Acetobacter xylinum’. J. Biosci. Bioeng. 106, 88-94. doi: 10.1263 / jbb.106.88
[0942] Klemm, D. et al. (2001) ‘Bacterial synthesized cellulose - artificial blood vessels for microsurgery’, Progress in Polymer Science, 26(9), pp. 1561-1603. doi: 10.1016 / S0079- 6700(01)00021-1.
[0943] Koo, H. M. et al. (2000) ‘Cloning, sequencing, and expression of UDP-glucose pyrophosphorylase gene from acetobacter xylinum BRC5’, Bioscience, Biotechnology and Biochemistry, 64(3), pp. 523-529. doi: 10.1271 / bbb.64.523.
[0944] Meyers A, Furtmann C, Gesing K, Tozakidis IEP, Jose J. 2019. Cell density-dependent autoinducible promoters for expression of recombinant proteins in Pseudomonas putida. Microb Biotechnol 12(5): 1003-1013
[0945] Rainey, P. B. and Bailey, M. J. (1996) ‘Physical and genetic map of the Pseudomonas fluorescens SBW25 chromosome’, Molecular Microbiology, 19(3), pp. 521-533. doi: 10.1046 / j.1365-2958.1996.391926.x.
[0946] Qi et al., 2022. Glucose addition promotes C fixation and bacteria diversity in C-poor soils, improves root morphology, and enhances key N metabolism in apple roots. PLoS One. 2022; 17(1): e0262691
[0947] Ryngajlto, M. et al. (2019) ‘Comparative genomics of the Komagataeibacter strains — Efficient bionanocellulose producers’, MicrobiologyOpen, 8(5), pp. 1-25. doi: 10.1002 / mbo3.731.
[0948] Sambrook, J., & R. (2001) ‘Molecular cloning: a laboratory manual’, Cold Spring Harbor Laboratory Press.
[0949] Standal, R., et al. (1994). ‘A new gene required for cellulose production and a gene encoding cellulolytic activity in Acetobacter xylinum are colocalized with the bcs operon’. J. Bacteriol. 176, 665-672. Tajima, K., et al. (2001). ‘Cloning and sequencing of the beta-glucosidase gene from Acetobacter xylinum ATCC 23769’. DNA Res. 8, 263-269. doi: 10.1093 / dnares / 8.6.263.
[0950] Vandamme, E.J., et al. (1998). ‘Improved production of bacterial cellulose and its application potential’. Polymer Degradation and Stability. 59 (1-3): 93-99. doi: 10.1016 / S0141- 3910(97)00185-7.
[0951] Walz, A. et al. (2002) ‘A gene encoding a protein modified by the phytohormone indoleacetic acid’, Proceedings of the National Academy of Sciences of the United States of America, 99(3), pp. 1718-1723. doi: 10.1073 / pnas.032450399.
[0952] Wong, H. C. et al. (1990) ‘Genetic organization of the cellulose synthase operon in Acetobacter xylinum’, Proceedings of the National Academy of Sciences of the United States of America, 87(20), pp. 8130-8134. doi: 10.1073 / pnas.87.20.8130.
[0953] For standard molecular biology techniques, see Sambrook, J., Russel, D.W. Molecular Cloning, A Laboratory Manual. 3 ed. 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press
[0954] Gawin A, et al., (2017). ‘The XylS / Pm regulator / promoter system and its use in fundamental studies of bacterial gene expression, recombinant protein production and metabolic engineering’ Microbial Biotechnology, 10(4), 702-718, doi:10.1111 / 1751-7915.12701.
[0955] Fernandez-Pinar R, et al. (2008). ‘A Two-Component Regulatory System Integrates Redox State and Population Density Sensing in Pseudomonas putida.’ Journal of Bacteriology , 109(23), https: / / doi.Org / 10.1128 / jb.00868-08.
[0956] Callaghan JD, et al. (2020). ‘Xylose-Inducible Promoter Tools for Pseudomonas Species and Their Use in Implicating a Role for the Type II Secretion System Protein XcpQ in the Inhibition of Corneal Epithelial Wound Closure’. Applied and Environmental Microbiology, 86:e00250-20, https: / / doi.Org / 10.1128 / AEM.00250-20
[0957] Jing X, et al., (2018). ‘Engineering Pseudomonas protegens Pf-5 to improve its antifungal activity and nitrogen fixation’. Microbial Biotechnology 13(1), 118-133, doi: 10.1111 / 1751- 7915.13335.
[0958] Yu G., et al. (2023) ‘Systematic identification of endogenous strong constitutive promoters from the diazotrophic rhizosphere bacterium Pseudomonas stutzeri DSM4166 to improve its nitrogenase activity’. Microbial Cell Factories 22(91). https: / / doi.org / 10.1186 / s12934-023-02085- 3.
[0959] Hoffmann J, Altenbuchner J. (2015). ‘Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440.’ PLoS One. 10(7) :e0133248. doi: 10.1371 / journal. pone.0133248.
[0960] Retallack DM, et al. (2006). ‘Identification of anthranilate and benzoate metabolic operons of Pseudomonas fluorescens and functional characterization of their promoter regions.’ Microbial Cell Factories, 5(1). doi: 10.1186 / 1475-2859-5-1. PMID: 16396686; PMCID: PMC1360089.
[0961] Numbered paragraphs:
[0962] 1. A method of increasing the sugar content in soil surrounding a plant root, the method comprising applying a composition comprising EPS expressing bacteria to the soil.
[0963] 2. A method of increasing the diversity of the microbiota of soil surrounding a plant root, the method comprising applying a composition comprising EPS expressing bacteria to the soil.
[0964] 3. The method according to paragraph 1 or paragraph 2, wherein the cellulose expressing bacteria is engineered to overexpress at least one protein involved in synthesis and / or secretion of the EPS.
[0965] 4. The method according to any one of paragraphs 1 to 3, wherein the EPS is cellulose.
[0966] 5. The method according to paragraph 4, wherein the cellulose expressing bacteria are modified to overexpress a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene.
[0967] 6. The method according to paragraph 5, wherein the cellulose expressing bacteria are further modified to overexpress a cmcAx gene and / or a bglAx gene.
[0968] 7. The method according to paragraph 5 or paragraph 6, wherein the cellulose expressing bacteria comprises a modified promoter that overexpresses the overexpressed genes, which are endogenous to the cellulose expressing bacteria.
[0969] 8. The method according to paragraph 5, wherein the modification comprises exogenous genes comprising a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene.
[0970] 9. The method according to paragraph 6, wherein the further modification comprises an exogenous cmcAx gene and / or an exogenous bglAx gene.
[0971] 10. The method according to paragraph 7 or paragraph 8, wherein the exogenous genes are heterologous.
[0972] 11. The method according to any one of paragraphs 4 to 10, wherein the genes are each isolated from K. xylinus. 12. The method according to any one of the preceding paragraphs, wherein the EPS expressing bacteria is a root-associated bacterium.
[0973] 13. The method according to any one of the preceding paragraphs, wherein the EPS expressing bacteria is a plant growth-promoting rhizobacterium.
[0974] 14. The method according to any one of the preceding paragraphs, wherein the EPS expressing bacteria is a Pseudomonas bacterium, optionally wherein the Pseudomonas bacterium is a Pseudomonas fluorescens.
[0975] 15. The method according to any one of the preceding paragraphs, wherein expression of the genes or proteins is regulated by a cell-density quorum sensing system.
[0976] 16. Use of genetically modified bacteria to increase sugar content in soil around plant roots, wherein the bacteria is genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0977] 17. Use of genetically modified bacteria to increase the diversity of the microbiota of soil surrounding a plant root, wherein the bacteria are genetically modified to overexpress at least one protein involved in synthesis and / or secretion of an EPS.
[0978] 18. The use according to paragraph 16 or paragraph 17, wherein the EPS is cellulose.
[0979] 19. The use according to paragraph 18, wherein the cellulose expressing bacteria are modified to overexpress a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene.
[0980] 20. The use according to paragraph 19, wherein the bacteria are further modified to overexpress a cmcAx gene and / or a bglAx gene.
[0981] 21. The use according to any one of paragraph 16 to 20, wherein the cellulose expressing bacteria comprise a modified promoter that overexpresses the overexpressed genes or proteins.
[0982] 22. A cellulose expressing bacterium comprising a modified promoter that overexpresses a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene, which are endogenous to the cellulose expressing bacterium. 23. The cellulose expressing bacterium according to paragraph 22, wherein the cellulose expressing bacterium is further modified to overexpress a cmcAx gene and / or a bglAx gene, which are endogenous to the cellulose expressing bacterium.
Claims
Claims1. A modified bacterium for producing cellulose, wherein bacterium is modified to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium.
2. The modified bacterium of claim 1 , wherein the bacterium is modified to overexpress at least one of wssB, wssC, wssD, and wssE.
3. The modified bacterium of claim 1 or claim 2, wherein the bacterium is modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
4. The modified bacterium of any one of claims 1 to 3, wherein bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
5. The modified bacterium of any one of claims 1 to 4, wherein the bacterium is Pseudomonas fluorescens, optionally Pseudomonas fluorescens SBW25.
6. The modified bacterium of any one of claims 1 to 5, wherein the bacterium comprises a modified promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose.
7. The modified bacterium of claim 6, wherein the bacterium is modified by the insertion of a promoter.
8. The modified bacterium of claim 7, wherein the promoter is an inducible or constitutive promoter, optionally a strong inducible promoter or strong constitutive promoter.
9. The modified bacterium of claim 7 or claim 8, wherein the promoter is from the same genus as the modified bacterium.
10. The modified bacterium of any one of claims 7 to 9, wherein the promoter is from the same species as the modified bacterium, optionally the same strain as the bacterium.
11. The modified bacterium of any one of claims 7 to 10, wherein the promoter replaces or disrupts the native promoter.
12. The modified bacterium of any one of claims 6 to 11, wherein the bacterium is modified with a sequence having at least 70% identity to the amino acid sequence of any one of SEQ ID NOs: 21-53.
13. The modified bacterium of claim 12, wherein the bacterium is modified with a sequence having at least 70% identity to SEQ ID NO: 50.
14. The modified bacterium of claim 13, wherein bacterium is modified with p12445 (SEQ ID NO: 50).
15. The modified bacterium of claim 6, wherein the modified promoter comprises a mutation in the sequence of the promoter.
16. A method of increasing production of cellulose in a bacterium compared to a reference bacterium, wherein the method comprises a step of modifying the bacterium to overexpress at least one gene involved in synthesis and / or secretion of cellulose, wherein the at least one gene is endogenous to the bacterium.
17. The method of claim 16, wherein the bacterium is modified to overexpress at least one of wssB, wssC, wssD, and wssE.
18. The method of claim 17, wherein the bacterium is modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
19. The method of claim 18, wherein bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
20. The method of any one of claims 17 to 19, wherein the bacterium is Pseudomonas fluorescens, optionally Pseudomonas fluorescens SBW25.
21. The method of any one of claims 16 to 20, wherein the bacterium comprises a modified promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose.
22. The method of claim 21 , wherein the bacterium is modified by the insertion of a promoter.
23. The method of claim 22, wherein the promoter is an inducible or constitutive promoter, optionally a strong inducible promoter or strong constitutive promoter.
24. The method of claim 22 or claim 23, wherein the promoter is from the same genus as the modified bacterium, optionally wherein the promoter is from the same species as the modified bacterium, further optionally the same strain as the modified bacterium.
25. The method of any one of claims 22 to 24, wherein the promoter replaces or disrupts the native promoter.
26. The method of any one of claims 21 to 25, wherein the bacterium is modified with a sequence having at least 70% identity to the amino acid sequence of any one of SEQ ID NOs: 21-53.
27. The method of claim 26, wherein the bacterium is modified with a sequence having at least 70% identity to SEQ ID NO: 50.
28. The method of claim 27, wherein bacterium is modified with p12445 (SEQ ID NO: 50).
29. The method of claim 21 , wherein the modified promoter comprises a mutation in the sequence of the promoter.
30. A method of increasing water-retention around plant roots comprising applying the modified bacterium of any one of claims 1 to 15 to soil surrounding a plant root.
31. A method of reducing water consumption in agriculture comprising applying the modified bacterium of any one of claims 1 to 15 to soil surrounding a plant root.
32. A method of capturing carbon comprising applying the modified bacterium of any one of claims 1 to 15 to soil surrounding a plant root, wherein carbon is converted to cellulose by the bacterium.
33. A method of increasing the sugar content in soil surrounding a plant root, the method comprising applying a composition comprising an EPS expressing bacterium to the soil.
34. A method of increasing the diversity of the microbiota of soil surrounding a plant root, the method comprising applying a composition comprising an EPS expressing bacterium to the soil.
35. The method according to claim 33 or 34, wherein the EPS expressing bacterium is engineered to overexpress at least one gene involved in synthesis and / or secretion of the EPS.
36. The method according to any one of claims 33 to 35, wherein the EPS is cellulose.
37. The method according to any one of claims 33 to 36, wherein the at least one gene is endogenous to the bacterium.
38. The method according to claim 37, wherein the bacterium is modified to overexpress at least one of wssB, wssC, wssD, and wssE.
39. The method of claim 37 or claim 38, wherein the bacterium is modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
40. The method of any one of claims 37 to 39, wherein bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
41. The method according to any one of claims 37 to 40, wherein the EPS expressing bacterium comprises a modified promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose.
42. The method of claim 41 , wherein the bacterium is modified by the insertion of a promoter or wherein the bacterium comprises a mutation in the sequence of the promoter.
43. The method of any one of claims 33 to 36, wherein the EPS expressing bacterium are modified to overexpress exogenous genes comprising a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene.
44. The method according to claim 43, wherein the bacterium further comprises an exogenous cmcAx gene and / or an exogenous bglAx gene.
45. The method according to claim 43 or claim 44, wherein the exogenous genes are heterologous.
46. The method according to any one of claims 43 to 45, wherein the genes are each isolated from K. xylinus.
47. The method according to any one of claims 33 to 46, wherein the EPS expressing bacterium is a root-associated bacterium.
48. The method according to any one of claims 33 to 47, wherein the EPS expressing bacterium is a plant growth-promoting rhizobacterium.
49. The method according to any one of claims 33 to 48, wherein the EPS expressing bacterium is a Pseudomonas bacterium, optionally wherein the Pseudomonas bacterium is a Pseudomonas fluorescens.
50. The method according to any one of claims 33 to 49, wherein expression of the genes or proteins is regulated by a cell-density quorum sensing system.
51. Use of a genetically modified bacterium to increase sugar content in soil around plant roots, wherein the bacterium is genetically modified to overexpress at least one gene involved in synthesis and / or secretion of an EPS.
52. Use of a genetically modified bacterium to increase the diversity of the microbiota of soil surrounding a plant root, wherein the bacterium is genetically modified to overexpress at least one gene involved in synthesis and / or secretion of an EPS.
53. The use according to claims 51 or claim 52, wherein the EPS is cellulose.
54. The use according to any one of claims 51 to 53, wherein the at least one gene is endogenous to the bacterium.
55. The use according to claim 54, wherein the bacterium is modified to overexpress at least one of wssB, wssC, wssD, and wssE.
56. The use of claim 54 or claim 55, wherein the bacterium is modified to overexpress at least one of wssZt, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wssl, and wssJ.
57. The use of any one of claims 54 to 56, wherein bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wss / , and wssJ.
58. The use according to any one of claims 54 to 57, wherein the EPS expressing bacterium comprises a modified promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose.
59. The use of claim 58, wherein the bacterium is modified by the insertion of a promoter or wherein the bacterium comprises a mutation in the sequence of the promoter.
60. The use of any one claims 51 to 53, wherein the EPS expressing bacterium is modified to overexpress exogenous genes comprising a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and / or a ccpAx gene.
61. The use according to claim 60, wherein the bacterium further comprises an exogenous cmcAx gene and / or an exogenous bglAx gene.
62. The use according to claim 60 or claim 61, wherein the exogenous genes are heterologous.
63. The use according to any one of claims 60 to 62, wherein the genes are each isolated from K. xylinus.
64. A method comprising:(a) isolating a bacterium; and(b) modifying the bacterium to overexpress at least one gene involved in synthesis and / or secretion of cellulose.
65. The method of claim 64, wherein the bacterium is modified to overexpress at least one of wssB, wssC, wssD, and wssE.
66. The method of claim 65, wherein the bacterium is modified to overexpress at least one of wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wss / , and wssJ.
67. The method of claim 66, wherein bacterium is modified to overexpress wssA, wssB, wssC, wssD, wssE, wssF, wssG, wssH, wss / , and wssJ.
68. The method of any one of claims 64 to 67, wherein the bacterium is Pseudomonas fluorescens, optionally Pseudomonas fluorescens SBW25.
69. The method of claim any one of claims 64 to 68, wherein the bacterium is modified by modifying the promoter that overexpresses the at least one gene involved in synthesis and / or secretion of cellulose.
70. The method of claim 69, wherein the bacterium is modified by inserting a promoter.
71. The method of claim 70, wherein the promoter is an inducible or constitutive promoter, optionally a strong inducible promoter or strong constitutive promoter.
72. The method of claim 70 or claim 71, wherein the promoter is from the same genus as the modified bacterium, optionally wherein the promoter is from the same species as the modified bacterium, further optionally the same strain as the modified bacterium.
73. The method of any one of claims 70 to 72, wherein insertion of the promoter replaces or disrupts the native promoter.
74. The method of any one of claims 69 to 73, wherein the bacterium is modified by inserting a sequence having at least 70% identity to the amino acid sequence of any one of SEQ ID NOs: 21-53.
75. The method of claim 74, wherein the bacterium is modified by inserting a sequence having at least 70% identity to SEQ ID NO: 50.
76. The method of claim 75, wherein bacterium is modified with p12445 (SEQ ID NO: 50).
77. The method of claim 69, wherein modification of the promoter comprises mutating the sequence of the promoter.
78. The method of any one of claims 64 to 77, wherein the method further comprises (c) generating a composition comprising the modified bacterium produced by step (b).
79. The method of any one of claims 64 to 78, wherein the method further comprises a step of introducing (i) the modified bacterium produced by step (b) or (ii) the composition of step (c) to the soil surrounding a plant.
80. The method of claim 79, wherein the introduction of the modified bacterium to the soil (i) increases water-retention, (ii) reduces water consumption, (iii) increases carbon capture, (iv) increases sugar content in the soil, and / or (v) increases the diversity of the microbiota of the soil.