Engineered mouse and compositions and methods relating thereto
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- XENCOR INC
- Filing Date
- 2024-08-30
- Publication Date
- 2026-07-08
AI Technical Summary
Current methods for generating bispecific antibodies, such as IgG-like bi-specifics, face challenges in correctly pairing heavy and light chains, leading to complex production processes and difficulties in removing unwanted byproducts.
The development of transgenic mice with a recombinant gene segment encoding IGKV10-96 transcriptionally linked to IGKJ1, or a variant thereof, allows for the production of libraries of B cells and antibodies with a high percentage of common light chain antibodies, simplifying the generation of bispecific antibodies by requiring only three different antibody chains.
This approach enables the production of antibodies with high affinity and diversity, similar to those from wild-type mice, while reducing the complexity of antibody production and increasing the efficiency of bispecific antibody generation.
Smart Images

Figure US2024044892_06032025_PF_FP_ABST
Abstract
Description
ENGINEERED MOUSE AND COMPOSITIONS AND METHODS RELATING THERETOCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority of US provisional application no. 63 / 536,002, filed August 31 , 2023, the disclosure of which is hereby incorporated by reference herein.FIELD
[0002] The present disclosure relates to transgenic mice producing common light chain antibodies comprising IGKV10-96 and IGKJ1 , or a variant thereof, libraries of B cells or antibodies arising from such mice, methods for producing libraries of B cells or antibodies arising from such mice, and related recombinant gene segments.REFERENCE TO SEQUENCE LISTING
[0003] The official copy of the Sequence Listing is submitted concurrently with the specification as a WIPO Standard ST.26 formatted XML file with file name “09402- 101WO1.xml”, a creation date of August 29, 2024, and a size of 14,539 bytes.BACKGROUND OF THE INVENTION
[0004] Bispecific antibodies have gained increasing popularity as therapeutics as they enable novel activities which cannot be achieved with monospecific antibodies. Some of the most popular bi-specific formats are molecules in which two Fab arms with different antigen specificity are combined into one IgG-like molecule.SUMMARY OF THE INVENTION
[0005] Provided herein are recombinant gene segments comprising a nucleic acid sequence encoding IGKV10-96 transcriptionally linked to a nucleic acid sequence encoding IGKJ1 , or a variant thereof. In some embodiments, the recombinant gene segment is a murine gene segment.
[0006] Also provided herein are transgenic mice, wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment comprising a nucleic acid sequence encoding transcriptionally linked to a nucleic acid sequence encoding IGKJ1 , or a variant thereof.
[0007] In some embodiments, a recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKV. In some embodiments, the recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKJ. In further embodiments the recombinant gene segment comprises nucleic acid sequence(s) encoding only IGKV10-96 and IGKJ1 , or a variant thereof. In some embodiments, the recombinant gene segment is a nucleicacid sequence having at least 90%, at least 95%, at least 99%, or 100% identity to SEQ ID NO: 1.
[0008] Also provided herein are libraries of B cells expressing antibodies, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; optionally, the library comprises at least 100 genetically distinct B cells. Also provided herein are libraries of antibodies wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; optionally, wherein the library comprises at least 100 genetically antibodies. In some embodiments, at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96. In some embodiments, the common light chain antibodies further comprise IGKJ1 , or a variant thereof. In some embodiments, at least 80% of the common light chain antibodies are an lgG2 isotype. In some embodiments, the lgG2 isotype is lgG2B or lgG2C. In some embodiments, the common light chain antibodies comprise a W96L mutation in CDR-L3. In some embodiments, the antibodies are humanized.Also provided herein are compositions comprising B cells and / or antibodies expressed by the B cells of the present disclosure. In some embodiments, the composition comprises a plurality of genetically distinct B cells that express genetically distinct antibodies, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof. In some embodiments, the composition comprises at least 100 genetically distinct B cells. In some embodiments of the composition: (i) at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; (ii) the common light chain antibodies further comprise IGKJ1 or a variant thereof; and / or (iii) at least 80% of the common light chain antibodies are an lgG2 isotype; optionally, wherein the lgG2 isotype is lgG2B or lgG2C.
[0009] Also provided herein are methods for producing a library of B cells expressing antibodies, the method comprising: (i) immunizing a transgenic mouse wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment comprising a nucleic acid sequence encoding IGKV10-96 transcriptionally linked to a nucleic acid sequence encoding IGKJ1 , or a variant thereof, and (ii) isolating B cells from the transgenic mouse.
[0010] In some methods, at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96. In some methods, at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96. In some methods, the common light chain antibodies further comprise IGKJ1 , or a variant thereof. In some methods, at least 80% of the common light chain antibodies are an lgG2 isotype. In some methods, the lgG2 isotype is lgG2B or lgG2C. In some methods, the isolating B cells comprises enriching B cells from a single cell suspension prepared from aspleen or a lymph node harvested from the transgenic mouse. In some methods, isolating B cells is performed at least 1 , at least 2, at least 3, at least 4, or at least 5 days after immunization. In some methods, isolating B cells is performed at least 5 days after immunization. In some methods, the isolating is performed on the fifth day after immunization.BRIEF DESCRIPTION OF THE FIGURES
[0011] FIG. 1 depicts a schematic of the kappa locus in WT C57BL / 6 mice showing the IGKJ segments, upstream IGKV segments and downstream IGKC region (not to scale) (top panel), and the same region after knocking in the recombinant IGKV10 / IGKJ1 segment, which leaves the upstream and downstream regions unaltered (not to scale) (bottom panel).
[0012] FIG. 2A, FIG. 2B, and FIG. 2C depict IgM (FIG. 2A), IgG (FIG. 2B) and kappa (FIG. 2C) serum concentrations of C57BL / 6 mice (wt, blue, n=6) and common light chain mice (cLC, red, n=6). Measurements from individual mice are represented by a gray circle. The differences in concentration of IgM and IgG antibodies in serum of C57BL / 6 mice and common light chain mice was not significant using Wilcoxon-rank-test. The kappa antibody concentration was determined to be significantly different (Wilcoxon-rank-test, p-value 0.015).
[0013] FIG. 3A, FIG. 3B, FIG. 3C, and FIG. 3D depict an immune repertoire characterization of immunized mice (N=2 for the LTA1 / B2 immunized WT mice, N=3 for the LTA / B or LIGHT immunized cLC mice respectively). FIG. 3A depicts Antigen A and antigen B serum antibody titration by ELISA. FIGS. 3B-3D depict analysis of B cell populations in each experimental group. The tissues from each immunized mice group were collected, stained, and subjected to FACS. FIG. 3B depicts the percentage of B cell subpopulations in the spleen, as revealed either by surface Kappa and Lambda expression or IgM and IgD expression of single live total B cells (CD19+B220+), or transitional B cells (CD93+B220+) of single live B cells (CD19+), or mature follicular B cell (CD23hiCD21 int) and marginal zone B cells (CD23intCD21hi) in total B cells. FIG. 3C depicts the percentage of B cell subsets in bone marrow. FACS analysis of cells stained for CD43 and B220 expression to identify pro / pre-B cells (B220loCD43+), small pre-B (B220IOCD43-), immature / mature (imm / mat B220hiCD43-) B cells. Indicated B cell subsets were pre-gated as single live CD19+ B cells Analysis of surface IgM and IgD or surface L chain K and A expression for recirculating B cells. Indicated B cell subsets were pre-gated as single live total B cells. FIG. 3D depicts the analysis of peritoneal B cell subsets as revealed by surface staining of B220 and CD5 in the pre-gated live CD19+ B cells. B cell subsets are defined as follows: B1a (B220-CD5+), B1 b (B220-CD5-), B2 (B220+CD5-), and the percentage of each subset was indicated in the graph.
[0014] FIG. 4A depicts the subclass and IgG isotype distribution in the sequenced single cell immune repertoire of OVA immunized WT C57BL / 6 mice (blue, n=6089) and common light chain mice (red, n=3716); FIG. 4B depicts the light chain subclass distribution in the sequenced single cell immune repertoire of OVA immunized WT C57BL / 6 mice (blue, n=6409) and commonlight chain mice (red, n=3394); FIG. 4C depicts the IGHV distribution in the sequenced single cell immune repertoire of OVA immunized WT C57BL / 6 mice (blue, n=6149) and common light chain mice (red, n=3859); and FIG. 4D depicts the light chain V-gene usage distribution in the sequenced single cell immune repertoire of OVA immunized WT C57BL / 6 mice (blue, n=6427) and common light chain mice (red, n=3429).
[0015] FIG. 5A depicts a bubble plot of clonotype size distribution in OVA immunized WT C57BL / 6 mice (blue) and common light chain mice (red). The bubble size corresponds to the relative size of clonotype (i.e., the number of clones which make up a clonotype). FIG. 5B depicts a bar graph visualizing the percentage of the sequenced immune repertoire, which is occupied by the 10 largest, the 11th to 50th largest, and the 51st to 500th largest clonotype in the OVA immunized WT C57BL / 6 mice (blue) and common light chain mice (red).
[0016] FIG. 6A depicts the distribution of amino acid mutations observed in OVA immunized C57BL / 6 mice in 675 IGKV10 / IGKJ1 derived antibodies; FIG. 6B depicts the distribution of amino acid mutations in the light chain of OVA immunized common light chain mice (3420 sequences). FIG. 6C and FIG. 6D depict the structural location of frequently mutated amino acid positions mapped onto a structure of a IGKV10 / IGKJ1 light chain (PDB code 5do2). Positions which are mutated with higher frequency in IGKV10 / IGKJ1 derived antibodies of WT C57BL / 6 mice (FIG. 6C) or common light chain mice (FIG. 6D) have a wider cartoon size and are colored in yellow or red color, while position which are conserved and are not frequently mutated are colored in blue.
[0017] FIG. 7A, FIG. 7B, FIG. 7C, and FIG. 7D depict ovalbumin binding of antibodies isolated from WT C57BL / 6 and cLCM animals. Ovalbumin binding was assessed for 48 antiOvalbumin clones selected from WT C57BL / 6 mice, 48 anti-Ovalbumin clones discovered from LCM with their respective endogenous light chain paired with the common light chain. FIG. 7A depicts ELISA screening of Ovalbumin binding. FIG. 7B depicts the binding affinity (KD) of ELISA positive antibodies for Ovalbumin, as determined by Biacore 8K. Differences in binding KD were assessed using a Wilcoxon-rank-test. The KDs of the WT C57BL / 6 clones was significantly different from the KDs of cLCM clones when paired with their endogenous or common light chain (adjusted p-value 0.00064 and 0.0032 respectively. FIG. 7C depicts epitope binning of 22 anti-Ovalbumin antibodies isolated from WT C57BL / 6 mice. Heatmap represents R2 values of the competitive binding profile of antibody pairs. A dark blue color represents high correlation between binding profiles of two antibodies while a light blue color represents a low correlation. The right Y-axis contains assigned epitope bins (A-G) based on the clustered R2 values. FIG. 7D depicts epitope binning of seven benchmark anti-ovalbumin antibodies isolated from WT C57BL / 6 mice, representative of the seven identified epitope bins, against 43 cLC antibodies. A dark blue color represents high correlation (R2) between binding profiles of two antibodies while a light blue color represents a low correlation.
[0018] FIG. 8 depicts a bar graph showing the light chain V-gene usage in antibodies which have been approved or are currently under clinical development.
[0019] FIG. 9 depicts a schematic showing the process to generate the common light chain mouse model by knock-in via homologous recombination.
[0020] FIG. 10 depicts titration using ELISA to assess ovalbumin binding of serum from WT C57BL / 6 (blue) and cLCM animals (red) immunized with ovalbumin.
[0021] FIG. 11 A, FIG. 11B, FIG. 11C, and FIG. 11 D depict phenotypic comparison of B-cells in naive and ovalbumin immunized mice. FIG. 11A depicts a comparison of staining of CD19+ / CD3- B-cells for lambda and kappa chain in naive WT C57BL / 6 and WT C57BL / 6 immunized with albumin. FIG. 11B depicts a comparison of staining of CD19+ / CD3- B-cells for lambda and kappa chain in naive WT C57BL / 6 and cLCM immunized with ovalbumin. FIG. 11C depicts a comparison of staining for CD21 and CD23 markers in naive WT C57BL / 6 and WT C57BL / 6 immunized with ovalbumin. FIG. 11 D depicts a comparison of staining for CD21 and CD23 markers in naive WT C57BL / 6 and cLCM immunized with ovalbumin.
[0022] FIG. 12A depicts a sorting strategy to isolate CD19+ / CD3- / IGM- / OVA+ B-cells from WT C57BL / 6 mice. FIG. 12B depicts a sorting strategy to isolate cLCM immunized with ovalbumin. Specificity of the sorting gates was validated using CD19+ / CD3- / IGM- B-cells from naive C57BL / 6 animals.
[0023] FIG. 13A and FIG. 13B depict a comparison of the IGHV gene usage in the antibody repertoire of the cLCM sequenced (FIG. 13A) using 10x Genomics paired seq (n=3859 sequences), and a VH only (FIG. 13B) repertoire sequencing (n= 199461 sequences).
[0024] FIG. 14A and FIG. 14B depict the observed frequency of non-sense mutation from SHM resulting in amino acid changes for positions 1 to 107 (Chothia numbering) in antibodies carrying IGKV10-96-J1 derived light chains in C57BL / 7 (n=675 sequences) (FIG. 14A) or cLCM (n=3420 sequences) (FIG. 14B).DETAILED DESCRIPTION OF THE INVENTION
[0025] For the descriptions herein and the appended claims, the singular forms “a”, and “an” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “a protein” includes more than one protein, and reference to “a compound” refers to more than one compound. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation. The use of “comprise,” “comprises,” “comprising” “include,” “includes,” and “including” are interchangeable and not intended to be limiting. It is to be further understood that where descriptions of various embodiments use the term “comprising,” those skilled in the art would understand that in some specific instances, anembodiment can be alternatively described using language “consisting essentially of’ or “consisting of.”
[0026] Where a range of values is provided, unless the context clearly dictates otherwise, it is understood that each intervening integer of the value, and each tenth of each intervening integer of the value, unless the context clearly dictates otherwise, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding (i) either or (ii) both of those included limits are also included in the invention. For example, “1 to 50,” includes “2 to 25,” “5 to 20,” “25 to 50,” “1 to 10,” etc.
[0027] Generally, the nomenclature used herein and the techniques and procedures described herein include those that are well understood and commonly employed by those of ordinary skill in the art, such as the common techniques and methodologies described in Sambrook et al., Molecular Cloning — A Laboratory Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 (hereinafter “Sambrook”); Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (supplemented through 2011) (hereinafter “Ausubel”); Antibody Engineering, Vols. 1 and 2, R. Kontermann and S. Dubel, eds., Springer-Verlag, Berlin and Heidelberg (2010); Monoclonal Antibodies: Methods and Protocols, V. Ossipow and N. Fischer, eds., 2nd Ed., Humana Press (2014); Therapeutic Antibodies: From Bench to Clinic, Z. An, ed., J. Wiley & Sons, Hoboken, N.J. (2009); and Phage Display, Tim Clackson and Henry B. Lowman, eds., Oxford University Press, United Kingdom (2004).
[0028] All publications, patents, patent applications, and other documents referenced in this disclosure are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference herein for all purposes.
[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. For purposes of interpreting this disclosure, the following description of terms will apply and, where appropriate, a term used in the singular form will also include the plural form and vice versa.
[0030] “Antibody,” as used herein, refers to a molecule comprising one or more polypeptide chains that specifically binds to, or is immunologically reactive with, a particular antigen. Exemplary antibodies of the present disclosure include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, multispecific (or heteroconjugate) antibodies (e.g., bispecific antibodies), monovalent antibodies (e.g., single-armantibodies), multivalent antibodies, antigen-binding fragments (e.g., Fab', F(ab')2, Fab, Fv, rlgG, and scFv fragments), antibody fusions, and synthetic antibodies (or antibody mimetics).
[0031] “Full-length antibody,” “intact antibody,” or “whole antibody” are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
[0032] “Antibody fragment” refers to a portion of a full-length antibody which is capable of binding the same antigen as the full-length antibody. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; monovalent, or single-armed antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.
[0033] “Class” of an antibody refers to the type of constant domain or constant region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these are further divided into subclasses (isotypes), e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 , and lgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called a, 5, s, y, and , respectively.
[0034] “Variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs) (see, e.g., Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91). A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively (see, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).
[0035] “Hypervariable region” or “HVR,” as used herein, refers to each of the regions of an antibody variable domain which are hypervariable in sequence and / or form structurally defined loops (“hypervariable loops”). Generally, native antibodies comprise four chains with six HVRs; three in the heavy chain variable domain, VH (HVR-H1 , HVR-H2, HVR-H3), and three in the light chain variable domain, VL (HVR-L1 , HVR-L2, HVR-L3). The HVRs generally comprise amino acid residues from the hypervariable loops and / or from the “complementarity determining regions” (CDRs). A number of hypervariable region delineations are in use and are encompassed herein. The Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). Chothia refers instead to the location of the structural loops (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). The AbM hypervariable regions represent a compromise between the Kabat CDRs and Chothia structural loops, and are used by Oxford Molecular'sAbM antibody modeling software. The “contact” hypervariable regions are based on an analysis of the available complex crystal structures. The residues from each of these hypervariable regions are noted in the table 1 below.
[0036] TABLE 1
[0037] Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al., supra.
[0038] Hypervariable regions, as used herein, may include extended or alternative hypervariable regions as follows: 24-36 or 24-34 (L1), 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) in the VL domain and 26-35 or 30-35 (H1), 50-61 , 50-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3) in the VH domain. The variable domain residues are numbered according to Kabat et al., supra, for each of these definitions.
[0039] “Complementarity determining region,” or “CDR,” as used herein, refers to the regions within the HVRs of the variable domain which have the highest sequence variability and / or are involved in antigen recognition. Generally, native antibodies comprise four chains with six CDRs; three in the heavy chain variable domains, VH (H1 , H2, H3), and three in the light chain variable domains, VL (L1 , L2, L3). Exemplary CDRs (CDR-L1 , CDR-L2, CDR-L3, CDR-H1 , CDR-H2, and CDR-H3) occur at amino acid residues 24-34 of L1 , 50-56 of L2, 89-97 of L3, 31- 35 of H1 , 50-61 of H2, and 95-102 of H3. (Numbering according to Kabat et al., supra).
[0040] “Framework” or “FR” refers to variable domain residues other than hypervariable region (HVR) residues. The FR of a variable domain generally consists of four FR domains: FR1 , FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1 (L1)-FR2-H2 (L2)-FR3-H3 (L3)-FR4.
[0041] “Native antibody” refers to a naturally occurring immunoglobulin molecule. For example, native IgG antibodies are heterotetrameric glycoproteins of about 150,000 Daltons, composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From N- to C-terminus, each heavy chain has a variable region (VH), also called a variableheavy domain or a heavy chain variable domain, followed by three constant domains (CH1 , CH2, and CH3) Similarly, from N- to C-terminus, each light chain has a variable region (VL), also called a variable light domain or a light chain variable domain, followed by a constant light (CL) domain. The light chain of an antibody may be assigned to one of two types, called kappa (K) and lambda (A), based on the amino acid sequence of its constant domain.
[0042] “Monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variant antibodies (e.g., variant antibodies contain mutations that occur naturally or arise during production of a monoclonal antibody, and generally are present in minor amounts). In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the term “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
[0043] “Chimeric antibody” refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remainder of the heavy and / or light chain is derived from a different source or species.
[0044] “Humanized antibody” refers to a chimeric antibody comprising amino acid sequences from non-human HVRs and amino acid sequences from human FRs. In certain embodiments, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody. A “humanized form” of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.
[0045] “Human antibody” refers to an antibody which possesses an amino acid sequence corresponding to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
[0046] “Human consensus framework” is a framework which represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH frameworksequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences. Generally, the subgroup of sequences is a subgroup as in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda Md. (1991), vols. 1-3. In some embodiments, for the VL, the subgroup is subgroup kappa I as in Kabat et al., supra. In some embodiments, for the VH, the subgroup is subgroup III as in Kabat et al., supra.
[0047] “Acceptor human framework” as used herein is a framework comprising the amino acid sequence of a light chain variable domain (VL) framework or a heavy chain variable domain (VH) framework derived from a human immunoglobulin framework or a human consensus framework. An acceptor human framework “derived from” a human immunoglobulin framework or a human consensus framework may comprise the same amino acid sequence thereof, or it may contain amino acid sequence changes. In some embodiments, the number of amino acid changes are 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less. In some embodiments, the VL acceptor human framework is identical in sequence to the VL human immunoglobulin framework sequence or human consensus framework sequence.
[0048] “Fc region,” refers to a dimer complex comprising the C-terminal polypeptide sequences of an immunoglobulin heavy chain, wherein a C-terminal polypeptide sequence is that which is obtainable by papain digestion of an intact antibody. The Fc region may comprise native or variant Fc sequences. Although the boundaries of the Fc sequence of an immunoglobulin heavy chain may vary, the human IgG heavy chain Fc sequence is usually defined to stretch from an amino acid residue at about position Cys226, or from about position Pro230, to the carboxyl-terminus of the Fc sequence. However, the C-terminal lysine (Lys447) of the Fc sequence may or may not be present. The Fc sequence of an immunoglobulin generally comprises two constant domains, a CH2 domain and a CH3 domain, and optionally comprises a CH4 domain.
[0049] “Fc receptor” or “FcR,” refers to a receptor that binds to the Fc region of an antibody. In some embodiments, an FcR is a native human FcR. In some embodiments, an FcR is one which binds an IgG antibody (a gamma receptor) and includes receptors of the FcyRI, FcyRII, and FcyRIII subclasses, including allelic variants and alternatively spliced forms of those receptors. FcyRII receptors include FcyRIIA (an “activating receptor”) and FcyRIIB (an “inhibiting receptor”), which have similar amino acid sequences that differ primarily in the cytoplasmic domains thereof. Activating receptor FcyRIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. Inhibiting receptor FcyRIIB contains an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain, (see, e.g., Daeron, Annu. Rev. Immunol. 15:203-234 (1997)). FcR, as used herein, also includes the neonatal receptor, FcRn, which is responsible for the transfer of maternal IgGs to the fetus (Guyer et al, J. Immunol. 1 17:587 (1976) and Kim et al, J. Immunol. 24:249 (1994)) and regulation of homeostasis of immunoglobulins. FcRs are reviewed, for example, in Ravetch andKinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et al, Immunomethods 4:25-34 (1994); and de Haas et al, J. Lab. Clin. Med. 126:330-41 (1995).
[0050] “Multivalent antibody,” as used herein, is an antibody comprising three or more antigen binding sites. The multivalent antibody is preferably engineered to have the three or more antigen binding sites and is generally not a native sequence IgM or IgA antibody.
[0051] “Multispecific antibody" is an antibody having at least two different binding sites, each site with a different binding specificity. A multispecific antibody can be a full length antibody or an antibody fragment, and the different binding sites may bind each to a different antigen or the different binding sites may bind to two different epitopes of the same antigen.
[0052] “Fv fragment” refers to an antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in tight association, which can be covalent in nature, for example in scFv. It is in this configuration that the three HVRs of each variable domain interact to define an antigen binding site on the surface of the VH-VL dimer. Collectively, the six HVRs or a subset thereof confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three HVRs specific for an antigen) has the ability to recognize and bind antigen, although usually at a lower affinity than the entire binding site.
[0053] “Fab fragment’ refers to an antibody fragment that contains a variable and constant domain of the light chain and a variable domain and the first constant domain (CH1) of the heavy chain. “F(ab')2 fragments” comprise a pair of Fab fragments which are generally covalently linked near their carboxy termini by hinge cysteines between them. Other chemical couplings of antibody fragments also are known in the art.
[0054] “Antigen binding arm,” as used herein, refers to a component of an antibody that has an ability to specifically bind a target molecule of interest. Typically the antigen binding arm is a complex of immunoglobulin polypeptide sequences, e.g., HVR and / or variable domain sequences of an immunoglobulin light and heavy chain.
[0055] “Single-chain Fv” or “scFv” refer to antibody fragments comprising the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, an Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired antigen binding structure.
[0056] “Diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH and VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
[0057] Linear antibodies” refers to the antibodies described in Zapata et al., Protein Eng., 8(10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.
[0058] “Naked antibody’’ refers to an antibody that is not conjugated to a heterologous moiety (e.g., a cytotoxic moiety) or radiolabel.
[0059] “Affinity” refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). “Binding affinity” refers to intrinsic binding affinity which reflects a 1 :1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the equilibrium dissociation constant (KD). Affinity can be measured by common methods known in the art, including those described herein. Specific illustrative and exemplary embodiments for measuring binding affinity are described in the following.
[0060] “Binds specifically” or “specific binding” refers to binding of an antibody to an antigen with an affinity value of no more than about 1 *10 "7M. In some embodiments, an antibody may have a secondary affinity for an antigen other than the antigen to which it binds specifically, where “secondary affinity” will generally refer to binding of an antibody to a secondary antigen with an affinity value of more than about 10 nM as described elsewhere herein. Where an antibody may have a secondary affinity for a secondary antigen, such an antibody will nevertheless bind specifically to the primary antigen.
[0061] “Affinity matured” antibody refers to an antibody with one or more alterations in one or more HVRs, compared to a parent antibody which does not possess such alterations, such alterations resulting in an improvement in the affinity of the antibody for antigen.
[0062] “Functional antigen binding site” of an antibody is one which is capable of binding a target antigen. The antigen binding affinity of the antigen binding site is not necessarily as strong as the parent antibody from which the antigen binding site is derived, but the ability to bind antigen must be measurable using any one of a variety of methods known for evaluating antibody binding to an antigen.
[0063] “Isolated antibody” refers to an antibody which has been separated from a component of its natural environment. In some embodiments, an antibody is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic methods (e.g., ion exchange or reverse phase HPLC). For review of methods for assessment of antibody purity, see, e.g., Flatman et al., J. Chromatogr. B 848:79-87.
[0064] “Substantially similar” or “substantially the same,” as used herein, refers to a sufficiently high degree of similarity between two numeric values (for example, one associated with a test antibody and the other associated with a reference antibody), such that one of skill in the art would consider the difference between the two values to be of little or no biologicaland / or statistical significance within the context of the biological characteristic measured by said values (e.g., KD values).
[0065] “Substantially different,” as used herein, refers to a sufficiently high degree of difference between two numeric values (generally one associated with a molecule and the other associated with a reference molecule) such that one of skill in the art would consider the difference between the two values to be of statistical significance within the context of the biological characteristic measured by said values (e.g., KD values).
[0066] “Effector functions” refer to those biological activities attributable to the Fc region of an antibody, which vary with the antibody isotype. Examples of antibody effector functions include: Clq binding and complement dependent cytotoxicity (CDC); Fc receptor binding; antibodydependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
[0067] One way to produce bi-specific molecules, for example for therapeutic use, may require the discovery of antibodies against the two antigens of interest that share a common light chain.
[0068] Bispecific antibodies have gained increased popularity as they enable novel activities which cannot be achieved with regular monospecific antibodies. Various formats have been established in recent years covering a variety of binding stoichiometries and specificities. Among the most popular formats are IgG-like bi-specifics which resemble the structure of a regular IgG combining two Fab arms of different specificities. Numerous IgG-like bi-specifics are currently in clinical development or have been approved.
[0069] One difficulty in generating an IgG-like bi-specific is the requirement to express four different chains - two different heavy chains and two different light chains - which often can form tetramer of multiple combinations resulting in the desired tetrameric IgG-like bi-specific with correctly paired heavy and light chains in a mixture with unwanted byproducts that are difficult to remove. Different methods have been established to overcome the heavy and light chain pairing problem. One method requires the separate expression of two half antibodies i.e. one light chain and one heavy chain specific for one antigen. The two different antibody halves are purified separately and subsequently combined to form a bispecific IgG-like molecule. Preference for hetero- over homo-dimerization of the heavy chain is achieved by mutations in the constant region. In a second method for bi-specific antibody generation, correct pairing of the two different light chains is achieved by mutations in the heavy-light chain interface, in addition to mutations in the heavy chain constant region to yield heterodimerzation. This approach allows for expression of all four protein chains of the bi-specific molecule in one cell. Finally, IgG-like bi- specifics can be generated by combining two Fab arms with different specificities which carry the same light chain. Similar to the aforementioned workflows, hetero-dimerization of the two heavy chains is achieved by mutations in the constant region yielding a common light chain bispecific Ab (cLC-bsAb). The advantage of this format is that it requires the expression of onlythree different antibody chains - two heavy chains with different binding specificities and the common light chain - reducing complexity in therapeutic development and manufacturing. cLC- bsAbs have been approved (e.g., Emicizumab) or are currently being evaluated in the clinic (e.g., Zenocutuzumab, Odronextamab, Linvoseltamab).
[0070] Several methods have been established to discover common light chain antibodies against a variety of targets. One approach is to generate antibody phage libraries which carry a limited light chain diversity. However, for some antigen, it can be very difficult to reach the targeted antibody affinity using a displayed library approach without an additional affinity maturation step. An alternative approach to antibody display library is animal immunization. Common light chain antibodies can be isolated from animals containing a diverse light chain immune repertoire by identifying antibody pairs that maintain binding when using the same light chain. Large-scale screening can be achieved by generating antibody display libraries from immunized animals where the heavy chain repertoire is paired with a common light chain. Subsequent library selection allows for the identification of heavy chain sequences that maintain binding when paired with the common light chain.
[0071] Provided herein are recombinant gene segments comprising a recombinant nucleic acid sequence encoding a selected IGKV gene transcriptionally linked to a selected IGKJ gene. The combination of selected IGKV and IGKJ genes can be made, for example, by assessing the frequency at which that combination occurs, and selecting a combination that is expressed reasonably frequently in a selected model, e.g., a wild type (wt) mouse. Other considerations in selecting a combination of IGKV and IGKJ genes can include, for example, promiscuity of the combination, sequence liabilities (including but not limited to the frequency of tryptophan residues) in the IGKV and IGKJ segments of an antibody light chain encoded by the recombinant gene segment. Notably, one or more recombinant gene segments provided herein can comprise a IGKV10-96 transcriptionally linked to a nucleic acid encoding IGKJ1 , or a variant thereof.
[0072] A recombinant gene segment herein can be designed such that if incorporated into a light chain germline locus of an antibody gene, an antibody light chain comprising IGKV10-96 and IGKJ1 , or a variant thereof can be produced. In some embodiments, the recombinant gene segment can be a murine gene segment. In some embodiments, the recombinant gene segment can be humanized, fully human, or of another organism.
[0073] A recombinant gene segment can be incorporated into a mouse such that antibodies produced by the mouse comprise IGKV10-96 and IGKJ1 , or a variant thereof. Examples of some such mice are provided herein.
[0074] Provided herein are transgenic mice wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment comprising a nucleic acid sequence encoding IGKV10-96 transcriptionally linked to a nucleic acid sequence encoding IGKJ1 or a variant thereof. Such a mouse can be a wild type mouse or a human mouse. A mouse can havea C57BL / 6 background or another background. In some embodiments, a mouse can comprise another modification, such as a mutation, a knock-in, or a knock out of another gene.
[0075] In some embodiments, a recombinant gene segment can comprise exactly one nucleic acid sequence encoding an IGKV. For example, a recombinant gene segment can comprise a nucleic acid sequence encoding IGKV10-96 and no other IGKV gene segments.
[0076] In some embodiments, a recombinant gene segment can comprise exactly one nucleic acid sequence encoding an IGKJ. For example, a recombinant gene segment can comprise a nucleic acid sequence encoding IGKJ1 or a variant thereof and no other IGKJ gene segments.
[0077] In some embodiments, a recombinant gene segment can comprise exactly one nucleic acid sequence encoding an IGKV and exactly one nucleic acid sequence encoding an IGKJ. For example, a recombinant gene segment can comprise a nucleic acid sequence(s) encoding IGKV10-96 and IGKJ1 or a variant thereof, and no other IGKV or IGKJ gene segments.
[0078] In some embodiments, a recombinant gene segment can comprise the nucleic acid sequence of SEQ ID NO: 1 , as provided in Table 2. In some embodiments, the nucleic acid sequence of a recombinant gene segment can have at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 1. Such a nucleic acid can have a substitution, an insertion, or a deletion of one or more nucleic acids compared with SEQ ID NO: 1 . In some embodiments, such a nucleic acid can encode an altered amino acid sequence having at least 90%, at least 95%, or at least 99% identity to the amino acid sequence encoded by SEQ ID NO: 1. Such an altered amino acid sequence can comprise a substitution, an insertion, or a deletion of one or more amino acids compared with the amino acid sequence encoded by SEQ ID NO: 1 .
[0079] In some embodiments, a recombinant gene segment can further comprise a nucleic acid sequence of a leader sequence. A selected example of a leader sequence is SEQ ID NO: 2, as provided in Table 2. Other leader sequences are known by those skilled in the art, and are also envisioned herein. A leader sequence can be selected, for example, to optimize one or more of transcription, translation, correct splicing or other properties of the gene segment or a product thereof.
[0080] In some embodiments, a recombinant gene segment can comprise the nucleic acid sequence of SEQ ID NO: 1 (encoding IGKV10-96 and IGKJ1) and the nucleic acid sequence of SEQ ID NO:2 (leader sequence), as provided in Table 2. For example, a prearranged gene segment can comprise the nucleic acid sequence of SEQ ID NO: 3, as provided in Table 2. Such a nucleic acid can have a substitution, an insertion, or a deletion of one or more nucleic acids compared with SEQ ID NO: 3. In some embodiments, such a nucleic acid can encode an altered amino acid sequence having at least 90%, at least 95%, or at least 99% identity to the amino acid sequence encoded by SEQ ID NO: 3. Such an altered amino acid sequence can comprise a substitution, an insertion, or a deletion of one or more amino acids compared with the amino acid sequence encoded by SEQ ID NO: 3.
[0081] TABLE 2: Sequences of a prearranged gene segment
[0082] Typical “conservative” amino acid substitutions and / or substitutions based on common side-chain class or properties are well-known in the art and can be used in the embodiments of the present disclosure. The present disclosure also contemplates variants based on nonconservative amino acid substitutions in which a member of one of amino acid side chain class is exchanged for an amino acid from another class.
[0083] Amino acid side chains are typically grouped according to the following classes or common properties: (1) hydrophobic: Met, Ala, Vai, Leu, He, Norleucine; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) chain orientation influencing: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe.
[0084] Techniques are well-known in the art for amino acid substitution into an antibody and subsequent screening for desired function, e.g., retained / improved antigen binding, decreased immunogenicity, or improved ADCC or CDC.
[0085] Amino acid substitution variants can include substituting one or more hypervariable region residues of a parent antibody (e.g., a humanized or human antibody). Generally, the resulting variant(s) selected for further study will have modifications in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and / or will have substantially retained certain biological properties of the parent antibody. An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described in the Examples herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g., binding affinity).
[0086] A useful method for identifying residues or regions of an antibody that may be targeted for mutagenesis is “alanine scanning mutagenesis” (see e.g., Cunningham and Wells (1989) Science, 244: 1081-1085). In this method, a residue or group of target residues (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) can be identified and replaced by a neutral or negatively charged amino acid (e.g., Ala or polyalanine) to determine whether the interaction of the antibody with an antigen is affected. Further substitutions may be introduced at the amino acid locations demonstrating functional sensitivity to the initial substitutions. Alternatively, or additionally, a crystal structure of an antigen-antibody complex to identify contact pointsbetween the antibody and antigen can be determined. Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution. Variants may be screened to determine whether they contain the desired properties.
[0087] Amino acid sequence insertions can include amino- and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intra-sequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue. Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme or a polypeptide which increases the serum half-life of the antibody.
[0088] Also provided herein are libraries of genetically distinct B cells that express antibodies, such as B cells of a mouse provided herein. In such libraries of B cells, a substantial majority of the antibodies expressed by the genetically distinct B cells can be common light chain antibodies, such as those provided herein. Also provided herein are libraries of antibodies. In some cases, a library of genetically distinct antibodies can be isolated from a library of B cells provided herein or a subset thereof.
[0089] In some embodiments the libraries of B cell comprise at least 100, at least 250, at least 500, at least 1000, or even more genetically distinct B cells. Accordingly, in some embodiments, the libraries of antibodies expressed by the library of B cells can comprise at least 100, at least 250, at least 500, at least 1000, or even more genetically distinct antibodies.
[0090] In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies.
[0091] Variable light chain antibodies of a library of antibodies or expressed by a library of B cells can comprise a variable light chain comprising IGKV10-96. In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies comprising a VL comprising IGKV10-96. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies comprising a VL comprising IGKV10-96.
[0092] In some embodiments, a library of B cells can express antibodies wherein at least 95% of the antibodies are common light chain antibodies comprising a VL comprising IGKV10-96. In some embodiments, at least 95% of the antibodies of a library of antibodies can comprise VL comprising IGKV10-96.
[0093] Antibodies of a library of antibodies or expressed by a library of B cells, which comprise IGKV10-96, can further comprise IGKJ1 , or a variant thereof. In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies comprising a VL comprising IGKV10-96 and IGKJ1 , or a variant thereof. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies of a library of antibodies or expressed by a library of B cells can be common light chain antibodies comprising a VL comprising IGKV10-96 and IGKJ1 , or a variant thereof.
[0094] A library of B cells can comprise antibodies of one or more classes, such as IgA, IgD, IgE, IgG, or IgM. In some embodiments, a library of B cells or a library of antibodies can comprise antibodies of one or more isotypes, such as but not limited to e.g., IgGI, lgG2, lgG3, lgG4, IgAI, and lgA2. In some embodiments, at least 80% of the antibodies of a library of B cells or a library of antibodies can be an lgG2 isotype. For example, the lgG2 isotype can be lgG2B or lgG2C. In addition, other proportions of classes and isotypes of antibodies for libraries provided are also envisioned herein.
[0095] In some embodiments, antibodies described herein, such as antibodies of a library of antibodies or expressed by a library of B cells can comprise one or more amino acid modifications compared with a wild type antibody amino acid sequence. For example, common light chain antibodies herein can comprise a W96L mutation in CDR-L3. Also, prearranged gene segments and transgenic mice as described herein can comprise a nucleic acid modification compared to the wild type sequence that yields a W96L mutation in CDR-L3.
[0096] In some embodiments, antibodies described herein, such as antibodies of a library of antibodies or expressed by a library of B cells can be humanized.
[0097] The present disclosure also provides compositions useful in the production, and / or manufacture of antibodies. Generally, the compositions comprise B cells (such as from a B cell library), and / or can also comprise antibodies expressed by the B cells. In some embodiments, a composition of the present disclosure can comprise a plurality of genetically distinct B cells that express a plurality of genetically distinct antibodies. In some embodiments, the composition comprises at least 100 genetically distinct B cells. In some embodiments of the compositions, at least 95% of the antibodies expressed by the B cells are common light chain antibodiescomprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof. In some embodiments of the compositions: (i) at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; (ii) the common light chain antibodies further comprise IGKJ1 or a variant thereof; and / or (iii) at least 80% of the common light chain antibodies are an lgG2 isotype; optionally, wherein the lgG2 isotype is lgG2B or lgG2C.
[0098] Also provided herein are methods for producing libraries provided herein. Methods can include methods for producing a library of B cells expressing antibodies, such as those provided herein, or methods for producing a library of antibodies, such as those provided herein.
[0099] A method for producing a library of B cells expressing antibodies can comprise immunizing a transgenic mouse provided herein, which can be followed by isolating B cells from the transgenic mouse. For example, a method for producing a library of B cells expressing antibodies can comprise immunizing a transgenic mouse wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a prearranged gene segment comprising a nucleic acid sequence encoding IGK10-96 transcriptionally linked to a nucleic acid sequence encoding IGKJ1 , or a variant thereof, followed by isolating B cells from the transgenic mouse.
[0100] B cells produced by a method provided herein can comprise B cells of a library of B cells provided herein, and B cells produced by a method provided herein can express antibodies, which can comprise a library of antibodies provided herein.
[0101] In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the antibodies of B cells isolated via a method provided herein can be common light chain antibodies. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies of B cells isolated via a method provided herein can be common light chain antibodies.
[0102] In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the antibodies of B cells isolated via a method provided herein can comprise a VL comprising IGKV10-96. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies of B cells isolated via a method provided herein can comprise a VL comprising IGKV10-96.
[0103] Antibodies expressed by B cells isolated via a method provided herein, which comprise IGKV10-96, can further comprise IGKJ1 , or a variant thereof. In some embodiments, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%of the antibodies expressed by B cells isolated via a method provided herein can be common light chain antibodies comprising a VL comprising IGKV10-96 and IGKJ1 , or a variant thereof. In some embodiments, between about 95% and about 96%, between about 95% and about 97%, between about 95% and about 98%, between about 95% and about 99%, between about 96% and about 97%, between about 96% and about 98%, between about 96% and about 99%, between about 97% and about 98%, between about 97% and 99%, or between about 98% and 99% of the antibodies expressed by B cells isolated via a method provided herein can be common light chain antibodies comprising a VL comprising IGKV10-96 and IGKJ1 , or a variant thereof.
[0104] B cells isolated from a method provided herein can comprise antibodies of one or more classes, such as IgA, IgD, IgE, IgG, or IgM. In some embodiments, such B cells can comprise antibodies of one or more isotypes, such as but not limited to e.g., IgGI, lgG2, lgG3, lgG4, IgAI, and lgA2. In some embodiments, at least 80% of the antibodies of such B cells can be an lgG2 isotype. For example, the lgG2 isotype can be lgG2B or lgG2C. In addition, other proportions of classes and isotypes of antibodies for libraries provided are also envisioned herein.
[0105] In some methods, the step of isolating B cells from the transgenic mouse can comprise enriching B cells from a single cell suspension prepared from a spleen or lymph node harvested from the transgenic mouse. In some embodiments, such isolating can be performed as in the example provided herein. In some embodiments, a method can comprise one or more other methods for isolating B cells from the transgenic mouse.
[0106] Isolation of the B cells can be performed at least 1 , at least 2, at least 3, at least 4, or at least 5 days after immunization. In some embodiments, isolation of the B cells can be performed between 1 and 2 days, between 1 and 3 days, between 1 and 4 days, between 1 and 5 days, between 2 and 3 days, between 2 and 4 days, between 2 and 5 days, between 3 and 4 days, between 3 and 5 days, or between 4 and 5 days after immunization. In some embodiments, isolation of the B cells can be performed on the fifth day after immunization.
[0107] Also provided herein are methods for producing a library of antibodies, such as a library of antibodies provided herein. A method for producing a library of antibodies can comprise a method for producing a library of B cells expressing antibodies provided herein, followed by isolating antibodies from the B cells. A method for producing a library of antibodies can comprise immunizing a transgenic mouse provided herein, which can be followed by isolating B cells from the transgenic mouse, which can be followed by isolation of antibodies from the B cells. For example, a method for producing a library of antibodies can comprise immunizing a transgenic mouse wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a prearranged gene segment comprising a nucleic acid sequence encoding IGK10-96 transcriptionally linked to a nucleic acid sequence encoding IGKJ1 or a variant thereof, followed by isolating B cells from the transgenic mouse, followed by isolation of antibodies from the B cells.
[0108] Further, common light chain antibodies (and libraries thereof) can be obtained from transgenic mice provided herein, for example by one or more of a number of methods. Such methods can include B-cell cloning and paired heavy / light chain sequencing (for example as provided in the example herein), heavy chain repertoire sequencing, immune libraries in combination with a display method (e.g., phage, yeast, mRNA, or ribosome display), or using a traditional hybridoma method. Such methods are known to skilled artisans.
[0109] An immune phage library can be generated from B cells isolated from the common light chain mouse, from which common light chain antibodies can be isolated. To build a phage library in order to isolate heavy chains which pair with the naive common light chain while maintaining antigen binding, lymphocytes and splenocytes can be obtained from antigen immunized common light chain mice. Total RNA can then be isolated from the B-cells and reverse transcript using RACE PCR. Heavy chain Fd segments can then be amplified from the cDNA by PCR using previously described murine variable region primers (Jinhua et al, PloS One. 2013;8(1): e53264) and primers complementary to the murine constant heavy and hinge junction regions. The amplified Fd DNA library can then be cloned into a phagemid vector which also contains the native common light chain IGKV10-96 / J1-96L. The resulting phagemid library can then be transformed into E. coli XL1-Blue cells by electroporation for phage generation. The page library can be subjected to several rounds of phage panning using either antigen in solution or immobilized to enrich for antigen specific binders. To determine the VH sequences in the enriched phage pools, phagemid DNA is isolated, VH sequences can be amplified by PCR and sequenced using Illumina Miseq. Finally, the obtained VH sequences can be synthesized and cloned into an IgG expression vector for expression with the common light chain. The resulting common light chain antibodies can be purified and binding to the antigen can be confirmed using various methods including ELISA, FACS, or surface plasmon resonance.
[0110] An endogenous common light chain mouse model, such as a transgenic mouse provided herein, generated with minimal genetic engineering can be suitable for common light chain antibody discovery. While such a model can comprise similarities to previously described mouse models, those previous models are not suitable for common light chain discovery as they deliberately express autoreactive light chains or light chains with a particular antigen specificity. Instead, a light chain gene segment (IGKV10-96) that is one of the most commonly used light chains was selected, which can pair well with a wide range of mouse VH genes with minimal bias, and which has high homology with human kappa light chain frequently used in therapeutic antibodies. Further, position 96 can be altered from its endogenous tryptophan to leucine to reduce the likelihood of developability issues. Such a model can generate a robust immune response upon immunization, for example as evident from a high antigen titer (FIG. 3A and FIG. 10), normal B cell development (FIGS. 3B-3D, FIGS. 11A-11D, and FIGS. 12A-12B), a diverse heavy chain repertoire with only slightly reduced VH gene usage (FIGS. 4A-4D) and clonotype diversity comparable to WT C57BL / 6 mice (FIGS. 5A-5B) in the example provided below.Further, the vast majority of antibodies in the immune repertoire of a transgenic mouse provided herein can carry a light chain derived from the prearranged IGKV10-96 / J1 L segment while the percentage of lambda chain antibodies is low. This can suggest that the expression of the selected prearranged IGKV10-96 / J1-96L segment can result in low receptor editing, for example as in FIGS. 4A-4D in the example provided below. Furthermore, isolated antibodies isolated from immunized (e.g., by OVA) transgenic mice can exhibit a high affinity to the model antigen, for example as in FIGS. 7A-7B in the example provided below. Finally, the epitope diversity (e.g., OVA epitope diversity) of the isolated cLC antibodies can match the diversity of antibodies (e.g., anti-OVA antibodies) isolated from WT C57BL / 6 mice , for example as in FIGS. 7C-7D in the example provided below. When combined with a robust antibody discovery workflow using either single cell sequencing as presented here or alternatively workflows such as immune library display or VH repertoire NGS, transgenic mice provided herein can allow for the rapid generation and identification of diverse high affinity common light chain antibodies. In some embodiments, antibodies can be humanized in bulk using established or novel humanization approaches.
[0111] While B cell development may not be impaired in transgenic mice provided herein, B cells in such transgenic mice can differ from WT C57BL / 6 B cells as they are homozygous for the rearranged IGKV10-96 / J1-96L locus. As a result both alleles of the prearranged IGKV10- 96 / J1 are expressed. In WT B cells, allelic exclusion can prevent the simultaneous rearrangement of both kappa clusters. However, due to differences in epigenetic modification one allele can undergo SHM at higher frequency than the other, which can result in the expression of two distinct BCRs on the surface of the transgenic mouse B cells. The dual allelic expression does not impact B cell development in general, for example as in FIGS. 3A-3D of the example provided below, although somatic mutation data for example as provided in FIGS. 6A- 6B in the example below, as those data can represent a mixture of both alleles. Thus, lower average mutation frequency in the cLCM mice can be a product of dual allelic expression and / or the technical limitations in separating the two highly similar light chain alleles during single cell sequencing.
[0112] Nevertheless, the IGKV10-96 / J1 mutation profile between a transgenic mouse and a C57BL / 6 mouse can be similar. Most SHM occur in the CDR-L1 and CDR-L3 loops. The most common SHM in the framework is position 83 (Chothia numbering), for example as in FIGS. 6C- 6D, and FIGS. 14A and 14B in the example provided herein. The mutation profile can suggest that a light chain of a transgenic mouse provided below can be involved in antigen binding in at least most of the antibodies. The highly mutated positions in the CDR-L1 (positions 30-31 ; Chothia) and in CDR-L3 (positions 92-94; Chothia) are usually solvent exposed in IGKV10-96 light chains (for example in PDB entry 5DO2, the relative solvent accessible area is 14-65% for CDR-H3 and 25-30% for CDR-H1), suggesting that they may directly interact with OVA. The framework position 83, while located away from the antigen, influences the overall dynamic ofthe Fab fragment. A change in residue at this position can influence the Fab elbow angle as well as the orientation of the VH and VL domains towards each other and can influence antibody affinity and stability. This position can also be optimized in human antiviral broadly neutralizing antibodies. The direct involvement of the light chain in antigen binding and the importance of somatic mutations can be demonstrated, for example by the reduction of binding signal when heavy chains are paired back to the non-mutated common light chain, such as in FIGS. 7A and 7B of the example below.
[0113] Previously published approaches which detail the generation of common light chain antibodies include a humanized common light chain rat and chicken and common light chain phage libraries. The isolated common light chain OVA antibodies from the transgenic mouse have a similar affinity range (0.85-120 nM) as anti-PGRN antibodies isolated from a common light chain chicken (cLCM-derived anti-OVA antibodies KD median is 5.95 nM and common light chain chicken KD median 10.3 nM), while the affinities of 4-1 -BB antibodies isolated from the phage library have an initial lower mean affinity (mean KD 128 nM), but reach similar affinity after affinity maturation (mean KD of affinity matured 4-1 -BB antibodies derived from the phage library is 13 nM which compares to a mean KD of cLCM derived OVA antibodies of 8nM, respectively).EXAMPLES
[0114] Various features and embodiments of the disclosure are illustrated in the following representative examples, which are intended to be illustrative, and not limiting. Those skilled in the art will readily appreciate that the specific examples are only illustrative of the invention as described more fully in the claims which follow thereafter. Every embodiment and feature described in the application should be understood to be interchangeable and combinable with every embodiment contained within.Example 1: An engineered mouse model which generates a diverse repertoire of endogenous, high affinity common light chain antibodies
[0115] The following abbreviations are utilized throughout the present example: BCR: B cell receptor; CDR: Complementarity-determining region; cLC: common light chain; cLC-bsAb: common light chain bispecific antibody; cLCM: common light chain mouse; ELISA: enzyme- linked immunoassay; FBS: fetal bovine serum; IgG: Immunoglobulin G; IgD: Immunoglobulin D; IgM: Immunoglobulin M; KD: equilibrium dissociation constant; LC: light chain; NGS: next generation sequencing; OVA: ovalbumin; PBS: phosphate buffered saline; WT: wildtype.
[0116] Presented here is an example of the generation and characterization of a common light chain mouse model, in which the endogenous IGKJ1 to 5 cluster is replaced with a prearranged, modified murine IGKV10-96 / IGKJ1 segment. This example demonstrates the genetic modification does not impact B cell development. Upon immunization with ovalbumin, theanimals generate an antibody repertoire with VH gene segment usage of similar diversity to WT mice, while the light chain diversity is restricted to antibodies derived from the prearranged IGKV10-96 / IGKJ1 germline. Further, the clonotype diversity of the common light chain immune repertoire matches the diversity of immune repertoire isolated from WT mice. Finally, the common light chain anti-ovalbumin antibodies have only slightly lower affinity (KD: 850 pM to 120 nM) as antibodies isolated from WT mice (KD: 64 pM to 191 nM), demonstrating the suitability of these animals for antibody discovery for bi-specific antibody generation.
[0117] Materials and Methods
[0118] Mouse model generation
[0119] The cLCM mouse model was generated at genoWay S.A. (Lyon, France). In a first step an expression vector was constructed covering the leader exon L1 , leader intron, leader exon L2, the prearranged IGKV10-96 / J1-96L segment, IGKJ intron and the IGKC constant region. Two versions of this construct were generated, one using the naive sequence and one with an optimized sequence to remove potential aberrant splicing sites. Vectors were expressed in murine 3T3 cells and the resulting transcript sizes were determined by PCR amplification from cDNA. Both expression vectors yield transcript with the expected sizes, indicating that the correctly spliced product was formed. However, an additional smaller product was observed using the construct with the naive sequence. The absence of aberrant splicing variants in the optimized sequence construct was further confirmed by Sanger sequencing. Using the optimized expression sequence, a targeting vector was constructed which contains, in addition to the L1 / leader intron / L2-IGVK10-96 / J1-96L segment, an additional 5’ segment and 3’ segments. The 5’ segment contains a homology region, covering a 2.8 kb region upstream of the J1 segment in WT C57BL / 6 mice and a neomycin cassette flanked by loxP sites. The 3’ segment contains a 3.5k b homology region covering the IGKJ intron and IGKC exon and Diphtheria Toxin cassette which serves as a negative selection marker (FIG. 9). The targeting vector was linearized and electroporated into C57BL / 6 embryonic stem cells (ES), which were subject to positive and negative selection. ES clones were screened using a PCR assay which detects the 5’ genomic / transgenic junction and correct insertion was subsequently confirmed using sequencing. Random non-homologous integration was excluded by assessing the presence of the neomycin cassette in genomic DNA, which confirmed that only one integrated copy is present in the selected clones. Knock-in ES clones were injected into blastocysts resulting in chimeric animals. Breeding was established with C57BL / 6 Cre deleter mice to excise the Neomycin cassette and generate heterozygous knock-in mice. The resulting offspring was screened by PCR to confirm excision of the neomycin cassette. Additional validation of knock-in and neomycin cassette excision was confirmed by sequencing the entire targeted locus in addition to 1kb up- and downstream. Validated animals were mated to produce homozygous common light chain mice.
[0120] Serum concentration of IqG, IqM and kappa antibodies by ELISA
[0121] Naive serum IgM titers and IgG titers in cLCM and WT C57BL / 6 mice were determined using an IgM mouse ELISA kit (Abeam #ab133047) and an IgG mouse ELISA kit (Abeam #151276) following the manufacturer’s protocol. Naive serum kappa antibody titers were determined using a Mouse Kappa Light Chain (Sandwich ELISA) kit (LSBio #F55173) following the protocol provided by the manufacturer’s protocol.
[0122] Ovalbumin immunization
[0123] Six female 7-week-old wild-type C57BL / 6 mice or common light chain mice were immunized with 50 pg Ovalbumin (InvivoGen, Cat# vac-pova). Briefly, mice were immunized with 200 pl of recombinant protein mixed with a mixture of Toll-like receptor adjuvants (Ref) by weekly intraperitoneal and subcutaneous injection. After four immunizations, serum from immunized mice was collected to test the OVA specific antibody titer using ELISA (see below). Four days before euthanization, animals received a final boost of 50 pg of protein intravenously with no adjuvant.
[0124] B cell phenotypic analysis by flow cytometry
[0125] Briefly, single-cell suspensions from bone marrow, spleen, and peritoneal cavity lavage were isolated from immunized cLCM and, for comparison, C57BL / 6 littermates. 106cells were suspended in FACS buffer containing 1 * PBS (pH 7.2), 2% FBS (Sigma-Aldrich), and 2 mM EDTA, and B cells were stained with premixed combinations of fluorochrome-labeled mAbs at concentrations optimized by titration, and total B cells were gated as singlet, live, CD19+, and / or B220+ lymphocytes. All Abs were obtained from Biolegend unless otherwise stated. The primary labeled mAbs used were: AF700 or AF594 conjugated a-B220, BV510 or APC-Cy7 a-CD19(BD Biosciences), BV605-conjugated a-lgD, Percp cy5.5-conjugated a-IgM (BD Biosciences), PE- Cy7 conjugated a-CD21 , APC-Cy7-labeled a-CD23, PE Cy7-conjugated a-CD93, PE Cy7- conjugated a-CD43, AF700-labeled CD5, FITC-conjugated a-kappa, and APC-conjugated a- lambda. 4',6-diamidino-2-phenylindole (DAPI) was used to exclude dead cells. FACS was performed using a CytoFLEX flow cytometer and data was analyzed using FlowJo (Tree Star) software.
[0126] Antigen specific B cell sorting
[0127] Spleen and lymph nodes were harvested from immunized mice five days after the final boost and single cell suspensions were prepared. Red blood cells were removed by standard erythrocyte lysis. B cells were enriched by EasySepTM mouse pan-B cell isolation kit (STEMCELL, Cat# 19844) according to the manufacturer’s instructions. Cells were then stained with a fluorophore-labeled antibody panel, which includes Percp cy5.5 conjugated anti-mouse IgM (BD Biosciences, 550881), Percp cy5.5 conjugated anti-mouse IgD (BD Biosciences, 564273), APC Cy7 conjugated anti-mouse CD19 (BD Biosciences, 557655), and a cocktail of phycoerythrin (PE) conjugated antibodies used during sorting as a dump channel: anti-mouse Ly6g (Biolegend, 108407), PE anti-mouse CD3 (Biolegend, 100205), and PE anti-mouse F4 / 80 (Biolegend, 123110). Finally, ovalbumin ((InvivoGen, Cat# vac-pova), labeled with Alexa647 andAlexa488 using Alexa Fluor labeling kits (Cat#: A20186 / A20181), were added. Stained cells were then collected for cell sorting via a Sony MA900 cell sorter. Single dump channel- / CD19+ / lgM- / Ovalbuminduel+ stained B cells were collected and barcoded using the 10x Genomics Chromium controller and a sequencing library was prepared according to the manufacturer’s instructions. In brief, after sorting, cells were spun down and resuspended in PBS + 2% FBS buffer and injected into a channel in the chip K (10x Genomics, Cat#: PN-1000287). Gel Beads- in-Emulsion (GEMs) were formed in the 10x Chromium instrument, and then collected for GEM reverse transcription (GEM-RT) reaction and cDNA amplification with Chromium Next GEM single cell 5’GEM KIT v2 (10x Genomics, Cat#: PN-1000266), followed by SPRIselect (Beckman Coulter, B23318) beads clean up. Amplified full-length cDNA was used to amplify full- length V(D)J segments with single cell mouse BCR amplification kit (10x Genomics, Cat#: PN- 1000255). V(D)J libraries were prepared using a library construction kit (10x Genomics, Cat#: PN-1000196) following the manufacturer’s user guide. Quality control and quantification were performed on the Agilent Tapestation using a High Sensitivity D5000 ScreenTape (Agilent Technologies, 5067-5592).
[0128] Single cell sequencing and analysis
[0129] The sequencing libraries were sequenced using an Illumina NextSeq Sequencer in conjunction with the mid output sequencing kit (Illumina, Cat #: 20024904). VH and VL sequences were assembled from the sequencing data using the Cell ranger software (10x Genomics). The cell ranger output was further analyzed to enable clone selection using R. Data for cells containing exactly one VH and one VL sequence was filtered and clustered the paired sequences into clonotypes based on the VH germline, CDR-H3 length and the CDR-H3 sequence identity (>80% amino acid identity) using CD-HIT50. Further, clonotypes consisting of at least 5 clones per consensus sequence and for each clone in those clonotypes the hamming distance to the consensus sequence were calculated for. Sequences containing sequence liabilities such as N-glycosylation sites and unpaired sequences in the CDRs were flagged. 48 clones from each from the WT C57BL / 6 and the cLCM were selected for gene synthesis and small-scale expression based on the following criteria: larger clonotype size, minimal hamming distance to clonotype consensus and no sequence liabilities in the CDR sequences. For downsampling sequences were randomly selected from the filtered Cell Ranger output and clonotypes were assigned using the downsampled dataset. Gini-coefficient and D50 diversity measure were also calculated using R.
[0130] Heavy chain immune repertoire sequencing and analysis
[0131] RNA was extracted from 300,000 splenocytes derived from the ovalbumin-immunized cLCM using the RNeasy extraction kit (Qiagen) and following the manufacturer’s instructions. RNA was eluted in 50 pL of RNAse-free water and the RNA concentration was measured. 5’ rapid amplification of cDNA ends (RACE) was carried out using the SMARTer® RACE 573’ Kit (Takara Bio) and adhering to the manufacturer’s user manual (with a few modifications).Random hexamers were used in place of the 5’ CDS Primer A for preparation of 5’ RACE- Ready cDNA. Reverse transcription was carried out using the SMARTERIIA oligonucleotide and SMARTScribe Reverse Transcriptase provided in the kit. The tubes were incubated at 42°C for 90 minutes followed by 70°C for 10 minutes in a hot-lid thermocycler. After incubation, the first- strand cDNA synthesis reaction was diluted with T ricine-EDTA and used as input DNA for the PCR amplification reaction. The forward primer and reverse primer mix used in the first PCR reaction is listed below. A nested PCR was carried out using the M1SS forward primer (listed above) and the Z-stepout reverse primer (ATTGGGCAGCCCTGATT) (SEQ ID NO: 9) and Forward Primer (10uM) M1SS] : AAGCAGTGGTATCAACGCA-5’ (SEQ ID NO: 10).
[0132] Reverse Primer Mix contains equal concentrations (10 uM) of the following primers: mlGG12_R2_Nested (ATTGGGCAGCCCTGATTAGTGGATAGACCGATG) (SEQ ID NO: 11), mlGG12_R2.1_Nested (ATTGGGCAGCCCTGATTAGTGGATAGACTGATG) (SEQ ID NO: 12), mlGG3_R2_Nested (ATTGGGCAGCCCTGATTAAGGGATAGACAGATG) (SEQ ID NO: 13), and mlGGKC_R2_Nested (ATTGGGCAGCCCTGATTGGATGGTGGGAAGATG) (SEQ ID NO: 14). A clean-up step using solid-phase reversible immobilization (SPRI) magnetic beads (Beckman Coulter Life Sciences) was performed on the PCR products following the manufacturer’s instructions. The NEBNext Ultra DNA Library Prep Kit (New England Biolabs, Catalog # E7370L) was used to ligate the index primers (NEBNext Multiplex Oligos for Illumina, Catalog# E6609S) to the final DNA products. Next-generation sequencing was carried out using the MiSeq Reagent Kit v3 (600 cycle) (Illumina, Product # MS-102-3003). Paired consensus R1 and R2 reads were assembled into a single sequence spanning the VH domain using flash pairwise aligner. IGHV, IGHD and IGHJ germlines were assigned using IgBlast and the IMGT published mouse reference germline set. Data was plotted using R / ggplot2.
[0133] Small scale antibody expression
[0134] Selected clones from the single B cell sequencing dataset were produced by DNA synthesis and transcriptionally active PCR (TAP) as chimeric human lgG1 / kappa antibodies. In brief, antibody variable-region DNA with 5'- and 3'-TAP universal sequences were synthesized (IDT DNA). After the variable region DNA, a promoter DNA fragment, and a heavy or light chain constant region terminal DNA fragment were assembled and amplified via two rounds of overlap PCR to produce two separate linear DNA fragments products, encoding the heavy chain and the light chain, respectively. The PCR products were verified by agarose gel electrophoresis and purified using the E-Z 96 Cycle Pure Kit (Omega Bio-Tek). Heavy- and light-chain fragments in a 1 :2 ratio were transiently co-transfected into Expi293 cells at a 3 ml scale using an ExpiFectamine™ 293 Transfection Kit (Gibco, Cat# 2401600) following the manufacturer’s instructions. Cells were incubated for six days before supernatant was harvested by centrifugation and the expressed antibodies were then purified in using protein A chromatography.
[0135] Enzyme-linked immunosorbent assay (ELISA) to determine antigen binding
[0136] M icrotiter plates (96-well) were coated overnight with ovalbumin (InvivoGen, Cat# vac- pova) at 1 pg / ml, then blocked with 300 pl of 1% bovine serum albumin in phosphate-buffered saline with 0.05% Tween 20 (PBS-T) for 2 hours. Antibodies (10 pg / ml) were diluted in a blocking buffer and 100 pl per well were added and incubated at room temperature for one hour. Then, horseradish peroxidase (HRP)-labeled goat anti-human IgG Fc antibody (Jackson ImmunoResearch, Cat#: 109-035-098) at 1 :5000 dilution in PBS-T was added at 100 pl / well as the secondary reagent. The ELISA plates were developed using a TMB solution, and the reaction was stopped by addition of 50 pL of 2M H2SO4. Absorbance was read at 450 nm on a VersaMax microplate reader. Antibodies that showed an absorbance higher than 0.3 OD were considered to be binders.
[0137] Biacore
[0138] Antibody association and dissociation rates were determined by Surface Plasmon Resonance (SPR) measurement using a Biacore 8K instrument. Each antibody at 0.5 pg / ml in HBS-P (0.01 M HEPES, 0.15M NaCI and 0.05% Surfactant P20) running buffer were captured by a Protein A chip (Cytiva, Cat#: 29127556). To measure the binding kinetics, ovalbumin (InvivoGen, Cat# vac-pova) from 11 nM to 100 nM in 3- fold serial dilutions, and a blank buffer for baseline subtraction, were injected at 30 pl / min for 120 seconds, followed by a 10-minute dissociation period. Regeneration of the Protein A surface was achieved via 30 seconds of 10 mM glycine (pH 1 .5) at 50 pl / min between each running cycle. All kinetic experiments were performed at 25°C.
[0139] Epitope Binning of WT and CLC antibodies
[0140] A previously established protocol was followed for epitope binning. Biotinylated OVA was captured at a concentration of 2 pg / mL to MagAvidin beads (Luminex). Capture was performed for 1 hour, at room temperature, in the dark. Beads were then washed 2x, on magnet, with flow buffer (1X PBS + 2% FBS), wash was aspirated, and beads were made to a concentration of 2.5x106beads / mL. Protein coated beads were then incubated with selected benchmark antibodies from the WT C57BL\6 or cLCM, at 5 pg / mL of antibody with 1.25x106beads / mL, for 45 minutes, room temperature, in the dark (one benchmark mAb per MagAvidin bead type). Beads were again washed 2x with flow buffer on a magnet. Post wash all bead types were pooled and made to 1 .25x106beads / mL. Prior to pooling 16pL of each bead type was removed to serve as single bead controls. All test panel antibodies from the WT C57BL / 6 or cLCM mice were then prepared in a 96-well half-skirted PCR plate, 20 pL / well of antibody at 3.3 pg / mL concentration. The pooled beads were then added to the PCR plate, 40 pL of pooled beads per well and then incubated with the test panel antibodies for 45 minutes, room temperature, in the dark. Beads were again washed 2x with flow buffer on a magnet. Detection antibody (Jackson immunoresearch, Goat anti human-FITC) was then added at 5 pg / mL, 50 pL / well, for 15 minutes, room temperature, in the dark. Beads were again washed 2x with flow buffer on amagnet. Final resuspension of beads was performed with 50 L of flow buffer and then plates were read on a Luminex. The fluorescence data was analyzed using Microsoft Excel.
[0141] Results
[0142] Model generation
[0143] Previous germline rearrangement studies suggest that mouse models expressing a common light chain immune repertoire can be generated with minimal genetic engineering by following some guiding principles. First, complete replacement of the IGJK locus with the prearranged VK / JK segment may ensure that no additional J-segments are available downstream of the inserted VK / JK segment for secondary rearrangement, potentially leading to deletion of the prearranged segment at the kappa Iocus36. Furthermore, it may be beneficial to use a prearranged K / JK segment that does not likely lead to the development of selfrecognizing BCR, which would lead to receptor editing and potential replacement with a lambda light chain.
[0144] To select a particular prearranged IGKV / IGKJ germline combination for model generation, IGKV germline commonly used in the mouse immune repertoire was considered first, as large differences have been reported on how frequently different IGKV germlines are used in the immune repertoire. Furthermore, the selected IGKV germline should be able to pair with a variety of IGHV germlines. Different IGVK germline genes have been reported to show different levels of promiscuity in their heavy chain pairing behavior41 . Using a IGKV germline which pairs with a variety of heavy chains derived from different IGHV genes can increase the diversity of the heavy chain repertoire. In addition it may be important to ensure that the CDRs of the selected prearranged IGKV / IGKJ segment do not contain obvious sequence liabilities such as unpaired cysteine and N-glycosylation sites and the number of potential sequence liabilities (e.g., W, M-oxidations, deamidation) are minimized. Finally, as the model generates murine antibodies, it may be helpful for the prearranged IGKV / IGKJ sequence to be easy to humanize, i.e. , having a high sequence identity to a human IGKV germline, for example one that is frequently used in the development of human antibody drugs.
[0145] Based on these criteria, the IGKV10-96 / IGKJ1 combination was chosen in this example to generate a common light chain mouse (cLCM). IGKV10-96 is one of the highest expressed mouse IGKV germlines (4.2% in non-immunized repertoires)40,42. IGKV10-96 exhibits promiscuous pairing behavior with heavy chains derived from multiple IGHV germlines41. IGKV10-96 shares 75% sequence identity to human IGKV1-33 and IGKV1-27 germlines. Antibodies with light chains derived from human IGKV1-33 and IGKV1-27 account for 10.5% (87 antibodies) of therapeutic antibodies that are either approved or under therapeutic development based on the TheraSabDab database (FIG. 8). Finally, IGKJ1 segment was chosen as it is the most frequently used J-segment in mouse and most frequently pairs with IGKV10-9642. However, the CDR-L3 of a prearranged IGKV10-96 / IGKJ1 segment carries a tryptophan at position 96 (Chothia numbering) which might be a sequence liability as tryptophan is prone tooxidation which may negatively impact antibody binding. To reduce the chance of potential development issues for antibodies stemming from the cLCM, the tryptophan at position 96 was replaced in the prearranged IGKV10-96 / IGKJ1 segment with leucine, a prevalent residue at position 96 in both human and mouse antibodies. The resulting prearranged gene segment is referred to in this example as IGKV10-96 / IGKJ1-96L
[0146] The cLC mouse model was constructed in a C57BL / 6 background using a knock-in approach utilizing homologous recombination in which the IGKJ cluster is replaced by the prearranged VK10-96 / J1-96L segment (FIG. 1 , FIG. 9). This approach ensures that the VK10- 96 / J1-96L segment is embedded in its endogenous locus which should allow for transcriptional control and post-transcriptional processing similarly as in endogenous rearranged light chains.
[0017] B cell development in the common light chain mice
[0148] To understand if insertion of the prearranged IGKV10-96 / IGKJ1-96L segment impacts B cell development the serum concentration of kappa light chain, IgM, and IgG antibodies in homozygous cLCM was measured and compared to WT C57BL / 6 mice. Overall, cLCM did not significantly differ from WT C57BL / 6 mice in IgM and IgG antibody concentrations, while there was a slightly lower kappa antibody serum concentration in cLCM (FIGS. 2A-2C).
[0149] The immune response in the mice challenged with ovalbumin (OVA) was measured. Six weeks after immunization, similar serum antibody titers against OVA were detected in both WT C57BL / 6 and cLCM (FIG. 10). The phenotype of spleen B cells in the mice challenged with OVA was also characterized. Similar percentages of CD19+ B cells and OVA-specific B cells were observed in splenocytes from both WT and cLCM mice. In both cases, the majority of B cells (~90%) expressed the kappa LC, while decreased lambda LC expression was observed in the genetically modified mice. In addition, cells with a mature follicular phenotype (CD23+ / CD21 int) were also present at similar levels (> 60%) in cLCM and WT C57BL / 6 mice (FIGS. 11A-11D). The data suggests normal immune response in the cLC mouse model.
[0150] To further check the cLCM’s immune response to antigens other than OVA, the B cell development in cLCM challenged by two antigens in another cohort study was characterized (FIGS. 3A-3D). In this study, two WT C57BL / 6 mice were immunized with one human protein antigen (antigen A) and six cLCM were immunized with two different human protein antigens (antigen A and antigen B). Robust immune response was observed in the cLC mice challenged with both antigens (FIG. 3A). B cell development was evaluated by comparing the splenic, bone-marrow, and peritoneal B cell compartments in both C57BL / 6 and cLCM. ~90% of spleen B cells express a kappa light chain and that 50-70% of B cells are mature follicular (CD23+ / CD21 int) B cells among all immunized mice splenocytes (FIG. 3B). The presence of mostly mature B cells is also observed using (IgMIow / IgDhigh) markers. In addition, a similar percentage (6-8%) of transitional B cells (CD93+ / B220+) in the spleen across all cohorts was observed.
[0151] To further investigate if the IGKV10-96 / IGKJ1-96L has a negative effect on B cell ontogeny, early B cell compartments in bone marrow by flow cytometry with specific surface markers were studied, as shown in FIG. 30. The B220+ / CD43+ pre-B population was slightly increased, and conversely, small pre-B cell population was decreased, while the immature and mature B cells were not affected. The total B220+ / lgD+ recirculating mature B cells were similarly present in both cLCM and WT mice, and most recirculating B cells expressed the kappa LC. Overall, there is no gross B cell developmental arrest evident in the bone marrow of cLCM. Finally, B1 lymphocytes, a distinct innate-like subset of B cells, appeared to be unaffected in the genetically modified mice, as observed by CD5+ / B220- staining of peritoneal cavity B cells (FIG. 3D).
[0152] Immune Repertoire - Isotype and V gene usage
[0153] To compare the antibody repertoire of the cLCM with WT C57BL / 6 mice upon ovalbumin (OVA) immunization in detail, IgM- CD3- OVA+ lymphocytes and splenocytes were isolated from pooled tissue of six cLCMs and six WT mice, respectively, using FACS (FIGS. 12A and 12B). The paired heavy and light chain variable region sequences of the BCR from the two pools were obtained by single cell sequencing. In total, we obtained 3859 heavy and 3459 light chain sequences from cLCM tissue containing 3915 cells of which 2884 cells contained exactly one heavy and one light chain pair. B cells from C57BL / 6 mice yield 6149 heavy and 6427 light chain sequences from 6173 cells of which 2884 cells contained one heavy and one light chain pair.
[0154] The Ig subclass distribution of the sequenced antibodies of cLCM matches with the one obtained from WT mice (FIG. 4A). The two OVA+ repertoires are dominated by IgG antibodies, the majority being of the lgG2B and lgG2C isotypes, while approximately 10% of the antibodies belong to IgG 1. Apart from IgG, some IgA, IgD and IgM antibodies were observed. Light chain subclasses in both repertoires are dominated by IGKC chains (FIG. 4B). The percentages of lambda chain antibodies is low in both animals (2% in the WT pool, vs 0.02% in the cLCM pool). In summary, the heavy and light chain subclass analysis supports our FACS staining results (FIGS. 3A-3D) demonstrating that there is no large difference in B cell development in cLCM compared to C57BL / 6 WT mice.
[0155] Next, the VH and VL gene usage in the two pooled repertoires was analyzed. The WT light chain immune repertoire contains antibodies which are derived from 79 different VK genes and 3 VA genes (FIG. 4D). The most frequent K genes are IGKV10-96 (13.4%), IGKV14- 111(10.6%) and IGKV1-117 (5.4 %). In contrast, the light chain repertoire of the cLCM is dominated by light chains derived from IGKV10-96 (99.7 %). The result validates the cLCM model design and the choice of prearranged IGKV10-96 / J1-96L segment demonstrating successful light chain expression with minimal receptor editing as evident from the absence of any other IGKV chains and a very low percentage of IGLV derived antibodies.
[0156] Given that the cLCM repertoire consists only of IGKV10-96 derived light chains, the use of a single light chain that can restrict the heavy chain diversity was probed. The VH usage of the cLCM repertoire was therefore analyzed and compared to the WT repertoire. Interestingly, there are some differences between the two repertoires in the VH usage (Chi-squared test p- value: 3.163e-05). While the C57BL / 6 WT repertoire is dominated by antibodies derived from IGHV5-17, the most utilized VH germline in cLCM repertoire is IGHV1-64 (FIG. 4C). 79 VH germlines were observed in the WT repertoire and 76 VH germlines when the WT repertoire is randomly subsampled to the same size as the cLCM repertoire (which consists of 67 VH genes). However, using Gini coefficient as a measure of equality of VH gene usage shows that the distribution is similar between the subsampled WT repertoire and cLCM repertoire (0.72 and 0.74, respectively).
[0157] The VH portion of B cells from spleen and lymph nodes of the OVA immunized cLCM were further sequenced using an amplicon sequencing approach. (FIG. 13A and 13B). While this approach does not preserve heavy-light chain pairing and has a higher error rate due to the absence of barcodes, it allows us to obtain a deeper sequencing depth and comprehensively capture the VH gene usage of OVA+ and OVA- B cells in lymphocytes and spleen. In addition to the 67 VHs observed in the single cell sequencing approach, 27 additional VH genes were identified in the VH only repertoire sequencing dataset (two VH genes are unique to the 10x dataset). Overall, the data suggests that even though the cLCM repertoire is restricted to one VK germline, a diverse heavy chain repertoire is maintained as VH usage was observed from all VH families. In addition, a comparison between the VH gene usage of OVA+ antibodies from cLCM and WT mouse suggests that the cLCM can generate an antigen-specific heavy chain repertoire that is only slightly more restricted in terms of VH usage compared to a repertoire observed in C57BL / 6 WT mouse.
[0158] Immune Repertoire - Clonotype diversity
[0159] To investigate the diversity of the immune repertoire on clonal level a clonotype analysis of the IgM- CD3- OVA+ sorted heavy I light chain single cell sequence repertoires was performed. Using only cells which contain one heavy chain and one light chain sequence, clones derived from an identical VH and possessing an equivalent CDR-H3 length with a high sequence identity were grouped into the same clonotype (see Material and Methods for details). As the WT C57BL / 6 mouse immune repertoire contains significantly more sequences, the repertoire was down-sampled to the size of the cLCM for the subsequent statistical analysis. 704 clonotypes were identified in the WT repertoire which compares with 515 clonotypes in the downsampled cLCM repertoire, suggesting a higher diversity of the WT repertoire at the clonal level. This observation is in line with a visual inspection of the clonotype distribution depicting the downs cLCM repertoire contains larger clonotypes compared to the WT repertoire (FIG. 5A). Overall, the cLCM immune repertoire is skewed to larger clonotype sizes, for example the top ten clonotypes occupy 26% of the immune repertoire in contrast to 14% in the WT repertoire(FIG. 5B). Another common diversity metric that measures the number of clonotypes that occupy 50% of the immune repertoire (D50) confirms that the cLCM immune repertoire has lower diversity. The D50 for cLCM is 39, in contrast with 91 for the WT repertoire. In summary, while the clonotype diversity is lower than that in WT mice, the identification of more than 515 potential antigen-positive clonotypes in cLCM suggests that the model is suitable for antibody discovery.
[0160] Light chain mutation profile
[0161] For antibody discovery, it can be essential to understand the mutation profile of the light chain. Although cLCM immune repertoire is dominated by clones derived from a single prearranged VK / J combination (FIG. 4D), the B cells in the cLCM will undergo affinity maturation which will likely result in the accumulation of somatic mutation (SHM) in the common light chain. Especially, if those mutated positions are involved in antigen binding, pairing an identified heavy chain with a non-somatically mutated light chain (cLC) might result in a loss of affinity compared to the endogenous light chain. To investigate the degree the light chain accumulates somatic mutations, the mutation profile of the light chain at the amino acid level was analyzed using the single cell repertoire data from cLCM (FIGS. 6A and 6B). The mutation profile of the light chain of the cLCM was compared to the immune profile of IGKV10-96 / J1 light chains from WT C57BL / 6 mice as light chains derived from this germline combination (IGKV10- 96 / J1) constitute approximately 10% of the WT immune repertoire. Interestingly the cLCM light chain repertoire contains in average significantly fewer somatic mutations which result in an amino acid change compared to the IGKV10-96 / J1 chains in the WT repertoire (4.9 and 6.4 mutations per light chain, respectively; Wilcoxon Rank Sum test p-value < 2.2e-16) (FIGS. 6A and 6B).
[0162] The amino acid positions which are mutated by SHM are similar between cLCM and the WT mice. CDR-L1 positions 30-32 (Chothia numbering) and CDR-L3 positions 92-94 (Chothia numbering) are mutation hotspots in the CDRs and position 83 is a mutation hotspot in the framework region (FIGS. 6C and 6D, and FIGS. 14A and 14B). The result of the abovedescribed mutation frequency and profile is that 67% of all CDR-L1 , 61% of all CDR-L2 and 41% of all CDR-L3 in the cLCM repertoire contain at least one somatic mutation which results in an amino acid change, thus only 8% of all light chains contain no mutations in the CDR-L loops. These results suggest that for most clones the light chain is likely involved in antigen binding and pairing the heavy chain with the common light chain can impact antibody affinity.
[0163] Identification of OVA specific antibodies
[0164] The OVA-specific antibodies obtained from the cLCM and wild-type animals were compared to provide further evidence supporting cLCM as an effective tool for antibody discovery. Forty-eight clones from the OVA+ cLCM and from the WT B cell repertoire were selected for small-scale antibody expression. In both groups, antibodies were paired with their respective endogenous light chains; thus, the light chain of antibodies from cLCM containedsomatic mutations. In the initial screening step, successful antibody expression and binding to ovalbumin was confirmed by ELISA (FIG. 7A). Of the 48 antibodies from WT mice tested for expression, 47 antibodies showed sufficient expression levels, and 42 antibodies demonstrated binding to OVA in ELISA. Of the 48 antibodies from the cLCM tested, 43 antibodies showed expression and 39 antibodies showed OVA binding in ELISA. The kinetics and binding affinity of the OVA specific antibodies were further characterized using Biacore (FIG. 7B). Twenty-two antibodies from WT mice and 20 antibodies from cLCM showed binding to OVA in Biacore, exhibiting binding affinities (KD) ranging from 64 pM to 191 nM and 600 pM to 180 nM in the WT and cLCM group, respectively. Overall, the antibodies obtained from cLCM had lower median affinity than the antibodies obtained from the WT mice (Wilcoxon-rank-test, p-value 0.00064).
[0165] The binding activities of the cLCM antibodies were directly compared using the endogenous light chain (containing somatic mutations) with the binding activity of the same antibodies using the common light chain (no somatic mutations). The 48 antibodies from the cLCM that were initially paired with their endogenous light chain, were paired with the common light chain. All of 48 cLC clones expressed, and 23 out of 48 clones (~50%) were confirmed to bind OVA by ELISA, compared to 90% (39 out of 43) of antibodies which retained binding when paired with the endogenous light chain. The cLC antibodies which retained antigen binding in ELISA were further analyzed on Biacore. Fourteen antibodies showed binding to OVA in Biacore with binding affinities (KD) ranging from 850pM to 120 nM. There was no significant difference in binding affinity compared to those antibodies paired with their endogenous light chain (FIG. 7B, Wilcoxon-rank test). The results demonstrate that some antibody clones rely on somatic mutations in the light chain to maintain antibody binding to OVA.
[0166] Epitope Binning of WT and CLC antibodies
[0167] Besides affinity, another important metric to evaluate the cLCM’s suitability for therapeutic antibody discovery is the epitope diversity of the antibody discovered as a larger epitope diversity increases the chances of discovering antibodies which exhibit the desired activity.
[0168] For the purpose of evaluating the epitope bin coverage of the anti-OVA antibodies we carried out two separate epitope binning experiments. The initial experiment binned 24 anti-OVA antibodies obtained from WT mice in order to determine the epitope diversity obtained in these animals. Using a FACS based binning approach, we identified eight distinct epitope bins, bins A through G (FIG. 7C). One WT anti-OVA antibody was selected from each of the seven respective bins to serve as benchmark antibodies in the follow-up cLCM epitope binning experiment. In the follow-up experiment we used a panel of 43 cLC anti-OVA antibodies against the seven benchmark antibodies obtained from WT C57BL / 6 mice. We found that approximately half, 21 , of the cLC anti-OVA antibodies bin with one of the seven benchmark antibodies from the WT mice. The remaining 22 CLC antibodies appear to fall into new unresolved epitope bins(FIG. 7D). These results demonstrate that the cLCM is able to generate antibodies against similar epitopes as their WT counterparts.
Claims
CLAIMSWhat is claimed is:1 . A recombinant gene segment comprising a nucleic acid sequence encoding IGKV10-96 or a variant thereof transcriptionally linked to a nucleic acid sequence encoding IGKJ1 or a variant thereof.
2. The recombinant gene segment of claim 1 , wherein the recombinant gene segment is a murine gene segment.
3. The recombinant gene segment of any one of claims 1 or 2, wherein the recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKV.
4. The recombinant gene segment of any one of claims 1-3, wherein the recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKJ.
5. The recombinant gene segment of any one of claims 1-4, wherein the recombinant gene segment comprises nucleic acid sequence(s) encoding only the IGKV10-96 or variant thereof and the IGKJ1 or variant thereof.
6. The recombinant gene segment of any one of claims 1-5, wherein the recombinant gene segment is a nucleic acid sequence having at least 90%, at least 95%, at least 99%, or 100% identity to SEQ ID NO: 1.
7. The recombinant gene segment of any one of claims 1-5, wherein the recombinant gene segment is a nucleic acid sequence which encodes an amino acid sequence having at least 90%, at least 95%, at least 99% or 100% identity to SEQ ID NO: 4, 5, 6, 7, or 8.
8. A transgenic mouse, wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment of any one of claims 1-7.
9. A transgenic mouse, wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment comprising a nucleic acid sequence encoding IGKV10-96 or variant thereof transcriptionally linked to a nucleic acid sequence encoding IGKJ1 or a variant thereof.
10. The transgenic mouse of claim 9, wherein the recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKV.11 . The transgenic mouse of any one of claims 9-10, wherein the recombinant gene segment comprises exactly one nucleic acid sequence encoding an IGKJ.
12. The transgenic mouse of any one of claims 9-11 , wherein the recombinant gene segment comprises nucleic acid sequence(s) encoding only the IGKV10-96 or variant thereof and the IGKJ1 or variant thereof.
13. The transgenic mouse of any one of claims 9-12, wherein the recombinant gene segment is a nucleic acid sequence having at least 90%, at least 95%, at least 99%, or 100% identity to SEQ ID NO: 1.
14. The transgenic mouse of any one of claims 9-12, wherein the recombinant gene segment is a nucleic acid sequence which encodes an amino acid sequence having at least 90%, at least 95%, at least 99% or 100% identity to SEQ ID NOs: 4, 5, 6, 7 or 8.
15. A library of B cells expressing antibodies, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; optionally, wherein the library comprises at least 100 genetically distinct B cells.
16. A library of antibodies, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof; optionally, wherein the library comprises at least 100 genetically distinct antibodies.
17. The library of B cells of claim 15 or the library of antibodies of claim 15, wherein at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof.
18. The library of B cells of any one of claims 15 or 17, or the library of antibodies of any one of claims 16 or 17, wherein the common light chain antibodies further comprise IGKJ1 or a variant thereof.
19. The library of B cells of one of claims 15, 17, or 18, or the library of antibodies of one of claims 16-18, wherein at least 80% of the common light chain antibodies are an lgG2 isotype.
20. The library of B cells of claim 19 or the library of antibodies of claim 12, wherein the lgG2 isotype is lgG2B or lgG2C.21 . The library of B cells of one of claims 15 or 17-20, or the library of antibodies of one of claims 16-20, wherein the common light chain antibodies comprise a W96L mutation in CDR-H3.
22. The library of B cells of one of claims 15 or 17-21 , or the library of antibodies of one of claims 16-21 , wherein the antibodies are humanized.
23. A composition comprising a plurality of genetically distinct B cells that express genetically distinct antibodies, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or avariant thereof; optionally, wherein the composition comprises at least 100 genetically distinct B cells.
24. The composition of claim 23, wherein at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96 or a variant thereof.
25. The composition of any one of claims 23-24, wherein the common light chain antibodies further comprise IGKJ1 or a variant thereof.
26. The composition of any one of claims 23-25, wherein at least 80% of the common light chain antibodies are an lgG2 isotype.
27. The composition of any one of claims 23-26, wherein the lgG2 isotype is lgG2B or lgG2C.
28. The composition of any one of claims 23-27, wherein the common light chain antibodies comprise a W96L mutation in CDR-H3.
29. The composition of any one of claims 23-28, wherein the antibodies are humanized.
30. A method for producing a library of B cells expressing antibodies, the method comprising: a. immunizing a transgenic mouse wherein an IGKJ1-5 gene cluster endogenous to the mouse is replaced with a recombinant gene segment comprising a nucleic acid sequence encoding IGKV10-96 or a variant thereof transcriptionally linked to a nucleic acid sequence encoding IGKJ1 or a variant thereof, and b. isolating B cells from the transgenic mouse.
31. The method of claim 30, wherein at least 95% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising IGKV10-96.
32. The method of any one of claims 30 or 31 , wherein at least 99% of the antibodies are common light chain antibodies comprising a variable light chain (VL) comprising the encoded IGKV10-96 or variant thereof.
33. The method of any one of claims 30-32, wherein the common light chain antibodies further comprise the encoded IGKJ1 or variant thereof.
34. The method of any one of claims 30-33, wherein at least 80% of the common light chain antibodies are an lgG2 isotype.
35. The method of claim 34, wherein the lgG2 isotype is lgG2B or lgG2C.
36. The method of any one of claims 30-35, wherein the isolating B cells comprises enriching B cells from a single cell suspension prepared from a spleen or a lymph node harvested from the transgenic mouse.
37. The method of any one of claims 30-36, wherein the isolating B cells is performed at least 1 , at least 2, at least 3, at least 4, or at least 5 days after immunization.
38. The method of any one of claims 30-37, wherein the isolating B cells is performed at least 5 days after immunization.
39. The method of any one of claims 30-38, wherein the isolating is performed on the fifth day after immunization.