Crispr nuclease polypeptides and gene editing systems comprising such

Abstract

Engineered CRISPR nuclease polypeptides derived from a reference CRISPR nuclease set forth as SEQ ID NO: 1, wherein, relative to the reference nuclease, the engineered CRISPR nuclease polypeptide comprises (i) one or more mutations in the HNH nuclease domain or in the RuvC nuclease domain that reduce or eliminate the nuclease activity thereof; (ii) one or more arginine and / or lysine substitutions; and / or (iii) one or more mutations for reducing PAM recognition stringency.

Description

CRISPR NUCLEASE POLYPEPTIDES AND GENE EDITING SYSTEMS COMPRISING SUCHCROSS REFERENCE TO RELATED APPLICATIONSThis application claims the benefit of the filing dates of U.S. Provisional Application No. 63 / 580,193, filed September 1, 2023, U.S. Provisional Application No. 63 / 580,173, filed September 1, 2023, U.S. Provisional Application No. 63 / 553,840, filed February 15, 2024; U.S. Provisional Application No. 63 / 638,552, filed April 25, 2024. Each of the priority applications is incorporated by reference herein in their entities.SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been filed electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 27, 2024, is named 063586-524001WO_SeqList_ST26.xml and is 330.5 kilobytes in size.BACKGROUNDClustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR- associated (Cas) genes, collectively known as CRISPR-Cas or CRTSPR / Cas systems, are adaptive immune systems in archaea and bacteria that defend particular species against foreign genetic elements.A CRISPR-Cas system typically comprises a CRISPR nuclease and one or more RNA components that direct the CRISPR nuclease to a target genomic site for gene editing. It is of interest to develop efficient CRISPR nucleases to improve gene editing efficiency.SUMMARY OF THE INVENTIONThe present disclosure provides CRISPR nucleases and gene editing systems comprising such for use in genetical modification of target genes. In some embodiments, the CRISPR nuclease is an engineered CRISPR nuclease polypeptide that exhibits advantageous enzymatic activities (e.g., high indel activities and / or DNA cleavage activities). Accordingly, the gene editing systems comprising such as provided herein would be expected to show superior effectiveness when used in gene editing.Accordingly, provided herein are CRISPR nuclease polypeptides derived from reference CRISPR nuclease of SEQ ID NO: 1 e.g., an engineered CRISPR nucleasepolypeptide of SEQ ID NO: 1), gene editing systems comprising the CRISPR nuclease polypeptide and a guide RNA targeting a genomic site of interest, and uses of the gene editing system for modifying the genomic site of interest in host cells. In some instances, the CRISPR nuclease polypeptide disclosed herein is an engineered CRISPR nuclease polypeptide. In some instances, the engineered CRISPR nuclease polypeptide is an arginine and / or lysine substitution variant of the reference nuclease, which may exhibit enhanced bioactivities such as indel activities. In other instances, the engineered CRISPR nuclease polypeptide may be a nickase variant of the reference nuclease, wherein the variant nuclease has reduced or eliminated nuclease activity of one of the nuclease domains relative to the reference nuclease, thereby exhibiting nickase activity. In yet other instances, the engineered CRISPR nuclease polypeptide may comprise one or more mutations relative to the reference enzyme that lead to reduced PAM recognition stringency. In some examples, the engineered CRISPR nuclease polypeptide comprises an arginine / lysine substitution, a nickase mutation, and / or a mutation that leads to less PAM recognition stringency.In some aspects, the present disclosure provides an engineered CRISPR nuclease polypeptide, which is a variant of a reference CRISPR nuclease set forth as SEQ ID NO: 1. The reference nuclease of SEQ ID NO: 1 comprises a RuvC nuclease domain and an HNH nuclease domain. Relative to the reference CRISPR nuclease, the engineered CRISPR nuclease polypeptide comprises: (i) one or more mutations in the HNH nuclease domain or in the RuvC nuclease domain that reduce or eliminate the nuclease activity thereof; optionally wherein the one or more mutations are in the HNH nuclease domain; (ii) one or more arginine and / or lysine substitutions, optionally one or more arginine substitutions; or (iii) a combination of (i) and (ii).In some embodiments, the engineered CRISPR nuclease polypeptide may comprise one or more mutations in the HNH nuclease domain at positions D844, H845, and / or N868 relative to SEQ ID NO: 1. In some examples, the mutation is at position H845. In some instances, the one or more mutations in the HNH nuclease domain may be amino acid residue substitutions, e.g., at one or more of positions D844, H845, and N868. In one example, the mutation at D844 is an amino acid substitution, e.g., D844A, D844G, D844L, or D844S. In another example, the mutation at H845 is an amino acid substitution, e.g., H845A, H845G, H845L, or H845S. In one specific example, the engineered CRISPR nuclease polypeptide comprises a mutation at position H845 (e.g., H845A) relative to SEQ ID NO: 1 e.g., comprising the amino acid sequence of SEQ ID NO: 32). In yet another example, the mutation at N868 is an amino acid substitution, e.g., N868A, N868G, N868L, or N868S.In some embodiments, the CRISPR nuclease polypeptide disclosed herein may comprise one or more nickase mutations (e.g., amino acid residue substitutions) in the RuvC nuclease domain, for example, at positions DIO, E763, and / or D991 relative to SEQ ID NO: 1. In some examples, the mutation may be at position E763 or D991.Alternatively or in addition, the engineered CRISPR nuclease polypeptide may comprise a bridge helix (BH) domain, a nucleic acid recognition (REC) domain, a phosphate lock loop (PLL), a wedge (WED) domain, and a PAM-interacting (PID) domain, and comprise one or more arginine and / or lysine substitutions (e.g., arginine substitutions) in the BH domain, in the REC domain, in the PLL domain, in the WED domain, in the PID domain, or a combination thereof. In some embodiments, the engineered CRISPR nuclease polypeptide may contain up to 20 arginine and / or lysine substitutions relative to the reference CRISPR nuclease. For example, the engineered CRISPR nuclease polypeptide may contain up to 15 arginine and / or lysine substitutions relative to the reference CRISPR nuclease. In specific examples, the one or more arginine and / or lysine substitutions can be at positions K736, L784, Q812, N813, 1857, and / or A919 of SEQ ID NO: 1. For example, in some embodiments, the CRISPR nuclease comprises an 1857R substitution.In specific examples, the engineered CRISPR nuclease polypeptide may contain the arginine and / or lysine substitutions at the following positions relative to SEQ ID NO: 1:(a) 1857, L784, and K736 (e.g., I857R, L784R, K736R);(b) 1857, A919, and K736 (e.g., I857R, A919R, K736R);(c) 1857, N813, and L784 (e.g., I857R, N813R, L784R);(d) 1857, L784, and A919 (e.g., I857R, L784R, A919R);(e) 1857, N813, and K736 (e.g., I857R, N813R, K736R);(f) 1857 and N813 (e.g., I857R, N813R);(g) L784, A919, and K736 (e.g., L784R, A919R, K736R);(h) 1857 and L784 (e.g., I857R and L784R); or(i) 1857 and A919 (e.g., I857R and A919R). More specifically, the engineered CRISPR nuclease polypeptide may contain arginine substitutions I857R, L784R, and K736R relative to SEQ ID NO: 1.In some embodiments, the engineered CRISPR nuclease polypeptide disclosed herein may comprise one or more mutations that enhance double-strand nuclease activity relative to the reference CRISPR nuclease, in which the mutations are introduced. Examples of such CRISPR nuclease polypeptide are provided in Table 8 below.Alternatively or in addition, the engineered CRISPR nuclease polypeptide disclosedherein may comprise or further comprise the one or more mutations for reducing PAM recognition stringency. In some instances, the one or more mutations for reducing PAM recognition stringency may be at position D61, A68, H494, LI 117, DI 144, SI 145, G1227, E1228, S1327, A1332, R1343, R1345, and / or T1347 of SEQ ID NO: 1. In some examples, such mutations may comprise: (i) one or more arginine and / or lysine substitutions, optionally arginine substitutions, at position D61, A68, H494, LI 117, G1227, SI 327, A1332, and / or T1347 of SEQ ID NO: 1; (ii) one or more amino acid substitutions at position DI 144, S I 145, El 228, R1343, and / or R1345, of SEQ ID NO: 1 ; or (iii) a combination of (i) and (ii). In specific examples, the one or more amino acid substitutions of (ii) may comprise optionally D1144L, S1145W, E1228Q, R1343P, R1345V, and / or R1345Q relative to SEQ ID NO: 1.In specific examples, the engineered CRISPR nuclease polypeptide with less PAM recognition stringency may comprise the following combination of mutations: LI 117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and A68R relative to SEQ ID NO: 1. In other specific examples, the engineered CRISPR nuclease polypeptide with less PAM recognition stringency may comprise the following combination of mutations: LI 117R, DI 144V, G1227R, E1228F, A1332R, R1345V,T1347R, and D61R relative to SEQ ID NO: 1. In yet other specific examples, the engineered CRISPR nuclease polypeptide with less PAM recognition stringency may comprise the following combination of mutations: LI 117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and H494R relative to SEQ ID NO: 1. Other exemplary engineered CRISPR nuclease polypeptides can be found in Table 9, each of which is within the scope of the present disclosure.The engineered CRISPR nuclease polypeptide as disclosed herein recognize a PAM sequence of 5’-NDR-3’, in which N represents A, C, G, or U, D represents A, G, or T, and R represents G or A. In some instances, the engineered CRISPR nuclease polypeptides having reduced PAM recognition stringency as disclosed herein may recognize a PAM sequence of 5’-NGN-3.’ See Example 6 below. In some examples, the PAM is 5’-NRG-3’ or 5’-NRR-3’, in which N and R are defined herein. In some specific examples, the PAM is 5’-NGG-3’, in which N represents any nucleotide. In other specific examples, the PAM can be 5 ’-TGC-3’ or 5’-GGA-3’.Any of the CRISPR nuclease polypeptides may comprise the arginine and / or lysine substitutions disclosed herein, any of the nickase mutations in either the HNH or RuvC nuclease domains also disclosed herein, any of the mutations leading to reduced PAM recognition stringency, or a combination thereof. For example, the CRISPR nuclease polypeptide may comprise (a) the one or more nickase mutations in the HNH nucleasedomain at positions D844, H845, and / or N868 relative to SEQ ID NO: 1 (e.g., the mutation is at position H845); and (b) one or more arginine and / or lysine substitutions relative to SEQ ID NO: 1 (e.g., at positions 1857, L784, and K736). For example, in some examples, the CRISPR nuclease polypeptide may comprise (e.g., consists of) a nickase mutation at position H845 (e.g., an H845A mutation) and an arginine and / or lysine substitution at position 1857 (e.g., an I857R substitution) relative to SEQ ID NO: 1. In other examples, the CRISPR nuclease polypeptide may comprise or further comprise the one or more mutations that result in reduced PAM recognition stringency (e.g., at positions LI 1 17, DI 144, G1227, El 228, A1332, R1345, and / or T1347 of SEQ ID NO: 1, and optionally at one or more positions of D61, A68, and H494 of SEQ ID NO: 1).In some embodiments, the engineered CRISPR nuclease polypeptide provided herein may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 1. In some examples, the engineered CRISPR nuclease polypeptide may comprise an amino acid sequence at least 95% identical to SEQ ID NO: 1. In specific examples, the engineered CRISPR nuclease polypeptide may comprise an amino acid sequence at least 98% identical to SEQ ID NO: 1.Any of the engineered CRISPR nuclease polypeptides may comprise the arginine and / or lysine substitutions disclosed herein, any of the mutations in either the HNH or RuvC nuclease domains also disclosed herein, or a combination thereof.In some embodiments, the engineered CRISPR nuclease polypeptide disclosed herein can be a fusion polypeptide, which may further comprise one or more functional fragments. In some embodiments, the one or more functional fragments may comprise one or more nuclear localization signals (NLSs), one or more peptide linkers, or a combination thereof. The one or more NLS may be located at the N-terminus, at the C-terminus, or both.In another aspect, the present disclosure features a nucleic acid, comprising a nucleotide sequence encoding the engineered CRISPR nuclease polypeptide disclosed herein. In some embodiments, the nucleic acid is an expression vector, in which the nucleotide sequence encoding the engineered CRISPR nuclease polypeptide is in operable linkage to a promoter. In other embodiments, the nucleic acid is a messenger RNA (mRNA). Also within the scope of the present disclosure is a host cell comprising the nucleic acid that encodes the engineered CRISPR nuclease polypeptide as disclosed herein.In addition, the present disclosure features a gene editing system, comprising: (a) a CRISPR nuclease polypeptide or a first nucleic acid encoding the CRISPR nuclease. The CRISPR nuclease polypeptide comprises an amino acid sequence at least 90% identical to areference CRISPR nuclease, which is set forth as SEQ ID NO: 1 ; and (b) a guide RNA (gRNA), or a second nucleic acid encoding the gRNA. The gRNA comprises a scaffold recognizable by the engineered CRISPR nuclease polypeptide and a spacer sequence specific to a target sequence within a genomic site of interest. The target sequence is upstream to a protospacer motif (PAM).In some embodiments, the CRISPR nuclease polypeptide is any of the engineered CRISPR nuclease polypeptides disclosed herein.In some embodiments, the scaffold may comprise a nucleotide sequence at least 85% identical to SEQ ID NO: 2. In some examples, the scaffold comprises SEQ ID NO: 2. Alternatively, the scaffold comprises one or more deletions, one or more nucleotide substitutions, or a combination thereof, as compared with SEQ ID NO: 2.Further, the present disclosure provides a gene editing method, comprising delivering the gene editing system as disclosed herein a host cell to edit a genomic site targeted by the gRNA of the gene editing system. In some embodiments, the host cell is cultured in vitro. In other embodiments, the host cell is located in a subject who needs the gene editing and the gene editing system is administered to the subject via a suitable route.The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.BRIEF DESCRIPTION OF THE DRAWINGSThe following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to the drawing in combination with the detailed description of specific embodiments presented herein.FIG. 1 is a diagram showing gene editing efficacy of the reference CRISPR nuclease SEQ ID NO: 1 on exemplary target genes AAVS1, EMX1, and VEGFA.FIGs. 2A-2D include gel images showing quantification of nuclease activities. FIG. 2A: a gel image captured using a 700 nm channel showing in vitro cleavage of the target strand (labelled on the 5’ end with an IR700 dye) of the target DNA substrate by the reference CRISPR nuclease, putative HNH-knockout nickases, or putative RuvC-knockout nickases. FIG. 2B: a gel image captured using an 800 nm channel showing in vitro cleavage of the non-target strand (labelled on the 5 ’ end with IR800) of the target DNA substrate bythe reference CRISPR nuclease, putative HNH-knockout nickases, or putative RuvC- knockout nickases. FIG. 2C: Overlaid images captured using 700 nm and 800 nm channels of FIG. 2 A and FIG. 2B. FIG. 2D: Quantification of the percent of cleaved target and nontarget DNA generated by the reference CRISPR nuclease, the putative HNH-knockout nickases, and the putative RuvC-knockout nickases tested in Example 3.DETAILED DESCRIPTION OF THE INVENTIONProvided herein are CRISPR nuclease polypeptides derived from the reference CRISPR nuclease of SEQ ID NO: 1. Such a CRISPR nuclease polypeptide may comprise the reference nuclease or a variant thereof as disclosed herein. The variant CRISPR nuclease polypeptides may comprise one or more mutations (e.g., arginine and / or lysine substitutions, optionally arginine substitutions) relative to the reference CRISPR nuclease. Alternatively or in addition, the variant CRISPR nuclease polypeptide may comprise one or more mutations in either the RuvC nuclease domain or the HNH nuclease domain. Such mutations (nickase mutations) may reduce or eliminate the nuclease activity of either the RuvC or the HNH nuclease domain, leading to a variant exhibiting nickase activity. As used herein, the term “nickase” refers to an enzyme that cuts one strand of a double- stranded DNA at a specific recognition nucleotide sequence (e.g., the target sequence disclosed herein). A nickase may interact with one strand of the DNA duplex to produce DNA molecules that are cut at one strand (a.k.a., nicked). In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated HNH domain. In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated RuvC domain. In other embodiments, the variant CRISPR nuclease polypeptide may comprise one or more mutations relative to SEQ ID NO: 1 that result in reduced PAM recognition stringency as compared with a counterpart CRISPR nuclease polypeptide without such mutations. Any of the variant CRISPR nuclease polypeptides disclosed herein may share a high sequence homology relative to the reference CRISPR nuclease (e.g., at least 85% sequence identity).The variant CRISPR nuclease polypeptides provided herein are expected to possess advantageous features relative to the reference CRISPR nuclease, for example, exhibiting nickase activity and / or higher nuclease activity, etc. As such, the variant CRISPR nuclease polypeptides disclosed herein would be expected to exhibit improved gene editing relative to the reference CRISPR nuclease, e.g., higher efficiency and accuracy in gene editing involving strand replacement.Alternatively or in addition, the CRISPR nuclease polypeptides may be fusionpolypeptides comprising a CRISPR nuclease (e.g., SEQ ID NO: 1 or a variant thereof) and one or more additional functional fragments such as those described herein (e.g., nuclease localization signal or NLS). In addition to the advantageous features noted above, the fusion polypeptides possess additional functions attributable to the fusion partners.Accordingly, the present disclosure provides CRISPR nuclease polypeptides derived from the reference CRISPR nuclease of SEQ ID NO: 1 (e.g., SEQ ID NO: 1 or a variant thereof), gene editing systems comprising such, and gene editing methods using such.I. CRISPR Nuclease PolypeptidesAs used herein, the term “CRISPR nuclease” refers to an RNA-guided effector that is capable of binding a nucleic acid and introducing a single-stranded break or double-stranded break. A CRISPR nuclease typically comprises multiple functional domains, e.g., nuclease domains (e.g. , RuvC and HNH), bridge helix (BH) domain, nucleic acid recognition (REC) domain, phosphate lock loop (PLL), wedge domain (WED), PAM-interacting domain (PID), or a combination thereof. As used herein, the term “domain” refers to a distinct functional and / or structural unit of a polypeptide. In some instances, a functional domain may be linear. In other instances, a functional domain can be discontinuous and conformational. In some embodiments, a domain may comprise a conserved amino acid sequence across different CRISPR nucleases.The reference CRISPR nuclease of SEQ ID NO: 1 (see Table 1 below) is a CRISPR nuclease that comprises both a RuvC nuclease domain (located at residues 1-59, 722-771, and 927-1101 of SEQ ID NO: 1) and a HNH domain (located at residues 772-926 of SEQ ID NO: 1). The RuvC nuclease domain and the HNH nuclease domain coordinate cleavage of the DNA strand adjacent to the 5 ’-NRG- 3’ PAM motif, in which N represents any nucleotide and R represents A or G. In some embodiments, the PAM motif is 5’-NGG-3’. Positions DIO, E763 and D991 are deemed the active sites in the RuvC domain and positions D844, H845, and N868 are deemed the active sites in the HNH domain. In addition to the nuclease domains, the reference CRISPR nuclease of SEQ ID NO: 1 also includes a BH domain (residues 60-93 of SEQ ID NO: 1), a REC domain (residues 94-721 of SEQ ID NO: 1), a PLL domain (residues 1102-1148 of SEQ ID NO: 1), a WED domain (residues 1 149-1208 of SEQ ID NO: 1), and a PID domain (residues 1209-1378 of SEQ ID NO: 1).(A) Variants of CRISPR Nuclease PolypeptideThe variant CRISPR nuclease polypeptides provided herein are derived from thereference CRISPR nuclease of SEQ ID NO: 1, e.g., via introducing one or more mutations to the reference CRISPR nuclease to modulate (e.g., enhance or reduce) one or more activities of the nuclease. As used herein, the term “variant CRISPR nuclease polypeptide” refers to a CRISPR nuclease polypeptide comprising an alteration, e.g., a substitution, insertion, deletion and / or fusion, at one or more residue positions, compared to the reference CRISPR nuclease (SEQ ID NO: 1).The variant CRISPR nuclease polypeptides may comprise one or more mutations (e.g., arginine substitutions) relative to the reference CRISPR nuclease. Alternatively or in addition, the variant CRISPR nuclease polypeptide may comprise one or more mutations in either the RuvC nuclease domain or the HNH nuclease domain. Such mutations may reduce or eliminate the nuclease activity of either the RuvC or the HNH nuclease domain, leading to a variant exhibiting nickase activity. The variant CRISPR nuclease polypeptides may share a high sequence homology relative to the reference CRISPR nuclease (e.g., at least 85% sequence identity).As used herein, the term “nickase” refers to an enzyme that cuts one strand of a double-stranded DNA at a specific recognition nucleotide sequence (e.g., the target sequence disclosed herein). A nickase may interact with one strand of the DNA duplex to produce DNA molecules that are cut at one strand (a.k.a., nicked). In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated HNH domain. In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated RuvC domain. In other embodiments, the variant CRISPR nuclease polypeptide may comprise one or more mutations relative to SEQ ID NO: 1 that result in reduced PAM recognition stringency as compared with a counterpart CRISPR nuclease polypeptide without such mutations. The variant CRISPR nuclease polypeptides may share a high sequence homology relative to the reference CRISPR nuclease (e.g. , at least 85% sequence identity).In some embodiments, the variant CRISPR nuclease polypeptides provided herein, relative to the reference CRISPR nuclease SEQ ID NO: 1, comprises one or more mutations in either the RuvC nuclease domain or the HNH nuclease domain (e.g., in the HNH nuclease domain) to reduce or eliminate the nuclease activity, and / or comprises one or more arginine and / or lysine substitutions to improve nuclease features suitable for use in gene editing.The variant CRISPR nuclease polypeptides provided herein are expected to exhibit one or more modulated activities (e.g., enhanced or reduced) relative to the reference CRISPR nuclease. As used herein, the term “activity” refers to a biological activity. In some embodiments, activity includes enzymatic activity, e.g., catalytic ability of an effector. Forexample, activity can include nuclease activity such as double-strand nuclease activity. In some embodiments, activity includes nickase activity. For example, the variant CRISPR nuclease polypeptides may cut substantially at only one strand of the target DNA duplex.In some embodiments, activity includes binding activity, e.g., binding of an effector (e.g., a CRISPR nuclease) to an RNA guide and / or target nucleic acid. In some examples, the variant CRISPR nuclease polypeptides disclosed herein have an enhanced binding to a cognate guide RNA (gRNA) as compared with the reference CRISPR nuclease, e.g., having a binding activity at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 2-fold, 5-fold, 10-fold, or greater than that of the reference CRISPR nuclease. A cognate gRNA refers to a gRNA having a scaffold recognizable by the CRISPR nuclease.In some examples, the variant CRISPR nuclease polypeptides disclosed herein have an enhanced enzymatic activity relative to the reference CRISPR nuclease, e.g., having an enzymatic activity at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 2- fold, 5-fold, 10- fold, or greater than that of the reference CRISPR nuclease. In other examples, the variant CRISPR nuclease polypeptides disclosed herein have a decreased enzymatic activity (e.g., the enzymatic activity for cleaving both strands of a target DNA duplex) relative to the reference CRISPR nuclease, e.g., having an enzymatic activity at least 20%, 30%, 40%, 50%, 60%, or 70% lower than that of the reference CRISPR nuclease. In some instances, the decreased enzymatic activity is achieved by reducing the nuclease activity of the RuvC domain. In other instances, the decreased enzymatic activity is achieved by reducing or diminishing the nuclease activity of the HNH domain.In some instances, the variant CRISPR nuclease polypeptides disclosed herein have enhanced indel activity relative to the reference CRISPR nuclease. As used herein, the term “indel activity” refers to the ability of a CRISPR nuclease to introduce an indel (insertion / deletion) into a sequence (e.g., a genomic target). For example, in some embodiments, the CRISPR nuclease introduces a double-strand break into a sequence (e.g., a genomic target in a cell), and through DNA repair mechanisms, an indel is created.In some embodiments, the variant CRISPR nuclease polypeptide provided herein share a high sequence homology relative to the reference CRISPR nuclease. For example, the variant CRISPR nuclease polypeptide may comprise an amino acid sequence at least 70% (e.g., at least 80%, 85%, 90%, 95%, or higher) identical to SEQ ID NO: 1. In some instances, the variant CRISPR nuclease polypeptide may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 1. In some instances, the variant CRISPR nuclease polypeptide may comprise an amino acid sequence at least 95% identical to SEQ ID NO: 1. In other instances,the variant CRISPR nuclease polypeptide may comprise an amino acid sequence at least 97% e.g., 98%, 99%, 99.5%, or greater) identical to SEQ ID NO: 1.The “percent identity” (a.k.a., sequence identity) of two nucleic acids or of two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength-12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, word length=3 to obtain amino acid sequences homologous to the protein molecules of the invention. Where gaps exist between two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.The variant CRISPR nuclease polypeptide provided herein can contain one or more alterations relative to the reference CRISPR nuclease of SEQ ID NO: 1, e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, fusion, or a combination thereof. In some instances, the alterations may be introduced into the BH domain, the PLL domain, the WED domain, the PID domain, or a combination thereof.In some embodiments, the variant CRISPR nuclease polypeptide provided herein may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof, relative to SEQ ID NO: 1. “Arginine substitutions” or “lysine substitution” refers to the replacement of a non-arginine or non-lysine residue in SEQ ID NO: 1 with an arginine or lysine residue. In some examples, the variant CRISPR nuclease polypeptide may contain up to 20 arginine and / or lysine substitutions, e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine and / or lysine substitutions. In specific examples, the variant CRISPR nuclease polypeptide may contain 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine and / or lysine substitutions.In some instances, one or more of the substituting arginine residues may be replaced by a conservative amino acid residue such as lysine or histidine. In some embodiments, the variant CRISPR nuclease polypeptide provided herein may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof.In some instances, the arginine and / or lysine substitutions e.g., arginine substitutions)may be located in the BH domain, in the PLL domain, in the WED domain, in the PID domain, or in any of the combination thereof. In some examples, the variant CRISPR nuclease polypeptide may contain one or more arginine and / or lysine substitutions at one or more of positions: 179, E331, Y348, S473, F501, 1581, D720, A730, G731, Q741, V752, M753, Q809, Q840, Q849, S872, S898, E982, K918, D985, Y986, Y1015, E1037, K1091, S1094, P1096, N1099, T1104, E1105, 11106, T1108, LI 117, K1131, 11147, E1179, M1205, P1208, E1214, A1226, Q1230, A1236, P1238, F1241, L1281, D1284, F1285, A1292, N1295, KI 298, G1329, Al 333, KI 344, SI 348, QI 360, and 11370 of SEQ ID NO: 1. In specific examples, the arginine and / or lysine substitutions (e.g., combination of arginine substitutions) can be at one or more of positions K736, L784, N813, Q812, 1857, and A919 of SEQ ID NO: 1.In some specific examples, the variant CRISPR nuclease polypeptide may contain one or more arginine substitutions of I79R, E331R, Y348R, S473R, F501R, I581R, D720R, A730R, G731R, Q741R, V752R, M753R, Q809R, Q840R, Q849R, S872R, S898R, E982R, K918R, D985R, Y986R, Y1015R, E1037R, K1091R, S1094R, P1096R, N1099R, T1104R, El 105R, Il 106R, T1 108R, LI 117R, KI 131R, 11147R, El 179R, M 1205R, P1208, E1214R, A1226R, Q1230R, A1236R, P1238R, F1241R, L1281R, D1284R, F1285R, A1292R, N1295R, K1298R, G1329R, A1333R, K1344R, S1348R, Q1360R, and I1370R relative to SEQ ID NO: 1.In some examples, the variant CRISPR nuclease polypeptide may contain one or more arginine substitutions at one or more of the above-noted positions. Examples include I857R, N813R, L784R, A919R, Q812R, or a combination thereof. In other examples, the variant CRISPR nuclease polypeptide may contain one or more lysine substitutions at one or more of the above-noted positions. Examples include I857K, N813K, L784K, A919K, Q812K, or a combination thereof.In other examples, the variant CRISPR nuclease polypeptide may contain a combination of arginine and lysine substitutions at: 179, E331, Y348, S473, F501, 1581, D720, A730, G731, Q741, V752, M753, Q809, Q840, Q849, S872, S898, E982, K918, D985, Y986, Y1015, E1037, K1091, S1094, P1096, N1099, T1104, El 105, Il 106, T1108, LI 117, KI 131 , 11147, E1179, M1205, P1208E1214, A1226, Q1230, A1236, P1238, F1241, L1281, D1284, F1285, A1292, N1295, K1298, G1329, A1333, K1344, S1348, Q1360, and / or 11370 of SEQ ID NO: 1. In specific examples, the variant CRISPR nuclease polypeptide may contain a combination of arginine and lysine substitutions (e. ., combination of arginine substitutions) at 1857, K736, L784, N813, Q812, 1857, and / or A919 of SEQ ID NO: 1.In some examples, the variant CRISPR nuclease polypeptide may contain one or more arginine substitutions at one or more of the above-noted positions. Examples include I857R, N813R, L784R, K736R, A919R, Q812R, or a combination thereof.In specific examples, the engineered CRISPR nuclease polypeptide may contain the arginine and / or lysine substitutions at the following positions relative to SEQ ID NO: 1: (a) 1857, L784, and K736; (b) 1857, A919 and K736; (c) 1857, N813, and L784; (d) 1857, L784, and A919; (e) 1857, N8I3, and K736; (f) 1857 and N813; (g) L784, A919, and K736; (h) 1857, and L784; or (i) 1857 and A919. In some instances, the engineered CRISPR nuclease polypeptide may contain arginine substitutions at any of the combinations of positions in SEQ ID NO: 1. In one specific example, the engineered CRISPR nuclease polypeptide may contain arginine substitutions I857R, L784R, and K736R relative to SEQ ID NO: 1. Other examples of arginine and / or lysine substitutions can be found in Table 7 below.Alternatively or in addition, the variant CRISPR nuclease polypeptide provided herein may comprise one or more mutations within either the RuvC or the HNH nuclease domain to reduce or eliminate the nuclease activity of the target domain, thereby producing a variant with nickase activity. Such mutations (nickase mutations) may be deletions, insertions, amino acid substitutions, or a combination thereof. In some embodiments, the mutations within either the RuvC or the HNH nuclease domain are amino acid substitutions, of which the substituting amino acid residue is not a conservative substitution of the native amino acid residue at the position of the mutation. For example, if the native amino acid residue is R, the substituting residue can be any amino acid residue except for K. Similarly, if the native amino acid residue is K, the substituting residue can be any amino acid residue except for R. Groups of conservative amino acid residue substitutions are provided herein.In some instances, the one or more nickase mutations may be within the HNH nuclease domain, for example, at D844, H845, and / or N868 of SEQ ID NO: 1. In some examples, the mutations may be amino acid residue substitutions and the native amino acid residues in SEQ ID NO: 1 may be replaced by an amino acid residue not of the same type as the native residues. For example, a positively charged residue may be replaced by a noncharged amino acid residue, or vice versa. In some examples, the amino acid residue substitution at D844 may be D844G, D844A, D844L, or D844S. In one specific example, the mutation can be D844A. In another example, the amino acid residue substitution at H845 may be H845G, H845A, H845I, H845L, H845M, H845V, or H845S. In one example, the engineered CRISPR nuclease is a nickase mutant comprising (e.g., consisting of) a residue substitution at position H845 (e.g., H845A) relative to SEQ ID NO: 1. In one specificexample, the mutation at position H845 can be H845A. Alternatively or in addition, the amino acid residue substitution may be at position N868, for example, N868G, N868A, N868L, or N868S. In one example, the mutation at position N868 is N868A.In some instances, the one or more mutations may be with the RuvC nuclease domain, for example, at position DIO, E763, D991, or a combination thereof, of SEQ ID NO: 1 (e.g. , at position E763 and / or D991). In some examples, the mutations may be amino acid residue substitutions and the native amino acid residues in SEQ ID NO: 1 may be replaced by an amino acid residue not of the same type as the native residues. For example, a positively charged residue may be replaced by a non-charged amino acid residue, or vice versa. In some examples, the amino acid residue substitution at DIO may be D10G, D10A, DIOL, or DIOS. In some examples, the amino acid residue substitution at E763 may be E763G, E763A, E765L, or E763S. Alternatively or in addition, the amino acid residue substitution at D991 may be D991G, D991A, D991L, or D991S.In some examples, the variant CRISPR nuclease polypeptide provided herein may be a nickase variant, which comprises one or more mutations in one nuclease domain (e.g. , the HNH nuclease domain such as at position H845, e.g., H845A). Exemplary nickase variants are provided in Table 4 below. Such a nickase variant may further comprise one or more arginine or lysine substitutions e.g., arginine substitutions) for enhancing certain features, such as indel activities. Exemplary arginine and / or lysine substitutions are provided herein, for example, at one or more of positions I857R, K736, L784, N813, Q812, 1857, and A919 of SEQ ID NO: 1 (e.g., the arginine substitutions at positions 1857, L784, and K736). In some examples, the CRISPR nuclease polypeptide may comprise (e.g., consists of) a nickase mutation at position H845 (e.g., an H845A mutation) and an arginine and / or lysine substitution at position 1857 (e.g., an I857R substitution).In some examples, the variant CRISPR nuclease polypeptide disclosed herein exhibits enhanced double-strand nuclease activity. Examples of such CRISPR nuclease polypeptides are provide in Table 8 below, each of which is within the scope of the present disclosure.In some embodiments, the engineered CRISPR nuclease polypeptide disclosed herein may comprise one or more mutations that reduce stringency of PAM recognition relative to the reference CRISPR nuclease. In some instances, the one or more mutations for reducing PAM recognition stringency may be at position of LI 117, DI 144, SI 145, G1227, E1228, S1327, A1332, R1343, R1345, and / or T1347 of SEQ ID NO: 1. In some examples, the one or more mutations may comprise: (i) one or more arginine and / or lysine substitutions, optionally arginine substitutions, at position LI 117, G1227, S1327, A1332, and / or T1347 of SEQ IDNO: 1 ; (ii) one or more amino acid substitutions at position DI 144, SI 145, E1228, R1343, and / or R1345, of SEQ ID NO: 1; or (iii) a combination of (i) and (ii).In some examples, such a variant CRISPR nuclease polypeptide may contain mutations (e.g., amino acid residue substitutions) at position D61 (e.g., D61R or D61K), LI 117 (e.g. , LI 117R or LI 117K), DI 144 e.g. , DI 144V, DI 144A, DI 144G, or DI 144S), SI 145 (e.g., S1145W, S1145Y, or S1145F), G1227 (e.g., G1227K or G1227R), E1228 (e.g., E1228F, E1228Y, or EI228W), A1327 (e.g., A1327R or A1332K), AI332 (e.g., A1332R or A1332K), R1345 (e.g., R1345Q or R1345N), R 1345 (e.g., R1345V, R1345A, R1345G, or R1345S, or R1345Q, R1345N), T1347 (e.g., T1347R or T1347K), or a combination thereof in SEQ ID NO: 1.In specific examples, the one or more amino acid substitutions of (ii) may comprise D1144L, S1145W, E1228Q, R1343P, R1345V and / or R1345Q relative to SEQ ID NO: 1. Alternatively, the substituting amino acid residues at one or more of positions Dl l 14, SI 145, E1228, R1343, and R1345, may be a conservative substitution of L, W, Q, P, V, and Q, respectively. For example, the substitutions at position DI 114 may be DI 114M, Dl l 141, or D1114V. The substitutions at position SI 145 may be S1145F or S1145Y. The substitutions at position E1228 may be E1228N. The substitutions at position R1345 may be R1345M, R1345I, R1345L, or R1345N. Specific examples of such variant CRISPR nuclease polypeptides are provided in Table 9, each of which is within the scope of the present disclosure.In some specific examples, the engineered CRISPR nuclease polypeptide comprises (or consists of) LI 117R, DI 144V, G1227R, E1228F, A1332R, R1345V, and T1347R relative to SEQ ID NO: 1. Such CRISPR nuclease polypeptide has the amino acid sequence set forth in SEQ ID NO: 130.In some examples, the engineered CRISPR nuclease polypeptide disclosed herein (e.g., those having mutations at positions L1117, D1144, G1227, E1228, A1332, R1343, R1345, and / or T1347) may further comprise one or more single arginine substitutions (e.g., a single arginine substitution) at position D61, A68, H494, L64, S410, T67, Q849, G1110, F501, T659, L784, Y516, G55, E1037, N57, D720, A919, A1294, Q812, N700, H657, T73, Q899, 1857, K751, D327, 1581, D462, E331, A589, D471, 1699, N1295, T470, 11147, E130, S473, A353, K40, K334, A60, S1348, K367, A1118, K31, Q349, K341, Q83, K585, Q840, G660, K527, G727, Y42, L1281, L122, Q123, T1108, E41, KI 131, K30, S872, 11206, DI 132, K460, L80, E459, KI 182, M696, K918, K126, N721, Q809, K1091, K736, K783, N498, K723, Hl 119, F463, L594, D472, K744, E365, G595, K45, Y348, K964, SI 181,N813, D407, S839, Y658, E586, G754, A730, ¥1015, D903, A1333, S461, or H1359 relative to SEQ ID NO: 130.In some specific examples, the engineered CRISPR nuclease polypeptide comprises L1117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and A68R relative to SEQ ID NO: 1. In other specific examples, the engineered CRISPR nuclease polypeptide comprises L1117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and D61R relative to SEQ ID NO: 1. In still other specific examples, the engineered CRISPR nuclease polypeptide comprises L11 17R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and H494R relative to SEQ ID NO: 1.In some instances, the variant CRISPR nuclease polypeptide exhibiting less stringent recognition of PAM sequences may recognize 5 ’-NGN-3’, 5’-NRN-3’, or 5’-NYN-3’ PAM sequences, in which N represents any nucleotide, R represents A or G, and Y represents C or T.In some examples, the variant CRISPR nuclease polypeptide may comprise one or more of the mutations disclosed herein (e.g., one or more arginine and / or lysine substitutions, one or more nickase mutations, and / or one or more mutations resulting less PAM recognition stringency).Any of the variant CRISPR nuclease polypeptides disclosed herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 1.In some instances, the variant CRISPR nuclease polypeptide may comprise one or more conservative amino acid residue substitutions, in addition to the mutations in the HNH or RuvC nuclease domain, the arginine / lysine substitutions, and / or the mutations that result in reduced PAM recognition stringency.As used herein, a “conservative amino acid substitution’’ refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references which compile such methods, e.g., Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.Exemplary CRISPR nuclease polypeptides for use in the gene editing systems provided herein are disclosed in Tables 1, 4, 8, and 9 below, each of which is within the scope of the present disclosure.In some embodiments, the variant CRISPR nuclease polypeptide may be a fusion polypeptide comprising a CRISPR nuclease and one or more additional functional moieties. As used herein, the terms “fusion” and “fused” refer to the joining of at least two nucleotide or protein molecules. For example, “fusion” and “fused” can refer to the joining of at least two polypeptide domains that are encoded by separate genes in nature. The fusion can be an N-terminal fusion, a C-terminal fusion, or an intramolecular fusion. In some aspects, the domains are transcribed and translated to produce a single polypeptide. In some instances, the CRISPR nuclease portion in the fusion polypeptide may be the reference CRISPR nuclease of SEQ ID NO: 1. Alternatively, the CRISPR nuclease portion in the fusion polypeptide may be a variant CRISPR nuclease derived from SEQ ID NO: 1 as those disclosed herein.Exemplary additional functional moieties to include in the fusion polypeptide include a peptide tag, a fluorescent protein, a base-editing domain, a DNA methylation domain, a histone residue modification domain, a localization factor, a transcription modification factor, a light-gated control factor, a chemically inducible factor, a chromatin visualization factor, or a combination thereof.In some embodiments, the additional functional moiety may comprise a nuclear localization signal (NLS), a nuclear export signal (NES), or a combination thereof. In some examples, the fusion polypeptide may comprise an NLS, which may be located at either the N-terminus or the C-terminus. In specific examples, the fusion polypeptide may comprise a first NLS located at the N-terminus and a second NLS located at the C-terminus. The first and second NLS fragments may be identical. Alternatively, the two NLS fragments may be different. In some embodiments, the fusion polypeptide may comprise an NLS near the N- terminus and / or near the C-terminus (e.g., within about 1, 2, 3, 4, or 5 of the first amino acid or last amino acid of the CRISPR nuclease). In some embodiments, the fusion polypeptide may comprise an NLS within a flexible loop of the CRISPR nuclease.In some embodiments, the additional functional moiety may be a flexible peptide linker, for example, an XTEN peptide linker, or a G / S rich peptide linker. Examples of such peptide linkers are provided in Example 1 below.In some embodiments, the gene editing system provided herein may comprise the CRISPR nuclease polypeptide, which may form a ribonucleoprotein (RNP) complex with thecognate guide RNA. As used herein, the term “complex” refers to a grouping of two or more molecules. In some embodiments, the complex comprises a polypeptide and a nucleic acid molecule interacting with (e.g., binding to, coming into contact with, adhering to) one another.In other embodiments, the gene editing system provided herein may comprise a nucleic acid encoding the CRISPR nuclease polypeptide. In some examples, the nucleotide sequence encoding the CRISPR nuclease polypeptide described herein can be codon- optimized for use in a particular host cell or organism. For example, the nucleic acid can be codon-optimized for any non-human eukaryote including mice, rats, rabbits, dogs, livestock, or non-human primates. Codon usage tables are readily available, for example, at the “Codon Usage Database” available at the world wide web site of kazusa.orjp / codon / and these tables can be adapted in a number of ways. See Nakamura et al. Nucl. Acids Res. 28:292 (2000), which is incorporated herein by reference in its entirety. Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, PA). In some examples, the nucleic acid encoding the CRISPR nuclease polypeptides as disclosed herein can be an mRNA molecule, which can be codon optimized. Exemplary codon-optimized nucleotide sequences encoding exemplary CRISPR nuclease polypeptides can be found in Tables 1 and 4 below, any of which is within the scope of the present disclosure.In some examples, the gene editing system may comprise a vector (e.g., a viral vector such as an AAV vector, an AdV vector, or a retroviral vector) encoding the CRISPR nuclease polypeptide.B. Preparation of Variant CRISPR Nuclease PolypeptidesThe variant CRISPR nuclease polypeptides as disclosed herein may be prepared by conventional methods or the methods disclosed herein. For example, the variant CRISPR nuclease polypeptides can be prepared by culturing host cells such as bacteria cells or mammalian cells, capable of producing the nuclease polypeptides, isolating the nuclease polypeptides thus produced, and optionally, purifying the nuclease polypeptides. The variant CRISPR nuclease polypeptides thus prepared may be complexed with a gRNA.The variant CRISPR nuclease polypeptides can be also prepared by an in vitro coupled transcription-translation system and optionally complexes with gRNA. Bacteria that can be used for preparation of the variant CRISPR nuclease polypeptides are not particularly limited as long as they can produce the variant CRISPR nuclease polypeptides. Somenonlimiting examples of the bacteria include E. coli cells described herein.Unless otherwise noted, all compositions and complexes and polypeptides provided herein are made in reference to the active level of that composition or complex or polypeptide, and are exclusive of impurities, for example, residual solvents or by-products, which may be present in commercially available sources. Enzymatic component weights are based on total active protein. All percentages and ratios are calculated by weight unless otherwise indicated. All percentages and ratios are calculated based on the total composition unless otherwise indicated. In the exemplified composition, the enzymatic levels are expressed by pure enzyme by weight of the total composition and unless otherwise specified, the ingredients are expressed by weight of the total compositions.(i) VectorsThe present disclosure provides vectors for expressing the variant CRISPR nuclease polypeptides. In some embodiments, a vector disclosed herein includes a nucleotide sequence encoding variant CRISPR nuclease polypeptides. In some embodiments, the vector comprises a Pol II promoter or a Pol III promoter.Expression of natural or synthetic polynucleotides is typically achieved by operably linking a polynucleotide encoding the variant CRISPR nuclease polypeptides to a promoter and incorporating the construct into an expression vector. The expression vector is not particularly limited as long as it includes a polynucleotide encoding the variant CRISPR nuclease polypeptides and can be suitable for replication and integration in eukaryotic cells.Typical expression vectors include transcription and translation terminators, initiation sequences, and promoters useful for expression of the desired polynucleotide. For example, plasmid vectors carrying a recognition sequence for RNA polymerase (pSP64, pBluescript, etc.), may be used. Vectors including those derived from retroviruses such as lentivirus are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. The expression vector may be provided to a cell in the form of a viral vector.Viral vector technology is well known in the art and described in a variety of virology and molecular biology manuals. Viruses useful as vectors include, but are not limited to phage viruses, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one ormore selectable markers.The kind of the vector is not particularly limited, and a vector that can be expressed in host cells can be appropriately selected. To be more specific, depending on the kind of the host cell, a promoter sequence to ensure the expression of the polypeptide(s) from the polynucleotide is appropriately selected, and this promoter sequence and the polynucleotide are inserted into any of various plasmids etc. for preparation of the expression vector.Additional promoter elements, e.g., enhancing sequences, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-1 10 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.Further, the disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.The expression vector to be introduced can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate transcriptional control sequences to enable expression in the host cells. Examples of such a marker include a dihydrofolate reductase gene and a neomycin resistance gene for eukaryotic cell culture; and a tetracycline resistance gene and an ampicillin resistance gene for culture of E. coll and other bacteria. By use of such a selection marker, it can be confirmed whether the polynucleotide encoding the polypeptide(s) of the present invention has been transferred into the host cells and then expressed without fail.The preparation method using recombinant expression vectors is not particularly limited, and examples thereof include methods using a plasmid, a phage or a cosmid.(ii) Methods of ExpressionThe present disclosure includes a method for protein expression, comprising translating the variant CRISPR nuclease polypeptides described herein.In some embodiments, a host cell described herein is used to express the variant CRISPR nuclease polypeptides. The host cell is not particularly limited, and various known cells can be preferably used. Specific examples of the host cell include bacteria such as E. coli, yeasts (budding yeast, Saccharomyces cerevisiae, and fission yeast, Schizosaccharomyces pombe), nematodes (Caenorhabditis elegans), Xenopus laevis oocytes, and animal cells (for example, CHO cells, COS cells and HEK293 cells). The method for transferring the expression vector described above into host cells, i.e., the transformation method, is not particularly limited, and known methods such as electroporation, the calcium phosphate method, the liposome method and the DEAE dextran method can be used.After a host is transformed with the expression vector, the host cells may be cultured, cultivated or bred, for production variant CRISPR nuclease polypeptides. After expression, the host cells can be collected and variant CRISPR nuclease polypeptides purified from the cultures etc. according to conventional methods (for example, filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).A variety of methods can be used to determine the level of production of a mature variant CRISPR nuclease polypeptide in a host cell. Such methods include, but are not limited to, for example, methods that utilize either polyclonal or monoclonal antibodies specific for the proteins or a labeling tag as described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), fluorescent immunoassays (FIA), and fluorescence activated cell sorting (FACS). These and other assays are well known in the art (See, e.g., Maddox et al., J. Exp. Med. 158:1211

[1983] ).The present disclosure provides methods of in vivo expression of variant CRISPR nuclease polypeptides (and optionally the gRNA in the gene editing system disclosed herein). Such a method may comprise providing a polyribonucleotide encoding the variant CRISPR nuclease polypeptide to a host cell in a subject (e.g., a human subject) wherein the polyribonucleotide encodes the variant CRISPR nuclease polypeptide expressing the variant CRISPR nuclease polypeptide from the cell.IL Gene Editing SystemIn some aspects, the present disclosure provides gene editing systems with enhanced gene editing efficiencies. The gene editing system comprises any of the variant CRISPRnuclease polypeptides disclosed herein or a nucleic encoding the CRISPR nuclease and one or more guide RNAs (gRNAs) or nucleic acid(s) encoding the gRNAs.A. CRISPR NucleaseIn some embodiments, the gene editing system disclosed herein comprises a variant CRISPR nuclease polypeptide as provided herein, e.g., a variant CRISPR nuclease polypeptide comprising one or more arginine or lysine substitutions, one or more mutations in one of the nuclease domains such as in the HNH nuclease domain, or a combination thereof. See above disclosures. Such a protein component may form a complex with the gRNA(s) in the same gene editing system.Alternatively, the gene editing system comprises a nucleic acid encoding the CRISPR nuclease polypeptide. In some instances, the nucleic acid can be an expression vector e.g., a viral vector) for producing the encoded nuclease polypeptide in host cells. In some instances, the expression vector may further comprise a coding sequence for producing one or more gRNAs of the gene editing system. In other examples, the nucleic acid encoding the CRISPR nuclease polypeptide may be a messenger RNA (mRNA) molecule. In some instances, the mRNA molecule may further comprise a coding sequence for the gRNA of the gene editing system.B. Guide RNAsThe gene editing system disclosed herein further comprises one or more gRNAs or nucleic acid(s) encoding such. As used herein, the terms “RNA guide”, “RNA guide sequence,” or “guide RNA (gRNA)” refer to an RNA molecule or a modified RNA molecule that facilitates the targeting of a CRISPR nuclease described herein to a genomic site of interest. For example, an RNA guide can be a molecule that comprises a spacer sequence and a scaffold sequence. The spacer sequence recognizes e.g., binds to) a site in a non-PAM strand that is complementary to a target sequence in the PAM strand, e.g., designed to be complementary to a specific nucleic acid sequence. The scaffold sequence contains a nuclease binding sequence for binding to the CRISPR nuclease. In some embodiments, the scaffold is an RNA sequence.In some instances, the gRNA disclosed herein may further comprise a linker sequence, a 5’ end and / or 3’ end protection fragment, or a combination thereof.(i) Spacer SequencesAs used herein, the term “spacer” and “spacer sequence” (a.k.a., a DNA-bindingsequence) is a portion in an RNA guide that is the RNA equivalent of the target sequence (a DNA sequence). The spacer contains a sequence capable of binding to the non-PAM strand via base-pairing at the site complementary to the target sequence (which is in the PAM strand). Such a spacer is also known as specific to the target sequence. In some instances, the spacer may be at least 75% identical to the target sequence (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%), except for the RNA-DNA sequence difference. In some instances, the spacer may be 100% identical to the target sequence except for the RNA-DNA sequence difference.The gene editing system disclosed herein comprises one or more gRNAs, each comprising a spacer for targeting a genomic site of interest and a scaffold, which is recognizable by the variant CRISPR nuclease polypeptide contained in the gene editing system. The target sequence can be adjacent to a protospacer adjacent motif (PAM) of 5’- NDR-3’, in which N represents any nucleotide, D represents A, G, or T, and R represents G or A. In some instances, the PAM is 5’-NRG-3’, in which N represents any nucleotide and R represents A or G. In some instances, the PAM is 5’-NRR-3’, in which N represents any nucleotide and R represents A or G. Alternatively, the PAM may be 5’ -NGN-3’, in which N represents any nucleotide (A, C, G, or U). In some specific examples, the PAM motif is 5’- NGG-3’ in which N represents any nucleotide. The PAM motif is located on the 3’ end of the target sequence. As used herein, the term “protospacer adjacent motif’ or “PAM sequence” refers to a DNA sequence adjacent to a target sequence. In some embodiments, a PAM sequence is required for binding of the CRISPR nuclease and / or indel activity. In a doublestranded DNA molecule, the strand containing the PAM motif is called the “PAM-strand” and the complementary strand is called the “non-PAM strand.” The gRNA binds to a site in the non-PAM strand that is complementary to a target sequence disclosed herein, and the PAM sequence as described herein is present in the PAM-strand. The PAM motif can be located upstream to the target sequence.As used herein, the term “adjacent to” refers to a nucleotide or amino acid sequence in close proximity to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if no nucleotides separate the two sequences ( / .<?., immediately adjacent). In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides separate the two sequences (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides). In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. Insome embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by up to 2 nucleotides, up to 5 nucleotides, up to 8 nucleotides, up to 10 nucleotides, up to 12 nucleotides, or up to 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by 2-5 nucleotides, 4-6 nucleotides, 4-8 nucleotides, 4-10 nucleotides, 6-8 nucleotides, 6-10 nucleotides, 6-12 nucleotides, 8-10 nucleotides, 8-12 nucleotides, 10-12 nucleotides, 10-15 nucleotides, or 12-15 nucleotides. In specific examples, the target sequence (corresponding to the spacer sequence) is immediately adjacent to the PAM motif.A spacer sequence as disclosed herein may have a length of from about 15 nucleotides to about 30 nucleotides. For example, the spacer sequence can have a length of from about 15 nucleotides to about 20 nucleotides, from about 15 nucleotides to about 25 nucleotides, from about 20 nucleotides to about 25 nucleotides, or from about 20 nucleotides to about 30 nucleotides. In some embodiments, the spacer in the gRNA may be generally designed to have a length of between 15 and 25 nucleotides (e.g. , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25) and be complementary to a specific target sequence. In some embodiments, the spacer sequence may be designed to have a length of between 18-22 nucleotides (e.g., 20 nucleotides).In some embodiments, the spacer sequence may have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a target sequence as described herein and is capable of binding to the complementary region of the target sequence via basepairing.In some embodiments, the spacer sequence comprises only RNA bases. In some embodiments, the spacer sequence comprises a DNA base (e.g., the spacer comprises at least one thymine). In some embodiments, the spacer sequence comprises RNA bases and DNA bases (e.g. , the DNA-binding sequence comprises at least one thymine and at least one uracil).( ii ) Scaffold SequenceThe scaffold sequence in the gRNA is recognizable by the variant CRISPR nuclease polypeptide also in the gene editing system. In some instances, the scaffold sequence comprises SEQ ID NO: 2, which is the cognate scaffold for the reference CRISPR nuclease of SEQ ID NO: 1.GUUUUAGAGCUGUGCUGAAAAGCACAGCACGUUAAAAUAAGGCAGUGA UUGAAAAAUCCAGUCCGUAUUCAGCUUGAAAAAGUGAGCACCGAAUCG GUGCUU (SEQ ID NO: 2)In other instances, the scaffold sequence may be a variant derived from SEQ ID NO: 2. Such a variant scaffold sequence may comprise a nucleotide sequence at least 80% (e.g., at least 85%, 90%, 95%, 98%, or greater) identical to SEQ ID NO: 2. Alternatively or in addition, the variant scaffold sequence may comprise deletions, nucleotide substitutions, or a combination thereof. The variant CRISPR nuclease polypeptide may have increased binding to the variant scaffold sequence as compared with the scaffold of SEQ ID NO: 2. In some examples, the variant scaffold may be a fragment of SEQ ID NO: 2 or a variant thereof as disclosed herein. For example, the variant scaffold for use in the gRNAs provided herein may have a length ranging from 100-150.In a gRNA, the scaffold may be located at the 3’ end of the spacer. In some instances, the scaffold and spacer are connected directly. In other instances, the scaffold and spacer may be connected via a nucleotide linker.C. Modification of Nucleic AcidsAny of the RNA components in a gene editing system as disclosed herein, e.g., the editing template RNA, the gRNA, the RT donor RNA, may include one or more modifications.Exemplary modifications can include any modification to the sugar, the nucleobase, the internucleoside linkage e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone), and any combination thereof. Some of the exemplary modifications provided herein are described in detail below.The gRNA or any of the nucleic acid sequences encoding components of the composition may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). One or more atoms of a purine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications may bemodifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof). Additional modifications are described herein.In some embodiments, the modification may include a chemical or cellular induced modification. For example, some nonlimiting examples of intracellular RNA modifications are described by Lewis and Pan in “RNA modifications and structures cooperate to guide RNA-protein interactions” from Nat Reviews Mol Cell Biol, 2017, 18:202-210.Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in the sequence. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) may be located at any position(s) of the sequence, such that the function of the sequence is not substantially decreased. The sequence may include from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e. any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%>, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%).In some embodiments, sugar modifications (e.g., at the 2’ position or 4’ position) or replacement of the sugar at one or more ribonucleotides of the sequence may, as well as backbone modifications, include modification or replacement of the phosphodiester linkages. Specific examples of a sequence include, but are not limited to, sequences including modified backbones or no natural internucleoside linkages such as internucleoside modifications, including modification or replacement of the phosphodiester linkages. Sequences having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, a sequence will include ribonucleotides with a phosphorus atom in its intemucleoside backbone.Modified sequence backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3 ’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’ -3 ’ or 2’-5’ to 5’-2’. Various salts, mixed salts and free acid forms are also included. In some embodiments, the sequence may be negatively or positively charged.The modified nucleotides, which may be incorporated into the sequence, can be modified on the intemucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another intemucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).The a-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.In specific embodiments, a modified nucleoside includes an alpha-thio-nucleoside e.g., 5’-O-(l-thiophosphate)-adenosine, 5’-( -(l-thiophosphate)-cytidine (a-thio-cytidine), 5’-<?-(l-thiophosphate)-guanosine, 5’-O-(l-thiophosphate)-uridine, or 5’-O-(l- thiophosphatej-pseudouridine).Other intemucleoside linkages that may be employed according to the present invention, including intemucleoside linkages which do not contain a phosphorous atom, are described herein.In some embodiments, the sequence may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into sequences, such as bifunctional modification. Cytotoxic nucleoside may include, but are not limited to, adenosine arabinoside, 5- azacytidine , 4’-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, l-(2-C-cyano-2-deoxy-beta-D-arabino- pentofuranosyl)-cytosine, decitabine, 5 -fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-l-(tetrahydrofuran-2-yl)pyrimidine- 2,4(1 H,3H)-dione), troxacitabine, tezacitahine, 2’-deoxy-2’-methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl- 1 - beta-D-arabinofuranosylcy tosine, N4-octadecyl- 1 -beta-D-arabinofuranosylcy tosine, N4- palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5’ -elaidic acid ester).In some embodiments, the sequence includes one or more post- transcriptional modifications (e.g. , capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, I. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197) In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of pyridin-4-one ribonucleoside, 5- aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5 -hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1 -methyl-pseudouridine, 4-thio-l -methyl -pseudouridine, 2-thio-l-methyl- pseudouridine, 1 -methyl- 1 -deaza-pseudouridine, 2-thio- 1 -methyl- 1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2- thio-pseudouridine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2- thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio-l- methyl-l-deaza-pseudoisocytidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-l- methyl-pseudoisocytidine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 2-aminopurine, 2, 6-diaminopurine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2- aminopurine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1- methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In some embodiments, mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza- guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7- deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6- methoxy-guanosine, 1 -methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8- oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio- guanosine, and N2,N2-dimethyl-6-thio-guanosine.The sequence may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally-occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU) may or may not be uniformly modified in the sequence, or in a given predetermined sequence region thereof. In some embodiments, the sequence includes a pseudouridine. In some embodiments, the sequence includes an inosine, which may aid in the immune system characterizing the sequence as endogenous versus viral RNAs. The incorporation of inosine may also mediate improved RNA stability / reduced degradation. See for example, Yu, Z. et al. (2015) RNA editing by AD ARI marks dsRNA as “self’. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.In some embodiments, any RNA sequence described herein, such as an editing template RNA, may comprise an end modification (e.g., a 5’ end modification or a 3’ end modification). In some embodiments, the end modification is a chemical modification. In some embodiments, the end modification is a structural modification. See disclosures herein.When a gene editing system disclosed herein comprises nucleic acids encoding theCRISPR nuclease and / or the RT polypeptide, e.g., mRNA molecules, such nucleic acid molecules may contain any of the modifications disclosed herein, where applicable.III. Gene Editing MethodsAny of the gene editing systems can be used to genetically modify (edit) a target nucleic acid, which can be a genetic site of interest, e.g., a genetic site where genetic editing is needed, for example, to fix a genetic mutation, to introduce a protective mutation, to introduce modifications for modulating expression of a gene, etc.The gene editing systems and compositions disclosed herein are applicable for editing and introducing edits into a variety of target sequences. In some embodiments, the target sequence is a DNA molecule, such as a DNA locus (referred to herein as a target sequence or an on-target sequence). The target sequence is adjacent to the PAM motif. In some instances, the PAM motif is 5’ to the target sequence. In some embodiments, the target nucleic acid is a genomic site in a cell. In some instances, the target nucleic acid where the genetic edit would occur can be in a protein-coding region. Alternatively, the target nucleic acid may be in a regulatory region, such as a promoter, enhancer, a 5’ or 3’ untranslated region. In other instances, the target nucleic acid can be in a non-coding gene, such as transposon, miRNA, tRNA, ribosomal RNA, ribozyme, or lincRNA.A. Gene EditsAny of the gene editing systems disclosed herein may be used to edit a target gene of interest, e.g. , a gene involved in a disease (e.g., a genetic disease). In some embodiments, the target gene can be one that is involved in an immune response in a subject. For example, the target gene can be an immune checkpoint gene or a tumor necrosis factor receptor superfamily member. The gene edit may occur in an exon e.g., in a coding region). Alternatively, the gene editing may occur in an intron or in a regulatory element (e.g., promoter, enhancer, inhibitory element, etc.). In some instances, the gene edit may result in reducing or eliminating the expression of the target gene. In other instances, the gene edit may result in enhancing expression of the target gene (e.g., disrupting an inhibitory factor).In some aspects, provided herein are methods for introducing at least one edit into a target nucleic acid (e.g. , a genomic site of interest such as in any of the target genes disclosed herein) using the gene editing system described herein.As used herein, the term “edit” refers to one or more modifications introduced into a nucleotide sequence in a target nucleic acid such as in a genomic site of interest. The editmay occur within a target sequence as defined herein. Alternatively, the edit may occur outside the target sequence (e.g., adjacent to the target sequence). The edit can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof.Deletion refers to a loss of a nucleotide or nucleotides in a nucleic acid sequence, relative to a reference sequence. No particular process is implied in how to make a sequence comprising a deletion. For instance, a sequence comprising a deletion can be synthesized directly from individual nucleotides. In other embodiments, a deletion is made by providing and then altering a reference sequence. The nucleic acid sequence can be in a genome of an organism. The nucleic acid sequence can be in a cell. The nucleic acid sequence can be a DNA sequence. The deletion can be a frameshift mutation or a non- frameshift mutation. A deletion described herein refers to an insertion of up to several kilobases.Insertion refers to a gain of a nucleotide or nucleotides in a nucleic acid sequence, relative to a reference sequence. No particular process is implied in how to make a sequence comprising an insertion. For instance, a sequence comprising an insertion can be synthesized directly from individual nucleotides. In other embodiments, an insertion is made by providing and then altering a reference sequence. The nucleic acid sequence can be in a genome of an organism. The nucleic acid sequence can be in a cell. The nucleic acid sequence can be a DNA sequence. The insertion can be a frameshift mutation or a non- frameshift mutation. An insertion described herein refers to an insertion of up to several kilobases.In some embodiments, the gene editing methods disclosed herein may introduce indels (e.g., insertions, deletions, or a combination thereof) at the target genetic site. In some examples, the indels may occur within about 1-10 nucleotides, 10-30 nucleotides, 30-50 nucleotides, 50-100 nucleotides, 100-200 nucleotides, 200-300 nucleotides, 300-400 nucleotides, or 400-500 nucleotides upstream of the PAM sequence. Alternatively, or in addition, the indels may occur within about 1-10 nucleotides, 10-30 nucleotides, 30-50 nucleotides, 50-100 nucleotides, 100-200 nucleotides, 200-300 nucleotides, 300-400 nucleotides, or 400-500 nucleotides downstream of the PAM sequence.In some embodiments, the indels may start at the PAM sequence. In some embodiments, the indels may start within about 1-30 nucleotide downstream of the PAM. Alternatively, the indels may start within about 1-30 nucleotide upstream of the PAM.B. Gene Editing in CellsIn some aspects, provided herein are methods for editing a genomic site of interest e.g., a target gene as disclosed herein) in cells using any of the gene editing systemsdisclosed herein. To perform this method, the gene editing system can be delivered to or introduced into a population of cells. In some instances, cells comprising the desired genetic editing may be collected and optionally cultured and expanded in vitro.The cell described herein can be a variety of cells. In some embodiments, the cell is an isolated cell. In some embodiments, the cell is in cell culture or a co-culture of two or more cell types. In some embodiments, the cell is ex vivo. In some embodiments, the cell is obtained from a living organism and maintained in a cell culture. In some embodiments, the cell is a single-cellular organism.In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell or derived from a bacterial cell. In some embodiments, the cell is an archaeal cell or derived from an archaeal cell.In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a plant cell or derived from a plant cell. In some embodiments, the cell is a fungal cell or derived from a fungal cell. In some embodiments, the cell is an animal cell or derived from an animal cell. In some embodiments, the cell is an invertebrate cell or derived from an invertebrate cell. In some embodiments, the cell is a vertebrate cell or derived from a vertebrate cell. In some embodiments, the cell is a mammalian cell or derived from a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a zebra fish cell. In some embodiments, the cell is a primate cell. In some embodiments, the cell is a rodent cell. In some embodiments, the cell is synthetically made, sometimes termed an artificial cell.In some embodiments, the cell is derived from a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, HEK293T, MF7, K562, HeLa, CHO, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, the cell is an immortal or immortalized cell. In some embodiments, the cell is a stem cell such as a totipotent stem cell e.g., omnipotent), a pluripotent stem cell, a multipotent stem cell, an oligopotent stem cell, or an unipotent stem cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC) or derived from an iPSC. In some embodiments, the cell is a mesenchymal stem cell. In some embodiments, the cell is an embryonic stem cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is a differentiated cell. For example, in some embodiments, the differentiated cell is a muscle cell (e.g., a myocyte), a fat cell (e.g., an adipocyte), a bone cell (e.g., an osteoblast, osteocyte, osteoclast), a blood cell(e.g., a monocyte, a lymphocyte, a neutrophil, an eosinophil, a basophil, a macrophage, a erythrocyte, or a platelet), a nerve cell (e.g., a neuron), an epithelial cell, an immune cell (e.g., a lymphocyte, a neutrophil, a monocyte, or a macrophage), a liver cell (e.g., a hepatocyte), a fibroblast, or a sex cell. In some embodiments, the cell is a terminally differentiated cell. For example, in some embodiments, the terminally differentiated cell is a neuronal cell, an adipocyte, a cardiomyocyte, a skeletal muscle cell, an epidermal cell, or a gut cell. In some embodiments, the cell is a glial cell. In some embodiments, the cell is a pancreatic islet cell, including an alpha cell, beta cell, delta cell, or enterochromaffin cell. In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is a B cell. In some embodiments, the immune cell is a Natural Killer (NK) cell. In some embodiments, the immune cell is a Tumor Infiltrating Lymphocyte (TIL). In some embodiments, the cell is a mammalian cell, e.g., a human cell or primate cell or a murine cell. In some embodiments, the murine cell is derived from a wildtype mouse, an immunosuppressed mouse, or a disease-specific mouse model. In some embodiments, the cell is a cell within a living tissue, organ, or organism.In some embodiments, the cell is a primary cell. For example, cultures of primary cells can be passaged 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, 15 times or more. In some embodiments, the primary cells are harvest from an individual by any known method. For example, leukocytes may be harvested by apheresis, leukocytapheresis, density gradient separation, etc. Cells from tissues such as skin, muscle, bone marrow, spleen, liver, pancreas, lung, intestine, stomach, etc. can be harvested by biopsy. An appropriate solution may be used for dispersion or suspension of the harvested cells. Such solution can generally be a balanced salt solution, (e.g., normal saline, phosphate-buffered saline (PBS), Hank's balanced salt solution, etc.), conveniently supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration. Buffers can include HEPES, phosphate buffers, lactate buffers, etc. Cells may be used immediately, or they may be stored (e.g., by freezing). Frozen cells can be thawed and can be capable of being reused. Cells can be frozen in a DMSO, serum, medium buffer (e.g., 10% DMSO, 50% serum, 40% buffered medium), and / or some other such common solution used to preserve cells at freezing temperatures.In embodiments wherein a gene editing system disclosed herein is introduced into a plurality of cells, at least about 0.5% of the cells comprise the desired edit. In some embodiments, at least about 1% of the cells comprise the desired edit. In some embodiments, at least about 2% of the cells comprise the desired edit. In some embodiments, at least about3% of the cells comprise the desired edit. In some embodiments, at least about 4% of the cells comprise the desired edit. In some embodiments, at least about 5% of the cells comprise the desired edit. In some embodiments, at least about 10% of the cells comprise the desired edit. In some embodiments, at least about 20% of the cells comprise the desired edit. In some embodiments, at least about 30% of the cells comprise the desired edit. In some embodiments, at least about 40% of the cells comprise the desired edit. In some embodiments, at least about 50% of the cells comprise the desired edit.The cells carrying the desired genetic edit, e.g., produced by the method disclosed herein using any of the gene editing systems also disclosed herein, are also within the scope of the present disclosure. In some instances, the cells modified by the CRISPR nuclease polypeptide disclosed herein may be useful as an expression system to manufacture biomolecules. For example, the modified cells may be useful to produce biomolecules such as proteins (e.g., cytokines, antibodies, antibody-based molecules), peptides, lipids, carbohydrates, nucleic acids, amino acids, and vitamins. In other embodiments, the modified cell may be useful in the production of a viral vector such as a lentivirus, adenovirus, adeno- associated virus, and oncolytic virus vector. In some embodiments, the modified cell may be useful in cytotoxicity studies. In some embodiments, the modified cell may be useful as a disease model. In some embodiments, the modified cell may be useful in vaccine production. In some embodiments, the modified cell may be useful in therapeutics. For example, in some embodiments, the modified cell may be useful in cellular therapies such as transfusions and transplantations.In some embodiments, the cells modified by the variant CRISPR nuclease polypeptide as disclosed herein may be useful to establish a new cell line comprising a modified genomic sequence. In some embodiments, a modified cell of the disclosure is a modified stem cell (e.g., a modified totipotent / omnipotent stem cell, a modified pluripotent stem cell, a modified multipotent stem cell, a modified oligopotent stem cell, or a modified unipotent stem cell) that differentiates into one or more cell lineages comprising the deletion of the modified stem cell. The disclosure further provides organisms (such as animals, plants, or fungi) comprising or produced from a modified cell of the disclosure.C. Delivery of Gene Editing Systems to CellsIn some embodiments, any of the gene editing systems or components thereof as disclosed herein may be formulated, for example, including a carrier, such as a carrier and / or a polymeric carrier, e.g. , a liposome or lipid nanoparticle, and delivered by known methods toa cell (e.g., a prokaryotic, eukaryotic, plant, mammalian, etc.). Such methods include, but not limited to, transfection (e.g., lipid-mediated, cationic polymers, calcium phosphate, dendrimers); electroporation or other methods of membrane disruption e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV), microinjection, microprojectile bombardment (“gene gun”), fugene, direct sonic loading, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, exosome-mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof.In some embodiments, the method comprises delivering one or more nucleic acids (e.g., nucleic acids encoding the variant CRISPR nuclease polypeptide and / or the gRNAs, and / or a pre-formed ribonucleoprotein to a cell. Exemplary intracellular delivery methods, include, but are not limited to: viruses or virus-like agents; chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, or cationic polymers (e.g., DEAE-dextran or polyethylenimine); non-chemical methods, such as microinjection, electroporation, cell squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, bacterial conjugation, delivery of plasmids or transposons; particle-based methods, such as using a gene gun, magnetofection or magnet assisted transfection, particle bombardment; and hybrid methods, such as nucleofection. In some embodiments, the present application further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a composition of the present invention is further delivered with an agent (e.g., compound, molecule, or biomolecule) that affects DNA repair or DNA repair machinery. In some embodiments, a composition of the present invention is further delivered with an agent (e.g., compound, molecule, or biomolecule) that affects the cell cycle.In some embodiments, a first composition comprising a variant CRISPR nuclease polypeptide is delivered to a cell. In some embodiments, a second composition comprising a gRNA is delivered to the cell. In some embodiments, the first composition is contacted with a cell before the second composition is contacted with the cell. In some embodiments, the first composition is contacted with a cell at the same time as the second composition is contacted with the cell. In some embodiments, the first composition is contacted with a cell after the second composition is contacted with the cell. In some embodiments, the first composition is delivered by a first delivery method and the second composition is delivered by a second delivery method. In some embodiments, the first delivery method is the same as the second delivery method. For example, in some embodiments, the first composition and the second composition are delivered via viral delivery. In some embodiments, the first delivery methodis different than the second delivery method. For example, in some embodiments, the first composition is delivered by viral delivery and the second composition is delivered by lipid nanoparticle-mediated transfer and the second composition is delivered by viral delivery or the first composition is delivered by lipid nanoparticle-mediated transfer and the second composition is delivered by viral delivery.IV. Therapeutic ApplicationsAny of the gene editing systems or modified cells generated using such a gene editing system as disclosed herein may be used for treating a disease that may be benefit from the gene edit introduced by the gene editing system or carried by the modified cells. For example, the disease may be a genetic disease and the gene edit fixes the gene mutation associated with the genetic disease. Alternatively, the disease may be associated with abnormal expression of a gene and the gene edit rescues such abnormal expression.In some embodiments, provided herein is a method for treating a disease comprising administering to a subject (e.g., a human patient) in need of the treatment any of the gene editing system disclosed herein. The gene editing system may be delivered to a specific tissue or specific type of cells where the gene edit is needed. The gene editing system may comprise LNPs encompassing one or more of the components, one or more vectors (e.g. , viral vectors) encoding one or more of the components, or a combination thereof. Components of the gene editing system may be formulated to form a pharmaceutical composition, which may further comprise one or more pharmaceutically acceptable carriers.In some embodiments, modified cells produced using any of the gene editing systems disclosed herein may be administered to a subject (e.g., a human patient) in need of the treatment. The modified cells may comprise a substitution, insertion, and / or deletion described herein. In some examples, the modified cells may include a cell line modified by the variant CRISPR nuclease polypeptide and the gRNA as disclosed herein. In some instances, the modified cells may be a heterogenous population comprising cells with different types of gene edits. Alternatively, the modified cells may comprise a substantially homogenous cell population (e.g., at least 80% of the cells in the whole population) comprising one particular gene edit. In some examples, the cells can be suspended in a suitable media.In some embodiments, provided herein is a composition comprising the gene editing system or components thereof or the modified cells. Such a composition can be a pharmaceutical composition. A pharmaceutical composition that is useful may be prepared, packaged, or sold in a formulation suitable for oral, rectal, vaginal, parenteral, topical,pulmonary, intranasal, intra-lesional, buccal, ophthalmic, intravenous, intra-organ or another route of administration. A pharmaceutical composition of the disclosure may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined number of cells. The number of cells is generally equal to the dosage of the cells which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.A formulation of a pharmaceutical composition suitable for parenteral administration may comprise the active agent (e.g. , the gene editing system or components thereof or the modified cells) combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such a formulation may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Some injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.The pharmaceutical composition may be in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the cells, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulation may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which that are useful include those which may comprise the cells in a packaged form, in a liposomal preparation, or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.V. Kits and Uses ThereofThe present disclosure also provides kits or systems that can be used, for example, tocarry out a method described herein. In some embodiments, the kits or systems include a variant CRISPR nuclease polypeptide and optionally a gRNA. In some embodiments, the kits or systems include a polynucleotide that encodes the variant CRISPR nuclease polypeptide and optionally the gRNA. The gRNA of the kits can be designed to target a sequence of interest. The variant CRISPR nuclease polypeptide and the gRNA can be packaged within the same vial or other vessel within a kit or system or can be packaged in separate vials or other vessels, the contents of which can be mixed prior to use. The kits or systems can additionally include, optionally, a buffer and / or instructions for use of the variant CRISPR nuclease polypeptide and the gRNA.In some embodiments, the kit comprises a first composition comprising a variant CRISPR nuclease polypeptide as disclosed herein. In some embodiments, the kit comprises a second composition comprising a gRNA as also disclosed herein. In some embodiments, the first composition and the second composition are packaged within the same vial. In some embodiments, the first composition and the second composition are packaged within different vials.In some embodiments, the kit may be useful for research purposes. For example, in some embodiments, the kit may be useful to study gene function.General techniquesThe practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (I. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols inImmunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wileyand Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed.1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cell Culture (R.I. Freshney, ed. ( 1986» ; Immobilized Cells and Enzymes (IRL Press, (1986» ; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.EXAMPLESThe following examples are provided to further illustrate some embodiments of the present disclosure but are not intended to limit the scope of the present disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.Example 1; CRISPR Nuclease-Mediated Editing of Human Target Genes in HEK293T CellsThis Example describes genomic editing of exemplary target genes, including the AAVS1, EMX1, and VEGFA genes, by the CRISPR nuclease of SEQ ID NO: 1 introduced into cells by lipid-based transient transfection into the HEK293T cell line.The CRISPR nuclease was tagged with an N-terminal SV40 nuclear localization signal (NLS) and a C-terminal XTEN linker directly upstream of a nucleoplasmin NLS, and its coding sequence was converted to a human codon-optimized DNA sequence, synthesized, and cloned into a pcDNA3.1 vector (Invitrogen), containing a CMV promoter for expression. The reference and NLS-tagged sequences used are in Table 1. Plasmids were purified using a midiprep kit.Table 1. Sequences of CRISPR Nuclease ConstructsRNA guides were designed and cloned into a pUC19 plasmid following the U6 PolIII promoter and terminated with a 6x polyT sequence. RNA guides were designed to be specific to target sequences within AAVS1, EMX1, and VEGFA with 5’-NGG-3’ PAM sequences (the PAM sequence is located immediately on the 3’ end of the target sequence). The U6 PolIII promoter uses a +1 G at the start of the transcript (i.e., the 5’ end of the RNA) formore efficient transcription that is excluded from the sequences described here. See all RNA guide sequences in Table 2. Plasmids were purified using a midiprep kit.Table 2. Target and RNA Guide Sequences* Spacer in upper case and scaffold (SEQ ID NO: 2) in lower caseApproximately 16 hours prior to transfection, 25,000 HEK293T cells in DMEM / 10%FBS+Pen / Strep (DIO media) were plated into each well of a 96-well plate. On the day of transfection, the cells were 70-90% confluent. For each well to be transfected, a mixture of Lipofectamine 2000™ (ThermoFisher Scientific) and Opti-MEM™ (ThermoFisher Scientific) was prepared and incubated at room temperature for 5 minutes (Solution 1). After incubation, the Lipofectamine 2000™: Opti-MEM™ mixture was added to a separate mixture containing the CRISPR nuclease plasmid (NLS-tagged), RNA guideplasmid, and Opti-MEM™ (Solution 2). In the case of negative controls, the CRISPR nuclease plasmid was excluded. Solutions 1 and 2 were mixed by pipetting up and down, then incubated at room temperature for 25 minutes. Following incubation, the Solution 1 and 2 mixture was added dropwise to each well of a 96-well plate containing the cells. Approximately 72 hours post transfection, cells were trypsinized by adding TrypLE™ (Thermo Fisher Scientific) to the center of each well and incubating at 37°C for approximately 5 minutes. DIO media was then added to each well and mixed to resuspend cells. The resuspended cells were centrifuged for 10 minutes to obtain a pellet, and the supernatant was discarded. The cell pellet was then resuspended in QuickExtract™ buffer (Lucigen®), and cells were incubated at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes.Next Generation Sequencing (NGS) samples were prepared by two rounds of PCR. Three technical replicates were analyzed per target for the reference and each variant. The first round (PCR1) was used to amplify specific genomic regions depending on the target. Round 2 PCR (PCR2) was performed to add Illumina adapters and indices. Reactions were then pooled and purified by column purification. Sequencing runs were performed using a 150 Cycle NextSeq 500 / 550 Mid or High Output v2.5 Kit or a 200 Cycle NovaSeq 6000 SP or SI Reagent Kit vl.5.For NGS analysis, the indel mapping function used a sample’s fastq file, the amplicon reference sequence, and the forward primer sequence. For each read, a kmer-scanning algorithm was used to calculate the edit operations (match, mismatch, insertion, deletion) between the read and the reference sequence. In order to remove small amounts of primer dimer present in some samples, the first 30 nt of each read was required to match the reference and reads where over half of the mapping nucleotides are mismatches were filtered out as well. Up to 50,000 reads passing those filters were used for analysis, and reads were counted as an indel read if they contained an insertion or deletion. The QC standard for the minimum number of reads passing filters was 10,000.For each target, indel ratios, referring to the fraction of NGS reads containing indels, were calculated for each sample and its cognate no protein control. Targets comprising a higher percentage of indels when the CRISPR nuclease was included in the transfection were indicative of DNA editing outcomes in the cell.As shown in FIG. 1, each of the six targets tested demonstrated a greater level of indels observed when the CRISPR nuclease plasmid was present. This Example thus shows that the CRISPR nuclease of SEQ ID NO: 1 edited human genes.Example 2 : Effectiveness of Variant CRISPR Nucleases for Targeting of Exemplary Mammalian GenesThis Example describes indel assessment on exemplary mammalian targets using CRISPR nuclease variants transfected into HEK293T cells.Arginine scanning mutagenesis was performed to individually substitute selected nonarginine residues of the reference CRISPR nuclease (SEQ ID NO: 1) to arginine. SEQ ID NO: 1 is referred to herein as the reference sequence. This resulted in 372 single arginine substitution variants. Nucleic acids encoding the reference and each CRISPR nuclease variant were then individually cloned into a pcDNA3.1 backbone (Invitrogen™), and the plasmids were prepped and diluted. The plasmids comprised a CMV promoter, a first NLS (KRTADGSEFESPKKKRKV; SEQ ID NO: 3) upstream of the coding sequence, an XTEN linker (SGGSSGGSSGSETPGTSESATPESSGGSSGGSS; SEQ ID NO: 8), and a second NLS (KRPAATKKAGQAKKKK; SEQ ID NO: 4) downstream of the coding sequence. See also Example 1 above.Exemplary RNA guides of VEGFA-T6 and EMX1-T7 were used in this study. Details of these gRNAs are provided in Table 2 above. RNA guides were cloned into a pUC19 backbone (New England Biolabs®). The plasmids were purified using a maxi-prep kit and diluted. Cells were transfected, and samples were prepared for NGS as described in Example 1 . Indel ratios, referring to the fraction of NGS reads containing indels, were calculated for the reference and for each variant. The indel ratios used for fold change calculations were the average of two technical replicates. To then calculate fold change in indel ratios, the indel ratio for each variant was divided by the indel ratio for the reference. Table 3 shows fold change in indel ratios for each target tested. Numbering is relative to the reference nuclease of SEQ ID NO: 1 (i.e., without an NLS).As shown in Table 3, 6 of the 372 variants with single arginine substitutions (left column) were characterized as yielding at least a 1.5X increase in indel ratio relative to the reference indel ratio, when averaged across the two targets (right column).Table 3. Fold Change in Indel Ratios** Variant indel ratio / Reference indel ratio55 variants with single arginine substitutions were analyzed as having indel ratios IX- 1.5X of the reference indel ratios: G1329R, Q741R, P1238R, A1236R, Q1230R, E1214R, A730R, Q849R, S473R, D985R, M753R, K918R, I1106R, M1205R, Y1015R, Q1360R, K1344R, F501R, K1091R, G731R, N1295R, F1241R, V752R, N1099R, E1179R, D720R, F1285R, I1370R, E1037R, E982R, S1094R, S872R, P1096R, A1226R, Q840R, Il 147R, L1117R, E331R, T1108R, K1298R, Y986R, S898R, A1333R, P1208R, E1105R, Q809R, L1281R, A1292R, K1131R, I581R, I79R, D1284R, T1104R, Y348R, and S1348R. The remaining variants with single arginine substitutions (311 variants) resulted in decreased indel ratios relative to the reference indel ratios (fold change in indel ratios of less than 1.0).The following variants, which exhibited at least a 1.5X-fold increase in indel ratio relative to the reference, were selected to engineer combination variants: I857R, N813R, L784R, K736R, A919R, and Q812R.Example 3: Engineering and Effectiveness of CRISPR Nickase Variants for Targeting Mammalian GenesThis Example describes introducing mutations into the CRISPR nuclease of SEQ ID NO: 1 that disrupt either the HNH or RuvC domains to produce a functional nickase. D844, H845, and N868 were identified as putative catalytic residues of the HNH domain. DIO, E763, and D991 positions were identified as putative catalytic residues of the RuvC domain. These positions were identified by analyzing models generated with AlphaFold2 (Jumper et al. , Nature 596: 583-9 (2021)) for structural regions resembling known HNH and RuvC active sites and / or by performing sequence alignments to other nucleases for which candidate positions had been previously identified. Examples of reference structures used to identify the HNH and RuvC active sites are represented with the following Protein Data Bank (PDB) identifiers: 5h0m, 7eu9, 61tu, 7odf, 71ys, 8dc2, 4cmp, 4oo8, 7z4j, 5axw, 5b2o, 6kc8, 7utn, 8csz, 8ctl, 8dmb.The coding sequence of the reference CRISPR nuclease was converted into an E. coli- codon optimized DNA sequence, synthesized, and cloned into a pET-28a(+) vector (Novagen) containing lac and T7 RNA polymerase promoters for gene expression. To test for nickase activity, individual alanine mutants were cloned for each of the positions identified as putative active site residues of the HNH and RuvC domains. A leucine mutant was also cloned for position H845. Research grade plasmids were received from GenScript. The engineered nickase sequences are shown in Table 4. The codon encoding the substituted residue is capitalized, bold, and underlined in the nucleotide sequence, and the substituted residue is shown in bold and underlined in the amino acid sequence. The putative HNH- knockout nickases were anticipated to cleave the non-target strand but not the target strand. The putative RuvC-knockout nickases were anticipated to cleave the target strand but not the non-target strand.Table 4. CRISPR Nuclease and Nickase SequencesA linear DNA template encoding an RNA guide was designed with a T7 promoter upstream and a T7Te terminator sequence downstream. The RNA guide was designed to be specific to a previously tested target sequence, described in Example 1 and Table 2 above, within the coding exon of EMX1 with a 5’-NGG-3’ PAM sequence (the PAM is 3’ of the target sequence). The T7 promoter uses a +1 G at the start of the transcript (i.e., the 5’ end of the RNA) for more efficient transcription that is shown for SEQ ID NO: 45. The sequence of the encoded RNA guide and its individual components are shown in Table 5.Table 5. RNA SequencesA DNA target was designed and ordered as a synthesized linear DNA fragment. The target sequence from EMX1 and 10 bases upstream and downstream within the exon was flanked by 200 bases of unrelated sequence upstream and 100 bases of unrelated sequence downstream. The extra sequence was added so that the cleaved and uncleaved products would separate well on a gel. The target and non-target strands were labelled with 5’ IR700 and 5’ IR800 labels, respectively, through PCR amplification using labelled primers. The sequences of the DNA target, the individual components of the DNA target, and the labelled PCR primers are in Table 6.Table 6. Target gBlock and Primer SequencesCleavage activity of the reference CRISPR nuclease (SEQ ID NO: 1) and each of the putative nickases was assessed using in vitro cleavage assays. Each polypeptide was individually co-expressed with the RNA guide in vitro by incubating the plasmid encoding the protein of interest from Table 4 and linear DNA template for the T7 transcribed EMX1- T2 sgRNA from Table 5 in a PURExpress® solution (NEB) containing SUPERaseHn™ RNase Inhibitor (Invitrogen) for 2 hours at 37°C. The unpurified polypeptide / RNA solution was then diluted into a solution of IX NEB Buffer 2 (NEB) containing approximately 1 ng / pl of the labelled DNA target amplicon. The solution was then incubated for 1 hour at 37°C. Reactions were stopped by incubating with RNase Cocktail™ (Invitrogen; approximately 1 U / pl final concentration) at 37°C for 15 minutes, followed by incubating with Proteinase K (NEB; approximately 0.04 U / pl final concentration) at 55°C for 30 minutes. The DNA was then purified using CleanNGS DNA & RNA Clean-Up Magnetic Beads (Bulldog Bio).The cleaved and uncleaved products of the target and non-target strands were separated by running the samples on a 10% TBE-Urea PAGE gel. The gel was imaged using a LI-COR Odysssey M imaging system using the 700 nm and 800 nm channels to visualize the 5’ IR700 and 5’ IR800 labels on the target and non-target strands of the target DNA substrate. Band intensities were quantified using ImageJ software.Gel images are shown in FIGs. 2A-2C, and quantification of the percent of cleaved target and non-target strands are shown in FIG. 2D. The uncleaved, HNH-cleaved, and RuvC-cleaved strands are indicated. FIG. 2A is a gel image captured using the 700 nm channel showing cleavage of the target strand. FIG. 2B is a gel image captured using the 800 nm channel showing cleavage of the non-target strand. FIG. 2C is an overlay of the gel images from FIG. 2A and FIG. 2B. As shown in FIGs. 2A-2D, the reference CRISPR nuclease (SEQ ID NO: 1) cleaved both the target strand and the non-target strand, as expected. Three of the four HNH-knockout nickase constructs (H845A, H845L, and N868A) showed significantly decreased activity on the target strand while retaining activity on the non-target strand. Each of the three RuvC-knockout nickase constructs (D10A, E763A, and D991 A) showed significantly decreased activity on the non-target strand while retaining activity on the target strand (FIGs. 2A-2D).This Example thus shows that HNH-knockout nickases and RuvC-knockout nickases were successfully engineered.Example 4: Effectiveness of Combination CRISPR Nuclease Variants for Targeting of Mammalian GenesThis Example describes indel assessment on mammalian targets using CRISPR nuclease variants comprising two or more substitutions identified as increasing indel activity in Example 2. 35 combination CRISPR variants were tested.Each CRISPR nuclease variant and RNA guide was cloned as described in Example 2. Exemplary RNA guides of VEGFA-T6 and EMX1-T7 were used in this study. Details of these gRNAs are provided in Table 2 above. HEK293T cells were further transfected, followed by NGS analysis, as described in Example 2. For each target, indel ratios, referring to the percentage of NGS reads comprising indels, were calculated for the reference CRISPR nuclease (SEQ ID NO: 1) and for each variant CRISPR nuclease. The indel ratios shown in Table 7 were calculated as the average of two bioreplicates, each of which contained two technical replicates.Table 7. Indel Ratios for Mammalian TargetsAs shown in Table 7, each of the CRISPR nuclease variants with combinations of amino acid substitutions exhibited higher indel activity than the reference CRISPR nuclease (SEQ ID NO: 1). 9 CRISPR nuclease variants resulted in indel ratios of over 0.25 when averaged across both targets, indicating that over 25% of NGS reads comprised indels. These 9 CRISPR nuclease variants comprised the following substitution combinations: a) I857R, L784R, K736R; b) I857R, A919R, K736R; c) I857R, N813R, L784R; d) I857R, L784R,A919R; e) I857R, N813R, K736R; f) I857R, N813R; g) L784R, A919R, K736R; h) I857R, L784R; and i) I857R, A919R. 8 CRISPR nuclease variants resulted in indel ratios between 0.2 and 0.24 when averaged across both targets, indicating between 20% and 24% of NGS reads comprised indels. 18 CRISPR nuclease variants resulted in indel ratios of 0.1 to 0.19 when averaged across both targets, indicating between 10% and 19% of NGS reads comprised indels. The average indel ratio across both targets exceeded that of the reference for all variants tested.Based on this experiment, the top-performing CRISPR nuclease variant comprising substitutions I857R, L784R, K736R was selected for further testing. This CRISPR nuclease variant exhibited a 2.5-fold increase in indel activity compared to the reference CRISPR nuclease.Example 5; Design of Additional CRISPR NucleasesThis Example describes design of additional CRISPR nucleases with desired bioactivities.Additional variants of the CRISPR nickase described herein are engineered. Each individual amino acid residue of the CRISPR nickase with an H845A substitution from Example 3 is replaced with the remaining nineteen available amino acids (except for the H845A residue). Nucleic acids encoding the CRISPR nickase variants are cloned into a pcDNA3.1 vector (Invitrogen) comprising a CMV promoter. The expression vectors are introduced into host cells for expression of the CRISPR nickase variants. The CRISPR nickase variants expressed in host cells are purified and their nickase activities are evaluated following the procedures provided in Example 3 above.Additional CRISPR nuclease variants are engineered to increase double-strand nuclease activity. The variants of Table 8 are cloned and evaluated as described in Example 2.Table 8. Variant CRISPR Nuclease SequencesAdditional CRISPR nuclease variants are engineered and evaluated for their ability to recognize less stringent PAM sequences. The variants of Table 9 are cloned and evaluated as described in Example 2 using target sequences adjacent to 5’-NGN-3’, 5’-NRN-3’, or 5’- NYN-3’ PAM sequences, in which N represents any nucleotide, R represents G or A, and Y represents C or T.Table 9. Variant CRISPR Nuclease SequencesExample 6 : Effectiveness of Variants of a CRISPR Nuclease with Relaxed PAM Stringency for Targeting of Exemplary Mammalian GenesThis Example describes indel assessment on exemplary mammalian targets using variants of a CRISPR nuclease with a relaxed PAM transfected into HEK293T cells.Arginine scanning mutagenesis was performed to individually substitute selected nonarginine residues of the CRISPR nuclease variant of SEQ ID NO: 130 to arginine. This resulted in 372 single arginine substitution variants. The variants were cloned and evaluated as described in Example 2 using the target sequences adjacent to 5’-NGN-3’ PAM sequences summarized in Table 10.Table 10. Mammalian Targets and Corresponding crRNAsHEK293T cells were further transfected, followed by NGS analysis, as described in Example 2. Indel activity of the CRISPR nuclease variant of SEQ ID NO: 130 is shown in Table 11. The data in Table 11 is the average of ten control samples, each of which had two bioreplicates and two technical replicates.Table 11. Percentage of NGS Reads Comprising IndelsNext, for each target, indel ratios, referring to the percentage of NGS reads comprising indels, were calculated for the variant CRISPR nuclease of SEQ ID NO: 130 and for each variant CRISPR nuclease. To then calculate fold change in indel ratios, the indel ratio for each variant was divided by the indel ratio for the variant CRISPR nuclease of SEQ ID NO: 130. The indel ratios used for fold change calculations were the average of two technical replicates. As shown in Table 12, 3 of the 372 variants with single arginine substitutions (left column) were characterized as yielding at least a 2X increase in indel ratio relative to the indel ratio for the variant CRISPR nuclease of SEQ ID NO: 130, when averaged across the two targets (right column).Table 12. Fold Change in Indel Ratios** Variant indel ratio / indel ratio of variant set forth in SEQ ID NO: 13011 variants with single arginine substitutions were analyzed as having indel ratios 1.5X-2X of the reference indel ratios: L64R, S410R, T67R, Q849R, G1110R, F501R, T659R, L784R, Y516R, G55R, and E1037R. 92 variants exhibited indel ratios 1-1.4X of the reference indel ratios: N57R, D720R, A919R, A1294R, Q812R, N700R, H657R, T73R, Q899R, T1347R, I857R, K751R, D327R, I581R, D462R, E331R, A589R, D471R, I699R, N1295R, T470R, I1147R, E130R, S473R, A353R, K40R, K334R, A60R, S1348R, K367R, A1118R, K31R, Q349R, K341R, Q83R, K585R, Q840R, G660R, K527R, G727R, Y42R, L1281R, L122R, Q123R, T1108R, E41R, K1131R, K30R, S872R, I1206R, D1132R, K460R, L80R, E459R, K1182R, L11 I7R, M696R, K9I8R, K126R, N721R, G1227R, Q809R, K1091R, K736R, A1332R, K783R, N498R, K723R, E1228R, H1119R, F463R, L594R, D472R, K744R, E365R, G595R, K45R, Y348R, K964R, S1181R, N813R, D407R, S839R, Y658R, E586R, G754R, A730R, Y1015R, D903R, A1333R, S461R, and H1359R. The remaining variants with single arginine substitutions (266 variants) resulted in decreased indel ratios relative to the indel ratios for the variant CRISPR nuclease of SEQ ID NO: 130 (fold change in indel ratios of less than 1.0).This Example thus shows that the CRISPR nuclease variant of SEQ ID NO: 130 is an active nuclease capable of editing target sequences adjacent to a 5 ’-NGN-3’ PAM (N representing A, C, G, or U) and that particular further arginine substitutions (e.g., D61R,A68R, and / or H494R) increase nuclease activity.OTHER EMBODIMENTSAll of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.EQUIVALENTSWhile several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.All definitions, as defined and used herein, should be understood to control overdictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition alsoallows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one’- refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

Claims

WHAT IS CLAIMED IS:

1. An engineered CRISPR nuclease polypeptide, wherein the engineered CRISPR nuclease polypeptide is a variant of a reference CRISPR nuclease set forth as SEQ ID NO: 1, which comprises a RuvC nuclease domain and an HNH nuclease domain; and wherein relative to the reference CRISPR nuclease, the engineered CRISPR nuclease polypeptide comprises:(i) one or more nickase mutations in the HNH nuclease domain or in the RuvC nuclease domain that reduce or eliminate the nuclease activity thereof; optionally wherein the one or more mutations are in the HNH nuclease domain;(ii) one or more arginine and / or lysine substitutions, optionally one or more arginine substitutions;(iii) one or more mutations for reducing PAM recognition stringency; or(iv) a combination of (i), (ii), and / or (iii).

2. The engineered CRISPR nuclease polypeptide of claim 1, wherein the CRISPR nuclease polypeptide comprises one or more mutations in the HNH nuclease domain at positions D844, H845, and / or N868 relative to SEQ ID NO: 1 ; optionally wherein the mutation is at position H845.

3. The engineered CRISPR nuclease polypeptide of claim 2, wherein:(a) the mutation at D844 is an amino acid substitution of D844A, D844G, D844L, or D844S;(b) the mutation at H845 is an amino acid substitution of H845A, H845G, H845L, or H845S; and(c) the mutation at N868 is an amino acid substitution of N868A, N868G, N868L, or N868S.

4. The engineered CRISPR nuclease polypeptide of claim 1, wherein the CRISPR nuclease polypeptide comprises one or more mutations in the RuvC nuclease domain at positions DIO, E763, and / or D991 relative to SEQ ID NO: 1 ; optionally wherein the mutation is at position E763 or D991.

5. The engineered CRISPR nuclease polypeptide of any one of claims 1-4, wherein the engineered CRISPR nuclease polypeptide comprises a bridge helix (BH) domain, a nucleic acid recognition (REC) domain, a phosphate lock loop (PLL), a wedge (WED) domain, and a PAM-interacting (PID) domain, and wherein one or more arginine and / or lysine substitutions, optionally arginine substitutions, are located in the BH domain, in the REC domain, in the PLL domain, in the WED domain, in the PID domain, or a combination thereof.

6. The engineered CRISPR nuclease polypeptide of any one of claims 1-5, wherein the engineered CRISPR nuclease polypeptide contains up to 20 arginine and / or lysine substitutions relative to the reference CRISPR nuclease; optionally wherein the engineered CRISPR nuclease polypeptide contains up to 15 arginine and / or lysine substitutions relative to the reference CRISPR nuclease; preferably wherein the one or more arginine and / or lysine substitutions are at positions K736, L784, Q812, N813, 1857, and / or A919; which optionally is I857R.

7. The engineered CRISPR nuclease polypeptide of claim 6, wherein the CRISPR nuclease polypeptide contains at least two arginine and / or lysine substitutions relative to the reference CRISPR nuclease, and wherein the at least two arginine and / or lysine substitutions are at positions K736, L784, Q812, N813, 1857, and / or A919.

8. The engineered CRISPR nuclease polypeptide of claim 7, wherein the CRISPR nuclease polypeptide contains arginine and / or lysine substitutions at the following positions relative to the reference CRISPR nuclease:(a) 1857, L784, and K736;(b) 1857, A919, and K736;(c) 1857, N813, and L784;(d) 1857, L784, and A919;(e) 1857, N813, and K736;(f) 1857 and N813;(g) L784, A919, and K736;(h) 1857 and L784; and(i) 1857 and A919.

9. The engineered CRISPR nuclease polypeptide of claim 8, wherein the CRISPR nuclease polypeptide comprises the following arginine substitutions relative to the reference CRISPR nuclease:(a) I857R, L784R, and K736R;(b) I857R, A919R, and K736R;(c) I857R, N813R, and L784R;(d) I857R, L784R, and A919R;(e) I857R, N813R, and K736R;(f) I857R and N813R;(g) L784R, A919R, and K736R;(h) I857R and L784R; and(i) I857R and A919R; optionally wherein the CRISPR nuclease polypeptide comprises the arginine substitutions of (a).

10. The engineered CRISPR nuclease polypeptide of claim 1, which comprises a nickase mutation at position H845, optionally H845A, and an arginine or lysine substitution at position 1857, optionally I857R, relative to SEQ ID NO: 1.

11. The engineered CRISPR nuclease polypeptide of any one of claims 1-10, wherein the CRISPR nuclease polypeptide comprises the one or more mutations for reducing PAM recognition stringency, optionally wherein the one or more mutations are at positions D61, A68, H494, L1117, D1144, S 1145, G1227, E1228, S1327, A1332, R1343, R1345, and / or T1347 of SEQ ID NO: 1.

12. The engineered CRISPR nuclease polypeptide of claim 11 , wherein the one or more mutations comprise:(i) one or more arginine and / or lysine substitutions, optionally arginine substitutions, at position D61, A68, H494, Li l 17, G1227, S1327, A1332, and / or T1347 of SEQ ID NO: 1 ;(ii) one or more amino acid substitutions at position DI 144, SI 145, E1228, R1343, and / or R1345, of SEQ ID NO: 1, optionally D1144L, S1145W, E1228Q, R1343P, R1345V and / or R1345Q; or(iii) a combination of (i) and (ii).

13. The engineered CRISPR nuclease polypeptide of claim 12, comprising the following combination of mutations relative to SEQ ID NO: 1 :(i) L1117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and A68R;(ii) LI 117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and D61R; or(iii) L1117R, DI 144V, G1227R, E1228F, A1332R, R1345V, T1347R, and H494R.

14. The engineered CRISPR nuclease polypeptide of any one of claims 1-13, wherein the engineered CRISPR nuclease polypeptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 1.

15. The engineered CRISPR nuclease polypeptide of claim 14, wherein the engineered CRISPR nuclease polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO: 1.

16. The engineered CRISPR nuclease polypeptide of claim 15, wherein the engineered CRISPR nuclease polypeptide comprises an amino acid sequence at least 98% identical to SEQ ID NO: 1.

17. The engineered CRISPR nuclease polypeptide of claim 1, wherein the engineered CRISPR nuclease polypeptide is set forth in Table 4, Table 8, or Table 9.

18. The engineered CRISPR nuclease polypeptide of any one of claims 1-17, which is a fusion polypeptide, which further comprises one or more functional fragments.

19. The engineered CRISPR nuclease polypeptide of claim 18, wherein the one or more functional fragments comprise a nuclear localization signal (NLS), a peptide linker, or a combination thereof.

20. The engineered CRISPR nuclease polypeptide of claim 19, wherein the NLS is fused to the engineered CRISPR nuclease polypeptide at its N-terminus and / or its C- terminus.

21. A nucleic acid, comprising a nucleotide sequence encoding the engineered CRISPR nuclease polypeptide of any one of claims 1 -20.

22. The nucleic acid of claim 21 , wherein the nucleic acid is an expression vector, in which the nucleotide sequence encoding the engineered CRISPR nuclease polypeptide is in operable linkage to a promoter.

23. The nucleic acid of claim 22, which is a messenger RNA (mRNA).

24. A host cell comprising the nucleic acid of claim 21 or claim 22.

25. A gene editing system, comprising:(a) a CRISPR nuclease polypeptide or a first nucleic acid encoding the CRISPR nuclease, wherein the CRISPR nuclease polypeptide comprises an amino acid sequence at least 90% identical to a reference CRISPR nuclease, which is set forth as SEQ ID NO: 1 ; and(b) a guide RNA (gRNA), or a second nucleic acid encoding the gRNA; wherein the gRNA comprises a scaffold recognizable by the engineered CRISPR nuclease polypeptide and a spacer sequence specific to a target sequence within a genomic site of interest, the target sequence being upstream to a protospacer motif (PAM).

26. The gene editing system of claim 25, wherein the CRISPR nuclease polypeptide is an engineered CRISPR nuclease polypeptide set forth in any one of claims 1- 20.

27. The gene editing system of claim 25 or 26, wherein the scaffold comprises a nucleotide sequence at least 85% identical to SEQ ID NO: 2.

28. The gene editing system of claim 27, wherein the scaffold comprises SEQ ID NO: 2.

29. The gene editing system of claim 27, wherein the scaffold comprises one or more deletions, one or more nucleotide substitutions, or a combination thereof, as compared with SEQ ID NO:

2.

30. The gene editing system of any one of claims 25-29, wherein the PAM is 5’-NDR-3’ or 5 ’-NGN-3’, in which N represents any nucleotide, D represents A, G, or T, and R represents G or A; optionally wherein the PAM is 5’-NRG-3’ or 5’-NRR-3’, in which N and R are defined herein; preferably wherein the PAM is 5’-NGG-3’, in which N represents any nucleotide.

31. A gene editing method, comprising delivering the gene editing system of any one of claims 25-30 to a host cell to edit a genomic site targeted by the gRNA of the gene editing system.

32. The gene editing method of claim 31, wherein the host cell is cultured in vitro.

33. The gene editing method of claim 32, wherein the host cell is located in a subject who needs the gene editing.

Images