Methods and compositions for treating ggggcc repeat expansion diseases

Abstract

The present disclosure provides double-stranded RNAs. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a recombinant expression vector encoding a recombinant nucleic acid of the present disclosure. The present disclosure provides compositions and delivery vehicles comprising a double stranded RNA, a recombinant nucleic acid, or a recombinant expression vector of the present disclosure. The present disclosure provides methods for selectively reducing translation and / or accumulation of a disease-associated GGGGCC repeat-containing RNA. The present disclosure provides methods for treating GGGGCC repeat expansion-associated diseases.

Description

METHODS AND COMPOSITIONS FOR TREATING GGGGCC REPEAT EXPANSION DISEASESCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 579,888, filed August 31, 2023 and U.S. Provisional Patent Application No. 63 / 614,364, filed Dec 22, 2023, which applications are incorporated herein by reference in its entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A SEQUENCE LISTING XML FIEE

[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “IRIS-003 WO_SEQ_LIST_v2” created on August 29, 2024, and having a size of 1,715,045 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.INTRODUCTION

[0003] Repeat expansion disorders are genetic disorders caused by expansion of DNA repeats. DNA repeats may be composed of single nucleotides to dodecamers or longer. The threshold at which repeat expansions become symptomatic varies with the particular disease. There are over 50 distinct diseases caused by repeat expansions. Repeat expansions may occur in coding or non-coding regions of genes. Repeat expansions may cause defects in a protein encoded by a gene; change the regulation of gene expression; produce a toxic RNA, or lead to chromosome instability.

[0004] An expanded hexanucleotide repeat has been implicated in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). This repeat expansion occurs in the first intron of the chromosome 9 open reading frame 72 (C9orf72) gene. It accounts for one third of familial ALS and a quarter of familial FTD. The sequence of the repeat within C9orf72 pre-mRNA is GGGGCC. Patients with ALS or FTD typically have one mutant C9orf72 allele that contains 700-1600 repeats, while unaffected individuals have fewer than 24 repeats in both alleles. The C9orf72 locus also expresses an antisense transcript that encodes a CCCCGG repeat that may contribute to disease.SUMMARY

[0005] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target GGGGCC repeat region; and ii) at least a second mismatch to the target GGGGCC repeat region. The present disclosure provides a double-stranded RNA comprising: a) a fust strand that hybridizes to atarget CCCCGG repeat region of a CCCCGG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CCCCGG repeat region; and ii) at least a second mismatch to the target CCCCGG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation and / or accumulation of a disease-associated GGGGCC repeat-containing RNA. The present disclosure provides methods for treating GGGGCC repeat expansion-associated diseases.BRIEF DESCRIPTION OF THE DRAWINGS

[0006] FIG. 1 provides examples of guide sequences of small binding RNAs (sbRNAs) of the present disclosure. Provided are the sequences of the guide strand (SEQ ID N0s:703-704, 633, 706-710, 631, 712-719, 627, 721-755, 634, 629, 758, 628, 760-769, respectively ), and reverse complement of the guide strand (SEQ ID NOs:636-671, 618, 673-702, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0007] FIG. 2 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs:837-903, respectively), and reverse complement of the guide strand (SEQ ID NOs:770-836, respectively ), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0008] FIG. 3 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs:996-1065, 632, 1067, 630, 1069, 635, 1071-1087, respectively), and reverse complement of the guide strand (SEQ ID NOs:904-995, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0009] FIG. 4 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs:673, 1184, 658, 650, 638, 1188, 687, 1190, 616, 1192-1200, 618, 1202, 657, 649, 1205-1207, 626, 1209-1210, 617, 1212-1218, 648, 1220, 695, 686,680, 1224-1238, 647, 1240, 694, 685, 679, 1244-1256, 661, 1258-1264, 624, 623, 1267-1269, 659, 1271- 1276, 673, respectively), and reverse complement of the guide strand (SEQ ID N0s:740,1089, 725, 717, 633, 1093, 754, 1095-1105, 739, 1107, 724, 716, 1110-1123, 715, 1125, 762, 753, 747, 1129-1143, 714, 1145, 761, 752, 746, 1149-1161, 728, 1163-1174, 726, 1176-1181, 740, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0010] FIG. 5 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs:1404, 817, 1406-1409, 814, 1411-1412, 621, 1414-1415, 828, 1417-1419, 625, 1421-1427, 770, 834, 1430-1436, 831, 1438-1465, 826, 1467- 1487, 619, 1489-1492, 810, 1494-1529, respectively), and reverse complement of the guide strand (SEQ ID NOs:1278, 884, 1280-1283, 881, 1285-1289, 895, 1291-1301, 837, 901, 1304-1310, 898, 1312-1339, 893, 1341-1366, 877, 1368-1403, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0011] FIG. 6 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs:1682-1687, 980, 966, 1690-1716, 983, 1718-1732, 979, 1734-1793, 615, 1795-1802, 620, 1804-1829, 614, 1831-1833, respectively), and reverse complement of the guide strand (SEQ ID NOs: 1530-1535, 1072, 1058, 1538-1564, 1075, 1566- 1580, 1071, 1582-1681, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0012] FIG. 7A-7B provide examples of nucleotide sequences of DNA encoding miRNA scaffolds comprising sbRNAs (SEQ ID NOs: 13-238, respectively).

[0013] FIG. 8A-8B provide examples of nucleotide sequences of DNA encoding miRNA scaffolds comprising sbRNAs (SEQ ID NOs:239-610, respectively).

[0014] FIG. 9A-9B depict knock-down of protein translation from repeat-containing antisense RNA (FIG. 9A) and repeat-containing sense RNA (FIG. 9B) using sbRNAs.

[0015] FIG. 10 depicts knock-down, expressed as nanoluciferase / firefly luciferase ratios, following transfection with guide sequences set out in Table 1.

[0016] FIG. 11 depicts knock-down, expressed as nanoluciferase / firefly luciferase ratios, following transfection with antisense guide sequences set out in Table 2.

[0017] FIG. 12A-12D provide schematic depictions of tandem scaffolds with 2 sbRNAs targeting sense and / or antisense targets (FIG. 12 A) and a recombinant expression vector comprising nucleotide sequences encoding tandem scaffolds in single-stranded (FIG. 12B) and self-complementary (FIG. 12C) AAV genome configurations. In the tandem scaffolds in FIGS. 12A-12C, a single promoter drives the expression of both sbRNAs. FIG. 12D depicts tandem sbRNAs expressed from dual promoters. The dual promoters may be the same promoter or different promoters.

[0018] FIG. 13 presents Table 3, which provides nucleotide sequences of 5’ flanking polynucleotides (5’ arm), 3' flanking polynucleotides (3’ arm), and loop polynucleotides for miRlOl (hsa-mir-101-2) and miR126 (hsa-mir-126); and provides nucleotide sequences of a 5’-flanking polynucleotide and a 3’ flanking polynucleotide for miR451 (hsa-mir-451).

[0019] FIG. 14 provides Table 5 which lists examples of sequences of sbRNAs (sbRNA #1 guide strands correspond to SEQ ID NOs:1834-1843, respectively; sbRNA #2 guide strands correspond to SEQ ID NOs: 1844- 1853, respectively) used as tandem sbRNAs and the miRNA scaffolds for the individual sbRNAs.

[0020] FIG. 15 depicts knock-down of protein translation from repeat-containing antisense RNA and repeat-containing sense RNA using tandem sbRNAs and sbRNAs expressed from dual promoters.

[0021] FIGS. 16A-16B provide Tables 6A and 6B which list examples of nucleotide sequences of DNA, labeled as Expression Cassette 1 (SEQ ID NOs:1915-1916 and 1862-1869, respectively; corresponding RNA guide strand 1 sequences are SEQ ID NOs:1834-1835 and 1854-1861, respectively) and Expression Cassette 2 (SEQ ID NOs:1917-1918 and 1878-1885, respectively; corresponding RNA guide strand 2 sequences are SEQ ID NOs: 1844- 1845 and 1870-1877, respectively), present in scAAVs for encoding tandem miRNA scaffolds / sbRNAs.

[0022] FIG. 17 provides Table 7 which lists examples of sequences of sbRNAs (sbRNA #1 guide strands correspond to SEQ ID NOs:1834-1843, respectively; sbRNA #2 guide strands correspond to SEQ ID NOs: 1844- 1853, respectively) expressed from dual promoters and the miRNA scaffolds for the individual sbRNAs.

[0023] FIG. 18 depicts the effect of the register on knockdown of protein translation from repeat-containing sense RNA using sbRNAs.

[0024] FIG. 19 depicts knockdown of poly(GA) dipeptide repeats (DPRs) in patient fibroblasts upon transduction of A AV-encoded tandem sbRNAs.

[0025] FIG. 20 depicts a dendrimer conjugated to a sbRNA.

[0026] FIGS. 21A and 21B depict knock-down of protein translation from repeat-containing antisense RNA and repeat-containing sense RNA using sbRNAs that include a 5' U on the guide strand.DEFINITIONS

[0027] As used herein, the term “nucleic acid” or “polynucleotide” refer to any nucleic acid polymer composed of covalently linked nucleotide subunits, such as polydeoxyribonucleotides or polyribonucleotides. Examples of nucleic acids include RNA and DNA.

[0028] As used herein, “RNA” refers to a molecule comprising one or more ribonucleotides and includes double-stranded RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, as well as modified RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of RNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0029] As used herein, “DNA” refers to a molecule comprising one or more deoxyribonucleotides and includes double-stranded DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, as well as modified DNA that differs from naturally-occurring DNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of DNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0030] As used herein, “nucleoside” means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0031] As used herein, “nucleotide” means a nucleoside further comprising a phosphate linking group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

[0032] As used herein, “nucleobase” or “base” means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0033] As used herein, “oligonucleotide” means a compound comprising a plurality of linked nucleosides. In some cases, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0034] As used herein, “single-stranded” means an oligomeric compound that is not hybridized to its complement and which lacks sufficient self-complementarity to form a stable self-duplex.

[0035] As used herein, “double-stranded” means an oligomeric compound that is partially or completely hybridized to its complement to form a stable duplex molecule. A double-stranded oligomeric compound may be composed of two separate strands of complementary oligomeric compounds hybridized to each other or a single oligomeric compound which has sufficient self-complementarity to form a stable self-duplex. Stable self-duplexes may contain stem-loop structure(s) and / or bulge(s).

[0036] “Isolated” refers to a substance that has been isolated from its natural environment or artificially produced. As used herein with respect to a cell, “isolated” refers to a cell that has been isolated from its natural environment (e.g., from a subject, organ, tissue, or bodily fluid). As used herein with respect to a nucleic acid, “isolated” refers to a nucleic acid that has been isolated or purified from its natural environment (e.g., from a cell, cell organelle, or cytoplasm), recombinantly produced, amplified, or synthesized. In embodiments, an isolated nucleic acid includes a nucleic acid contained within a vector.

[0037] As used herein, the term “wild-type” or “non-mutant” form of a gene refers to a nucleic acid that encodes a protein associated with normal or non-pathogenic activity (e.g., a protein lacking a mutation, such as a repeat region expansion that results in higher risk of developing, onset, or progression of a ncurodcgcncrativc disease).

[0038] As used herein, the term “mutation” refers to any change in the structure of a gene, e.g., gene sequence, resulting in an altered form of the gene, which may be passed onto subsequent generations (hereditary mutation) or not (somatic mutation). Gene mutations include the substitution, insertion, or deletion of a single base in DNA or the substitution, insertion, deletion, or rearrangement of multiple bases or larger sections of genes or chromosomes, including repeat expansions.

[0039] As used herein, a “microRNA” or “miRNA” refers to a small non-coding RNA molecule capable of mediating silencing of a target gene by cleavage of the target mRNA, translational repression of the target mRNA, target mRNA degradation, or a combination thereof. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementary, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. Pre-miRNA is exported into the cytoplasm, where it is enzymatically processed by Dicer to produce a miRNA duplex with the passenger strand and then a single- stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Reference to a miRNA may include synthetic or artificial miRNAs.

[0040] As used herein, a “synthetic miRNA” or “artificial miRNA” or “amiRNA” or “small binding RNA” (sbRNA) refers to a pri-miRNA or pre-miRNA (e.g., miRNA backbone or scaffold) in which the endogenous miRNA guide sequence and passenger sequence within the stem sequence have been replaced with a heterologous guide sequence and a heterologous passenger sequence (see, e.g., Eamens et al. (2014), Methods Mol. Biol. 1062:211-224). In some cases, the nature of the complementarity of the guide and passenger sequences (e.g., number of bases, position of mismatches, types of bulges, etc.) can be similar or different from the nature of complementarity of the guide andpassenger sequences in the endogenous miRNA backbone upon which the synthetic miRNA is constructed.

[0041] As used herein, the term “microRNA backbone,” “niiR backbone,” “microRNA scaffold,” or “miR scaffold” refers to a pri-miRNA or pre-miRNA scaffold, with the stem sequence replaced by a heterologous RNA of interest, and is capable of producing a functional, mature miRNA that directs RNA silencing at the gene targeted by the miRNA of interest. In some cases, a miR backbone comprises a 5’ flanking region (also referred to herein as a “5’ flanking polynucleotide” or a “5’ leader”), a loop motif region (also referred to herein as a “loop polynucleotide”), and a 3’ flanking region (also referred to herein as a “3' flanking polynucleotide” or a “3' trailer”). In some cases, a miR backbone comprises a 5’ flanking region and a 3’ flanking region (and does not include a loop motif region). A miR backbone may be derived completely or partially from a wild type miRNA scaffold or be a completely artificial sequence.

[0042] A “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or self-duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (terminal loop portion). The terms “hairpin”, “self-duplex” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art. As is known in the art, the secondary structure does not require exact base-pairing. Thus, the stem can include one or more base mismatches or bulges. Alternatively, the base -pairing can be exact, i.e. not include any mismatches.

[0043] As used herein, the term “guide strand sequence” of an inhibitory nucleic acid refers to a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary) to a region of about 10-50 nucleotides (e.g., about 15-30, 16- 25, 18-23, or 19-22 nucleotides) of the mRNA or pre-mRNA targeted for silencing. The guide sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, e.g., to trigger the destruction of the target mRNA by the RNAi machinery or process or to reduce translation of the target mRNA. In some cases, the guide strand sequence refers to the mature guide sequence remaining following cleavage by Dicer.

[0044] As used herein, the term “passenger strand sequence” of an inhibitory nucleic acid refers to a sequence that is homologous to the target mRNA or pre-mRNA, and partially or completely complementary to the guide strand sequence of an inhibitory nucleic acid. The guide strand sequence and passenger strand sequence of an inhibitory nucleic acid are hybridized to form a duplex structure (e.g., forming a double-stranded duplex or single-stranded self-annealing duplex structure). In some cases, the guide strand sequence and passenger strand sequence refers to the mature sequences remaining following cleavage by Dicer.

[0045] As used herein, the term “5’ arm” or “5’ stem” refers to a portion of a double stranded RNA (e.g., shRNA, prc-miRNA, pri-mRNA) that comprises the guide strand or passenger strand.

[0046] As used herein, the term “3’ arm” or “3’ stem” refers to a portion of a double stranded RNA that comprises the passenger strand to the 5’ stem’s guide strand, or the guide strand to the 5’ stem’s passenger strand.

[0047] As used herein, a “duplex,” when used in reference to an inhibitory nucleic acid, refers to two nucleic acid strands (e.g., a guide strand and passenger strand) hybridizing together to form a duplex structure. A duplex may be formed by two separate nucleic acid strands or by a single nucleic acid strand having a region of self-complementarity (e.g., hairpin or stem-loop).

[0048] As used herein, “target nucleic acid” means a nucleic acid molecule to which an antisense compound hybridizes. A target nucleic acid may be a mRNA (target mRNA) or pre-mRNA (target pre-mRNA) encoded by a target gene.

[0049] As used herein, “targeting” or “targeted to” means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. A double-stranded RNA targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0050] As used herein, the term “complementary” refers to the ability of polynucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide subunits in antiparallel polynucleotide strands or a single, self-annealing polynucleotide strand.Complementary polynucleotide strands can form base pairs in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. In some cases, complementary nucleotides include G and U (wobble base pair). As apparent to skilled persons in the art, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. Furthermore, when a “U” is denoted in the context of the present invention, the ability to substitute a “T” is understood, unless otherwise stated. Complementarity also encompasses Watson-Crick base pairing between non-modified and modified nucleobases (e.g., 5-methyl cytosine substituted for cytosine). Full complementarity, perfect complementarity or 100% complementarity between two polynucleotide strands is where each nucleotide of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand. % complementarity refers to the number of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are complementary to an aligned reference sequence (e.g., a target mRNA, passenger strand), divided by the total number of nucleotides and multiplying by 100. In such an alignment, a nucleobase / nucleotide which does not form a base pair is called a mismatch. Insertions and deletions are not permitted in calculating % complementarity of a contiguous nucleotide sequence. It is understood by skilled persons in the artthat in calculating complementarity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % complementarity).

[0051] As used herein, “non-complementary” in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0052] As used herein, “mismatch” means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned. Either or both of the first and second oligomeric compounds may be oligonucleotides. Nucleotides that do not base pair include self-pairing nucleotides (A-A, T-T, U-U, C-C, and G-G), A and C, C and U, C and T, A and G. In some cases, a mismatch does not include G-U wobble base pairs.

[0053] The "percent identity " between two or more nucleic acid sequences refers to the proportion of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are shared by a reference sequence (i.e., % identity = number of identical nucleotides / total number of nucleotides in the aligned region (e.g., the contiguous nucleotide sequence) x 100). Insertions and deletions are not permitted in the calculation of % identity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating identity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5- methyl cytosine is considered the same as cytosine for the purpose of calculating % identity).

[0054] As used herein, the term “hybridizing” or “hybridizes” refers to two nucleic acid strands forming hydrogen bonds between base pairs on antiparallel strands, thereby forming a duplex. While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. The strength of hybridization between two nucleic acid strands may be described by the melting temperature (Tm), defined as at a given ionic strength and pH, the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.

[0055] As used herein, “heterologous” refers to a nucleic acid that is not found in a native(naturally occurring) nucleic acid. For example, relative to a component of a microRNA (e.g., a 5’ flanking polynucleotide, a loop polynucleotide, a 3' flanking polynucleotide) a heterologous guide sequence and a heterologous passenger sequence comprises a nucleotide sequence that is not associated with the microRNA in nature. As used herein, the “guide sequence” is interchangeable with “first strand” (or “targeting strand”, where the “targeting strand” hybridizes to a target RNA) of a double-stranded RNA, regardless of the orientation.

[0056] As used herein, “expression cassette” refers to any type of genetic construct containing a nucleic acid (c.g., transgcnc) in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some cases, expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or inhibitory RNA (e.g., siRNA, shRNA, miRNA) from a transcribed gene. In some cases, the transgene is operably linked to expression control sequences.

[0057] As used herein, the term “transgene” refers to an exogenous nucleic acid that has been transferred naturally or by genetic engineering means into another cell and is capable of being transcribed, and optionally translated.

[0058] As used herein, the term “gene expression” refers to the process by which a nucleic acid is transcribed from a nucleic acid molecule, and often, translated into a peptide or protein. The process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post- translational control, post-translational modification, or any combination thereof. Reference to a measurement of “gene expression” may refer to measurement of the product of transcription (e.g., RNA or mRNA), or the product of translation (e.g., peptides or proteins).

[0059] As used herein, the term “inhibit expression of a gene” means to reduce, down-regulate, suppress, block, lower, or stop expression of the gene. The expression product of a gene can be an RNA molecule transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. A reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. In some cases, inhibition of expression reduces the level of a polypeptide without substantially affecting production of the encoding mRNA. The level of expression may be determined using standard techniques for measuring mRNA or protein.

[0060] As used herein, “vector” refers to a genetic construct that is capable of transporting a nucleic acid molecule (c.g., transgcnc encoding inhibitory nucleic acid) between cells and effecting expression of the nucleic acid molecule when operably linked to suitable expression control sequences. Expression control sequences may include transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. The vector may be a plasmid, phage particle, transposon, cosmid, phagemid, chromosome, artificial chromosome, virus, virion, lipid nanoparticle, etc. Once transformed into a suitable host cell, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.

[0061] As used herein, “host cell” refers to any cell that contains, or is capable of containing a composition of interest, e.g., an inhibitory nucleic acid. In some cases, a host cell is a mammalian cell,such as a rodent cell (e.g., mouse or rat) or primate cell (e.g., monkey, chimpanzee, or human). In embodiments, a host cell may be in vitro or in vivo. In some cases, a host cell may be from an established cell line or primary cells. In some cases, a host cell may be obtained from a patient having or suspected of having a repeat expansion disease or disorder. In embodiments, a host cell is a non-CNS cell, such as a fibroblast. In some cases, a host cell is a cell of the CNS, such as a neuron, a glial cell, an astrocyte, or a microglial cell.

[0062] As used herein, “expanded repeat containing gene” or “expanded repeat containingRNA” refers to a mutant gene or RNA molecule (e.g., pre-mRNA or mRNA) encoded by the mutant gene having a base sequence that includes a repeat region (e.g., GGGGCC repeat) where the repeat region is expanded beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. The presence or length of the repeat region may affect normal processing, function or activity of the RNA or encoded protein and cause a “repeat expansion” or “expanded repeat” disease or disorder. Expanded repeats may be unstable (dynamic) mutations that change size in successive generations. An expanded repeat may be a dinucleotide repeat, a trinucleotide repeat, a tetranucleotide repeat, a pentanucleotide repeat, a hexanucleotide repeat, etc. In some cases, a repeat is a GGGGCC repeat, a GGGCCG repeat, a GGCCGG repeat, or a GCCGGG repeat. In some cases, a repeat in an RNA is a CCCCGG repeat, a GCCCCG repeat, a GGCCCC repeat, or a CGGCCC repeat. An expanded repeat containing gene or RNA encoded by the expanded repeat containing gene may also be referred to as a “pathologic allele” or “pathogenic allele.” In some cases, a pathologic or pathogenic allele of a GGGGCC repeat containing gene or RNA encoded by the gene has > 30 consecutive GGGGCC repeats.

[0063] A “repeat expansion disease or disorder,” or “expanded repeat disease or disorder,” refers to a disease or disorder caused by the expansion of a base repeat sequence beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. A repeat expansion disease or disorder may manifest with markedly varied phenotypes depending on the size of the repeat expansion.

[0064] As used herein, “subject,” “patient,” and “individual” are used interchangeably herein and refer to living organisms (e.g., mammals) selected for treatment or therapy. Examples of subjects include human and non-human mammals. Non-human mammals include, e.g., non-human primates (monkey, chimpanzee), cows, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and transgenic species thereof.

[0065] As used herein, “subject,” “patient,” and “individual” are used interchangeably herein and refer to living organisms (e.g., mammals) selected for treatment or therapy. Examples of subjects include humans. Examples of subjects include non-human mammals, such as non-human primates (monkey,chimpanzee), cows, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and transgenic species thereof.

[0066] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0067] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and arc also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0068] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0069] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a small binding RNA” includes a plurality of such small binding RNAs and reference to “the microRNA scaffold” includes reference to one or more microRNA scaffolds and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0070] The use of the terms “a,” “an,” and “the,” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e.. meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges ofvalues herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10- 15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the embodiments of the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed.

[0071] As used herein, the term “about” used in connection with an amount indicates that the amount can vary by 10% of the stated amount. For example, “about 100” means an amount of from 90- 110. Where about is used in the context of a range, the “about” used in reference to the lower amount of the range means that the lower amount includes an amount that is 10% lower than the lower amount of the range, and “about” used in reference to the higher amount of the range means that the higher amount includes an amount 10% higher than the higher amount of the range. For example, from about 100 to about 1000 means that the range extends from 90 to 1100.

[0072] The term “and / or” as used herein a phrase such as “A and / or B” is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used herein a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0073] It is understood that aspects and embodiments of the present disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments.

[0074] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such subcombination was individually and explicitly disclosed herein.

[0075] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.DETAILED DESCRIPTION

[0076] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target GGGGCC repeat region; and ii) at least a second mismatch to the target GGGGCC repeat region. The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CCCCGG repeat region; and ii) at least a second mismatch to the target CCCCGG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation and / or accumulation of a disease-associated GGGGCC repeat-containing RNA. The present disclosure provides methods for treating GGGGCC repeat expansion-associated diseases.DOUBLE-STRANDED RNAS

[0077] The double-stranded target RNAs target the repeat region of a repeat-containing target RNA (e.g., an mRNA or a pre-mRNA), and contain from 2 to 7 (e.g., 2, 3, 4, 5, 6, or 7) mismatches relative to the repeat region in the target RNA. In some cases, the ds RNA contains only 2 mismatches to the target repeat region. In some cases, the ds RNA contains only 3 mismatches to the target repeat region. In some cases, the ds RNA contains only 4 mismatches to the target repeat region. In some cases, the ds RNA contains only 5 mismatches to the target repeat region. In some cases, the ds RNA contains only 6 mismatches to the target repeat region. In some cases, the ds RNA contains only 7 mismatches to the target repeat region. In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a firstmismatch to the target GGGGCC repeat region; and ii) at least a second mismatch to the target GGGGCC repeat region. In some cases, the first mismatch is at position 8; when the first mismatch is at position 8 based on the numbering of GGGGCCGGGGCCGGGGCCGGGGCC (SEQ ID NO:1) GGGCCGGGGCCGGGGCCGGGGCCG (SEQ ID NO:2), GGCCGGGGCCGGGGCCGGGGCCGG (SEQ ID NO:3), GCCGGGGCCGGGGCCGGGGCCGGG (SEQ ID NO:4), CCGGGGCCGGGGCCGGGGCCGGGG (SEQ ID NO:5), or CGGGGCCGGGGCCGGGGCCGGGGC (SEQ ID NO:6), the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 9; when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 10; when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 11; when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 10 bases 3’ of the first mismatch. In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region; and ii) at least a second mismatch to the target GGGGCC repeat region. In some cases, the first mismatch is at position 8; when the first mismatch is at position 8 based on the numbering of CCCCGGCCCCGGCCCCGGCCCCGG (SEQ ID NO:7), CCCGGCCCCGGCCCCGGCCCCGGC (SEQ ID NO: 8), CCGGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO:9), CGGCCCCGGCCCCGGCCCCGGCCC (SEQ ID NO: 10), GGCCCCGGCCCCGGCCCCGGCCCC (SEQ ID NO: 11), or GCCCCGGCCCCGGCCCCGGCCCCG (SEQ ID NO: 12), the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 9; when the first mismatch is at position 9 based on the numbering of SEQ ID NO:7, 8, 9 10, 11, or 12, the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 10; when the first mismatch is at position 10 based on the numbering of SEQ ID NO:7, 8, 9 10, 11, or 12, the second mismatch is from 1 to 11 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 11 ; when the first mismatch is at position 11 based on the numbering of SEQ ID NO:7, 8, 9 10, 11, or 12, the second mismatch is from 1 to 10 bases 3’ of the first mismatch.

[0078] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA. In some cases, thedsRNA does not comprise a substitution of a C with a G. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region of a CCCCGG repeatcontaining RNA. In some cases, the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 5 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA. In some cases, the fhst strand comprises no more than 6 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 6 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA. In some cases, the first strand comprises no more than 7 mismatches with the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, or the first strand comprises no more than 7 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA. In some cases, the mismatches are all within nucleotides 8-12, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, the mismatches are all within nucleotides 8-10, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, the mismatches are all within nucleotides 9-12, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, the mismatches are all within nucleotides 10-12, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the fust stand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the doublestranded RNA has a length of from 13 nucleotides to 35 nucleotides (e.g., from 13 nucleotides to 15 nucleotides, from 15 nucleotides to 17 nucleotides, from 17 nucleotides to 19 nucleotides, from 19 nucleotides to 21 nucleotides, from 21 nucleotides to 25 nucleotides, from 25 nucleotides to 30 nucleotides, or from 30 nucleotides to 35 nucleotides). In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has alength of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides.

[0079] In some cases, where the fust strand comprises 2 mismatches (e.g., only 2 mismatches), the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l- 12. In some cases, where the first strand comprises 2 mismatches (e.g., only 2 mismatches), the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the second mismatch is 3’ of nucleotide 11).

[0080] In some cases, where the fust strand comprises 3 mismatches (e.g., only 3 mismatches), the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, where the first strand comprises 3 mismatches (e.g., only 3 mismatches), the second mismatch is within nucleotides 8-1 1 , based on the numbering of any one of SEQ ID NOs:l-12 and the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the third mismatch is 3’ of nucleotide 11). In some cases, where the first strand comprises 3 mismatches (e.g., only 3 mismatches), the second and the third mismatches not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the second and third mismatches are 3’ of nucleotide 11.

[0081] In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, where the fust strand comprises 4 mismatches (e.g., only 4 mismatches), the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the fourth mismatch is 3’ of nucleotide 11). In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the third and fourth mismatches are 3’ of nucleotide 11). In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second, third, and fourth mismatches are not within nucleotides 8-1 1 , based on the numbering of any one of SEQ ID NOs: 1 -12 (e.g., the second, third, and fourth mismatches are 3’ of nucleotide 11).

[0082] In some embodiments, a dsRNA of the present disclosure may include a 5’ U or a 5’ A. A U or A at the fust (i.e., the 5') nucleotide in the guide strand can be included to favor its incorporation into the Argonaute protein during RISC formation and / or to favor its incorporation relative to the passenger strand. In such embodiments, while the 5’ U or the 5’ A present in the guide strand (e.g., the first strand) is a mismatch to the target GGGGCC repeat region of a GGGGCC repeat-containing RNA, this mismatch is not counted in the total number of mismatches present in the guide RNA relative to thetarget GGGGCC repeat region. For example, when the guide strand that binds to the repeat region of a repeat-containing target RNA includes a 5’ U or a 5’ A and includes a first mismatch and a second mismatch 3’ to the first mismatch, the total number of mismatches is indicated as 2. This is because the 5' U or a 5' A is an optional feature that is not present in every embodiment disclosed herein.Accordingly, the first strand (e.g., guide strand) that has 2, 3, 4, 5, 6, or 7 mismatches relative to the repeat region in the target RNA has 2+1, 3+1, 4+1, 5+1, 6+1, or 7+1 mismatches relative to the repeat region in the target RNA when the first strand includes a 5’ U or a 5’ A, where the 2, 3, 4, 5, 6, or 7 mismatches are spaced as described herein and the +1 mismatch is the 5’ U or a 5’ A. Thus, the present disclosure also encompasses dsRNA that includes a first mismatch and additional mismatch(es) 3’ to the first mismatch and an additional mismatch 5’ to the first mismatch where the additional mismatch 5’ to the first mismatch is the U or A. In certain embodiments, a dsRNA of the present disclosure may comprise a sequence as disclosed herein and may further include a 5’ A or a 5’ U. For example, the guide strand may further include a 5’ U in addition to the sequences disclosed herein.First mismatch at position 8; 2 mismatches

[0083] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-6; and ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 13 bases 3' of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3' of the first mismatch. In some cases, the second mismatch is 8 bases 3' of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 13 bases 3’ of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0084] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:7-12; and ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 13 bases 3’ of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. Insome cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0085] Non-limiting examples of first strand sequences are presented in FIG. 1, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 4, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 8; 3 mismatches

[0086] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the fust mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; and iii) a third mismatch to the target GGGGCC repeat region, where the thud mismatch is from 1 to 13 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and b) a second strand that hybridizes to the fust strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; and iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 13 bases 3' of the first mismatch; and b) a second strand that hybridizes to the fust strand.

[0087] For example, in some cases, the first mismatch, the second mismatch, and the thud mismatch are at positions 8, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 12, respectively, based on thenumbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 12 respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 9, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l -6 or any one of SEQ ID NOs:7-12.

[0088] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases,the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0089] Non-limiting examples of first strand sequences arc presented in FIG. 2, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 5, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 8; 4 mismatches

[0090] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the thud mismatch is from 1 to 13 bases 3' of the first mismatch; and iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 13 bases 3' of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a doublestranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 13 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0091] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or anyone of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 9, 10, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0092] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0093] Non-limiting examples of first strand sequences are presented in FIG. 3, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 6, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 8; 5 mismatches

[0094] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCCrepeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 13 bases 3’ of the first mismatch; and v) a fifth mismatch to the target GGGGCC repeat region, where the fifth mismatch is from 1 to 13 bases 3' of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 13 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CCCCGG repeat region, where the fifth mismatch is from 1 to 13 bases 3’ of the first mismatch and b) a second strand that hybridizes to the first strand.

[0095] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0096] As an example, in some cases, the first mismatch is at position 8, and the second, third, fourth, and fifth mismatches are at positions 9, 10, 11, and 12, respectively. As one non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCAAAAACGGCCCC (SEQ ID NO: 1886). As another non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCAAAAACGGCCCCGG (SEQ ID NO: 1887). As another non-limiting example, the firststrand comprises the nucleotide sequence GCCGGGGAAAAAGCCGGGG (SEQ ID NO: 1888). As another non-limiting example, the first strand comprises the nucleotide sequence GCCGGGGAAAAAGCCGGGGCC (SEQ ID NO: 1889).First mismatch at position 9; 2 mismatches

[0097] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-6; and ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3" of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3' of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch.

[0098] For example, in some cases, the first mismatch and the second mismatch arc at positions9 and 10, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 9 and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 9 and 13, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch and the second mismatch are at positions 9 and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch and the second mismatch are at positions 9 and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12.

[0099] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. Insome cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0100] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:7-12; and ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region. In some cases, the fust strand comprises no more than 4 mismatches with the target CCCCGG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches tothe first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0101] Non-limiting examples of first strand sequences are presented in FIG. 1, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 4, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 9; 3 mismatches

[0102] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; and iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; and iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0103] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, insome cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the fust mismatch, the second mismatch, and the third mismatch are at positions 9, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the fust mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12.

[0104] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the fust strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-strandedRNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0105] Non-limiting examples of first strand sequences are presented in FIG. 2, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 5, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 9; 4 mismatches

[0106] In some cases, a double-stranded RNA of the present disclosure comprises a) a fir st strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 12 bases 3' of the first mismatch; and iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a doublestranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0107] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1 -6 or any one of SEQ ID NOs:7-l 2. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or anyone of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 16, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 12, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 13, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0108] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases,the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0109] Non-limiting examples of first strand sequences are presented in FIG. 3, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 6, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 9; 5 mismatches

[0110] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 12 bases 3' of the first mismatch; iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and v) a fifth mismatch to the target GGGGCC repeat region, where the fifth mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the fir st strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CCCCGG repeat region, where the fifth mismatch is from 1 to 12 bases 3’ of the first mismatch and b) a second strand that hybridizes to the first strand.

[0111] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. Insome cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0112] As an example, in some cases, the first mismatch is at position 9, and the second, third, fourth, and fifth mismatches are at positions 10, 11, 12, and 15, respectively. As one non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCGAAAACGACCCCGG (SEQ ID NO: 1890). As another non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCGAAAACGACCCC (SEQ ID NO:1891). As another non-limiting example, the first strand comprises the nucleotide sequence GCCGGGGCAAAAGCAGGGGCC (SEQ ID NO: 1892). As another non-limiting example, the first strand comprises the nucleotide sequence GCCGGGGCAAAAGCAGGGG (SEQ ID NO: 1893).

[0113] As another example, in some cases, the first mismatch is at position 9, and the second, third, fourth, and fifth mismatches are at positions 10, 11, 15, and 19, respectively. As one non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCGAAACCGACCCAGG (SEQ ID NO: 1894). As another non-limiting example, the first strand comprises the nucleotide sequence CGGCCCCGAAACCGACCCA (SEQ ID NO: 1895). As another non-limiting example, the first strand comprises the nucleotide sequence GCCGGGGCAAAGGCAGGGACC (SEQ ID NO: 1896). As another non-limiting example, the first strand comprises the nucleotide sequence GCCGGGGCAAAGGCAGGGA (SEQ ID NO: 1897).First mismatch at position 10; 2 mismatches

[0114] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-6; and ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 11 bases 3’ of the fir st mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, thesecond mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3' of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the fir st strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the fir st strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the doublestranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0115] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the fir st mismatch is at position 10 based on the number of any one of SEQ ID NOs:7-12; and ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3' of the first mismatch. In some cases, the second mismatch is 5 bases 3' of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases,the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch.

[0116] For example, in some cases, the first mismatch and the second mismatch are at positions 10 and 11, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 15, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 17, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, the first mismatch and the second mismatch are at positions 10 and 19, respectively, based on the numbering of any one of SEQ ID NOs: 1-6 or any one of SEQ ID NOs:7-12.

[0117] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0118] Non-limiting examples of first strand sequences are presented in FIG. 1, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 4, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 10; 3 mismatches

[0119] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 1 1 bases 3’ of the first mismatch; and iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 11 bases 3' of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0120] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions10, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 13, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0121] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0122] Non-limiting examples of first strand sequences are presented in FIG. 2, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 5, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 10; 4 mismatches

[0123] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCCrepeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a doublestranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0124] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 13, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 15, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 16, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, insome cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 13, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 16, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 13, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0125] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0126] Non-limiting examples of first strand sequences are presented in FIG. 3, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 6, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 10; 5 mismatches

[0127] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 10 based on the number of anyone of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 11 bases 3' of the first mismatch; iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 11 bases 3' of the first mismatch; and v) a fifth mismatch to the target GGGGCC repeat region, where the fifth mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the fir st strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 11 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CCCCGG repeat region, where the fifth mismatch is from 1 to 11 bases 3’ of the first mismatch and b) a second strand that hybridizes to the first strand.

[0128] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.First mismatch at position 11; 2 mismatches

[0129] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b)a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-6; and ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 10 bases 3' of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3' of the first mismatch. In some cases, the second mismatch is 8 bases 3' of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0130] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:7-12; and ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 1base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3' of the first mismatch. In some cases, the second mismatch is 5 bases 3' of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the fust strand comprises no more than 2 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the fust strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the fust strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0131] Non-limiting examples of first strand sequences are presented in FIG. 1, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 4, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 11; 3 mismatches

[0132] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the secondmismatch is from 1 to 10 bases 3’ of the first mismatch; and iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 10 bases 3' of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; and iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0133] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7- 12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0134] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases,the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0135] Non-limiting examples of first strand sequences arc presented in FIG. 2, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 5, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 11; 4 mismatches

[0136] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the thud mismatch is from 1 to 10 bases 3' of the first mismatch; and iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 10 bases 3' of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a doublestranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0137] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 16, and 21, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or anyone of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 17, and 21, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 13, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 13, 14, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 15, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 18, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 13, 16, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-6 or any one of SEQ ID NOs:7-12.

[0138] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 4 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0139] Non-limiting examples of first strand sequences are presented in FIG. 3, where the target RNA is a GGGGCC (“G4C2”) repeat-containing RNA. Non-limiting examples of first strand sequences are presented in FIG. 6, where the target RNA is a CCCCGG (“C4G2”) repeat-containing RNA.First mismatch at position 11; 5 mismatches

[0140] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target GGGGCC repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-6; ii) a second mismatch to the target GGGGCC repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target GGGGCC repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; iv) a fourth mismatch to the target GGGGCC repeat region, where the fourth mismatch is from 1 to 10 bases 3’ of the first mismatch; and v) a fifth mismatch to the target GGGGCC repeat region, where the fifth mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand. In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CCCCGG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:7-12; ii) a second mismatch to the target CCCCGG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target CCCCGG repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CCCCGG repeat region, where the fourth mismatch is from 1 to 10 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CCCCGG repeat region, where the fifth mismatch is from 1 to 10 bases 3’ of the first mismatch and b) a second strand that hybridizes to the first strand.

[0141] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U. In some cases, the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (c.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the secondstrand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.Chemical modifications

[0142] A nucleic acid of the present disclosure (c.g., an sbRNA, a nucleic acid comprising an sbRNA of the present disclosure, or a nucleic acid encoding both strands of an sbRNA of the present disclosure) can comprise one or more of the following: i) one or more chemically modified nucleobases; ii) one or more chemically modified sugars; and iii) one or more chemically modified internucleoside or internucleotide linkages). In some cases, the one or more modifications provide for increased nuclease resistance, compared to the nucleic acid not comprising the one or more modifications.

[0143] In some embodiments, an RNA of the present disclosure (e.g., an sbRNA) comprises one or more modifications (e.g., a base modification, a backbone modification, a sugar modification). In some embodiments, a DNA of the present disclosure (e.g., a DNA comprising a nucleotide sequence encoding an RNA (e.g., a dsRNA) of the present disclosure) comprises one or more modifications (e.g., a base modification, a backbone modification, a sugar modification). A nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear' polymeric compound can be further joined to form a circular compound, however, linear compounds are suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

[0144] Suitable nucleic acid modifications include, but are not limited to: 2’O-methyl modified nucleotides, 2’ -Fluoro modified nucleotides, 2’-O-(2-methoxyethyl) modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioate linkages, and a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). Additional details and additional modifications are described below.

[0145] A 2'-O-Methyl modified nucleotide (also referred to as 2'-O-Methyl RNA) is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a post-transcriptional modification. Oligonucleotides can be directly synthesized that contain 2'-O-Methyl RNA. This modification increases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNA stability. It is stable with respect to attack by single-stranded ribonucleases and is typically 5 to 10-fold less susceptible to DNases than DNA.

[0146] 2' -Fluoro modified nucleotides (e.g., 2' Fluoro bases) have a fluorine modified ribose which increases binding affinity (Tm) and also confers some relative nuclease resistance when compar ed to native RNA. These modifications improve stability in serum or other biological fluids.

[0147] 2’-O-(2-methoxyethyl) modified nucleotides have a 2-methoxyethyl modified ribose which increases pairing stability and also confers some relative nuclease resistance when compared to native RNA. These modifications improve stability in serum or other biological fluids.

[0148] LNA bases have a modification to the ribose backbone that locks the base in the C3'-endo position, which favors RNA A-type helix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end.

[0149] The phosphorothioate (PS) bond (i.e., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5'- or 3'-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well.

[0150] In some cases, a subject nucleic acid has one or more nucleotides that are 2'-O-Methyl modified nucleotides. In some cases, a subject nucleic acid has one or more 2’ Fluoro modified nucleotides. In some cases, a subject nucleic acid has one or more LNA bases. In some cases, a subject nucleic acid has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the subject nucleic acid has one or more phosphorothioate linkages). In some cases, a subject nucleic acid has a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). In some cases, a subject nucleic acid has a combination of modified nucleotides. For example, a subject nucleic acid can have a 5’ cap (e.g., a 7-methylguanylate cap (m7G)) in addition to having one or more nucleotides with other modifications (e.g., a 2'-O-Methyl nucleotide and / or a 2’ Fluoro modified nucleotide and / or a LNA base and / or a phosphorothioate linkage).Modified backbones and modified internucleoside linkages

[0151] In some cases, a nucleic acid of the present disclosure includes a modified backbone or one or more non-natural internucleoside linkages. Nucleic acids having modified backbones include thosethat retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

[0152] Suitable modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included.

[0153] In some cases, a subject nucleic acid comprises one or more phosphorothioate and / or heteroatom internucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and - O-N(CH3)-CH2-CH - (wherein the native phosphodiester internucleotide linkage is represented as -O- P(=O)(OH)-O-CH2-). MMI type intcrnuclcosidc linkages arc disclosed in the above referenced U.S. Pat. No. 5,489,677, the disclosure of which is incorporated herein by reference in its entirety. Suitable amide internucleoside linkages are disclosed in U.S. Pat. No. 5,602,240, the disclosure of which is incorporated herein by reference in its entirety.

[0154] Also suitable are nucleic acids having morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506. For example, in some cases, a subject nucleic acid comprises a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage.

[0155] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.Mimetics

[0156] A subject nucleic acid can be a nucleic acid mimetic. The term "mimetic" as it is applied to polynucleotides is intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0157] One polynucleotide mimetic that has been reported to have excellent hybridization properties is a peptide nucleic acid (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.Representative U.S. patents that describe the preparation of PNA compounds include, but are not limited to: U.S. Pat. Nos. 5,539,082; 5,714,331 ; and 5,719,262, the disclosures of which are incorporated herein by reference in their entirety.

[0158] Another class of polynucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. The nonionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based polynucleotides are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based polynucleotides are disclosed in U.S. Pat. No. 5,034,506, the disclosure of which is incorporated herein by reference in its entirety. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.

[0159] A further class of polynucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et aL, J. Am. Chem. Soc., 2000, 122, 8595-8602, the disclosure of which isincorporated herein by reference in its entirety). In general, the incorporation of CeNA monomers into a DNA chain increases the stability of a DNA / RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.

[0160] A further modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456, the disclosure of which is incorporated herein by reference in its entirety). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10° C), stability towards 3'-exonucleolytic degradation and good solubility properties. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (e.g., Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638, the disclosure of which is incorporated herein by reference in its entirety).

[0161] The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5-methyl- cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630, the disclosure of which is incorporated herein by reference in its entirety). LNAs and preparation thereof arc also described in WO 98 / 39352 and WO 99 / 14226, as well as U.S. applications 20120165514, 20100216983, 20090041809, 20060117410, 20040014959, 20020094555, and 20020086998, the disclosures of which are incorporated herein by reference in their entirety.Modified sugar moieties

[0162] A subject nucleic acid can also include one or more substituted sugar moieties. Suitable polynucleotides comprise a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.l to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO)mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other suitable polynucleotides comprise a sugar substituent group selected from: Ci to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modificationincludes 2'-methoxy ethoxy (2'-O-CH2 CH2OCH3, also known as 2'-0-(2-methoxyethyl) or 2'-M0E) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504, the disclosure of which is incorporated herein by reference in its entirety) i.e., an alkoxy alkoxy group. A further suitable modification includes 2'- dimethylaminooxyethoxy, i.e., a OiCfFhONlCH ih group, also known as 2'-DMA0E, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl- amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.

[0163] Other suitable sugar substituent groups include methoxy (-O-CH3), aminopropoxy (— O CHi CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (—0— CH2 — CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3’ position of the sugar on the 3’ terminal nucleoside or in 2’-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.Base modifications and substitutions

[0164] A subject nucleic acid may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5 -methylcytosine (5- mc-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadcninc, 6-mcthyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3- deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(lH-pyrimido(5,4-b)(l,4)benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido(5,4- b)(l,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2- aminoethoxy)-H-pyrimido(5,4-(b) (l,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5- b)indol-2-one), pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).

[0165] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed.John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993; the disclosures of which are incorporated herein by reference in their entirety. Certain of these nucleobases are useful for increasing the binding affinity of an oligomeric compound. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278; the disclosure of which is incorporated herein by reference in its entirety) and are suitable base substitutions, e.g., when combined with 2'-O-methoxyethyl sugar modifications.Conjugates

[0166] In some cases, a subject nucleic acid comprises one or more moieties conjugated to the nucleic acid. Thus, the present disclosure provides a conjugate comprising: a) a nucleic acid of the present disclosure, e.g., a double-stranded RNA of the present disclosure; and b) one or more non-nucleic acid moieties conjugated to the nucleic acid, directly or via a linker.

[0167] In some cases, the non-nucleic acid moiety is conjugated to the double-stranded RNA directly. In some cases, the non-nucleic acid moiety is conjugated to the double-stranded RNA via a linker. Suitable linkers can contain an ether, a thiocthcr, urea, carbonate, an amine, an amide, malcimidc- thioether, disulfide, phosphodiester, sulfonamide, a product of a click chemistry reaction (e.g., a triazole from an azide-alkyne cycloaddition), or a carbamate.

[0168] In some cases, a moiety conjugated to a subject nucleic acid enhances the activity, stability, cellular distribution, or cellular uptake of the nucleic acid. Suitable moieties include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Suitable conjugate groups include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a subject nucleic acid.

[0169] Suitable conjugate moieties include, but are not limited to, a lipid moiety, such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate or hexadecylglycerol (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651- 3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); a polyamine or a polyethylene glycol chain (Manoharan et aL, Nucleosides & Nucleotides, 1995, 14, 969-973); adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); a retinoic acid moiety; a 1-pyrene butyric acid moiety; a dihydrotestosterone moiety; a geranyloxyhexanol moiety; a borneol moiety; a menthol moiety; a 1,3- propanediol moiety; a heptadecyl group; a myristic acid moiety; an O3-(oleoyl)lithocholic acid moiety; an 03-(oleoyl)cholenic acid moiety; a dimcthoxytrityl moiety; and a phenoxazine moiety.

[0170] The present disclosure provides a conjugate comprising: a) a double-stranded RNA of the present disclosure; and b) one or more lipophilic moieties conjugated to one or more internal positions on one or both strands of the double-stranded RNA, where the one or more lipophilic moieties is conjugated to the double-stranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties is a highly hydrophobic lipid, a moderately hydrophobic lipid, or an amphiphilic lipid. Examples of highly hydrophobic lipids include cholesterol and docosanoic acid (DCA). Examples of moderately hydrophobic lipids include unsaturated fatty acid, e.g., eicosapentaenoic acid (EPA). Examples of amphiphilic lipids include dendrimers. An example of a dendrimer that may be conjugated to a doublestranded RNA of the present disclosure is depicted in Fig. 20.

[0171] In some cases, the one or more lipophilic moieties is selected from: a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propandediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxy trityl, DCA, eicosapentaenoic acid, dendrimer, and phenoxazine. In some cases, the one or more lipophilic moieties is or comprises a palmityl moiety. In some cases, the one or more lipophilic moieties contains a saturated or unsaturated C4-C30 hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated C4-C30 hydrocarbon chain conjugated to one or both strands of the double-stranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties comprises a saturated or unsaturated C4-C30 hydrocarbon chain and a functional group. In some cases, theone or more lipophilic moieties comprises a saturated or unsaturated hydrocarbon chain having 5 or more carbons and a functional group. Suitable functional groups include, e.g., a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne. In some cases, the one or more lipophilic moieties is or comprises a Ce-Cis hydrocarbon chain, e.g., Ci6, Cis, C20, or C22 hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated Ce-Cis hydrocarbon chain conjugated to one or both strands of the double-stranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties is or comprises a Ci6 hydrocarbon chain. In some cases, the one or more lipophilic moieties is or comprises a C20 saturated or unsaturated hydrocarbon chain. In some cases, the one or more lipophilic moieties is or comprises a C22 saturated or unsaturated hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated Ci6 hydrocarbon chain conjugated to one or both strands of the double-stranded RNA directly or via a linker.

[0172] In some cases, the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase in the double-stranded RNA. In some cases, the lipophilic moiety is conjugated, directly or via a linker, to a sugar moiety, e.g., 2’0, in the double-stranded RNA. In some cases, the lipophilic moiety is conjugated, directly or via a linker, to an internucleoside linkage in the double-stranded RNA.

[0173] In one embodiment, the lipophilic moiety is conjugated to one or both terminal positions and / or one or more internal positions on at least one strand of the double-stranded RNA. In one embodiment, the lipophilic moiety is conjugated to one or more internal positions on at least one strand, which include all positions except the terminal three positions from each end of the strand.

[0174] In one embodiment, two or more of the lipophilic moieties are conjugated to one or both terminal positions and / or one or more internal positions on at least one strand of the double-stranded RNA. In one embodiment, two or more of the lipophilic moieties are conjugated to one or more internal positions on at least one strand, which include all positions except the terminal three positions from each end of the strand.Target nucleic acids and target cells

[0175] The double stranded RNAs of the present disclosure may be targeted to any gene or nucleic acid construct containing the targeted repeat region, where the targeted repeat region comprises a repeat of GGGGCC or a repeat of CCCCGG. In some cases, a target RNA is an antisense RNA. In some cases, a target RNA is a sense RNA. The target RNA is present in a target cell having an expanded GGGGCC repeat in an intron of the C9orf72 gene.

[0176] In some cases, the target GGGGCC repeat region in a target RNA has more than 30GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has more than 50GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has more than 100GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has more than 250 repeats. In some cases, the target GGGGCC repeat region in a target RNA has from 550 GGGGCC repeats to 700 GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has from 550 GGGGCC repeats to 1000 GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has from 550 GGGGCC repeats to 1600 GGGGCC repeats. In some cases, the target GGGGCC repeat region in a target RNA has up to 3500 GGGGCC repeats.

[0177] In some cases, the target CCCCGG repeat region in a target RNA has more than 30 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has more than 50 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has more than 100 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has more than 250 repeats. In some cases, the target CCCCGG repeat region in a target RNA has more than 500 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has from 550 CCCCGG repeats to 700 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has from 550 CCCCGG repeats to 1000 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has from 550 CCCCGG repeats to 1600 CCCCGG repeats. In some cases, the target CCCCGG repeat region in a target RNA has up to 3500 CCCCGG repeats.

[0178] Target cells having an expanded GGGGCC repeat in an intron of the C9orf72 gene can have a normal (wild-type) allele of the C9orf72 gene and a disease-associated allele of the C9orf72 gene, where the disease-associated allele has an expanded GGGGCC repeat in an intron of the C9orf72 gene.

[0179] Target cells include, but are not limited to, neurons, e.g., motor neurons and cortical neurons; astrocytes; microglia; and oligodendrocytes.NUCLEIC ACIDS, EXPRESSION CASSETTES, AND RECOMBINANT EXPRESSION VECTORS

[0180] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising a double-stranded RNA of the present disclosure in a microRNA (miR) scaffold. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant RNA comprising a double-stranded RNA of the present disclosure present in a miR scaffold. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA comprising a double-stranded RNA of the present disclosure present in a miR scaffold. In some cases, a double stranded RNA of the disclosure is encoded by a nucleic acid molecule, for example a DNA molecule. Double stranded RNAs provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.

[0181] In some cases, a nucleic acid molecule (e.g., DNA) encoding the double stranded RNA is contained within an expression cassette. In some cases, the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene.“Operably linked” sequences include expression control sequences that are contiguous with the transgene or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly A) signal sequences, or any combination thereof.

[0182] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a dsRNA of the present disclosure, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide. The present disclosure comprises a DNA molecule encoding such a recombinant nucleic acid. The present disclosure comprises a recombinant expression vector comprising the DNA molecule.

[0183] In some cases, a dsRNA of the disclosure is encoded by a nucleic acid molecule, for example a DNA molecule. Double stranded RNA sequences provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.

[0184] In some cases, nucleic acid molecule (e.g., DNA) encoding the double stranded RNA is contained within an expression cassette or a recombinant expression vector.

[0185] In some cases, the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene. “Operably linked” sequences include expression control sequences that arc contiguous with the transgcnc or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly A) signal sequences, or any combination thereof.

[0186] In some cases, a promoter is an endogenous promoter, synthetic promoter, hybrid promoter, constitutive promoter, inducible promoter, tissue-specific promoter (e.g., central nervous system (CNS)-specific), or cell-specific promoter (neurons, glial cells, or astrocytes). Examples of constitutive promoters include, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter (optionally with the RSV enhancer), cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), SV40 promoter, and dihydrofolate reductase promoter. Examples of inducible promoters include zinc -inducible sheep metallothionine (MT) promoter, dexamethasone (Dex) -inducible mousemammary tumor virus (MMTV) promoter, T7 polymerase promoter system, the ecdysone insect promoter, tetracycline -repressible system, tetracycline-inducible system, RU486-inducible system, and the rapamycin-inducible system. Further examples of promoters that may be used include, for example, chicken beta-actin promoter (CBA promoter), a CAG promoter, an Hl promoter, a CD68 promoter, a JeT promoter, synapsin promoter, RNA pol II promoter, or an RNA pol III promoter (e.g., U6, Hl, etc.).

[0187] In some cases, a promoter is an RNA pol II promoter. Examples of pol II promoters include PGK, CBA, Ul, CMV, EIFla, EFla, CAG, or synaptophysin promoters. In some cases, the promoter is a tissue-specific RNA pol II promoter. In some cases, the tissue-specific RNA pol II promoter is derived from a gene that exhibits neuron-specific expression. In some cases, an expression cassette comprises a pol II promoter and a poly(A) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol II promoter and on the 3’ end by the poly(A) tail.

[0188] In some cases, a promoter is a neuron specific promoter. Examples of neuron-specific promoters include those from neuron specific enolase (NSE), human synapsin 1, human synapsin 2 promoter, caMK kinase, and tubulin.

[0189] In some cases, a promoter is an RNA pol III promoter. Examples of pol III promoters include U6, Hl, 7SK, Y, RPR, MRP, and selenocysteine tRNA. In some cases, an expression cassette comprises a pol III promoter and a poly(T) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol III promoter and on the 3’ end by the poly(T) tail.

[0190] In some cases, a promoter is an RNA pol I promoter. In some cases, an expression cassette comprises a pol I promoter and a 3’-box, e.g. with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol I promoter and on the 3’ end by the 3’-box.

[0191] Expression cassettes for double stranded RNAs are known in the ait, see, e.g., ter Brake ct al. Mol. Thor. (2008) 16:557; Maczuga ct al., BMC Biotcchnol. (2012) 12:42; and Bofill-Dc Ros and Gu (2016) 103:157.

[0192] In some cases, the DNA sequence encoding the double stranded RNA of the disclosure is positioned in an untranslated region of an expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron, a 5' untranslated region (5 ’UTR), or a 3' untranslated region (3'UTR) of the expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron downstream of the promoter and upstream of an expressed gene.

[0193] In some cases, the DNA nucleotide sequence encoding a dsRNA of the disclosure is flanked by two AAV inverted terminal repeats (ITRs) (e.g., 5’ ITR and 3’ ITR) within the expression cassette. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)). In some cases, one of theITRs is truncated (e.g., shortened or not full- length). In some cases, a truncated ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors).

[0194] In some cases, the expression cassette comprises a nucleotide sequence selected from the nucleotide sequences depicted in FIG. 7A-7B or FIG. 8A-8B. In some cases, the cassette does not include the 3’ TTTTTT sequence. FIG. 7A presents the 5’miRNA arm (5’-3’), DNA guide strand sequence (5’-3 ’), loop, and dinucleotide of a cassette; FIG. 7B provides the passenger strand, 3’-miRNA arm (5 ’-3'), and Pol3 transcription termination (TTTTTT) of the same cassette. FIG. 8 A presents the 5'miRNA arm (5'-3’), DNA guide strand sequence (5’-3'), loop, and dinucleotide of a cassette; FIG. 8B provides the passenger strand, 3’-miRNA arm (5’-3’), and Pol3 transcription termination (TTTTTT) of the same cassette.

[0195] In some cases, an expression cassette of the present disclosure comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 13-238. In some cases, an expression cassette of the present disclosure comprises the nucleotide sequence set forth in any one of SEQ ID NOs:239-610.

[0196] An expression cassette as set forth in SEQ ID NOs:13-238 and in SEQ ID NOs:239-610 (and depicted in FIG. 7A, FIG. 7B, FIG. 8A, and FIG. 8B) includes 5’ flanking polynucleotide (5’ miRNA arm), a 3' flanking polynucleotide (3’-miRNA arm), and a loop polynucleotide derived from miR33. Thus, for example, the 5’ flanking polynucleotide of the expression cassettes set forth in SEQ ID NOs: 13-238 and in SEQ ID NOs:239-610 has the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:611); the loop polynucleotide of the expression cassettes set forth in SEQ ID NOs: 13-238 and in SEQ ID NOs:239-610 has the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:612); and the 3’ flanking polynucleotide of the expression cassettes set forth in SEQ ID NOs: 13-238 and in SEQ ID NOs:239-610 has the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:613).

[0197] In some cases, an expression cassette of the present disclosure includes a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide from miRlOl. Thus, for example, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of any one of the expression cassettes as set forth in SEQ ID NOs: 13-238 and in SEQ ID NQs:239-610 can be replaced with the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of miRlOl depicted in FIG. 13. As another example, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of any one of the expression cassettes as set forth in SEQ ID NOs: 13-238 and in SEQ ID NOs:239-610 can be replaced with the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of miR126 depicted in FIG. 13.

[0198] In some cases, a dsRNA described herein is encoded by a recombinant expression vector, such as a plasmid, a non-viral vector, or a viral vector. The use of vectors for expressing doublestranded RNAs of the present disclosure can allow for continual or controlled expression of the doublestranded RNAs in a subject, thus obviating the need for multiple doses of the double-stranded RNAs to be administered to the subject. The present disclosure provides a recombinant vector comprising a nucleotide sequence encoding a double-stranded RNA of the present disclosure. The present disclosure provides a recombinant vector comprising an expression cassette encoding a double-stranded RNA of the present disclosure.

[0199] Suitable viral vectors include, but are not limited to, herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, baculoviral vectors, and the like.

[0200] In some cases, the vector encoding a dsRNA of the present disclosure is a retroviral vector. In some cases, a retroviral vector is a mouse stem cell virus, murine leukemia virus (e.g., Moloney murine leukemia virus vector), feline leukemia virus, feline sarcoma virus, or avian reticuloendotheliosis virus vector. In some cases, the vector encoding a dsRNA of the present disclosure is a lentivirus or lentiviral based vector. In some cases, a lentiviral vector is a HIV (human immunodeficiency virus, including HIV type 1 and HIV type 2), equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-Visna viral vector. Methods for expressing shRNAs using lentivirus engineered cells are known in the art, for example, Stegmeier et al. Proc. Natl. Acad. Sci. USA (2005) 102:13212-13217; Klinghoffer et al. RNA (2010) 16:879-884. Production of replication-incompetent recombinant lentivirus may be achieved, for example, by co-transfection of expression vectors and packaging plasmids using commercially available packaging cell lines, such as TLA-HEK293TM, and packaging plasmids (Thermo Scientific / Open Biosystems, Huntsville, AL).

[0201] In some cases, the vector encoding a dsRNA of the present disclosure is an adeno- associated virus (AAV) vector, such as a recombinant rAAV vector, which is produced by recombinant methods. AAV is a single-stranded, non-enveloped DNA virus having a genome that encodes proteins for replication (rep) and the capsid (Cap), flanked by two ITRs, which serve as the origin of replication of the viral genome. AAV also contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid. In some cases, the AAV vector comprises an expression cassette encoding a dsRNA of the present disclosure flanked by two cis-acting AAV ITRs (5’ ITR and 3’ ITR). Functional ITR sequences are used for the rescue, replication and packaging of the AAV viral particle. Thus, an AAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e.g., one or two functional ITRs and packaging sequence) of the virus. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS)and terminal resolution site (trs)). In some cases, one or both of the ITRs is modified, e.g., by insertion, deletion, or substitution, provided that the ITRs provide for functional rescue, replication, and packaging. In some cases, a modified ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors). In some cases, the ITRs are selected from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11 and variants thereof. In some cases, the ITRs are from AAV2.

[0202] Other expression control sequences may be present in the rAAV vector operably linked to the DNA sequence encoding the double stranded RNA, including one or more of transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, poly adenylation (poly A) signal sequences, or any combination thereof.

[0203] rAAV vectors may have one or more AAV wild type genes deleted in whole or in part. In some embodiments the rAAV vector is replication defective. In some cases, the rAAV vector lacks a functional Rep protein and / or capsid protein.

[0204] Methods of packaging recombinant AAV vector into AAV capsids using host cell culture are known in the art. In some cases, one or more of the required components for packaging the rAAV vector, (e.g., Rep sequence, cap sequence, and / or accessory functions) may be provided by a stable host cell that has been engineered to contain the one or more required components (e.g., by a vector). Expression of the required components for AAV packaging may be under control of an inducible or constitutive promoter in the host packaging cell. AAV helper vectors are commonly used to provide transient expression of AAV rep and / or cap genes, which function in trans, to complement missing AAV functions that are necessary for AAV replication. In some cases, AAV helper vectors lack AAV ITRs and can neither replicate nor package themselves. AAV helper vectors can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion.

[0205] Recombinant AAV vectors of the present disclosure may be encapsidated by an AAV capsid to form a rAAV particle. A “rAAV particle” or “rAAV virion” refers to an infectious, replication-defective virus including an AAV protein shell, encapsidating a transgene of interest which is flanked on both sides by AAV ITRs. A rAAV particle is produced in a suitable host cell which has sequences specifying a rAAV vector, AAV helper functions and accessory functions introduced therein to render the host cell capable of encoding AAV polypeptides that are required for packaging the rAAV vector (containing the transgene sequence of interest) into infectious rAAV particles for subsequent gene delivery to a target cell.

[0206] In some cases, rAAV particles may be produced using the triple transfection method (see, e.g., U.S. Patent No. 6,001,650, incorporated herein by reference in its entirety). In this approach, the rAAV particles are produced by transfecting a host cell with a rAAV vector (comprising a transgene)to be packaged into rAAV particles, an AAV helper vector, and an accessory function vector. In some cases, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The accessory function vector encodes nucleotide sequences for non- AAV derived viral and / or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions”). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus. In some cases, a double transfection method, wherein the AAV helper function and accessory function are cloned on a single vector, is used to generate rAAV particles.

[0207] The AAV capsid is an important element in determining the tissue-specificity of the rAAV particle. Thus, a rAAV particle having a particular capsid tissue specificity can be selected. In some cases, the rAAV particle comprises a capsid selected from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof. In some cases, the AAV capsid is selected from a serotype that is capable of crossing the bloodbrain barrier, e.g., AAV9, AAVrh.10, or a variant thereof. In some cases, the AAV capsid is a chimeric AAV capsid.

[0208] In some cases, the rAAV vector is a mammalian serotype AAV vector (e.g., AAV genome and ITRs derived from mammalian serotype AAV), including a primate serotype AAV vector or human serotype AAV vector. In some cases, the AAV vector is derived from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof. In some cases, the AAV vector is a chimeric AAV vector. In some cases, rAAV vectors may be vectors comprising an AAV genome and AAV capsid derived from the same AAV serotype. In some cases, rAAV vectors are pseudotyped, meaning the rAAV vectors comprise an AAV genome derived from one AAV serotype and an AAV capsid derived at least in part from a different AAV serotype.

[0209] In some cases, the rAAV vector is AAV9 serotype. In some cases, the rAAV comprises an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), an AAV9 rep protein (e.g., SEQ ID NO:3 of US Patent No. 7,198,951), or both. In some cases, the rAAV comprises: (i) an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), and (ii) AAV2 ITRs.

[0210] In some cases, the rAAV particle is capable of transducing cells of the central nervous system (CNS). In some cases, the rAAV particle is capable of transducing non-neuronal cells or neuronal cells of the CNS. In some cases, the CNS cell is a neuron, glial cell, astrocyte, or microglial cell.

[0211] In some cases, the rAAV vector is a self-complementary AAV (scAAV) vector. scAAV vectors contain two complementary DNA strands in the form of a dimeric inverted repeat genome. The two complementary str ands within the dimeric inverted repeat genome anneal together to form one double stranded DNA that is ready for immediate replication and transcription, thus bypassing the requirement for host cell DNA synthesis. Self-complementary AAV vectors are described in U.S. Patent Nos. 7,465,583; 7,790,154; 8,361,457; and 8,784,799.

[0212] The present disclosure also provides host cells transfected with the rAAV comprising a nucleotide sequence encoding a dsRNA of the present disclosure. In some cases, the host cell is a prokaryotic cell or a eukaryotic cell. In some cases, the host cell is a mammalian cell (e.g., HEK293T, COS cells, HeLa cells, KB cells), bacterial cell (Escherichia coll), yeast cell, insect cell (Sf9, Sf21, Drosophila, mosquito), etc. In some cases, the host cell is obtained or derived from a human subject. In some cases, the host cell is a fibroblast. In some cases, the host cell is a neuron.DNA molecule encoding one or both strands of a double-stranded RNA

[0213] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding: i) the first strand of a double-stranded RNA of the present disclosure; and ii) the second strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand and the second strand is operably linked to a promoter. In some cases, the promoter is a PollI promoter. In some cases, the promoter is a U6 promoter. In some cases, the promoter is a CAG promoter. In some cases, the promoter is a CBA promoter. In some cases, the promoter is a CMV promoter. In some cases, the promoter is an EFla promoter. In some cases, the promoter is an Hl promoter. In some cases, a DNA molecule of the present disclosure comprises a nucleotide sequence that encodes any one of SEQ ID NOs:295-375.Recombinant RNA molecules

[0214] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flankingpolynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR451. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR144. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miRlOl. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide are derived from miR126. Examples of 5’ flanking polynucleotides, loop polynucleotides, and 3’ flanking polynucleotides are provided in FIG. 13.

[0215] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3' trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double- stranded RNA; iii) the second strand of the doublestranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.Cassettes encoding a recombinant RNA molecule

[0216] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotidesequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred to herein as a “5' leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3' of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0217] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises:i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 650 nucleotides (e.g., from 110 nucleotides (nt) to 115 nt, from 115 nt to 120 nt, from 500 nt to 600 nt, or from 600 nt to 610 nt). In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0218] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:611). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:612). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:613). In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequencerpprpp’p’p y of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3' of the nucleotide sequence encoding the 3' flanking polynucleotide.

[0219] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence TCAGGTAGATATGAGACTGAACTGTCCTTTG (SEQ IDNO: 1898). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence TGTATATCUGAAAGG (SEQ ID NO: 1899). In some cases, the portion of the cassette encoding the 3' flanking polynucleotide comprises the nucleotide sequence GAATGGTGGTGCCATCACATTGAGAAAGGG (SEQ ID NO: 1900). In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence Ty pp y of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a poly adenylation sequence 3’ of the nucleotide sequence encoding the 3' flanking polynucleotide.

[0220] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence TCTGGAAGACGCCACGCCTCCGCTGGCGACGGGA (SEQ ID NO: 1901). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence CTGTGACACTTCAAAC (SEQ ID NO: 1902). In some cases, the portion of the cassette encoding the 3' flanking polynucleotide comprises the nucleotide sequence CCGTCCACGGCACCGCATCGAAAACGCCGCTG (SEQ ID NO: 1903).Recombinant expression vector encoding sbRNA

[0221] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CAG promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CBA promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFla promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno- associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0222] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) amicroRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.

[0223] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3' flanking polynucleotide (also referred to herein as a “3' trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.Recombinant expression vector comprising a cassette

[0224] The present disclosure provides a recombinant expression vector comprising cassette (a “DNA molecule”) of the present disclosure, where the cassette comprises a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFla promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.Tandem miRNA scaffold / sbRNAs

[0225] In some cases, a nucleic acid of the present disclosure comprises two recombinant RNAs (c.g., an RNA comprising a miRNA scaffold and an sbRNA of the present disclosure, as described above). This is depicted schematically in FIG. 12A. In some cases, a cassette of the present disclosure comprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure. In some cases, a recombinant expression vector of the present disclosure comprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure. This is depicted schematically in FIG. 12B.

[0226] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5 ’ to 3 ’ : i) the 5’ Hanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the second strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide, where at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0227] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5’ flankingpolynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the first strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide, where at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0228] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide and a 3‘ flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5' flanking polynucleotide; ii) the first strand of the dsRNA; iii) the second strand of the dsRNA; and iv) the 3’ flanking polynucleotide, where one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0229] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide and a 3' flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5’ flanking polynucleotide; ii) the second strand of the dsRNA; iii) the first strand of the dsRNA; and iv) the 3’ flanking polynucleotide, where one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0230] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the miRNA scaffold of the second recombinant nucleic acid; and b) the dsRNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA, and the dsRNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.

[0231] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the miRNA scaffold of the second recombinant nucleic acid; and b) the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to atarget GGGGCC repeat region of a GGGGCC repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.

[0232] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid differs in nucleotide sequence from the miRNA scaffold of the second recombinant nucleic acid; and b) the dsRNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA, and the dsRNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.

[0233] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid differs in nucleotide sequence from the miRNA scaffold of the second recombinant nucleic acid; and b) the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.COMPOSITIONS, DELIVERY VEHICLES, AND VIRAL PARTICLES

[0234] The present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a viral particle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a delivery vehicle comprising a conjugate of the present disclosure. The present disclosure provides a composition comprising a recombinant expression vector of the present disclosure. The present disclosure provides a composition comprising a double-stranded RNA of the present disclosure. The present disclosure provides a composition comprising a conjugate of the present disclosure.Delivery vehicles

[0235] A recombinant expression vector of the present disclosure can be present in a delivery vehicle. Thus, the present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. In some cases, the delivery vehicle is a non-viral delivery vehicle. In some cases, the delivery vehicle is a lipid nanoparticle. In some cases, the delivery vehicle is a viral delivery vehicle. In some cases, the viral delivery vehicle is a recombinant AAV virion. Suitable AAV virions include those with AAV2 capsid, an AAV9 capsid, and the like.

[0236] Suitable lipid nanoparticles can include, e.g., one or more cationic lipids, lipids modified with poly(ethylene glycol) (“PEGylated lipids”), and the like. Suitable cationic lipids include, but are not limited to, XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31 -tetraen-l9-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N- dimethyl-2,2-di((92,12Z)-octadeca-9,12-dienyl)tetrahydr- o-3aH-cyclopenta[d] [l,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undccylamino)propyl)-Nl,N16-diundccyl-4,7,10,13-tct- raazahcxadccanc- 1,16-diamide), DODAP (l,2-dioleyl-3-dimethylammonium propane), HGT4003, ICE, HGT5000, cis or trans HGT5001, DOTAP (l,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl- 3 -trimethylammonium propane), DLinDMA, DLin-KC2-DMA, and C12-200. Other suitable lipids that can be included in a lipid nanoparticle include, but are not limited to, DSPC (l,2-distearoyl-sn-glycero-3- phosphocholine), DPPC (l,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero- 3-phosphocthanolaminc), DPPE (l,2-dipalmitoyl-sn-glyccro-3-phosphocthanolaminc), DMPE (1,2- dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (l,2-dioleoyl-sn-glycero-3-phospho-(l'-rac- glycerol)), and cholesterol. Suitable PEGylated lipids include, e.g., PEG-DSG ( 1 ,2-Distearoyl-rac- glycero-3-methoxypolyethylene glycol conjugated to, e.g., PEG-1000, PEG-2000, PEG-5000, and the like), PEG-DMG (1,2-Dimyristoyl-rac-glycerol conjugated to PEG), and PEG-ceramides.Pharmaceutical Compositions

[0237] The disclosure provides pharmaceutical compositions comprising nucleic acids (e.g., DNA; dsRNA, etc.), expression cassettes, vectors encoding double stranded RNAs, or conjugates described herein and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with cells and / or tissues without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0238] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it mayperform its intended function. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the cell or tissue being contacted. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0239] As is well known in the medical arts, the dosage for any one patient depends upon many factors, including the patient's size, weight, body surface area, age, the level of expression of inhibitory RNA expression required to achieve a therapeutic effect, stability of the inhibitory nucleic acid, specific disease being treated, stage of disease, sex, time and route of administration, general health, and other drugs being administered concurrently.

[0240] In some cases, rAAVs as described herein are administered to a subject in an amount of about IxlO6VG (viral genomes) to about IxlO16VGper subject, or about IxlO6, 2xl06, 3xl06, 4xl06, 5xl06, 6xl06, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2xl08, 3xlO8, 4xl08, 5xl08, 6xl08, 7xl08, 8xlO8, 9xl08, IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xlO9, 9xl09, IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xl010, 7xlO10, 8xl010, 9xlO10, IxlO11, 2x10", 2.1x10", 2.2x10", 2.3x10", 2.4x10", 2.5x10", 2.6x10", 2.7x10", 2.8x10", 2.9x10", 3x10", 4x10", 5x10", 6x10", 7x10", 7.1x10", 7.2x10", 7.3x10", 7.4x10", 7.5x10", 7.6x10", 7.7x10", 7.8x10", 7.9x10", 8x10", 9x10", IxlO12, l.lxlO12, 1.2xl012, 1.3xl012, 1.4xl012, 1.5xl012, 1.6xl012, 1.7xl012, 1.8xl012, 1.9xl012, 2xl012, 3xl012, 4xl012, 4.1xl012, 4.2xl012, 4.3xl012, 4.4xl012, 4.5xl012, 4.6xl012, 4.7xl012, 4.8xl012, 4.9xl012, 5xl012, 6xl012, 7xl012, 8xl012, 8. IxlO12, 8.2xl012, 8.3xl012, 8.4xl012, 8.5xl012, 8.6xl012, 8.7xl012, 8.8xlO12, 8.9xl012, 9xl012, IxlO11, 2xl013, 3xlO13, 4x10", 5x10", 6x10", 6.7xl013, 7x10", 8x10", 9x10", IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, 9xl014, 1x10", 2x10", 3x10", 4x10", 5x10", 6x10", 7x10", 8x10", 9x10", or IxlO16VG / subject.

[0241] In some cases, rAAV particles as described herein are administered to a subject in an amount of about IxlO6VG / kg to about IxlO16VG / kg, or about IxlO6, 2xl06, 3xl06, 4xl06, 5xl06, 6xl06, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2x108, 3xl08, 4xl08, 5x108, 6xl08, 7xl08, 8x1O8, 9xl08, l x109, 2xl09, 3xlO9, 4x109, 5xl09, 6xl09, 7xl09, 8xl09, 9xl09, IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xlO10, 7xlO10, 8xl010, 9xlO10, 1x10", 2x10", 2.1x10", 2.2x10", 2.3x10", 2.4x10", 2.5x10", 2.6x10", 2.7x10", 2.8x10", 2.9x10", 3x10", 4x10", 5x10", 6x10", 7x10", 7.1x10", 7.2x10", 7.3x10", 7.4x10", 7.5x10", 7.6x10", 7.7x10", 7.8x10", 7.9x10", 8x10", 9x10", IxlO12, l.lxlO12, 1.2xl012, 1.3xl012, 1.4xl012, 1.5xl012, 1.6xl012, 1.7xl012, 1.8xl012, 1.9xl012, 2xl012, 3xl012, 4xl012, 4.1xl012, 4.2xl012, 4.3xl012, 4.4xl012, 4.5xl012, 4.6xl012, 4.7xl012, 4.8xl012, 4.9xl012, 5xl012, 6xl012, 7xl012, 8xl012, 8. IxlO12, 8.2xl012, 8.3xl012, 8.4xl012, 8.5xl012, 8.6xl012, 8.7xl012, 8.8xl012, 8.9xl012, 9xl012, IxlO13, 2xl013, 3x10", 4x10",5xlO13, 6xlO13, 6.7xl013, 7xlO13, 8xlO13, 9xlO13, IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, 9xl014, IxlO15, 2xl015, 3xlO15, 4xl015, 5xlO15, 6xlO15, 7xl015, 8xlO15, 9xl015, or IxlO16VG / kg.

[0242] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art. An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient ( / '.e., weight, mass, or body area), the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and / or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and / or overall survival, or a lessening of symptom severity). For prophylactic use, a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder. Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.

[0243] Compositions (e.g., pharmaceutical compositions) may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intracisternal (e.g., via intracis ter nal injection), intraparenchymal, intrastriatal, intrathalamic, intracerebellar, intracranial, intracisternal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject. In some cases, compositions are directly injected into the CNS of the subject. In some cases, direct injection into the CNS is intracerebral injection, intracerebral ventricular injection, intracisternal injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, and / or intralumbar injection. In some cases, compositions are administered by a combination of direct injection into the CNS and by a route that is not directly injected into the CNS (e.g., intravenously).

[0244] In some cases, pharmaceutical compositions comprising rAAV particles are formulated to reduce aggregation of rAAV particles, particularly where high rAAV particle concentrations arc present (e.g., '10” VG / ml or more). Methods for reducing aggregation of rAAV particles are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright F R, et al., Molecular Therapy (2005) 12:171-178, incorporated herein by reference in its entirety).Kits

[0245] In some cases, the compositions provided herein may be assembled into pharmaceutical or research kits to facilitate their use in therapeutic or research use. A kit may include one or more containers comprising: (a) expression cassette or vector encoding a double stranded RNA as described herein; (b) instructions for use; and optionally (c) reagents for transducing the kit component (a) into a host cell. In some cases, the kit component (a) may be in a pharmaceutical formulation and dosage suitable for a particular use and mode of administration. For example, the kit component (a) may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. The components of the kit may require mixing one or more components prior to use or may be prepared in a premixed state. The components of the kit may be in liquid or solid form, and may require addition of a solvent or further dilution. The components of the kit may be sterile. The instructions may be in written or electronic form and may be associated with the kit or provided via internet or web-based communication. The kit may be shipped and stored at a refrigerated or frozen temperature.TREATMENT METHODS

[0246] The present disclosure provides nucleic acids (e.g., DNA), expression cassettes, recombinant expression vectors comprising a cassette, recombinant expression vectors encoding dsRNAs, or pharmaceutical compositions described herein for use in a method of therapy.

[0247] The present disclosure provides methods for selectively reducing translation of a disease-associated GGGGCC repeat-containing RNA and / or accumulation of disease-associated GGGGCC repeat-containing RNA in an individual having a GGGGCC repeat expansion disease or disorder. The methods comprise administering to the individual an effective amount of a recombinant expression vector of the present disclosure, a delivery vehicle of the present disclosure, a viral particle of the present disclosure, or a pharmaceutical composition of the present disclosure. Diseases associated with GGGGCC repeat expansions include amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). In some cases, the GGGGCC repeat expansion disease is ALS. In some cases, the GGGGCC repeat expansion disease is FTD. In some cases, the individual has both ALS and FTD.

[0248] In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAVparticle, pharmaceutical composition) is directly injected into the central nervous system (CNS) of the subject. In some cases, direct injection into the CNS is intracerebral injection, intracisternal injection, intraparenchymal injection, intrathecal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is intracerebral ventricular injection. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, intralumbar injection, or any combination thereof. In some cases, administration to the subject is accomplished by a combination of direct injection to the CNS and by a route that is not directly injected into the CNS (e.g., intravenously).

[0249] A method of the present disclosure can comprise administering to an individual in need thereof an effective amount of a composition of the present disclosure (e.g., a dsRNA, an isolated nucleic acid comprising an expression cassette encoding a dsRNA, a recombinant expression vector encoding a dsRNA, a recombinant expression vector encoding a dsRNA within a miR scaffold, an rAAV particle, a conjugate, or a pharmaceutical composition of the present disclosure). In some cases, an effective amount of a composition of the present disclosure is an amount that, when administered to an individual in need thereof, reduces translation of a disease-associated GGGGCC repeat-containing RNA and / or a disease-associated CCCCGG repeat-containing RNA produced by transcription of a GGGGCC repeat expansion more than it reduces translation of a non-disease-associated GGGGCC repeat-containing RNA and / or a non-disease-associated CCCCGG repeat-containing RNA. In some cases, an effective amount of a composition of the present disclosure is an amount that, when administered to an individual in need thereof, reduces translation of a disease-associated GGGGCC repeat-containing RNA and / or a disease- associated CCCCGG repeat-containing RNA produced by transcription of a GGGGCC repeat expansion to an extent that is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 2.5-fold, at least 5-fold, or at least 10-fold, greater than the extent to which it reduces translation of a non-disease-associated GGGGCC repeat-containing RNA and / or a non-disease-associated CCCCGG repeat-containing RNA.

[0250] In some cases, an effective amount of a composition of the present disclosure (e.g., a dsRNA, an isolated nucleic acid comprising an expression cassette encoding a dsRNA, a recombinant expression vector encoding a dsRNA, a recombinant expression vector encoding a dsRNA within a miR scaffold, an rAAV particle, a conjugate, or a pharmaceutical composition of the present disclosure) is an amount that, when administered to an individual in need thereof, reduces the amount or level of dipeptide repeats (DPR) by at least 10%, compared to the level of DPR in the individual, or in a cell or tissue in the individual, before said administering. In some cases, an effective amount of a composition of the present disclosure is an amount that, when administered to an individual in need thereof, stabilizes the level of DPRs. DPRs associated with GGGGCC expansion repeat diseases include: i) Gly-Ala (GA) DPRs; ii)Gly-Arg (GR) DPRs; iii) Pro- Ala (PA) DPRs; iv) Pro- Arg (PR) DPRs, and v) Gly-Pro (GP) DPRs. Such DPRs can be generated by repeat-associated non-ATG (RAN) translation. DPRs can be translated from both the sense and the antisense RNA products of transcription of intron 1 of C9orf72. Tissues that can contain DPRs include, e.g., the spinal cord, hippocampus, basal ganglia, frontal cortex, cerebellum, and motor cortex.

[0251] In some cases, the methods of the present disclosure reduce the level of a DPR in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, in a cell compared to the level of the DPR in a cell that has not been contacted with the double stranded RNA. In some cases, the methods of the present disclosure reduces the level of a DPR in a cell by 10-20%, 10- 30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20- 60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30- 90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50- 70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70- 90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, or 90-100% compared to the level of the DPR in a cell that has not been contacted with the double stranded RNA.

[0252] In some cases, the methods of the present disclosure reduce the number of nuclear toxic sense RNA foci in a cell (e.g., a neuron) in an individual, compared to the number of nuclear toxic sense RNA foci in the cell before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of nuclear toxic sense RNA foci in a cell (e.g., a neuron) in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of nuclear toxic sense RNA foci in the cell before treatment with the method. In some cases, a method of the present disclosure stabilizes the number of nuclear toxic sense RNA foci in a cell in an individual.

[0253] In some cases, the methods of the present disclosure reduce the number of nuclear toxic antisense RNA foci in a cell (e.g., a neuron) in an individual, compared to the number of nuclear toxic antisense RNA foci in the cell before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of nuclear toxic antisense RNA foci in a cell (e.g., a neuron) in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of nuclear toxic antisense RNA foci in the cell before treatment with the method. In some cases, a method of the present disclosure stabilizes the number of nuclear toxic antisense RNA foci in a cell in an individual.

[0254] In some cases, the methods of the present disclosure reduce the number of cells in an individual that contain toxic RNA foci, compared to the number cells containing toxic RNA foci in the individual before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of cells containing toxic RNA foci in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of cells containing toxic RNA foci before treatment with the method.

[0255] In some cases, a method of the present disclosure reduces the level of misprocessed RNA transcribed from a disease-associated C9orf72 allele. For example, in some cases, a method of the present disclosure reduces the level of misprocessed RNA transcribed from a disease-associated C9orf72 allele by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the level of misproccsscd RNA transcribed from a disease-associated C9orf72 allele in a cell in the individual before treatment with the method.

[0256] In some cases, a method of the present disclosure increases function in an individual. For example, in an individual having ALS, a method of the present disclosure can improve the ALS Functional Rating Scale-Revised (ALSFRS-R) score by one or more points. The total ALSFRS-R score ranges from 48 (normal function) to 0 (no function). The ALSFRS-R score is determined by assessing the answers to a questionnaire that measures patient function through an assessment of the ability to carry out activities of daily living, including speech, salivation, swallowing, writing, feeding, dressing, turning, walking, climbing, dsypnea, orthopnea, and respiratory insufficiency. See, e.g., Cedarbaum et al. (1999) J. Neurol. Sci. 169:13. In some cases, a method of the present disclosure stabilizes the ALSFRS- R score in an individual. In some cases, a method of the present disclosure stabilizes or improves Slow Vital Capacity (SVC). In some cases, a method of the present disclosure stabilizes or improves the Handheld Dynamometry (HHD) Megascore as measured by the HHD device.

[0257] In some cases, in an individual having FTD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by the Clinical Dementia Rating National Alzheimer’s Coordinating Center Frontotemporal Lobar Degeneration Domains (CDR Plus NACC FTLD) assessment. In some cases, in an individual having FTD, a method of the present disclosure stabilizes or improves neurocognition, as assessed by any one of the Multilingual Naming Test (MINT), the Number Span Test, Verbal Fluency, Semantic Fluency, the Trail Making Test A and B, the California Verbal Learning Test (CVLT), the Benson Complex Figure Copy, the Montreal Cognitive Assessment (MoCA), the Frontotemporal Dementia Rating Scale (FRS), the Cambridge Behavioral Inventory - Revised (CBI- R), and the Clinical Global Impression of Severity and Change (CGI-S, CGI-C).

[0258] In some cases, in an individual having FTD or ALS, a method of the present disclosure stabilizes or improves brain anatomy as assessed by magnetic resonance imaging (MRI).

[0259] In some cases, in an individual having FTD or ALS, a method of the present disclosure can stabilize or reduce Neurofilament Light Chain (NIL) levels in the cerebrospinal fluid (CSF) or in the circulation (e.g., in blood, serum, or plasma) in the individual. In some cases, in an individual having FTD or ALS, a method of the present disclosure can reduce NfL levels in CSF or in the circulation in the individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the level of NfL in the CSF or in the circulation of the individual before treatment with the method. Levels of NfL can be determined using any known assay, e.g., an immunoassay (i.e., an antibody-based assay) using an antibody specific for NfL. See, e.g., Lee et al. (2022) Front. Neurol. 13:935382. In some cases, an immunoassay utilizes two specific monoclonal antibodies to both capture and detect the NfL antigen, and exhibits a signal correlative to the concentration present in the patient sample. Suitable immunoassays include, e.g., the Simoa® NfL Assay from Quanterix.

[0260] By ‘ ‘stabilizes” is meant that a given parameter (e.g., level of DPRs, number of toxic foci, function, NfL levels, etc.) does not significantly change, i.e., does not become significantly worse, over a given period of time following treatment with a method of the present disclosure. For example, a parameter that is “stabilized” does not change by more than about 1% to about 10% over a given period of time following treatment with a method of the present disclosure.Examples of Non-Limiting Aspects of the Disclosure

[0261] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below:

[0262] Aspect 1. A double-stranded RNA comprising: a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA; and b) a second strand that hybridizes to the first strand,

[0263] wherein the first strand comprises:

[0264] i) a first mismatch to the target GGGGCC repeat region; and

[0265] ii) at least a second mismatch to the target GGGGCC repeat region,

[0266] wherein:

[0267] i) when the first mismatch is at position 8 based on the numbering ofGGGGCCGGGGCCGGGGCCGGGGCC (SEQ ID NO:1) GGGCCGGGGCCGGGGCCGGGGCCG(SEQ ID NOG), GGCCGGGGCCGGGGCCGGGGCCGG (SEQ ID NOG), GCCGGGGCCGGGGCCGGGGCCGGG (SEQ ID NO:4), CCGGGGCCGGGGCCGGGGCCGGGG (SEQ ID NOG), or CGGGGCCGGGGCCGGGGCCGGGGC (SEQ ID NO:6), the second mismatch is from 1 to 13 bases 3’ of the first mismatch;

[0268] ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 12 bases 3' of the first mismatch;

[0269] iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and

[0270] iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 10 bases 3’ of the first mismatch.

[0271] Aspect 2. A double-stranded RNA comprising:

[0272] a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and

[0273] b) a second strand that hybridizes to the first strand,

[0274] wherein the first strand comprises:

[0275] i) a first mismatch to the target CCCCGG repeat region; and

[0276] ii) at least a second mismatch to the target CCCCGG repeat region,

[0277] wherein:

[0278] i) when the first mismatch is at position 8 based on the numbering ofCCCCGGCCCCGGCCCCGGCCCCGG (SEQ ID NOG), CCCGGCCCCGGCCCCGGCCCCGGC (SEQ ID NOG), CCGGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO:9), CGGCCCCGGCCCCGGCCCCGGCCC (SEQ ID NO: 10), GGCCCCGGCCCCGGCCCCGGCCCC (SEQ ID NO: 11), or GCCCCGGCCCCGGCCCCGGCCCCG (SEQ ID NO: 12), the second mismatch is from 1 to 13 bases 3’ of the first mismatch;

[0279] ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:7, 8, 9 10, 11, or 12, the second mismatch is from 1 to 12 bases 3’ of the first mismatch;

[0280] iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NOG, 8, 9 10, 11, or 12, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and

[0281] iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NOG, 8, 9 10, 11, or 12, the second mismatch is from 1 to 10 bases 3’ of the first mismatch

[0282] Aspect 3. The double-stranded RNA of aspect 1 or aspect 2, wherein each mismatch is generated by a substitution that is independently selected from:

[0283] a) a substitution of a G with an A, a U, or a C; and

[0284] b) a substitution of a C with an A or a U.

[0285] Aspect 4. The double-stranded RNA of any one of aspects 1-3, wherein the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

[0286] Aspect 5. The double-stranded RNA of any one of aspects 1-3, wherein the fust strand comprises no more than 3 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

[0287] Aspect 6. The double-stranded RNA of any one of aspects 1-3, wherein the first strand comprises no more than 4 mismatches with the tar get GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

[0288] Aspect 7. The double-stranded RNA of any one of aspects 1-3, wherein the first strand comprises no more than 5 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 5 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

[0289] Aspect 8. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0290] Aspect 9. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0291] Aspect 10. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0292] Aspect 11. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0293] Aspect 12. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0294] Aspect 13. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0295] Aspect 14. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0296] Aspect 15. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises four mismatches to the target repeat region, wherein the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l- 12.

[0297] Aspect 16. The double-stranded RNA of any one of aspect 1-7, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

[0298] Aspect 17. The double-stranded RNA of any one of aspect 1-7, wherein the at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:l-12.

[0299] Aspect 18. The double-stranded RNA of aspect 2, wherein the first strand comprises a nucleotide sequence selected from:

[0300] i) CCGGGGCCUAGGACGGGUCCG (SEQ ID NO:614); (PS_C4G2rep_39670;9, 10, 13, 18)

[0301] ii) CCGGGGCCGGUUCCGGGUACG (SEQ ID NO:615); (PS_C4G2rep_ 18753;11, 12, 18, 19)

[0302] iii) CCGGGGCCGAGGCCUGGGCCG (SEQ ID NO:616); (PS_C4G2rep_24; 10.15)

[0303] iv) CCGGGGCCGUGGCCGGUGCCG (SEQ ID NO:617); (PS_C4G2rep_88; 10,17)

[0304] v) CCGGGGCCGUAGCCGGGGCCG (SEQ ID NO:618); (PS_C4G2rep_70;10,11)

[0305] vi) CCGGGGCCGGUGAAGGGGCCG (SEQ ID NO:619); (PS_C4G2rep_2161;11, 13, 14)

[0306] vii) CCGGGGCCGGUGACGUGGUCG (SEQ ID NQ:620); (PS_C4G2rep_18895;11, 13, 16, 19)

[0307] viii) CCGGGGCCGAUGCCGGGUCCG (SEQ ID NO:621); (PS_C4G2rep_413; 10,11, 18)

[0308] ix) CCGGGGCCGUGGCCGAGGCCG (SEQ ID NO:622); (PS_C4G2rep_54; 10,16);

[0309] x) CCGGGGCCCGGGACGGGGCCG (SEQ ID NO:623) ; (PS_C4G2rep_288 ; 9,13);

[0310] xi) CCGGGGCCCGGUCCGGGGCCG (SEQ ID NO:624); (PS_C4G2rep_287; 9,12);

[0311] xii) CCGGGGCCGAGGACGGGUCCG (SEQ ID NO:625); and(PS_C4G2rep_504; 10, 13, 18) and

[0312] xiii) CCGGGGCCGUGGCCCGGGCCG (SEQ ID NO:626) (PS_C4G2rep_81; 10, 15), optionally wherein the first strand comprises a nucleotide sequence selected from SEQ ID NO: 614- 626 further comprising a 5’ U or a 5’ A.

[0313] Aspect 19. The double-stranded RNA of aspect 1, wherein the first strand comprises a nucleotide sequence selected from:

[0314] i) CGGCCCCGGUCCCGGACCCGG (SEQ ID NO:627); (GS_G4C2rep_49)

[0315] ii) CGGCCCCGUACCCGGCCCCGG (SEQ ID NO:628); (GS_G4C2rep_260)

[0316] iii) CGGCCCCGACCCCGGCACCGG (SEQ ID NO:629); (GS_G4C2rep_220)

[0317] iv) CGGCCCCGUACCCGGUACCGG (SEQ ID NO:630); (GS_G4C2rep_28671)

[0318] v) CGGCCCCGGACCCGGCCACGG (SEQ ID NO:631); (GS_G4C2rep_27)

[0319] vi) CGGCCCCGUACCAUGCCCCGG (SEQ ID NO:632); (GS_G4C2rep_28528)

[0320] vii) CGGCCCCGGACUCGGCCCCGG (SEQ ID NO:633); (GS_G4C2rep_14)

[0321] viii) CGGCCCCGACCCCGGUCCCGG (SEQ ID NO:634); and(GS_G4C2rep_219)

[0322] ix) CGGCCCCGUACCCGGCAACGG (SEQ ID NO:635); (GS_G4C2rep_28683), optionally wherein the first strand comprises a nucleotide sequence selected from SEQ ID NO: 627-635 further comprises a 5’ U or a 5’ A.

[0323] Aspect 20. The double-stranded RNA of aspect 1, wherein the first strand or the second strand comprises any one of the guide strand sequences or reverse complement sequences depicted in FIG. 1-6, optionally wherein the guide strand sequences comprises a5’ U or a 5’ A.

[0324] Aspect 21. The double-stranded RNA of any one of aspects 1-20, wherein the second strand is 100% complementary to the first strand.

[0325] Aspect 22. The double-stranded RNA of any one of aspects 1-20, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

[0326] Aspect 23. The double-stranded RNA of any one of aspects 1-22, wherein the doublestranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

[0327] Aspect 24. The double-stranded RNA of any one of aspects 1-22, wherein the doublestranded RNA has a length of from 21 nucleotides to 25 nucleotides.

[0328] Aspect 25. The double-stranded RNA of any one of aspects 1-22, wherein the doublestranded RNA has a length of 21 nucleotides.

[0329] Aspect 26. The double-stranded RNA of any one of aspects 1-25, wherein the doublestranded RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification.

[0330] Aspect 27. A DNA molecule comprising a nucleotide sequence encoding the first strand as set forth in any one of aspects 1-25, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

[0331] Aspect 28. A recombinant nucleic acid comprising:

[0332] al) the double-stranded RNA of any one of aspects 1-25; and

[0333] bl) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3' flanking polynucleotide,

[0334] wherein the recombinant nucleic acid comprises:

[0335] i) the 5’ flanking polynucleotide;

[0336] ii) the first strand of the double-stranded RNA;

[0337] iii) the loop polynucleotide;

[0338] iv) the second strand of the double-stranded RNA; and

[0339] v) the 3’ flanking polynucleotide;

[0340] wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or

[0341] a2) the double-stranded RNA of any one of aspects 1-25; and

[0342] b2) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3' flanking pofynuefeotide,

[0343] wherein the recombinant nucleic acid comprises:

[0344] i) the 5’ flanking polynucleotide;

[0345] ii) the second strand of the double-stranded RNA;

[0346] iii) the loop polynucleotide;

[0347] iv) the first strand of the double-stranded RNA: and

[0348] v) the 3’ flanking polynucleotide,

[0349] where at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-str anded RNA; or

[0350] a3) the double-stranded RNA of any one of aspects 1-25; and

[0351] b3) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide,

[0352] wherein the recombinant nucleic acid comprises:

[0353] i) the 5’ flanking polynucleotide;

[0354] ii) the first strand of the double-stranded RNA;

[0355] iii) the second strand of the double-stranded RNA; and

[0356] iv) the 3’ flanking polynucleotide;

[0357] wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or

[0358] a4) the double-stranded RNA of any one of aspects 1-25; and

[0359] b4) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide,

[0360] wherein the recombinant nucleic acid comprises:

[0361] i) the 5’ flanking polynucleotide;

[0362] ii) the second strand of the double-stranded RNA;

[0363] iii) the first strand of the double-stranded RNA; and

[0364] iv) the 3’ flanking polynucleotide;

[0365] wherein one or both of the 5' flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0366] Aspect 29. The recombinant nucleic acid of aspect 28, wherein the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33, miR451, miR144, miRlOl, or miR126, optionally wherein the nucleotide sequences of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are selected from those depicted in FIG. 13.

[0367] Aspect 30. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to aspect 28 or aspect 29.

[0368] Aspect 31. The DNA molecule of aspect 30, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctggcgggcagctctg (SEQ ID NO:611).

[0369] Aspect 32. The DNA molecule of aspect 30 or aspect 31, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgttctggcaatacctg (SEQ ID NO:612).

[0370] Aspect 33. The DNA molecule of any one of aspects 30-32, wherein the 3’ flanking polynucleotide is encoded by the nucleotide sequence: gggaggcctgccctgactgcccac (SEQ ID NO:613).

[0371] Aspect 34. The DNA molecule of aspect 30, wherein the DNA molecule comprises a nucleotide sequence depicted in FIG. 7A-7B or depicted in FIG. 8A-8B, the nucleotide sequence set forth in any one of SEQ ID NOs: 13-238, or the nucleotide sequence set forth in any one of SEQ ID NOs:239-610.

[0372] Aspect 35. The DNA molecule of aspect 30, wherein the DNA molecule comprises: a) a first nucleotide sequence encoding a first recombinant nucleic acid according to aspect 28 or aspect 29; and b) a second nucleotide sequence encoding a second recombinant nucleic acid according to aspect 28 or aspect 29, wherein the first recombinant nucleic acid differs in nucleotide sequence from the second recombinant nucleic acid.

[0373] Aspect 36. The DNA molecule of aspect 35, wherein the first recombinant nucleic acid comprises a first microRNA scaffold, wherein the second recombinant nucleic acid comprises a second microRNA scaffold, and wherein the first microRNA scaffold differs in nucleotide sequence from the second microRNA scaffold.

[0374] Aspect 37. The DNA molecule of aspect 35, wherein the microRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the microRNA scaffold of the second recombinant nucleic acid.

[0375] Aspect 38. The DNA molecule of any one of aspects 35-37, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

[0376] Aspect 39. The DNA molecule of any one of aspects 35-37, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA.

[0377] Aspect 40. A recombinant expression vector comprising the DNA molecule of any one of aspects 30-39.

[0378] Aspect 41. The recombinant expression vector of aspect 40, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell, optionally wherein the first nucleotide sequence encoding the first recombinant nucleic acid according to aspect 28 or aspect 29 is operably linked to a first promoter; and the second nucleotide sequence encoding the second recombinant nucleic acid according to aspect 28 or aspect 29 is operably linked to a second promoter, wherein the first promoter and the second promoter are same or different and wherein the first and second promoters are functional in a eukaryotic cell.

[0379] Aspect 42. The recombinant expression vector of aspect 41, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter or wherein the first promoter is an RNA polymerase II promoter and the second promoter is an RNA polymerase III promoter or vice versa.

[0380] Aspect 43. The recombinant expression vector of aspect 41 or aspect 42, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter or wherein the first and second promoters are independently selected from a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

[0381] Aspect 44. The recombinant expression vector of any one of aspects 40-43, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0382] Aspect 45. A recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid of aspect 28, aspect 29, or any one of aspects 30-39.

[0383] Aspect 46. The recombinant expression vector of aspect 45, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell, optionally wherein the first nucleotide sequence encoding the first recombinant nucleic acid according to aspect 28 or aspect 29 is operably linked to a first promoter; and the second nucleotide sequence encoding the second recombinant nucleic acid according to aspect 28 or aspect 29 is operably linked to a second promoter, wherein the first promoter and the second promoter are same or different and wherein the first and second promoters are functional in a eukaryotic cell.

[0384] Aspect 47. The recombinant expression vector of aspect 46, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter or wherein the first promoter is an RNA polymerase II promoter and the second promoter is an RNA polymerase III promoter or vice versa.

[0385] Aspect 48. The recombinant expression vector of aspect 45 or aspect 46, wherein the promoter is a CAG promoter, a CBA promoter a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter or wherein the first and second promoters are independently selected from a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

[0386] Aspect 49. The recombinant expression vector of any one of aspects 45-48, wherein the recombinant expression vector comprises a 5' adcno-associatcd virus (AAV) inverted terminal repeat (ITR) sequence and a 3' AAV ITR sequence.

[0387] Aspect 50. A conjugate comprising: a) a double-stranded RNA of any one of aspects 1- 26; and b) one or more non-nucleic acid moieties conjugated, directly or via a linker, to one or both strands of the double-stranded RNA, at one or both terminal positions or at one or more internal positions.

[0388] Aspect 51. The conjugate of aspect 50, wherein the one or more non-nucleic acid moieties is or comprises a lipophilic moiety.

[0389] Aspect 52. The conjugate of aspect 51 , wherein the lipophilic moiety is a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3- propandediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, 03- (oleoyl)cholenic acid, docosanoic acid (DCA), eicosapentaenoic acid (EPA), a dendrimer, dimethoxytrityl, or phenoxazine.

[0390] Aspect 53. The conjugate of aspect 51, wherein the lipophilic moiety comprises a saturated or unsaturated C4-C30 hydrocarbon chain or saturated or unsaturated hydrocarbon chain longer than 30, and an optional functional group selected from the group consisting of a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne.

[0391] Aspect 54. The conjugate of aspect 53, wherein the lipophilic moiety contains a saturated or unsaturated Ce-Cix hydrocarbon chain, C6-C22 hydrocarbon chain, a C22 hydrocarbon chain, or hydrocarbon chain longer than C22.

[0392] Aspect 55. The conjugate of aspect 54, wherein the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain.

[0393] Aspect 56. The conjugate of any one of aspects 50-55, wherein the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase, a sugar moiety, or an internucleoside linkage in the double-stranded RNA, optionally wherein the lipophilic moiety is linked to the first or the second strand, further optionally wherein the lipophilic moiety is linked to a 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands.

[0394] Aspect 57. A delivery vehicle comprising the recombinant expression vector of any one of aspects 40-49.

[0395] Aspect 58. The delivery vehicle of aspect 57, wherein the delivery vehicle is a non-viral delivery vehicle.

[0396] Aspect 59. The delivery vehicle of aspect 58, wherein the delivery vehicle is a lipid nanopar ticlc.

[0397] Aspect 60. The delivery vehicle of aspect 57, wherein the delivery vehicle is a viral particle.

[0398] Aspect 61. A delivery vehicle comprising the double-stranded RNA of any one of aspects 1-25.

[0399] Aspect 62. A delivery vehicle comprising the double-stranded RNA of aspect 26.

[0400] Aspect 63. The delivery vehicle of aspect 61 or aspect 62, wherein the double-strandedRNA comprises a covalently linked lipid moiety, optionally wherein the lipid moiety is linked to the sense or the anti-sense strand, further optionally wherein the lipid moiety is linked to a 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands.

[0401] Aspect 64. The delivery vehicle of aspect 63, wherein the covalently linked lipid moiety comprises a palmityl moiety, docosanoic acid (DCA), eicosapentaenoic acid (EPA), or a dendrimer, optionally wherein the dendrimer comprises the dendrimer of Fig. 20.

[0402] Aspect 65. The delivery vehicle of any one of aspects 62-64, wherein the delivery vehicle is a lipid nanoparticle.

[0403] Aspect 66. A delivery vehicle comprising the conjugate of any one of aspects 50-56.

[0404] Aspect 67. A viral particle comprising the recombinant expression vector of any one of aspects 40-49.

[0405] Aspect 68. The viral particle of aspect 67, wherein the viral particle is an adeno- associated virus (AAV) particle.

[0406] Aspect 69. The viral particle of aspect 68, wherein the AAV particle comprises an AAV9 capsid.

[0407] Aspect 70. The viral particle of aspect 68, wherein the AAV particle comprises an AAV2 capsid.

[0408] Aspect 71. A composition comprising: a) the recombinant expression vector of any one of aspects 40-49; and b) a pharmaceutically acceptable excipient.

[0409] Aspect 72. A composition comprising: a) the delivery vehicle of any one of aspects 57- 65; and b) a pharmaceutically acceptable excipient.

[0410] Aspect 73. A composition comprising: a) a viral particle of any one of aspects 67-70; and b) a pharmaceutically acceptable excipient.

[0411] Aspect 74. A composition comprising: a) a conjugate of any one of aspects 50-56; and b) a pharmaceutically acceptable excipient.

[0412] Aspect 75. A method for selectively reducing the translation and / or accumulation of a disease-associated GGGGCC repeat-containing RNA and / or a disease-associated CCCCGG repeatcontaining RNA produced by transcription of a GGGGCC repeat expansion in intron 1 of a C9orf72 gene in an individual having a GGGGCC repeat expansion disorder, the method comprising administering to the individual an effective amount of the expression vector of any one of aspects 40-49, delivery vehicle of any one of aspects 57-66, the viral particle of any one of aspects 67-70, or the composition of any one of aspects 71-74.

[0413] Aspect 76. The method of aspect 75, wherein the repeat expansion disorder is amyotrophic lateral sclerosis or frontotemporal dementia.

[0414] Aspect 77. The method of aspect 75 or aspect 76, wherein said administering comprises direct injection to the central nervous system of the individual.

[0415] Aspect 78. The method of aspect 77, wherein the direct injection is intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

[0416] Aspect 79. The method of any one of aspects 75-78, wherein said administering reduces the number of cells containing toxic foci by at least 10%, compared to the number of cells containing toxic foci in the individual before said administering.

[0417] Aspect 80. The method of any one of aspects 75-78, wherein said administering reduces the dipeptide repeats (DPR) by at least 10%, compared to the level of DPR in the individual before said administering.

[0418] Aspect 81. The method of any one of aspects 75-78, wherein said administering reduces defective splicing of C9orf72-encoded transcription products.

[0419] Aspect 82. A method of treating amyotrophic lateral sclerosis or frontotemporal dementia in an individual, the method comprising administering to the individual an effective amount of the expression vector of any one of aspects 40-49, delivery vehicle of any one of aspects 57-66, the viral particle of any one of aspects 67-70, or the composition of any one of aspects 71-74.

[0420] Aspect 83. A method of treating amyotrophic lateral sclerosis and frontotemporal dementia in an individual, the method comprising administering to the individual an effective amount of the expression vector of any one of aspects 40-49, delivery vehicle of any one of aspects 57-66, the viral particle of any one of aspects 67-70, or the composition of any one of aspects 71-74.EXAMPLES

[0421] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c., subcutaneous(ly); and the like.Example 1: Reduction of GGGGCC or CCCCGG repeat-associated non- AUG (RAN) translation with repeat-targeting small binding RNAs (sbRNAs) in a luciferase-based model system

[0422] Guide sequence candidates were generated to systematically evaluate the effect of the sequence, number, and position of mismatches, as well the starting position of the guide within the repeat (i.c. GGGGCC or GGGCCG). Guide sequences containing double mismatches, where at least one mismatch is located in position 8, 9, 10 or 11, and the second mismatch is located between the first mismatch and position 21, were generated. Triple, quadruple, and quintuple mismatches, where the second mismatch is within nucleotides 9-21, the third mismatch is within nucleotides 10-21, the fourth mismatch is within nucleotides 11-21, and the optional fifth mismatch is within nucleotides 12-21 of the guide sequence were also generated.

[0423] In silica analyses were conducted to remove guide sequences that have the potential for deleterious off-target effects. Guide sequences were selected if the following criteria for off-target genes are met: (1) 0 off-target genes containing fully complementary sequence to guide sequence within positions 1 -21 ; (2) < 1 off-target genes containing fully complementary 17mer within guide sequence positions 1-21; (3) If off-target gene(s) contain fully complementary 17mer: i) Off-target gene(s) cannot be tumor suppressor gcnc(s), essential genes (708 genes identified from three independent studies (Wang et al. (2015) Science 350:6264; Hart et al. (2015) Cell 163:1515; Blomen et al. (2015) Science 350:6264]); housekeeping genes (Hounkpe et al. (2021) Nucl. Acids. Res. 49:D947; Eisenberg and Levanon (2013) Trends Genet. 29:569), ii) Off-target gene(s) cannot have high expression in the Cl segment of cervical spinal cord, cerebral cortex, or Brodmann (1909) area 9 relative to whole brain or relative to all other tissues; specifically, if sbRNA guide sequence has a perfect seed match, and TPM(transcript per million) of off-target gene >1 , expression values should not be > Q3 (corresponding to the upper quartile, highest cut off (25%) of data) relative to all expressed genes in Cl segment of cervical spinal cord or cerebral cortex or Brodmann (1909) area 9. If expression values are > Q3, but TPM < 10, an off-target analysis by Western-blot is required. If sequence does not have a perfect seed match but has TPM >_1 and expression values > Q3 relative to all expressed genes in Cl segment of cervical spinal cord or cerebral cortex or Brodmann (1909) area 9, Western-blot analysis is required for TPM < 10. If the sbRNA guide sequence does not have a perfect seed match, and expression values of off-target genes are not > Q3 relative to all expressed genes in the tissues listed above, the sbRNA is selected for follow up cloning.

[0424] 226 GGGGCC-targeting guide sequence candidates and 372 CCCCGG-targeting guide sequence candidates that passed the in silico analysis were embedded within the miR-33 scaffold, synthesized, and cloned into a custom mammalian expression plasmid that contains a U6 promoter driving the sbRNA and a human PGK promoter driving GFP-T2A-Puromycin. Of the guide sequences synthesized, there were 67 GGGGCC-targeting and 94 CCCCGG-targeting guide sequences with 2 mismatches, 67 GGGGCC-targeting and 126 CCCCGG-targeting guide sequences with 3 mismatches, and 92 GGGGCC-targeting and 152 CCCCGG-targeting guide sequences with 4 mismatches.

[0425] To evaluate the ability of GGGGCC or CCCCGG repeat-targeting sbRNAs to block repeat-associated non-AUG (RAN) translation, tetracycline-inducible stable reporter cell lines were generated as described in Cheng ct al. (2018) Nat. Comm. 9: 51. Briefly, around 70 GGGGCC or CCCCGG repeats were fused with NLuc lacking an AUG start codon and containing a C-terminal MYC tag (C9R-NLuc) in-frame with either poly-GA or poly-PA peptides. Fragments of C9orf72 intron 1 are cloned before the GGGGCC expansions. NLuc reporter lacking an AUG and the 70 (GGGGCC) repeats (Neg-Nluc) was used as a negative control, while an Flue reporter with an AUG start codon (AUG-Fluc) was used as a normalization control. To generate cell lines stably expressing both C9R-Nluc and AUG- Fluc, C9R-NLuc was integrated into the inducible Flp-In reporter site in HeLa Flp-In cells, and AUG- FLuc was integrated via retroviral transduction.

[0426] Luciferase assays were established and performed by transfecting the C9R-NLuc cells on 96-well plates (20,000 cells / well) with 30 ng indicated sbRNA-expressing plasmid using Lipofectamine 3000. Twenty-four hours after transfection, RAN translation was induced by the introduction of doxycycline. Forty-eight hours after transfection, cells were lysed in 40 pL of lx Passive Lysis buffer (Promega) for 5 min, shaking. 30 pL of lysate was used in the Dual-Glo Luciferase Assay (Promega) to determine the knockdown efficiency of the designed sbRNAs.

[0427] Nanoluciferase values were first normalized to firefly luciferase values and then normalized to scramble control (CGAGGGCGACUUAACCUUAGG; SEQ ID NO: 1904). Luciferase experiments were performed a minimum of three times and statistical analysis was performed usingmultiple t-tests comparing scramble vs. sbRNA candidate normalized luciferase activity for each sbRNA. The positive control miRNA targeting the nanoluciferase sequence was expected to result in -50% decrease in nanoluciferase activity (corresponding to DPR expression).

[0428] A significant (p < 0.05) reduction in nanoluciferase activity was observed for 107 of the 226 GGGGCC-targeting guide sequences and 296 of the 372 CCCCGG-targeting guide sequences evaluated (FIG. 9A-9B). Overall, guide sequences containing two or four mismatches showed the most potent knock-down of nanoluciferase activity. Eight GGGGCC-targeting guide sequences (Table 1) and ten CCCCGG-targeting guide sequences (Table 2) were identified as the top candidates, based on the following criteria: 1) mean nanoluciferase luciferase activity < 65% of scramble control, 2) biological coefficient of variance (CV) <20%, 3) significant decreases (p < 0.05) in nanoluciferase activity relative to scramble control. Tables 1 and 2: mm = mismatches.Table 1Table 2

[0429] The nanoluciferase / firefly luciferase ratios following transfection with the guide sequences set out in Table 1 are shown in FIG. 10. The nanoluciferase / firefly luciferase ratios following transfection with the guide sequences set out in Table 2 are shown in FIG. 11.Example 2: Reduction of GGGGCC and CCCCGG repeat- associated non- AUG (RAN) translation with two repeat-targeting sbRNAs in a luciferase-based model system

[0430] Therapeutic candidates were generated to deliver two sbRNA sequences, either from a single miRNA scaffold (i.e. miR-126), tandem miRNA scaffolds (Table 4), or two miRNA scaffolds driven by separate promoters in a dual promoter configuration. The guide sequences in Table 1 were combined with the guide sequences in Table 2 to generate 307 possible tandem candidates and 23 possible dual promoter candidates.Table 4

[0431] Luciferase assays were established and performed as described in Example1. Nanoluciferase values were first normalized to firefly luciferase values and then normalized to scramble control (CGAGGGCGACUUAACCUUAGG; SEQ ID NO:1904). Luciferase experiments were performed a minimum of three times and statistical analysis was performed using multiple t-tests comparing scramble vs. sbRNA candidate normalized luciferase activity for each sbRNA. The positive control miRNA targeting the nanoluciferase sequence was expected to result in -25% decrease in nanoluciferase activity (corresponding to DPR expression).

[0432] A significant (p < 0.05) reduction in GGGGCC-nanolucifcrasc activity was observed for 97 of the 307 tandem sequences, and a significant (p < 0.05) reduction in CCCCGG-nanoluciferase activity was observed for 104 of the 307 tandem sequences evaluated (FIG. 15). Ten tandem sequences (Table 5) were identified as the top candidates, based on a biological coefficient of variance (CV) < 30% and meeting one or more of the following criteria: 1) mean GGGGCC-nanoluciferase luciferase activity < 65% of scramble control, 2) mean CCCCGG-nanoluciferase luciferase activity < 75% of scramble control, 3) mean GGGGCC-nanoluciferase luciferase activity < 80% of scramble control and mean CCCCGG-nanoluciferase luciferase activity < 90% of scramble control. A significant (p < 0.05) reduction in GGGGCC-nanoluciferase activity was observed for 9 of the 23 dual promoter sequences, and a significant (p < 0.05) reduction in CCCCGG-nanoluciferase activity was observed for 22 of the 23 dual promoter sequences evaluated (FIG. 15). Six dual promoter sequences (Table 7) were identified as the top candidates, based on a biological coefficient of variance (CV) < 30% and meeting the following criteria: 1) mean GGGGCC-nanoluciferase luciferase activity < 70% of scramble control and 2) mean CCCCGG-nanoluciferase luciferase activity < 70% of scramble control.

[0433] In FIG. 15, the tandem combinations refer to the orientations of the cassette, as described in Table 4. miR33+miR33 represents tandems in which miRNA scaffold #1 is miR33 (with a CCCCGG-targeting guide) and miRNA scaffold #2 is miR33 (with a GGGGCC-targeting guide). miR33 PS - miRlOl GS represents tandems in which miRNA scaffold #! is miR33 (with a CCCCGG-targeting guide) and miRNA scaffold #2 is miRlOl (with a GGGGCC-targeting guide). miR126 represents constructs in which miRNA scaffold #1 is miR126 with a CCCCGG-targeting first guide and a GGGGCC-targeting second guide is included.

[0434] FIGS. 16A-16B provide Tables 6A and 6B which list examples of nucleotide sequences of DNA, Expression Cassette 1 and Expression Cassette 2, encoding tandem miRNA scaffolds / sbRNAs contained in sc A A Vs.

[0435] In Table 6 A, the first expression cassette DNA sequence present in each sc AAV is listed. The expression cassette includes miRNA scaffold depicted in lower case letters and the guide RNA and passenger RNA depicted in upper case letters. Specifically, the expression cassette 1 encodes miR-33 5’ arm (depicted in lower case letters), RNA guide sequence (depicted in upper case letters), miR-33 loop (depicted in lower case letters), RNA passenger sequence (depicted in upper case letters), and miR-33 3’ arm (depicted in lower case letters). Table 6A also provides the name for the scAAV DNA encoding the tandem miRNA scaffolds / sbRNAs, the ID number for the first RNA guide and the miRNA scaffold.

[0436] In Table 6B, the second expression cassette DNA sequence present in each scAAV that contains the first expression cassette is listed. The expression cassette encodes miR-33 5’ arm (depicted in lower case letters), RNA guide sequence (depicted in upper case letters), miR-33 loop (depicted in lower case letters), RNA passenger sequence (depicted in upper case letters), and miR-33 3’ arm (depicted in lower case letters). The miR-101 encoding DNA sequences arc depicted in upper case and the RNA guide and passenger encoding DNA sequences are depicted in lower case. Table 6B also provides the name for the scAAV DNA encoding the tandem miRNA scaffolds / sbRNAs, the ID number for the second RNA guide and the miRNA scaffold.

[0437] FIG. 17 provides Table 7 which lists examples of sequences of sbRNAs (sbRNA #1 guide strands correspond to SEQ ID NOs:1834-1843, respectively; sbRNA #2 guide strands correspond to SEQ ID NOs: 1844- 1853, respectively) expressed from dual promoters and the miRNA scaffolds for the individual sbRNAs.Example 3: Register Does Not Impact Knock-Down Efficiency for Hexanucleotide Repeats

[0438] Guide sequence candidates were generated containing three mismatches in positions 9, 10, and 11 to allow for comparison of the same miRNA scaffold containing first strand sequences representative of the 1st registry (CCCCGG), 2nd registry (CCCGGC), 3rd registry (CCGGCC), 4th registry (CGGCCC), 5th registry (GGCCCC), or 6th registry (GCCCCG).

[0439] Luciferase assays were established and performed as described in Example1. Nanoluciferase values were first normalized to firefly luciferase values and then normalized to scramble control (CGAGGGCGACUUAACCUUAGG; SEQ ID NO: 1904). Luciferase experiments were performed a minimum of three times and statistical analysis was performed using multiple t-tests comparing scramble vs. sbRNA candidate normalized luciferase activity for each sbRNA. The positive control miRNA targeting the nanoluciferase sequence was expected to result in at least -25% decrease in nanoluciferase activity (corresponding to DPR expression).

[0440] Guide sequences resulted in between 10% - 45% reductions of luciferase activity compared to the negative control. A significant (p < 0.05) reduction in GGGGCC-nanolucifcrasc activity was observed for 4 of the 6 registries (FIG. 18). These data demonstrate that sequences initiated at any of the six possible nucleotides within the repeat are capable of efficient knock-down of the target sequence.

[0441] FIG. 18 depicts the effect of the register on knockdown of protein translation from repeat-containing sense RNA using sbRNAs.Example 4: Reducing C9orf72 foci detection - while preserving C9orf72 mRNA levels - in C9orf72 ALS / FTP patient fibroblasts in vitro

[0442] Lipid-conjugated duplex sbRNAs or AAV vectors containing nucleotide sequences encoding an sbRNA are produced using standard methods. C9orf72 ALS / FTD patient fibroblasts are transfected with lipid-conjugated sbRNA or infected with the AAV particles. Ten days after treatment, foci levels are measured by RNA in situ hybridization (RNA-ISH) using probes complementary to the GGGGCC & CCCCGG hexanucleotide repeats. C9orf72 mRNA levels are measured by RNA-Seq.Example 5: Reducing C9orf72 foci detection, DPR protein production, and glutamate-induced neuronal death - while preserving C9orf72 mRNA levels - in C9orf72 ALS / FTD patient-derived neurons in vitro

[0443] Lipid-conjugated duplex sbRNAs or AAV vectors containing nucleotide sequences encoding an sbRNA are produced using standard methods. C9orf72 ALS / FTD patient fibroblasts are reprogrammed into induced pluripotent stem cells using a non-integrating system based on the oriP / EBNAl (Epstein-Barr nuclear antigen l)-based episomal plasmid vector system, then differentiated into motor neurons and associated support cells according to established protocols, as described by Sareen et al. The patient-derived neurons are then transfected with lipid-conjugate sbRNA or infected with the AAV particles, and the sbRNAs are produced in the neurons. Ten days after treatment, foci levels are measured by RNA-ISH using probes complementary to the GGGGCC & CCCCGG hexanucleotide repeats, and dipeptide repeat (DPR) levels are measured by Meso Scale Discovery immunoassays. C9orf72 mRNA levels are measured by RNA-Seq.

[0444] In separate experiments, neuronal cell death upon glutamate treatment is measured for neurons transfected with lipid-conjugated sbRNA or infected with the AAV par ticles or the respective controls. Briefly, C9orf72 iPSC-derived neurons show increased susceptibility to glutamate-induced cell death. sbRNA-transfected or infected neurons will be subjected to various concentrations of glutamate, and the extent of neuronal cell death will be measured and compared to controls. Decrease in cell death in C9orf72 ALS / FTD neurons are correlated to decreased NfL levels Thus, in a human patient, decreased cell death in neurons can be measured by a reduction in NfL levels.Example 6: Measuring off-target activity in healthy hepatocytes in vitro

[0445] Lipid-conjugated sbRNAs or AAV vectors containing nucleotide sequences encoding an sbRNA are produced using standard methods. Healthy human hepatocytes are transfected with lipid- conjugated sbRNA or infected with the AAV particles, and the sbRNAs are produced in the hepatocytes. Five days after infection, hepatocytes are harvested and Western blot of potential off-targets is performed using antibodies that detect proteins translated from off-target genes.Example 7: Reduction of C9orf72 associated RNA foci and DPRs in vivo in a C9orf72 BAC transgenic mouse model of ALS / FTP

[0446] sbRNAs are covalently attached to a lipid (e.g., C16) at either internal or terminal positions. Alternatively, DNA expression cassettes comprising nucleotide sequences encoding sbRNAs targeting the GGGGCC and CCCCGG repeats, where the nucleotide sequences arc operably linked to a U6 promoter, are packaged into an AAV9 capsid to produced recombinant AAV9. Recombinant virus comprising the recombinant AAV9 capsid is produced using dual transfection into mammalian cells and purified by column purification. Recombinant virus is formulated in an isotonic, physiological pH buffer consisting of histidine, sodium chloride, trehalose, and poloxamer 188. Recombinant AAV vectors are titered using digital droplet PCR (ddPCR). As a negative control, formulation vehicle is delivered to one group of transgenic mice and one group of wild-type littermates.

[0447] The lipid-conjugated sbRNA or AAV particles are administered by ICV injection into anesthetized male and female C9orf72 BAC transgenic mice (C57BL / 6J-Tg(C9orf72_i3)112Lutzy / J) and wild-type littermates at 3 months of age. A 5.0 pL volume of test article is delivered as a bolus injection.

[0448] Body weights of animals are taken at baseline to ensure even distribution between treatment groups. Weights are then assessed once per week until the time of tissue collection when animals are weighed before being collected.

[0449] Four or eight weeks after injections, animals are euthanized, and tissues are harvested. Half of all animals (male and female balanced) per group are anesthetized with isoflurane and transcardially perfused with phosphate buffered saline (PBS) until the liver is clear. Afterwards, the whole brain is harvested and placed into 25mL vials with 4% paraformaldehyde (PF A) and stored at 4°C for 24 hours. After 24 hours, brains are transferred to 30% sucrose in PBS and stored at 4°C. The spinal cord is harvested and dissected, where the top 1 / 3 is collected into RNAlater solution, and the bottom 2 / 3 is collected and placed into 25mL vials with 4% paraformaldehyde (PFA) and stored at 4°C for 24 hours. For the remaining animals in each group, the animals are euthanized via rapid decapitation, and the brain and spinal cords are excised and rinsed in chilled 0.9% sterile saline to remove excess blood. Brains are microdissected by region under RNase-free conditions on top of a pre-wetted (0.9% saline) piece ofclean (free of DNA and RNA) filter paper resting on a glass petri dish packed in wet ice. The following brain structures are dissected: cerebral cortex and subcortical brain. Each brain tissue sample and entire spinal cord is placed into individual 1.5 mL Eppendorf tubes and snap frozen in li...

Claims

CLAIMSWhat is claimed is:

1. A double-stranded RNA comprising: a) a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeatcontaining RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target GGGGCC repeat region; and ii) at least a second mismatch to the target GGGGCC repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering ofGGGGCCGGGGCCGGGGCCGGGGCC (SEQ ID NO:1) GGGCCGGGGCCGGGGCCGGGGCCG (SEQ ID NO:2), GGCCGGGGCCGGGGCCGGGGCCGG (SEQ ID NOG), GCCGGGGCCGGGGCCGGGGCCGGG (SEQ ID NO:4), CCGGGGCCGGGGCCGGGGCCGGGG (SEQ ID NOG), or CGGGGCCGGGGCCGGGGCCGGGGC (SEQ ID NOG), the second mismatch is from 1 to 13 bases 3’ of the first mismatch; ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, 3, 4, 5, or 6, the second mismatch is from 1 to 10 bases 3’ of the first mismatch.

2. A double-stranded RNA comprising: a) a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeatcontaining RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CCCCGG repeat region; and ii) at least a second mismatch to the target CCCCGG repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering ofCCCCGGCCCCGGCCCCGGCCCCGG (SEQ ID NO:7), CCCGGCCCCGGCCCCGGCCCCGGC(SEQ ID NO:8), CCGGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO:9), CGGCCCCGGCCCCGGCCCCGGCCC (SEQ ID NO: 10), GGCCCCGGCCCCGGCCCCGGCCCC (SEQ ID NO: 11), or GCCCCGGCCCCGGCCCCGGCCCCG (SEQ ID NO: 12), the second mismatch is from 1 to 13 bases 3’ of the first mismatch; ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:7, 8, 9 10, 11, or 12, the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:7, 8, 9 10,11, or 12, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:7, 8, 9 10,11, or 12, the second mismatch is from 1 to 10 bases 3’ of the first mismatch3. The double-stranded RNA of claim 1 or claim 2, wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; and b) a substitution of a C with an A or a U.

4. The double-stranded RNA of any one of claims 1-3, wherein the first strand comprises no more than 2 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 2 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

5. The double-stranded RNA of any one of claims 1-3, wherein the first strand comprises no more than 3 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 3 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

6. The double-stranded RNA of any one of claims 1-3, wherein the fust strand comprises no more than 4 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 4 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

7. The double-stranded RNA of any one of claims 1-3, wherein the fir st strand comprises no more than 5 mismatches with the target GGGGCC repeat region of a GGGGCC repeatcontaining RNA, or wherein the first strand comprises no more than 5 mismatches with the target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

8. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

9. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

10. The double-stranded RNA of any one of claim 1 -7, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

11. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8- 11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

12. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

13. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

14. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8- 11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs: l-12.

15. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises four mismatches to the target repeat region, wherein the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12, and wherein thefourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQID NOs:l-12.

16. The double-stranded RNA of any one of claim 1-7, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12.

17. The double-stranded RNA of any one of claim 1-7, wherein the at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:l-12.

18. The double-stranded RNA of claim 2, wherein the first strand comprises a nucleotide sequence selected from: i) CCGGGGCCUAGGACGGGUCCG (SEQ ID NO:614); (PS_C4G2rep_39670; 9, 10, 13, 18) ii) CCGGGGCCGGUUCCGGGUACG (SEQ ID NO:615); (PS_C4G2rep_18753; 11, 12, 18, 19) iii) CCGGGGCCGAGGCCUGGGCCG (SEQ ID NO:616); (PS_C4G2rep_24; 10, 15) iv) CCGGGGCCGUGGCCGGUGCCG (SEQ ID NO:617); (PS_C4G2rep_88; 10, 17) v) CCGGGGCCGUAGCCGGGGCCG (SEQ ID NO:618); (PS_C4G2rep_70; 10,11) vi) CCGGGGCCGGUGAAGGGGCCG (SEQ ID NO:619); (PS_C4G2rep_2161; 11, 13, 14) vii) CCGGGGCCGGUGACGUGGUCG (SEQ ID NO:620); (PS_C4G2rep_18895; 11, 13, 16,19) viii) CCGGGGCCGAUGCCGGGUCCG (SEQ ID NO:621); (PS_C4G2rep_413; 10, 11, 18) ix) CCGGGGCCGUGGCCGAGGCCG (SEQ ID NO:622); (PS_C4G2rep_54; 10, 16); x) CCGGGGCCCGGGACGGGGCCG (SEQ ID NO:623); (PS_C4G2rep_288; 9, 13); xi) CCGGGGCCCGGUCCGGGGCCG (SEQ ID NO:624); (PS_C4G2rep_287; 9, 12); xii) CCGGGGCCGAGGACGGGUCCG (SEQ ID NO:625); and (PS_C4G2rep_504; 10, 13, 18) and xiii) CCGGGGCCGUGGCCCGGGCCG (SEQ ID NO:626). (PS_C4G2rep_81; 10, 15)19. The double-stranded RNA of claim 1, wherein the first strand comprises a nucleotide sequence selected from: i) CGGCCCCGGUCCCGGACCCGG (SEQ ID NO: 627); (GS_G4C2rep_49) ii) CGGCCCCGUACCCGGCCCCGG (SEQ ID NO:628); (GS_G4C2rep_260) iii) CGGCCCCGACCCCGGCACCGG (SEQ ID NO:629); (GS_G4C2rep_220)iv) CGGCCCCGU ACCCGGUACCGG (SEQ ID NO:630); (GS_G4C2rep_28671) v) CGGCCCCGGACCCGGCCACGG (SEQ ID NO: 631 ) ; (GS_G4C2rep_27) vi) CGGCCCCGU ACC AUGCCCCGG (SEQ ID NO: 632) ; (GS_G4C2rep_28528) vii) CGGCCCCGGACUCGGCCCCGG (SEQ ID NO:633); (GS_G4C2rep_14) viii) CGGCCCCGACCCCGGUCCCGG (SEQ ID NO:634); and (GS_G4C2rep_219) ix) CGGCCCCGU ACCCGGCAACGG (SEQ ID NO: 635); (GS_G4C2rep_28683).

20. The double-stranded RNA of claim 1 , wherein the first strand or the second strand comprises any one of the guide strand sequences or reverse complement sequences depicted in FIG. 1- 6.

21. The double-stranded RNA of any one of claims 1-20, wherein the second strand is 100% complementary to the first strand.

22. The double-stranded RNA of any one of claims 1-20, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

23. The double-stranded RNA of any one of claims 1-22, wherein the double-stranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

24. The double-stranded RNA of any one of claims 1-22, wherein the double-stranded RNA has a length of from 21 nucleotides to 25 nucleotides.

25. The double-stranded RNA of any one of claims 1-22, wherein the double-stranded RNA has a length of 21 nucleotides.

26. The double-stranded RNA of any one of claims 1-25, wherein the double-stranded RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification.

27. A DNA molecule comprising a nucleotide sequence encoding the first strand as set forth in any one of claims 1-25, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

28. A recombinant nucleic acid comprising: al) the double-stranded RNA of any one of claims 1-25; and bl) a microRNA scaffold comprising a 5' flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the second strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide; wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a2) the double-stranded RNA of any one of claims 1-25; and b2) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the first strand of the double-stranded RNA: and v) the 3’ flanking polynucleotide, where at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a3) the double-stranded RNA of any one of claims 1-25; and b3) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5' flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide;wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a4) the double-stranded RNA of any one of claims 1-25; and b4) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

29. The recombinant nucleic acid of claim 28, wherein the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33, miR451, miR144, miRlOl, or miR126.

30. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to claim 28 or claim 29.

31. The DNA molecule of claim 30, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctggcgggcagctctg (SEQ ID NO:611).

32. The DNA molecule of claim 30 or claim 31, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgttctggcaatacctg (SEQ ID NO:612).

33. The DNA molecule of any one of claims 30-32, wherein the 3’ flanking polynucleotide is encoded by the nucleotide sequence: gggaggcctgccctgactgcccac (SEQ ID NO:613).

34. The DNA molecule of claim 30, wherein the DNA molecule comprises a nucleotide sequence depicted in FIG. 7A-7B or depicted in FIG. 8A-8B, the nucleotide sequence set forth in any one of SEQ ID NOs: 13-238, or the nucleotide sequence set forth in any one of SEQ ID NOs:239-610.Ill35. The DNA molecule of claim 30. wherein the DNA molecule comprises: a) a first nucleotide sequence encoding a fust recombinant nucleic acid according to claim 28 or claim 29; and b) a second nucleotide sequence encoding a second recombinant nucleic acid according to claim 28 or claim 29, wherein the first recombinant nucleic acid differs in nucleotide sequence from the second recombinant nucleic acid.

36. The DNA molecule of claim 35, wherein the first recombinant nucleic acid comprises a first microRNA scaffold, wherein the second recombinant nucleic acid comprises a second microRNA scaffold, and wherein the first microRNA scaffold differs in nucleotide sequence from the second microRNA scaffold.

37. The DNA molecule of claim 35, wherein the microRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the microRNA scaffold of the second recombinant nucleic acid.

38. The DNA molecule of any one of claims 35-37, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA.

39. The DNA molecule of any one of claims 35-37, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CCCCGG repeat region of a CCCCGG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a fust strand that hybridizes to a target GGGGCC repeat region of a GGGGCC repeat-containing RNA.

40. A recombinant expression vector comprising the DNA molecule of any one of claims 30-39.

41. The recombinant expression vector of claim 40, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell, optionally wherein the first nucleotide sequence encoding the first recombinant nucleic acid according to claim 28 or claim 29 is operably linked to a first promoter; andthe second nucleotide sequence encoding the second recombinant nucleic acid according to claim 28 or claim 29 is operably linked to a second promoter, wherein the first promoter and the second promoter are same or different and wherein the first and second promoters are functional in a eukaryotic cell.

42. The recombinant expression vector of claim 41. wherein the promoter is an RN A polymerase II promoter or an RNA polymerase III promoter or wherein the first promoter is an RNA polymerase II promoter and the second promoter is an RNA polymerase III promoter or vice versa.

43. The recombinant expression vector of claim 41 or claim 42, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter or wherein the first and second promoters are independently selected from a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

44. The recombinant expression vector of any one of claims 40-43, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

45. A recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid of claim 28, claim 29, or any one of claims 30-39.

46. The recombinant expression vector of claim 45. wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell, optionally wherein the first nucleotide sequence encoding the first recombinant nucleic acid according to claim 28 or claim 29 is operably linked to a first promoter; and the second nucleotide sequence encoding the second recombinant nucleic acid according to claim 28 or claim 29 is operably linked to a second promoter, wherein the first promoter and the second promoter are same or different and wherein the first and second promoters are functional in a eukaryotic cell.

47. The recombinant expression vector of claim 46, wherein the promoter is an RNA polymeraseII promoter or an RNA polymerase III promoter or wherein the first promoter is an RNApolymerase II promoter and the second promoter is an RNA polymerase III promoter or vice versa.

48. The recombinant expression vector of claim 45 or claim 46, wherein the promoter is a CAG promoter, a CBA promoter a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter or wherein the first and second promoters are independently selected from a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

49. The recombinant expression vector of any one of claims 45-48, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

50. A conjugate comprising: a) a double-stranded RNA of any one of claims 1-26; and b) one or more non-nucleic acid moieties conjugated, directly or via a linker, to one or both strands of the double-stranded RNA, at one or both terminal positions or at one or more internal positions.

51. The conjugate of claim 50, wherein the one or more non-nucleic acid moieties is or comprises a lipophilic moiety.

52. The conjugate of claim 51, wherein the lipophilic moiety is a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3- propandediol, a heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, docosanoic acid (DCA), eicosapentaenoic acid (EPA), a dendrimer, dimethoxytrityl, or phenoxazine.

53. The conjugate of claim 51, wherein the lipophilic moiety comprises a saturated or unsaturated C4-C30 hydrocarbon chain or saturated or unsaturated hydrocarbon chain longer than 30, and an optional functional group selected from the group consisting of a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne.

54. The conjugate of claim 53, wherein the lipophilic moiety contains a saturated or unsaturatedCe-C is hydrocarbon chain, C6-C22 hydrocarbon chain, a C22 hydrocarbon chain, or hydrocarbon chain longer than Ci2.

55. The conjugate of claim 54, wherein the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain.

56. The conjugate of any one of claims 50-55, wherein the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase, a sugar- moiety, or an internucleoside linkage in the double-stranded RNA, optionally wherein the lipophilic moiety is linked to the first or the second strand, further optionally wherein the lipophilic moiety is linked to a 2'-O of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands.

57. A delivery vehicle comprising the recombinant expression vector of any one of claims 40- 49.

58. The delivery vehicle of claim 57, wherein the delivery vehicle is a non-viral delivery vehicle.

59. The delivery vehicle of claim 58, wherein the delivery vehicle is a lipid nanoparticle.

60. The delivery vehicle of claim 57, wherein the delivery vehicle is a viral particle.

61. A delivery vehicle comprising the double-stranded RNA of any one of claims 1-25.

62. A delivery vehicle comprising the double-stranded RNA of claim 26.

63. The delivery vehicle of claim 61 or claim 62, wherein the double-stranded RNA comprises a covalently linked lipid moiety, optionally wherein the lipid moiety is linked to the sense or the anti-sense strand, further optionally wherein the lipid moiety is linked to a 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands.

64. The delivery vehicle of claim 63, wherein the covalently linked lipid moiety comprises a palmityl moiety, docosanoic acid (DCA), eicosapentaenoic acid (EPA), or a dendrimer, optionally wherein the dendrimer comprises the dendrimer of Fig. 20.

65. The delivery vehicle of any one of claims 62-64, wherein the delivery vehicle is a lipid nanoparticle.

66. A delivery vehicle comprising the conjugate of any one of claims 50-56.

67. A viral particle comprising the recombinant expression vector of any one of claims 40-49.

68. The viral particle of claim 67, wherein the viral particle is an adeno-associated virus (AAV) particle.

69. The viral particle of claim 68, wherein the AAV particle comprises an AAV9 capsid.

70. The viral particle of claim 68, wherein the AAV particle comprises an AAV2 capsid.

71. A composition comprising: a) the recombinant expression vector of any one of claims 40-49; and b) a pharmaceutically acceptable excipient.

72. A composition comprising: a) the delivery vehicle of any one of claims 57-65; and b) a pharmaceutically acceptable excipient.

73. A composition comprising: a) a viral particle of any one of claims 67-70; and b) a pharmaceutically acceptable excipient.

74. A composition comprising: a) a conjugate of any one of claims 50-56; and b) a pharmaceutically acceptable excipient.

75. A method for selectively reducing the translation and / or accumulation of a disease- associated GGGGCC repeat-containing RNA and / or a disease-associated CCCCGG repeatcontaining RNA produced by transcription of a GGGGCC repeat expansion in intron 1 of a C9orf72 gene in an individual having a GGGGCC repeat expansion disorder, the method comprising administering to the individual an effective amount of the expression vector of any one of claims 40-49, delivery vehicle of any one of claims 57-66, the viral particle of any one of claims 67-70, or the composition of any one of claims 71-74.

76. The method of claim 75, wherein the repeat expansion disorder is amyotrophic lateral sclerosis or frontotemporal dementia.

77. The method of claim 75 or claim 76, wherein said administering comprises direct injection to the central nervous system of the individual.

78. The method of claim 77, wherein the direct injection is intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

79. The method of any one of claims 75-78, wherein said administering reduces the number of cells containing toxic foci by at least 10%, compared to the number of cells containing toxic foci in the individual before said administering.

80. The method of any one of claims 75-78, wherein said administering reduces the dipeptide repeats (DPR) by at least 10%, compared to the level of DPR in the individual before said administering.

81. The method of any one of claims 75-78, wherein said administering reduces defective splicing of C9orf72-encoded transcription products.

82. A method of treating amyotrophic lateral sclerosis or frontotemporal dementia in an individual, the method comprising administering to the individual an effective amount of the expression vector of any one of claims 40-49, delivery vehicle of any one of claims 57-66, the viral particle of any one of claims 67-70, or the composition of any one of claims 71-74.

3. A method of treating amyotrophic lateral sclerosis and frontotemporal dementia in an individual, the method comprising administering to the individual an effective amount of the expression vector of any one of claims 40-49, delivery vehicle of any one of claims 57-66, the viral particle of any one of claims 67-70, or the composition of any one of claims 71-74.

Images