Agents that can bind elav4 for use in the treatment of tauopathies
Patent Information
- Application Number
- EP2024798542
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-14
- Filing Date
- 2024-11-01
- Publication Date
- 2026-09-09
AI Technical Summary
Current treatments for tauopathies, such as Alzheimer's disease, amyotrophic lateral sclerosis, frontotemporal dementia, Parkinson's disease, progressive supranuclear palsy, and multiple sclerosis, are limited by the blood-brain barrier, metabolic stability, specificity, and lack of effective disease-modifying therapies.
Development of agents that can bind and modulate the activity of ELAVL4 with high affinity, specifically targeting neurons to decrease intracellular phosphorylated tau levels and alter the Aβ42/Aβ40 ratio, thereby addressing the pathological hallmarks of tauopathies.
The proposed agents effectively reduce the levels of phosphorylated tau and alter the Aβ42/Aβ40 ratio, providing a potential therapeutic strategy for treating tauopathies by targeting both hallmark lesions associated with these diseases.
Smart Images

Figure EP2024080927_08052025_PF_FP_ABST
Abstract
Description
[0001] AGENTS FOR USE IN THE TREATMENT OF TAUOPATHIES Field of the invention The invention relates to the treatment of tauopathies. The invention relates in particular to agents for use in the treatment of tauopathies through modulation of ELAVL4 activity. The invention further relates to compositions effective in treating tauopathies. Background of the invention Tauopathies are neurodegenerative disorders characterized by the deposition of abnormal tau protein in brain cells, including neurons and glial cells. These depositions involve the pathological aggregation of tau protein into neurofibrillary tangles. The aggregation is generally caused by the hyperphosphorylation of normally occurring tau protein in neurons, after which the formed tangles disrupt the cytoskeleton. This process can eventually lead to cell death and the progressive loss of neuronal connections in the brain. Furthermore, the tau fibrils can spread through the brain and continue to disrupt healthy neuronal cells. Neurofibrils were first described by Alois Alzheimer in one of his patients with Alzheimer’s disease (AD), and are considered one of the major hallmarks of AD. Other examples of tauopathies include amyotrophic lateral sclerosis, frontotemporal dementia, Parkinson’s disease, progressive supranuclear palsy and multiple sclerosis. AD is one of the leading causes of dementia in humans. It generally starts with difficulties in short-term memory, and progresses into more serious memory issues, disorientation, mood swings, self-neglect and behavioral issues. As the condition of the patient worsens, the decline in bodily and cognitive functions ultimately leads to death. AD is characterized by two hallmark neuropathological lesions found in patients’ brains. One of these hallmark lesions is the intraneuronal buildup of hyperphosphorylated tau fibrils that aggregate into so-called neurofibrillary tangles. Secondly, there is the extracellular buildup of neuritic plaques consisting of amyloid-β (Aβ). Aβ is a fragment of the larger Amyloid Precursor Protein (APP), a transmembrane protein expressed in neurons with important functions in neuronal growth and survival. Upon breakdown, several different secretases cut APP into smaller fragments, among which Aβ. Depending on the secretase that cuts APP, the Aβ produced varies in length, whereby the longer Aβ consisting of 42 amino acids (Aβ42) is more prone to aggregation into harmful plaques than the shorter 40 amino acid (Aβ40) fragment. An increased Aβ42 / Aβ40 ratio is therefore considered to be indicative of more neurotoxic Aβ, and treatments that can impact the processing of APP and the subsequent buildup of Aβ plaques represent a promising avenue of treatment. The tau neurofibrillary tangles and the Aβ-plaques lead to loss of neurons and synapses, causing an irreversible degeneration of the brain regions affected. Over time, this leads to the progressively more serious symptoms of AD. Current treatment of AD generally focuses on targeting Aβ aggregation and – to a lesser extent – hyperphosphorylated tau aggregation directly, for example with antibodies or small compounds. However, the blood-brain barrier prevents most larger molecules from effectively crossing into the brain in significant quantities and results in poor bioavailability in the brain. Furthermore, metabolic stability, specificity and other important therapeutic factors are often lacking. Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease affecting lower and upper motor neurons. The loss of lower motor neurons drives progressive muscle atrophy, while the loss of upper motor neurons is predominantly manifested as spasticity. In ALS, the progressive loss of motor function culminates in respiratory failure and death in the majority of individuals within 3 and 5 years of symptom onset. In addition, increased tau phosphorylation has been observed in (motor neurons of) ALS patients, especially those patients (also) affected with cognitive or executive dysfunction, while blood levels of phosphorylated tau have been reported to be markedly increased in ALS patients and to be specifically associated with lower motor neuron impairment. Taken together, these findings indicate that phosphorylated tau plays a role in ALS pathology, and hence and at least to some extent, ALS can be considered a tauopathy. Frontotemporal dementia (FTD) is a prototypical tauopathy and neurodegenerative disease that is characterized by the pathological buildup of hyperphosphorylated tau and neuronal death. FTD is the most common form of dementia in individuals under 60 years of age, with an economic burden that is nearly twice that reported for AD. Despite its devastating effects, there are currently no effective disease-modifying therapies for FTD, highlighting an urgent unmet need. Parkinson’s disease (PD) is another major neurodegenerative disease that primarily affects motor systems but can also be accompanied by non-motor symptoms. There is a widespread neuron degeneration in brains of PD patients. Recent studies have demonstrated increasing evidence of tau pathology in PD. Aggregation and deposition of tau were observed in ~50% of PD brains. In PD, tau protein is also hyperphosphorylated and seems to be transported from neuron to neuron, while it also interacts with alpha-synuclein, the most well-known familial PD protein. Progressive supranuclear palsy (PSP) is a rare neurological condition that can cause problems with balance, movement, vision, speech and swallowing. PSP occurs when brain cells in certain parts of the brain are damaged as a result of deposition of hyperphosphorylated tau. PSP can thus also be considered a tauopathy. Lastly, multiple sclerosis (MS) is a chronic inflammatory condition of the central nervous system (CNS), characterized by lesions with demyelination and / or insufficient remyelination of neurons, with concomitant neuronal degeneration. Depending on the location of the MS lesions in the CNS, a variety of neurological symptoms – such as visual loss, limb weakness or sensory loss – can occur. Most people with the disease suffer from relapsing-remitting MS (RRMS), i.e., they experience multiple episodes of neurological disability, usually lasting days to weeks, followed by a full or partial recovery to baseline level. After typically 10–20 years, many of those affected develop secondary progressive MS (SPMS), characterized by a progressive clinical course and eventually manifesting greatly impaired mobility and cognition, while approximately 15% of patients have primary progressive MS (PPMS), with a progressive course from disease onset. Recently, hyperphosphorylated tau aggregates have been identified in brain lesions from SPMS and PPMS patients, while the cerebrospinal fluid (CSF) levels of phosphorylated tau have been reported to be considerably increased in MS patients with a progressive disease course (Emeršič et al. (2024) Biomarkers of tau phosphorylation state are associated with the clinical course of multiple sclerosis; Mult Scler Relat Disord.2024 Oct:90:105801). Combined, these findings indicate that (hyper)phosphorylated tau plays a role in MS pathology. Therefore and at least in part, MS can (also) be considered a tauopathy. ELAVL4, or HuD, is a member of the Hu / ELAV-like family of RNA-binding proteins. Such proteins are involved in post-transcriptional gene regulation of numerous other genes by binding and stabilizing their mRNA, thereby increasing protein expression, and are involved in processes such as mRNA polyadenylation, alternative splicing, trafficking, turnover and translation. ELAVL4 is a central regulator in tauopathy-related synaptic pathways and can bind and stabilize multiple mRNAs encoding proteins that are implicated in tauopathies. Recent research focused on using both knockout and overexpression constructs of ELAVL4 to further investigate its effects on pathways related to AD. ELAVL4 was shown to directly affect tau phosphorylation in neurons, with increased expression of ELAVL4 leading to lower tau phosphorylation and ELAVL4 knockout leading to higher tau phosphorylation (Van der Linden et al., Progress in neurobiology 217 (2022) 102316). Increasing ELAVL4 expression was shown to act against the formation of the direct precursor of tau fibrils and as such represents an interesting target for the treatment of tauopathies. ELAVL4 can also bind and stabilize mRNAs of several secretases involved in APP breakdown, among which α-secretase ADAM10. This secretase breaks down APP in a non- amyloidogenic manner. It can also bind and stabilize the mRNA of several genes involved in the degradation of Aβ. Furthermore, ELAVL4 directly binds to mRNA of APP itself, leading to alternative splicing of APP that can change the Aβ42 / Aβ40 ratio of fragments formed during breakdown. Overexpression of ELAVL4 was shown to lead to a decreased Aβ42 / Aβ40 ratio, which may then lead to a lower aggregation of Aβ plaques. Thus, overexpression of ELAVL4 acts on both hallmark lesions associated with AD. This makes ELAVL4 an especially attractive target for the treatment of AD, and its modulation may represent a new avenue of treating both pathological hallmarks of AD simultaneously. In addition to AD, recent studies have demonstrated that modulated ELAVL4 function / activity is implicated in ALS (De Santis et al.2019 Mutant FUS and ELAVL4 (HuD) Aberrant Crosstalk in Amyotrophic Lateral Sclerosis (Cell Rep.2019 Jun 25;27(13):3818-3831); Dell’Orco et al.2021 HuD regulates SOD1 expression during oxidative stress in differentiated neuroblastoma cells and sporadic ALS motor cortex (Neurobiol Dis.2021 Jan:148:10521) ; Garone et al.2021 ALS-related FUS mutations alter axon growth in motoneurons and affect HuD / ELAVL4 and FMRP activity (Commun Biol.2021 Sep 1;4(1):1025)), in FTD (Bowles et al. 2021 ELAVL4, splicing, and glutamatergic dysfunction precede neuron loss in MAPT mutation cerebral organoids (Cell.2021 Aug 19;184(17):4547-4563), in PD (DeStefano et al.2008 Replication of association between ELAVL4 and Parkinson disease: the GenePD study (Hum Genet.2008 Aug;124(1):95-9); Pastic et al.2022 LRRK2 Phosphorylates Neuronal Elav RNA- Binding Proteins to Regulate Phenotypes Relevant to Parkinson’s Disease Silvestri et al.2022 Emerging Roles for the RNA- Binding Protein HuD (ELAVL4) in Nervous System Diseases (Int J Mol Sci.2022 Nov 23;23(23):14606)) and in MS (Borgonetti and Galeotti (2023) Posttranscriptional Regulation of Gene Expression Participates in the Myelin Restoration in Mouse Models of Multiple Sclerosis: Antisense Modulation of HuR and HuD ELAV RNA Binding Protein; May;60(5):2661-2677). Apart from the aforementioned literature studies that implicate altered ELAVL4 function in specific tauopathies and based on ELAVL4 knockout experiments in neurons performed by the inventors, it was found that through alternative splicing, ELAVL4 upregulates the main, functional isoform of O-GlcNac transferase (OGT) (Van der Linden et al., supra; Table 7). OGT is an enzyme that adds O-GlcNac to proteins such as tau, which in turn significantly reduces tau aggregation and hyperphosphorylation, making OGT activators attractive potential novel drugs to treat all tauopathies (Xia et al.2024 Dihydroartemisinin promotes tau O- GlcNAcylation and improves cognitive function in hTau transgenic mice; Prog Neuropsychopharmacol Biol Psychiatry.2024 Dec 20:135:111105). In this respect, modulation of ELAVL4 function may constitute an attractive, novel therapeutic strategy for tauopathies in general. Moreover, tauopathies are more prevalent with increasing age, and they are caused by a combination of various genetic and environmental factors. While progress has been made in the understanding of tauopathies, the exact causes, risk factors and potential ways to treat them are still not (fully) understood. In this respect and with the ageing world population, new treatment methods for tauopathies are only becoming ever more relevant. Van der Linden et al. (supra) used overexpression constructs and knockouts of ELAVL4 to investigate the effect of increased ELAVL4 expression in neurons. While it has been shown that ELAVL4 is upregulated in the hippocampus of mice and rats upon learning and memory tasks and is important in neuroplasticity of mature neurons, it was also shown that both knockout and constitutive overexpression of ELAVL4 ultimately leads to impaired hippocampus-dependent learning and memory. In addition, ELAVL4 is predominantly but not exclusively expressed in the brain, and upregulating the transcription of ELAVL4 may cause adverse effects in other body parts than the brain through induction of ELAVL4 transcription. For example, ELAVL4 has also been linked to type 2 diabetes mellitus and certain forms of small-cell lung cancer through high expression in pancreatic and small-cell lung cancer cells. Moreover, introducing genetic constructs in patients is not clinically feasible. Knocking-out or overexpressing ELAVL4 may thus have detrimental effects on the body or its functions and is therefore not desirable. It is therefore an object of the present invention to provide an agent that can bind and modulate the activity of ELAVL4 in a patient for the treatment of tauopathies, in particular AD, ALS, FTD, PD,PSP and MS. A preferred agent exclusively and transiently modulates the activity of existing ELAVL4 in cells already expressing it. In the research leading to the invention, it was found that agents that can bind ELAVL4 with an affinity of at least -8.0 kcal / mol are capable of decreasing the level of intracellular phosphorylated tau in neurons and may therefore be suitable for use in the treatment of tauopathy. Preferably, the agent can bind ELAVL4 with an affinity of at least -9.0 kcal / mol, at least -9.5, at least -10.0, at least -10.5, at least -11.0. The present invention thus relates to an agent for use in decreasing the level of intracellular phosphorylated tau in neurons, which agent can bind ELAVL4 with a binding affinity of at least - 8.0 kcal / mol. To modulate the activity of ELAVL4, an agent needs to be administered that can bind it and influence its activity. An analysis of the binding affinity between ELAVL4 and a wide range of pharmaceutically known compounds was performed, after which a selection was made of compounds showing high binding affinity to ELAVL4 (Table 1). Binding affinity between a compound and a putative protein target can be determined in silico based on the crystallographic structure of the compound and target. Specifically, the tool Autodock Vina (version 1.1.2) was used to predict the binding affinity between ELAVL4 and 5860 compounds approved by regulatory agencies for multiple disease indications, using standard settings. Where possible, the compounds that showed the highest binding affinity – i.e., the lowest kcal / mol value – were then further divided into groups, based on their molecular structure, or presence of certain moieties or backbones. In an embodiment of the invention, the agent provided comprises a steroid backbone. Steroids are biologically active organic compounds with a specific core chemical structure generally comprising 17 carbon atoms in four fused rings, three 6 member cyclohexane rings and one 5 member cyclopentane ring. Variations of this structure exist such as vitamin D, which is a steroid in which one of the cyclohexane rings has been cleaved. Steroids can further comprise a large diversity of side groups that can alter their chemical properties. Steroids generally act as signaling molecules in and between cells and are important components of cell membranes. In a further embodiment of the invention, the agent comprises a sugar moiety by glycoside linkage. Glycosidic bonds are types of ether bonds that join a carbohydrate to another group. Such sugar moieties can alter the hydrophobicity and binding affinities of molecules. In another embodiment, the agent comprises an O-linked glucuronide. Glucuronidation is often involved in the drug metabolism of pharmaceuticals and glucuronides are also attached via glycosidic bonds. Glucuronidation can alter the toxicity, hydrophobicity and binding affinity of molecules undergoing it. In yet another embodiment, the agent comprises a macrocyclic group, such as a macrolactone or macrolactam group. Macrolactone groups are cyclic carboxylic esters (of at least 8 atoms), formed by intramolecular esterification of the hydroxyl group of a carboxylic acid moiety with a carbon atom within the same molecule. Macrolactones to which one or two deoxysugars are attached are called macrolides. Macrolactams are amides that are the nitrogen analogs of the naturally occurring macrolactones and macrolides. In yet a further embodiment, the agent is selected from the group of porphyrins, vitamin D glucuronides, steroid glucuronides, withanolides, cardenolide glycosides, anthracyclines, ergoloid mesylates, ergotamines and derivates, biphenyls, and piperazines. The agent for use in decreasing the level of intracellular phosphorylated tau in neurons is preferably selected from the group consisting of Temoporfin, Nystatin, Rifaximin, 25-O-Desacetyl rifabutin, Rifabutin, Eptifibatide, Paritaprevir, Simeprevir, Rifampicin, 3'-Demethyletoposide (norerythromycin), 31-O-Demethyltacrolimus, (23S)-23,25-dihdroxy-24-oxovitamine D323-(beta- glucuronide), Vitamin D23-glucuronide, 4-Hydroxyandrostenedione glucuronide, Estriol-17- glucuronide, 11-Oxo-androsterone glucuronide, Estriol-3-glucuronide, 17-beta-Estradiol glucuronide, Candesartan N2-Glucuronide, Etoposide glucuronide, Clofazimine Glucuronide, Sorafenib Beta-D-Glucuronide, Hydromorphone-3-glucuronide, Withanolide D, Doxorubicinol, Doxorubicinol Aglycone, Dihydroergotoxine, Ergotamine, Dihydroergocristine (Ergoloid), Ergoloid Mesylate, Conivaptan, Tasosartan, Eltrombopag, Lomitapide, Azilsartan medoxomil, O- Deethylated Candesartan, Netupitant, Id14326, Venetoclax, Fosnetupitant, Antrafenine, Lurasidone, Fad (Flavin adenine dinucleotide), Naldemedine, Dutasteride (Avodart), Dabrafenib, 6-Methoxy-2-naphthylacetic acid, Gliquidone, Midostaurin, Ledipasvir, Cepharanthine, Indocyanine Green, N-Trifluoroacetyladriamycinol, Rupatadine, Lumacaftor, Rutin, Glimepiride, Irinotecan, Talniflumate, Bemetizide, NPC, Saquinavir, Alatrofloxacin, Ecamsule, Nebivolol, Acetyldigitoxin, 20, 22-Dihydrodigoxigenin, Digoxigenin bisdigitoxoside, Digitoxin, Digoxigenin, Deslanoside, Digoxin, Digoxigenin monodigitoxoside, 3-keto-Digoxigenin. More preferably, the agent is selected from the group consisting of Temoporfin, Nystatin, Rifaximin, Rifabutin, Estradiol 17-Beta-D-Glucuronide, Doxorubicinol, Co-Dergocrine Mesylate, Conivaptan Hydrochloride, Eltrombopag, Azilsartan, Medoxomil, Netupitant, Venetoclax, Dutasteride, Dabrafenib, 6-Methoxy-2-Naphthylacetic Acid, Gliquidonemidostaurin, Ledipasvir, Cepharantine, Indocyanine Green, Rupatadine, Lumacaftor, Rutin, Glimepiride, Talniflumate, Bemetizide, Saquinavir, Ecamsule, Nebivolol, Acetyldigitoxin, Digoxigenin. The best results are obtained with the agent Indocyanine Green. In a further embodiment, the agent is administered for the treatment of tauopathy. The agent for use in the treatment of tauopathy is suitably a compound selected from Table 1. The invention further relates to the combination of two or more compounds selected from Table 1 for the treatment of tauopathy. In a preferred embodiment, the agent for use in the treatment of tauopathy is a compound from the group consisting of Temoporfin, Nystatin, Rifaximin, 25-O-Desacetyl rifabutin, Rifabutin, Eptifibatide, Paritaprevir, Simeprevir, Rifampicin, 3'-Demethyletoposide (norerythromycin), 31-O-Demethyltacrolimus, (23S)-23,25-dihdroxy-24-oxovitamine D323-(beta- glucuronide), Vitamin D23-glucuronide, 4-Hydroxyandrostenedione glucuronide, Estriol-17- glucuronide, 11-Oxo-androsterone glucuronide, Estriol-3-glucuronide, 17-beta-Estradiol glucuronide, Candesartan N2-Glucuronide, Etoposide glucuronide, Clofazimine Glucuronide, Sorafenib Beta-D-Glucuronide, Hydromorphone-3-glucuronide, Withanolide D, Doxorubicinol, Doxorubicinol Aglycone, Dihydroergotoxine, Ergotamine, Dihydroergocristine (Ergoloid), Ergoloid Mesylate, Conivaptan, Tasosartan, Eltrombopag, Lomitapide, Azilsartan medoxomil, O- Deethylated Candesartan, Netupitant, Id14326, Venetoclax, Fosnetupitant, Antrafenine, Lurasidone, Fad (Flavin adenine dinucleotide), Naldemedine, Dutasteride (Avodart), Dabrafenib, 6-Methoxy-2-naphthylacetic acid, Gliquidone, Midostaurin, Ledipasvir, Cepharanthine, Indocyanine Green, N-Trifluoroacetyladriamycinol, Rupatadine, Lumacaftor, Rutin, Glimepiride, Irinotecan, Talniflumate, Bemetizide, NPC, Saquinavir, Alatrofloxacin, Ecamsule, Nebivolol, Acetyldigitoxin, 20, 22-Dihydrodigoxigenin, Digoxigenin bisdigitoxoside, Digitoxin, Digoxigenin, Deslanoside, Digoxin, Digoxigenin monodigitoxoside, 3-keto-Digoxigenin. More preferably, the agent for use in the treatment of tauopathy is selected from the group consisting of Temoporfin, Nystatin, Rifaximin, Rifabutin, Estradiol 17-Beta-D-Glucuronide, Doxorubicinol, Co-Dergocrine Mesylate, Conivaptan Hydrochloride, Eltrombopag, Azilsartan, Medoxomil, Netupitant, Venetoclax, Dutasteride, Dabrafenib, 6-Methoxy-2-Naphthylacetic Acid, Gliquidonemidostaurin, Ledipasvir, Cepharantine, Indocyanine Green, Rupatadine, Lumacaftor, Rutin, Glimepiride, Talniflumate, Bemetizide, Saquinavir, Ecamsule, Nebivolol, Acetyldigitoxin, Digoxigenin. Most preferably, the agent for use in the treatment of tauopathy is Indocyanine Green. For the treatment of tauopathies, it is important that the agent is effective in the reduction of neurofibrillary tau tangles in neurons and other brain cells that are caused by hyperphosphorylation of tau, especially on residue Thr181. In an embodiment, the administration of the agent leads to a decrease in tau phosphorylation. In a preferred embodiment, the administration of the agent also leads to a specific decrease in tau phosphorylation at residue Thr181. In one embodiment, the % change in protein levels of phosphorylated tau in normal neurons treated with the agent is at least 20% as compared to non-treated normal neurons. The % change in protein levels of phosphorylated tau in normal neurons treated with the agent is in order of increased preference at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non-treated normal neurons. Protein levels of phosphorylated tau are the levels of tau protein molecules that are phosphorylated. The % change in protein levels of phosphorylated tau as described herein is obtained in normal neurons that are derived from human induced pluripotent stem cells (iPSCs) that originally carry the APP London mutation V717I, but wherein the mutation V717I mutation is corrected back to valine. According to a further aspect thereof, the agent for use of the invention is furthermore for use in decreasing the Aβ42 / Aβ40 ratio in fAD neurons. In this case, the agent is preferably selected from the group consisting of Nystatin, Rifaximin, Rifabutin, Co-Dergocrine Mesylate, Conivaptan Hydrochloride, Eltrombopag, Venetoclax, Dutasteride, and Indocyanine Green. In one embodiment, the % change in protein levels of phosphorylated tau in fAD neurons treated with the agent is at least 15% as compared to non-treated fAD neurons and the % change in the Aβ42 / Aβ40 ratio in fAD neurons treated with the agent is at least 10% as compared to non- treated fAD neurons. The % change in protein levels of phosphorylated tau in fAD neurons treated with the agent is in order of increased preference at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non-treated fAD neurons. The % change in the Aβ42 / Aβ40 ratio in fAD neurons treated with the agent is in order of increased preference at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non-treated fAD neurons. The % change in protein levels of phosphorylated tau and the % change in the Aβ42 / Aβ40 ratio as described herein is obtained in fAD neurons that are derived from human induced pluripotent stem cells (iPSCs) that carry the APP London mutation V717I. In a further embodiment, the agent can bind and modulate the activity of ELAVL4 in a patient for the treatment of AD. For treatment of AD, its hallmark lesions must be effectively ameliorated. As mentioned before, a high Aβ42 / Aβ40 is considered indicative for the onset and progression of AD as the longer Aβ42 variant is more prone to aggregation. Therefore, in one embodiment, the administration of the agent leads – also – to a decreased Aβ42 / Aβ40 ratio in the patients’ neurons. The invention further relates to a composition comprising at least one agent that can modulate ELAVL4 activity that is effective in the treatment of tauopathies. In one embodiment, such a composition comprises at least one such agent and further comprises a pharmaceutically acceptable excipient that does not cause any or only minimal adverse effects in the patient’s body. For effective treatment of tauopathies, the agent must be capable of crossing into the brain of the patient. However, the blood-brain barrier is known to be restrictive as to which compounds can pass it. Therefore, in one embodiment, the agent is a compound that can readily cross the blood-brain barrier of the patient. In another embodiment, the composition comprises an additional carrier that allows the agent to cross the blood-brain barrier. The invention further relates to a compound or combination of compounds selected from Table 1 for use in the treatment of ALS, FTD, PD, PSP or MS. The present invention will now be illustrated in the examples that follow and that are given for illustration purposes only and are not intended to limit the invention in any way. In the Examples, reference is made to the following figures: Figure 1. Representation of in silico modeling of Temoporfin – the identified compound with the highest binding affinity – binding to ELAVL4 as calculated by Autodock Vina (version 1.1.2), using Discovery Studio Visualizer. EXAMPLES EXAMPLE 1 In silico determination of binding affinity To identify candidate agents capable of binding ELAVL4, the tool Autodock Vina (version 1.1.2) was used to predict the binding affinity between ELAVL4 and 5860 compounds approved by regulatory agencies for multiple disease indications, using standard settings. Where possible, the compounds that showed the highest binding affinity – i.e., the lowest kcal / mol value – were then further divided into groups, based on their molecular structure, or presence of certain moieties or backbones. This group of compounds and their grouping are shown in Table 1 and Table 2.
[0002] Table 1 Overview of compounds with a binding affinity for ELAVL4 of < -9.0 kcal / mol and an additional group of compounds belonging to the group of ‘cardenolide glycosides’ that have a slightly lower affinity for ELAVL4 (< -8.0 kcal / mol but > -9.0 kcal / mol), including Human Metabolome Data Base (HMDB) accession number, Drug bank ID, commercial name if applicable, compound class, and the main structure group number according to the groups listed in Table 2. Affinity HMDB DrugBank ID Commercial name Compound Class Main structure group (kcal / mol) -11.1 HMDB0258804 DB11630 Temoporfin Porphyrins 1 -9.9 HMDB0014784 DB00646 Nystatin macrolactones / macrolides / macrolactams 2 -9.8 HMDB0015351 DB01220 Rifaximin macrolactones / macrolides / macrolactams 2 -9.7 HMDB0060732 - 25-O-Desacetyl rifabutin macrolactones / macrolides / macrolactams 2 -9.5 HMDB0014753 DB00615 Rifabutin macrolactones / macrolides / macrolactams 2 -9.4 HMDB0251895 DB00063 Eptifibatide macrolactones / macrolides / macrolactams 2 -9.4 HMDB0256130 DB09297 Paritaprevir macrolactones / macrolides / macrolactams 2 -9.3 - DB06290 Simeprevir macrolactones / macrolides / macrolactams 2 -9.3 HMDB0015179 DB01045 Rifampicin macrolactones / macrolides / macrolactams 2 3'-Demethyletoposide 2 -9.5 HMDB0061028 - (norerythromycin) macrolactones / macrolides / macrolactams -9.1 HMDB0061049 - 31-O-Demethyltacrolimus macrolactones / macrolides / macrolactams 2
[0003] (23S)-23,25-dihdroxy-24- 3 oxovitamine D323-(beta- -9.4 HMDB0010361 - glucuronide) Vitamin D and derivatives; O-glucuronides -9.0 HMDB0010344 Vitamin D23-glucuronide Vitamin D and derivatives; O-glucuronides 3 4-Hydroxyandrostenedione Steroid glucuronide conjugates / Steroidal glycosides; 4 -9.3 HMDB0010315 - glucuronide O-glucuronides Steroid glucuronide conjugates / Steroidal glycosides; 4 -9.2 HMDB0010333 - Estriol-17-glucuronide O-glucuronides Steroid glucuronide conjugates / Steroidal glycosides; 4 -9.2 HMDB0010338 - 11-Oxo-androsterone glucuronide O-glucuronides Steroid glucuronide conjugates / Steroidal glycosides; 4 -9.1 HMDB0010335 Estriol-3-glucuronide O-glucuronides Steroid glucuronide conjugates / Steroidal glycosides; 4 -9.0 HMDB0010317 Estradiol-17-beta-D-glucuronide O-glucuronides N2-glucuronide; Phenylpyrazoles; Biphenyls and 4 / 9 -9.7 HMDB0013843 - Candesartan N2-Glucuronide derivatives -9.5 HMDB0060635 - Etoposide glucuronide Pyrimidones; O-glucuronides 4 -9.1 HMDB0061133 - Clofazimine Glucuronide Pyrroloindoles; O-glucuronides 4 -9.0 HMDB0060872 Sorafenib Beta-D-Glucuronide N-glucuronides 4 -9.0 HMDB0060824 Hydromorphone-3-glucuronide morphinans; O-glucuronides; Phenolic glycosides 4 -9.2 HMDB0003218 - Withanolide D Withanolides 5 -9.0 HMDB0041884 Doxorubicinol Anthracycline 7 -9.0 HMDB0060823 Doxorubicinol Aglycone Anthracycline 7 -9.9 - DB00320 Dihydroergotoxine Ergoloid mesylates 8
[0004] -9.5 HMDB0014834 DB00696 Ergotamine Ergotamines, dihydroergotamines, and derivatives 8 -9.2 HMDB0251309 DB13345 Dihydroergocristine (Ergoloid) Ergotamines, dihydroergotamines, and derivatives 8 -9.2 - - Co-dergocrine Mesylate Ergotamines, dihydroergotamines, and derivatives 8 -9.9 HMDB0015010 DB00872 Conivaptan Hydrochloride Biphenyls and derivatives 9 -9.5 HMDB0015439 DB01349 Tasosartan Biphenyls and derivatives 9 -9.4 HMDB0251758 DB06210 Eltrombopag Biphenyls and derivatives 9 -9.4 HMDB0254156 DB08827 Lomitapide Biphenyls and derivatives; Fluorenes 9 -9.1 HMDB0248803 DB08822 Azilsartan medoxomil Biphenyls and derivatives 9 -9.1 HMDB0013842 - O-Deethylated Candesartan Biphenyls and derivatives 9 Piperazines; flavonoid-7-o-glucuronides; O- 10 -9.8 HMDB0255552 DB09048 Netupitant glucuronides -9.7 HMDB0060828 - Id14326 Piperazines; N-arylpiperazine 10 -9.2 HMDB0247760 DB11581 Venetoclax N-arylpiperazines; phenylpiperazines 10 -9.2 HMDB0304886 DB14019 Fosnetupitant Piperazines; Pyridinylpiperazines 10 -9.1 HMDB0015488 DB01419 Antrafenine Piperazines; beta lactams; Cephalosporins 10 -9.0 HMDB0254219 DB08815 Lurasidone Piperazines; N-arylpiperazines 10 DB03147; 11 -10.2 HMDB0001248 DB02332 Fad (Flavin adenine dinucleotide) Flavin nucleotide -9.8 HMDB0255430 DB11691 Naldemedine Morphinans 11 -9.7 HMDB0015258 DB01126 Dutasteride Androgens and derivatives 11 -9.7 HMDB0250818 DB08912 Dabrafenib Sulfanilide 11 -9.7 HMDB0060787 - 6-Methoxy-2-naphthylacetic acid hydroxybenzoic acid derivatives; NSAID 11 -9.6 HMDB0015381 DB01251 Gliquidone 1,3-isoquinolinediones 11 -9.6 HMDB0249058 DB06595 Midostaurin Indolocarbazoles 11
[0005] -9.6 - DB09027 Ledipasvir Fluorenes 11 Lignans, neolignans and related compounds >> has a 11 -9.5 HMDB0249813 DB16824 Cepharanthine circle structure, and looks similar to tempoforin -9.4 - DB09374 Indocyanine Green Naphthalenes 11 -9.4 HMDB0060586 - N-Trifluoroacetyladriamycinol Anthracyclines 11 -9.3 HMDB0240234 DB11614 Rupatadine Benzocycloheptapyridines 11 -9.3 HMDB0247669 DB09280 Lumacaftor Phenylpyridines 11 -9.2 HMDB0003249 DB01698 Rutin flavonol glycoside 11 -9.2 HMDB0014367 DB00222 Glimepiride Benzenesulfonamides 11 -9.2 HMDB0014900 DB00762 Irinotecan Camptothecins 11 -9.1 HMDB0258700 DB09295 Talniflumate Benzofuranones 11 -9.1 - - Bemetizide thiazide diuretics 11 -9.1 HMDB0060499 - NPC Camptothecins 11 -9.1 HMDB0015362 DB01232 Saquinavir Asparagine and derivatives 11 -9.1 HMDB0248113 DB09335 Alatrofloxacin Dipeptides 11 -9.1 - DB09534 Ecamsule Bicyclic monoterpenoids 11 -9.0 HMDB0015594 DB04861 Nebivolol 1-benzopyrans 11 Additional group with affinity (kcal / mol) between -9.0 and -8.0 kcal / mol: -8.9 HMDB0014652 DB00511 Acetyldigitoxin cardenolide glycoside 6 -8.7 HMDB0060730 20, 22-Dihydrodigoxigenin cardenolide glycoside 6 -8.7 HMDB0060818 DBMET02502 Digoxigenin bisdigitoxoside cardenolide glycoside 6 -8.6 DB01396 Digitoxin cardenolide glycoside 6 -8.6 HMDB0060731 DB03671 Digoxigenin cardenolide glycoside 6 -8.5 HMDB0015211 DB01078 Deslanoside cardenolide glycoside 6
[0006] -8.5 HMDB0001917 DB00390 Digoxin cardenolide glycoside 6 -8.3 HMDB0060819 - Digoxigenin monodigitoxoside cardenolide glycoside 6 -8.2 HMDB0060746 3-keto-Digoxigenin cardenolide glycoside 6 Table 2 List of the chemical structure groups for the compounds from Table 1 Notes 1Porphyrins2Macrolactones / macrolides / macrolactams3Vitamin D Vitamin D backbone + O-linked 4Steroid glucuronides Steroid backbone + O-linked glucuronide5Steroid backbone + Steroid backbone + + sugar aAnthraquinone backbone + sugar moiety by a glycosidic 8Ergoloid mesylates / Ergotamines and derivates
[0007] EXAMPLE 2 Testing compounds on neurons derived from induced pluripotent stem cell lines (iPSCs) The selected compounds were tested for their effect on neurons derived from human induced pluripotent stem cells (iPSCs), i.e., stem cells harboring the APP London mutation V717I (fAD) and isogenic, CRISPR- corrected (fADcorr) stem cells, with the fADcorrneurons representing “normal” human neurons. For those compounds that are sufficiently effective in reducing phosphorylated tau levels and – for some compounds – also the Aβ42 / Aβ40 ratio, their dose- dependent efficacy is further evaluated (and confirmed) in iPSC-derived fADcorrand fAD neurons in which either overexpression or knockout of ELAVL4 is induced. iPSC differentiation into Glutamatergic iNeurons Cells were dissociated with TripLE Express Enzyme (Thermo Fisher Scientific) and plated onto Matrigel-coated plates at 50,000 cells / cm2 in Essential 8 Flex Medium (Thermo Fisher Scientific) (day 0). On day 1, the medium was changed to KSR media with doxycycline (4 ug / ml, Sigma). Doxycycline was maintained in the medium for the remainder of the differentiation. On day 2, the medium was changed to 1:1 KSR: N2B with puromycin (5 ug / ml, GIBCO). Puromycin was maintained in the medium throughout the differentiation. On day 3, the medium was changed to N2B + 1:100 B27 supplement (Thermo Fisher Scientific), and puromycin (10 ug / ml). From day 4 on, cells were cultured in NBM medium + 1:50 B27 + BDNF, GDNF, CNTF (10 ng / ml, Peprotech) until day 21 (d21) post induction of neuronal differentiation. Induced neuron protocol media: KSR medium: Knockout DMEM, 15% KOSR, 1x MEM-NEAA, 55 uM beta-mercaptoethanol, 1x GlutaMAX (Thermo Fisher Scientific). N2B medium: DMEM / F12, 1x GlutaMAX (Thermo Fisher Scientific), 1x N2 supplement B (StemCell Technologies), 0.3% dextrose (D-(+)-glucose, Sigma). NBM medium: Neurobasal medium, 0.5x MEM-NEAA, 1x GlutaMAX (Thermo Fisher Scientific), 0.3% dextrose (D-(+)-glucose, Sigma Compound testing The selected compounds from the in-silico ELAVL4-binding analysis were tested for their effect on ELAVL4 and its downstream pathways, i.e., (1) the level of phosphorylated tau in fADcorrneurons, and (2) the level of phosphorylated tau (phosphor tau) and the Aβ42 / 40 ratio in / surrounding fAD neurons. At d21, the neurons differentiated from iPSCs were treated for 24h with three concentrations of each of the compounds. For all compounds, the ‘middle’ concentration was determined based on literature about which concentration was used (most) often and without (too many toxic) effects in in vitro studies. Subsequently and with the exception of Temoporfin and Co-dergocrine Mesylate in the experiments in fADcorr neurons (Table 5 below), the tested ‘low’ and ‘high’ concentrations of each compound were 10 x less and 10 x more than the middle concentration, respectively. Immunofluorescence staining Cells cultivated in slide flasks (Thermo Fisher Scientific) were fixed for 20 min in 4% (w / v) paraformaldehyde at room temperature. Antigen retrieval was required for all experiments, and donkey serum (6% [v / v] in Tris-buffered saline and 0.5% [v / v] Triton X-100) was used during the blocking and for the dilution of the antibodies. The slides were incubated with the primary antibody overnight at 4°C. The sections were washed 3 times for 5 minutes with Tris buffered saline and incubated for 2 hours at 37°C with the secondary antibody. This was followed by 3 further washes of 5 minutes in Tris-buffered saline, and then the slides were mounted with Vectashield-containing DAPI (40 ,6-diamidino-2-phenylindole) mounting medium (Vector Laboratories, Inc, Burlingame, CA) and observed in a Zeiss Imager Z2 microscope (Zeiss, Oberkochen, Germany). Images were captured with the software Zen Pro 2012 (Carl Zeiss, Sliedrecht, the Netherlands). Primary and secondary antibodies used for iPSC-derived neuronal characterizations are listed in Table 3. Quantitative PCR (qPCR) analyses To assess the effect of the different compound concentrations on the RNA expression of (total) tau and - in the fADcorrneurons - APP695 (the Amyloid-beta precursor protein (APP) isoform that is specifically and highly / predominantly expressed in neurons), qPCR analyses were performed. In addition, qPCR analyses were performed for selected neuronal markers and housekeeping genes to determine whether one or more concentrations of each compound was / were toxic to the fADcorror fAD neurons, leading to neuronal death. Total RNA was isolated by using the NucleoSpin RNA Clean-up Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. RNA was quantified and cDNA was synthesized from 1 mg RNA by using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) following the manufacturer’s instructions. qPCR was performed with the GoTaq Real-Time qPCR Master Kit (Promega, Madison, WI). Samples were processed in an QuantstudioTM3 Real-Time PCR Applied Biosystems (Thermo Fisher Scientific). Each sample was assayed in triplicate and normalized against the mean expression of three housekeeping genes, i.e., GUSB, GAPDH and ACTB. Relative quantification was based on the 2^(ΔΔCt) method, with undifferentiated iPSCs as calibrators for the characterization of the glutamatergic iNeurons. Primers for the qPCR analyses are listed in Table 4. Quantitative ELISA analyses To assess the effect of most compound concentrations in the fADcorrneurons and the fAD neurons on the protein expression of (1) phospho tau and (2) Aβ42 and Aβ40 - which then also allowed for the calculation of the Aβ42 / Aβ40 ratio - enzyme-linked immunosorbent assay (ELISA) analyses were performed, using different kits (Invitrogen kit for phospho tau and ThermoFisher Scientific kit for Aβ42 and Aβ40). For phospho tau measurements, proteins were extracted from the cell pellet with the Complete Cell Extraction Buffer (ThermoFisher Scientific). For Aβ42 and Aβ40 protein measurements, the supernatant was used directly from the culture. All samples were collected after 21 day-differentiation and 24h compound treatment. To calculate the sample dilution, the initial protein concentration was measured with the Pierce BCA protein assay kit (ThermoFisher Scientific). All experiments were performed according to the manufacturer's instructions. ELISA measurements were recorded in a microplate reader, the data were processed with the software Prism and the Aβ42 / Aβ40 ratio was calculated with the software Microsoft Excel. Semiquantitative Western Blot (WB) analyses To assess the effect of some compound concentrations in the fAD neurons on the protein expression of phospho tau, Western Blot (WB) analyses were performed. Cells were lysed in RIPA buffer, containing 50 mM Tris-HCL, 150 mM NaCl, 1 % (v / v) NP40, 0.1 % (v / v) SDS, 0.5% (w / v) sodium deoxycholate, 1 mM EDTA and protease inhibitor cocktail. Western blotting was performed using the NuPAGE system (Thermo Fisher Scientific), according to the manufacturer’s instructions. Membranes were blocked with 5% milk in PBS and all primary and secondary antibodies were diluted in 5% milk in PBS. The blots were analyzed on an Odyssey DLx (Li-cor). Primary and secondary antibodies used for WB analyses are listed in Table 3. In Table 5, the qPCR results - % change in RNA levels of (total) tau compared to non- treated neurons - and ELISA results - % change in protein levels of phospho tau compared to non- treated neurons - for 3 concentrations of 31 compounds from Table 1 are shown. As can be derived from Table 5, all tested concentrations of the 31 compounds cause a decrease of intraneuronal phospho tau levels of at least 20 %, indicating that these 31 compounds could be used to treat tauopathies in general. In Table 6, the qPCR results - % change in RNA levels of (total) tau and APP695 compared to non-treated neurons - and ELISA or WB results - % change in protein levels of phospho tau and % change of the Aβ42 / Aβ40 ratio compared to non-treated neurons - for 3 concentrations of 9 / 31 compounds from Table 5 in fAD neurons are shown. As can be derived from Table 6, multiple tested concentrations of the 9 compounds cause a decrease of intraneuronal phospho tau levels – of at least 15 % for at least one concentration – and the extraneuronal Aβ42 / Aβ40 ratio of at least 10 % for at least one concentration – indicating that these 9 compounds could not only be used to treat tauopathies in general but also AD in particular. Table 3. Primary and secondary antibodies used for neuronal characterizations and WB analyses Antibody Host / Type Brand Cat. N. Tau Rabbit polyclonal Sigma (Merk) T6402 Phospho tau Mouse monoclonal ThermoFisher MN1050 Synapsin I Rabbit polyclonal Sigma (Merk) 574777 APP A4 Mouse polyclonal Sigma (Merk) MAB348 NeuN Mouse polyclonal Sigma (Merk) MAB377 Tuj1 Rabbit polyclonal Sigma (Merk) MAB1637 Mouse Alexa Fluor 488 Goat polyclonal ThermoFisher 10696113 Chicken Alexa Fluor 488 Goat polyclonal Invitrogen A11039 Chicken Alexa Fluor 568 Goat polyclonal Molecular Probes A11041 Rabbit Alexa Fluor 568 Donkey polyclonal Molecular Probes A10042 Mouse IRDye800 Goat polyclonal Licor Biosciences 926-32210 Rabbit IRDye800 Goat polyclonal Licor Biosciences 926-32211 Mouse Alexa Fluor 680 Goat polyclonal ThermoFisher A-21057 Rabbit Alexa Fluor 680 Goat polyclonal Molecular Probes A21076
[0008] Table 4. Primers for the quantitative PCR analyses Gene Sequence MAP2 F: AGGCTGTAGCAGTCCTGAAAGG R: CTTCCTCCACTGTGACAGTCTG PAX6 F: CTGAGGAATCAGAGAAGACAGGC R: CTGAGGAATCAGAGAAGACAGGC SYN1 F: CGATGCCAAATATGACGTGCGTG R: AGCATCGCAGAGCCAGTATTGG TUBB3 F: TCAGCGTCTACTACAACGAGGC R: GCCTGAAGAGATGTCCAAAGGC NCAM F: CATCACCTGGAGGACTTCTACC R: CAGTGTACTGGATGCTCTTCAGG TAU F: CCAGTCCAAGTGTGGCTCAAAG R: GCCTAATGAGCCACACTTGGAG APP695 F: CCCTACGAAGAAGCCACAGA R: TTGGCTTTCTGGAAATGGGC
[0009] Table 5. Compounds tested in fADcorrneurons. The qPCR results - % change in RNA levels of (total) tau compared to non-treated neurons - and ELISA results - % change in protein levels of phospho tau compared to non-treated neurons - for 3 concentrations of 31 compounds from Table 1 are shown. "X" indicates that, based on the qPCR analyses for selected neuronal markers and housekeeping genes, the compound concentration was found to be toxic to the fADcorrneurons, leading to neuronal death. Number Main structure Compound Concentration %Δcontrol tau (qPCR) %Δcontrol group phospho tau (ELISA) 11 TEMOPORFIN0.05 μM41% -30%0.1 μM26% -32%0.5 μM24% -35%2 2 NYSTATIN 0.05 μM 18% -24% 0.5 μM 25% -24% 5 μM -12% -32% 3 2 RIFAXIMIN 0.1 μM 40% -40% 1 μM -4% -35% 10 μM -18% -37% 42 RIFABUTIN0.1 μM2% -34%1μM27% -40%10 μM26% -40%5 4 ESTRADIOL 17-BETA-D-GLUCURONIDE 1 μM 28% -33% 10 μM 17% -37% 100 μM83% -46%67 DOXORUBICINOL0.1 μM-53% -31%1 μM -16% -28% 10 μM -59% -33%
[0010] 8 CO-DERGOCRINE MESYLATE1 μM30% -25%5μM9% -31%10 μM12% -32%9 CONIVAPTAN HYDROCHLORIDE0.1 nM-81% -34%1 nM -86% -23% 10 nM -89% -36%9 ELTROMBOPAG0.1 μM-86% -34%1 μM -91% -39% 10 μM -93% -34%9 AZILSARTAN MEDOXOMIL0.1 μM23% -34%1μM16% -30%10 μM46% -36%10 NETUPITANT 1 nM 106% -40% 10 nM 8% -41% 100 nM 10% -34%10 VENETOCLAX0.01 μM54% -35%0.1 μM -16% -34% 1μM46% -44%11 DUTASTERIDE 0.05 μM 40% -38% 0.5 μM 39% -40% 5 μM 3% -44%11 DABRAFENIB0.01 μM48% -35%0.1 μM21% -35%1μM61% -33%116-METHOXY-2-NAPHTHYLACETIC ACID1 μM 65% -32%10 μM -3% -36% 100 μM31% -49%
[0011] 11 GLIQUIDONE0.5 μM-37% -32%5 μM -29% -35% 50 μM20% -32%11 MIDOSTAURIN0.01 μM-26% -37%0.1 μM76% -34%1 μM -33% -31%11 LEDIPASVIR0.1 μM-45% -25%1 μM -50% -21% 10 μM -40% -29%11 CEPHARANTINE0.01 μM35% -27%0.1 μM6% -32%1μM24% -33%11 INDOCYANINE GREEN1 μM4% -29%10 μM25% -36%100 μM49% -46%11 RUPATADINE 1 μM 37% -54% 10 μM -3% -52% 100 μM 65% -67%11 LUMACAFTOR0.1 μM21% -31%1μM12% -31%10 μM34% -28%11 RUTIN1 μM-3% -31%10 μM25% -33%100 μM46% -49%11 GLIMEPIRIDE 1 μM 31% -50% 10 μM -5% -58% 100 μM 27% -64%
[0012] 11 TALNIFLUMATE 1 μM -11% -56% 10 μM 23% -53% 100 μM 45% -62% 11 BEMETIZIDE 1 μM 85% -55% 10 μM 91% -60% 100 μM 74% -56% 11 SAQUINAVIR 0.5 μM 41% -53% 5 μM 53% -55% 50 μM 54% -70% 11 ECAMSULE 15 μM 22% -56% 150 μM 35% -54% 1,5mM X X 11 NEBIVOLOL 0.1 μM -6% -48% 1 μM -19% -54% 10 μM X X6ACETYLDIGITOXIN10 nM -49% -53%100 nM -23% -53% 1 μM X X 6 DIGOXIGENIN 10 nM -67% -58% 100 nM -72% -52% 1 μM -80% -53%
[0013] Table 6. Compounds tested in fAD neurons. The qPCR results - % change in RNA levels of (total) tau and APP695 compared to non-treated neurons - and ELISA or WB results - % change in protein levels of phospho tau and % change of the Aβ42 / Aβ40 ratio compared to non-treated neurons - for 3 concentrations of 9 / 31 compounds from Table 5 in fAD neurons are shown. "X" indicates that, based on the qPCR analyses for selected neuronal markers and housekeeping genes, the compound concentration was found to be toxic to the fAD neurons, leading to neuronal death. No. Main Compound Concentration %Δcontrol tau %Δcontrol APP695 %Δcontrol %Δcontrol structure (qPCR) (qPCR) phospho tau Aβ42 / 40 group (ELISA or (ELISA) WB*) 2 2 NYSTATIN 0.05 μM -47% 19% -11% 2% 0.5 μM -33% -3% -39% -24% 5 μM 6% 51% -68% -4% 3 2 RIFAXIMIN 0.1 μM -39% -21% -6% -4% 1 μM -26% -4% -7% -12% 10 μM 2% -17% -17% -30% 42 RIFABUTIN0.1 μM-3% -1% -18% -1%1 μM -33% -7% -24% -10% 10 μM -24% -16% -11% -11% 78 CO-DERGOCRINE MESYLATE1 μM15% 14% -30% -25%10 μM -21% -18% -11% -19% 100 μMX X X X89 CONIVAPTAN HYDROCHLORIDE0.1 nM1% 3% -2% -24%1 nM -24% 7% -21% -19% 10 nM -30% -12% -14% -18%
[0014] 9 ELTROMBOPAG0.1 μM-6% 5% -30% -25%1 μM -10% 5% -25% -12% 10 μM -29% -17% -31% -27%10 VENETOCLAX0.01 μM9% 37% -9% -33%0.1 μM -18% 21% -17% -30% 1 μM -9% 18% -7% -36% 11 DUTASTERIDE 0.05 μM -29% 13% -21% -22% 0.5 μM -4% 24% -23% -26% 5 μM -24% 29% -11% -10%11 INDOCYANINE GREEN *1 μM-25% -6% -22% -18%10 μM -40% 3% -40% -34% 100 μM -23% 1% -80% -40%
[0015] Table 7. Effect of ELAVL4 knockout in fADcorr and fAD neurons on alternative splicing of OGT. When ELAVL4 is knocked out in fADcorr neurons, the expression of the main functional isoform of OGT is significantly downregulated (p and q (corrected p) < 0,05 and negative beta (effect size)) while the expression of the non-functional isoform of OGT is significantly upregulated (p and q (corrected p) < 0,05 and positive beta (effect size)). This implies that in fADcorr neurons, ELAVL4 upregulates the expression of the main, functional isoform of OGT while it downregulates the expression of the non-functional isoform of OGT. Likewise, the data indicate that in fAD neurons, ELAVL4 downregulates the expression of the non-functional isoform of OGT. fADcorr neurons with ELAVL4 ko vs fADcorr neurons Gene Splicing Function of isoform p q beta variant / isoform OGT ENST00000373719.7 main, functional isoform (nucleocytoplasmic form, 6,51E-05 6,25E-04 -0,1106 specifically adds O-GlcNac to proteins, including TAU) OGT ENST00000488174.5 non-functional isoform 3,56E-03 2,21E-02 0,23328 fAD neurons with ELAVL4 ko vs fAD neurons Gene Splicing Function of isoform p q beta variant / isoform OGT ENST00000488174.5 non-functional isoform 1,98E-03 2,04E-02 0,24755 OGT ENST00000373719.7 main, functional isoform (nucleocytoplasmic form, specifically 1,87E-01 5,20E-01 0,03656 adds O-GlcNac to proteins, including TAU)
Claims
CLAIMS 1. An agent for use in decreasing the level of intracellular phosphorylated tau in neurons, which agent can bind ELAVL4 with a binding affinity of at least -8.0 kcal / mol.
2. The agent for use as claimed in claim 1, wherein the agent comprises a structural element selected from the group consisting of a steroid backbone, a sugar moiety by glycosidic linkage, an O-linked glucuronide, and a lactone group.
3. The agent for use as claimed in claim 1 or 2, wherein the agent is selected from the group of porphyrins, macrolactams, macrolides, vitamin D glucuronides, steroid glucuronides, withanolides, cardenolide glycosides, anthracyclines, ergoloid mesylates, ergotamines and derivates thereof, biphenyls, and piperazines.
4. The agent for use as claimed in any one of claims 1-3, wherein the agent is selected from the group consisting of Temoporfin, Nystatin, Rifaximin, 25-O-Desacetyl rifabutin, Rifabutin, Eptifibatide, Paritaprevir, Simeprevir, Rifampicin, 3'-Demethyletoposide (norerythromycin), 31-O-Demethyltacrolimus, (23S)-23,25-dihdroxy-24-oxovitamine D323-(beta- glucuronide), Vitamin D23-glucuronide, 4-Hydroxyandrostenedione glucuronide, Estriol-17- glucuronide, 11-Oxo-androsterone glucuronide, Estriol-3-glucuronide, 17-beta-Estradiol glucuronide, Candesartan N2-Glucuronide, Etoposide glucuronide, Clofazimine Glucuronide, Sorafenib Beta-D-Glucuronide, Hydromorphone-3-glucuronide, Withanolide D, Doxorubicinol, Doxorubicinol Aglycone, Dihydroergotoxine, Ergotamine, Dihydroergocristine (Ergoloid), Ergoloid Mesylate, Conivaptan, Tasosartan, Eltrombopag, Lomitapide, Azilsartan medoxomil, O- Deethylated Candesartan, Netupitant, Id14326, Venetoclax, Fosnetupitant, Antrafenine, Lurasidone, Fad (Flavin adenine dinucleotide), Naldemedine, Dutasteride (Avodart), Dabrafenib, 6-Methoxy-2-naphthylacetic acid, Gliquidone, Midostaurin, Ledipasvir, Cepharanthine, Indocyanine Green, N-Trifluoroacetyladriamycinol, Rupatadine, Lumacaftor, Rutin, Glimepiride, Irinotecan, Talniflumate, Bemetizide, NPC, Saquinavir, Alatrofloxacin, Ecamsule, Nebivolol, Acetyldigitoxin, 20, 22-Dihydrodigoxigenin, Digoxigenin bisdigitoxoside, Digitoxin, Digoxigenin, Deslanoside, Digoxin, Digoxigenin monodigitoxoside, 3-keto-Digoxigenin.
5. The agent for use as claimed in any one of the claims 1-4, wherein the agent is selected from the group consisting of Temoporfin, Nystatin, Rifaximin, Rifabutin, Estradiol 17-Beta-D- Glucuronide, Doxorubicinol, Co-Dergocrine Mesylate, Conivaptan Hydrochloride, Eltrombopag, Azilsartan, Medoxomil, Netupitant, Venetoclax, Dutasteride, Dabrafenib, 6-Methoxy-2- Naphthylacetic Acid, Gliquidonemidostaurin, Ledipasvir, Cepharantine, Indocyanine Green, Rupatadine, Lumacaftor, Rutin, Glimepiride, Talniflumate, Bemetizide, Saquinavir, Ecamsule, Nebivolol, Acetyldigitoxin, Digoxigenin.
6. The agent for use as claimed in any one of the claims 1-5, wherein the agent is Indocyanine Green.
7. The agent for use as claimed in any one of the claims 1-6, wherein the % change in protein levels of phosphorylated tau in normal neurons treated with the agent is at least 20% as compared to non-treated normal neurons.
8. The agent for use as claimed in claim 7, wherein the % change in protein levels of phosphorylated tau in normal neurons treated with the agent is in order of increased preference at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non-treated normal neurons.
9. The agent for use as claimed in claim 7 or 8, wherein the normal neurons are derived from human induced pluripotent stem cells (iPSCs) that originally carry the APP London mutation V717I, but wherein the mutation V717I mutation is corrected back to valine.
10. The agent for use as claimed in any one of the claims 1-6, wherein the agent is furthermore for use in decreasing the Aβ42 / Aβ40 ratio in fAD neurons.
11. The agent for use as claimed in claim 10, wherein the agent is selected from the group consisting of Nystatin, Rifaximin, Rifabutin, Co-Dergocrine Mesylate, Conivaptan Hydrochloride, Eltrombopag, Venetoclax, Dutasteride, and Indocyanine Green.
12. The agent for use as claimed in claim 10 or 11, wherein the % change in protein levels of phosphorylated tau in fAD neurons treated with the agent is at least 15% as compared to non- treated fAD neurons and the % change in the Aβ42 / Aβ40 ratio in fAD neurons treated with the agent is at least 10% as compared to non-treated fAD neurons.
13. The agent for use as claimed in claim 12, wherein the % change in protein levels of phosphorylated tau in fAD neurons treated with the agent is in order of increased preference at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non-treated fAD neurons.
14. The agent for use as claimed in any one of the claims 11-13, wherein the % change in the Aβ42 / Aβ40 ratio in fAD neurons treated with the agent is in order of increased preference at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% as compared to non- treated fAD neurons.
15. The agent for use as claimed in any one of the claims 11-14, wherein the fAD neurons are derived from human induced pluripotent stem cells (iPSCs) that carry the APP London mutation V717I.
16. The agent for use as claimed in any one of claims 1-15, wherein the agent is administered for the treatment of tauopathy.
17. The agent for use as claimed in claim 16, wherein the tauopathy is involved in a disorder selected from the group consisting of Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease (PD), progressive supranuclear palsy (PSP), and multiple sclerosis (MS).
18. A pharmaceutically active composition for use in decreasing the level of intracellular phosphorylated tau in neurons, comprising at least one agent as defined in any one of claims 1-17, and a pharmaceutically acceptable excipient.
19. The pharmaceutically active composition for use as claimed in claim 18, wherein the composition is effective in treating tauopathy.
20. The pharmaceutically active composition for use as claimed in claim 19, wherein the tauopathy is involved in a disorder selected from the group consisting of Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease (PD), progressive supranuclear palsy (PSP), and multiple sclerosis (MS).
21. Method for treating tauopathy, comprising the administration of an agent as defined in any one of the claims 1-15 to an individual suffering from a disorder selected from the group consisting of Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease (PD), progressive supranuclear palsy (PSP), and multiple sclerosis (MS).