Methods and compositions for reducing angiotensinogen
Patent Information
- Application Number
- EP2024887040
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-03
- Filing Date
- 2024-11-01
- Publication Date
- 2026-09-09
AI Technical Summary
Current therapeutic options for heart failure, particularly for patients with heart failure with reduced ejection fraction (HFrEF), are limited due to intolerance to renin-angiotensin-aldosterone system (RAAS) inhibitors, leading to underdosing and suboptimal clinical benefits.
Administration of an oligomeric agent comprising a modified oligonucleotide, specifically a GalNAc-conjugated modified oligonucleotide, which is designed to reduce the levels of angiotensinogen (AGT) RNA and/or protein in subjects intolerant to RAAS inhibitors, thereby addressing the limitations of existing therapies.
The oligomeric agent effectively decreases AGT levels by at least 70% to less than 95% in subjects, potentially offering a more tolerable and effective treatment option for heart failure patients who cannot tolerate standard RAAS inhibitor therapies.
Smart Images

Figure IMGF000012_0001 
Figure IMGF000013_0001 
Figure IMGF000014_0001
Abstract
Description
Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application METHODS AND COMPOSITIONS FOR REDUCING ANGIOTENSINOGEN CROSS REFERENCE TO RELATED APPLICATION
[0001] This PCT application claims the benefit of U.S. provisional application no.63 / 596,175, filed on November 3, 2023, the entire contents of which is hereby incorporated by reference in its entirety. SEQUENCE LISTING
[0002] The present application is being filed concurrently with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0479USLSEQ.xml, created on October 30, 2023, which is 47 KB in size. The contents of the electronic format of the sequence listing are incorporated herein by reference in their entirety. FIELD OF THE INVENTION
[0003] Compositions and methods described herein relate to reducing the amount of angiotensinogen (AGT) in a cell or subject, for example a subject having or at risk for heart failure, such as heart failure with reduced ejection fraction (HFrEF). Compositions and methods also relate to methods for ameliorating symptoms of, and treating, heart failure, including HFrEF. BACKGROUND
[0004] Heart failure (HF), a clinical syndrome becoming a global public health issue imposing serious burdens on healthcare systems, is characterized by significant mortality, frequent hospitalization, and poor quality of life (QOL), with an overall prevalence that is steadily increasing worldwide. (Shahim et al. (2023) Cardiac Failure Review 9:e11; Ambrosy et al., Curr Heart Fail Rep 2014; 11: 416-427; Heidenreich et al., Circ Heart Fail 2013; 6: 606-619). Symptoms of heart failure include, but are not limited to, fatigue, rapid or irregular heartbeat, palpitation, shortness of breath, chest pain, dizziness, weakness, dyspnea, orthopnea, edema, hepatic congestion, and ascites. HF can be stratified into three groups by assessment of left ventricular (LV) ejection fraction (EF) (i.e., a measure of how much blood is pumped from the left ventricle with each contraction): heart failure with reduced EF (HFrEF; also referred to as systolic HF), heart failure with mid-range EF 1 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (HFmrEF) and heart failure with preserved EF (HFpEF; also referred to as diastolic HF) with each of the three groups having different demographics, comorbidities, and responses to therapies.
[0005] Approximately 40%-60% of HF patients are classified as HFrEF, (Shahim et al. (2023) Cardiac Failure Review 9:e11 ). HFrEF is associated with diminished contractility of the heart muscle and cardiovascular conditions that adversely impact left ventricular systolic function (e.g., coronary artery disease) and LV remodeling, and the most prevalent cause of HFrEF is ischemic heart disease. Four classes of medications, known as the “four pillars” of heart failure therapy, greatly improve outcome, morbidity and mortality and attenuate adverse cardiac remodeling in patients with HFrEF, though only for those who can tolerate them at guideline- recommended target doses. See, e.g., Heidenreich et al (2022) Circulation 145(18):e895-e1032, 2022 AHA / ACC / HFSA Guideline for the Management of Heart Failure: A Report of the American College of Cardiology / American Heart Association Joint Committee on Clinical Practice Guidelines. Medicines in two of the four pillars inhibit the renin-angiotensin-aldosterone system (RAAS) (RAAS inhibitors), while others blunt the detrimental sympathetic nervous output to the heart (beta blockers) or antagonize sodium-glucose cotransporter-2 receptors (SGLT2) in the kidneys to act as a weak diuretic and attenuate adverse remodeling. Specific therapies are available and recommended for HFrEF, however, those treatments lack efficacy in treating HFpEF (see, e.g., Simmonds et al. (2020) Cells 9:242). ESC recently gave class I recommendation to SGLT2 inhibitors for HFmrEF and HFpEF for the first time at their 2023 congress.
[0006] Activation of the RAAS and the sympathetic nervous system (i.e., neurohormonal activation) occurs in response to decreases in cardiac output and renal perfusion as a compensatory homeostatic response to low cardiac output seen in heart failure. Neurohormonal activation is associated with a cascade of effects on the peripheral vasculature, heart and kidneys (see, e.g., Hartupee and Mann (2017) Nat Rev Cardiol 14(1): 30–38). The net effect of responses is to produce hemodynamic changes in heart, kidneys and vasculature to increase cardiac output and ventricular filling. The heart also compensates at the cellular level by increasing myocyte size to counteract the reduction in cardiac output, leading to cardiac hypertrophy and adverse remodeling at the organ level. While this compensatory remodeling is initially beneficial, the heart and individual myocytes eventually grow to a point that they can no longer support their own metabolic needs, and the heart eventually fails to produce enough cardiac output to perfuse vital organs and meet the metabolic demands of the body. This leads to end-stage heart failure and death will occur without heart transplantation. 2 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0007] Several classes of RAAS inhibitors have been developed over the last several decades and have demonstrated the ability to improve morbidity and mortality in heart failure and attenuate adverse cardiac remodeling described above. Classes of RAAS inhibitors developed for heart failure include: (i) angiotensin converting enzyme inhibitors (ACEi) that block the conversion of Ang I to Ang II, thereby reducing cardiac afterload or the force against which the heart must pump; (ii) angiotensin receptor blockers (ARBs) that competitively inhibit AT1 receptors and block action of Ang II at end organs which also results in reduction of cardiac afterload; (iii) mineralocorticoid receptor antagonists (MRA) competitively inhibit mineralocorticoid receptors in the distal convoluted tubules of the kidneys to block the action of aldosterone, thereby enhancing natriuresis and diuresis and reducing cardiac afterload; and (iv) the angiotensin receptor blocker-neprilysin inhibitor (ARNi), which combines the ARB valsartan with sacubitril, a neprilysin inhibitor (NI)), a circulating endogenous peptidase that acts to breakdown B-type or brain natriuretic peptide (BNP), thereby potentiating the activity of BNP and enhancing natriuresis and diuresis to reduce cardiac preload and afterload. Despite overwhelming evidence of the benefits of RAAS inhibitors, there is abundant evidence that utilization and efficacy is far from universal, and when RAAS inhibitors are used they are rarely prescribed at guideline-recommended target doses due, in part, to side effects of these drugs.
[0008] For example, many patients have intolerances that limit use of ACEi, particularly at >50% of guideline-recommended target doses. For example, some patients experience persistent cough and / or angioedema, thought to be related to elevated bradykinin levels arising from ACE inhibition. Although first investigated as a possible alternative for HF patients who could not tolerate ACEi, ARB therapy has been associated with renal dysfunction and hyperkalemia in some HF patients. Furthermore, combining ACEi and ARBs can exacerbate renal dysfunction and cause difficult to control hyperkalemia, leading to underdosing and drug cessation, and this combination of ACEi and ARBs is considered contraindicated by European and American Cardiology societies. Treatment with MRA has been associated with hyperkalemia, renal dysfunction and gynecomastia in landmark heart failure trials. As a monotherapy, sacubitril failed to demonstrate efficacy in heart failure patients. Combinations of NI with ACEi resulted in cases of severe angioedema due to the combined effects of ACE and neprilysin inhibition on bradykinin levels. Because ARNi contains an ARB, it is associated with many of the same toxicities as ACEi and ARBs including hypotension, renal dysfunction, acute kidney injury (AKI) and hyperkalemia. Many contemporary registry studies evaluating the real world utilization of GDMT have demonstrated that substantial proportions of HF 3 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application patients are either never prescribed GDMT or they are prescribed GDMT at suboptimal doses that have not shown to have clinical benefit in landmark studies. These registries consistently show that patients who are not prescribed GDMT or who are prescribed <50% of guideline-directed target doses of ACEi, ARB, ARNi or MRA have significantly worse morbidity and mortality than those taking guideline-recommended target doses. Intolerance to RAAS inhibitors is further exacerbated when multiple classes of RAAS inhibitors (such as ARNI + MRA) are used concurrently or when these drugs are used in patients with baseline renal dysfunction or borderline renal function.
[0009] Currently, there are limited therapeutic options to fully inhibit the RAAS pathway in HF patients with intolerance to existing RAAS inhibitors so that they can achieve the desired clinical benefits of guideline target doses. Patients with severe renal dysfunction and hyperkalemia are unlikely to tolerate RAAS inhibitors let alone combination of ARNI and MRA at guideline- recommended target doses. American and European guidelines recommend combination of vasodilators isosorbide dinitrate and hydralazine as second line therapy for HF patients with renal dysfunction or other contraindications to ACE / ARB / ARNi. However, the pure vasodilators lack RAAS inhibitory activity and show no ability to attenuate adverse remodeling in direct head-to-head studies. Underprescription of RAAS inhibitors is still a global problem affecting nearly a majority of patients with heart failure. Though reasons for non-prescription and underdosing of RAAS inhibitors are multifactorial, intolerance is a major factor in limiting treatment of a substantial number of patients. Thus, effective therapies to treat HF patients, particularly HFrEF patients, who are unable, or at risk of being able, to tolerate Guideline-recommended doses of RAAS inhibitors remains a major unmet need. SUMMARY OF THE INVENTION
[0010] Described herein are methods for reducing the amount of angiotensinogen (AGT) RNA and / or AGT protein in a subject. In certain embodiments, the subject is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor. In certain embodiments, the subject has, or is at risk for, heart failure, e.g., heart failure with reduced ejection fraction (HFrEF). In certain embodiments, methods include administering about 15 mg to about 200 mg of an oligomeric agent having a modified oligonucleotide consisting of 16-30 linked nucleosides wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of a nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or salt thereof, to a subject having or at 4 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application risk for heart failure. In certain embodiments, the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. In certain embodiments the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described herein are methods for reducing the amount of angiotensinogen (AGT) RNA and / or AGT protein in a subject who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. In certain embodiments, the subject has or is at risk for, or the heart failure is, heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described are methods for reducing the amount of AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor, comprising administering an oligomeric compound or salt thereof to a subject having or at risk for heart failure; wherein the subject is intolerant, or is at risk of being intolerant, to treatment with a RAAS inhibitor; and wherein the amount of AGT protein in the subject is reduced by at least 70%, at least 75%, at least 80% or at least 85% but less than 95% in the subject, wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified 5 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0011] Described are methods of treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent having a modified oligonucleotide consisting of 16-30 linked nucleosides wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to a nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2, or salt thereof, to a subject having or at risk for heart failure. In certain embodiments the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80%, or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. In certain embodiments the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described are methods of treating heart failure in a subject having or at risk for heart failure who is intolerant or who is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. In certain embodiments, the subject has or is at risk for, or the heart failure is, heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described are methods of treating heart failure in a subject, comprising administering an oligomeric compound 6 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or a salt thereof to a subject having or at risk of having heart failure, wherein the subject is or is at risk of being intolerant to treatment with a RAAS inhibitor; wherein treatment results in one or more symptoms ameliorated and / or lack of progression of heart failure, wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0012] Additionally described are methods of treating heart failure in a subject, comprising administering about 50 mg to about 200 mg an oligomeric compound or a salt thereof to a subject; wherein administering oligomeric compound results in amelioration of one or more symptoms and / or lack of progression of heart failure, wherein the oligomeric compound is a GalNAc- conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0013] Also described are uses of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein the oligomeric agent has a modified oligonucleotide consisting of 16-30 linked nucleosides and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2, and the subject has or is at risk for heart failure. In certain embodiments the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA 7 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application and / or AGT protein in the subject prior to any administration of the oligomeric agent; and in certain embodiments the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described are uses of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2, or salt thereof and the subject has or is at risk for heart failure. In certain embodiments the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. In certain embodiments the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Also described are uses of an oligomeric compound or a salt thereof for treating heart failure in a subject intolerant to, or at risk of being intolerant to, treatment with a RAAS inhibitor, wherein: the subject does not progress or one or more symptoms are ameliorated; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0014] Described are uses of 50 mg to 200 mg of an oligomeric compound or a salt thereof for treating heart failure in a subject having or at risk for heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’): 8 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT ApplicationmCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0015] Also provided are uses of an oligomeric compound or a salt thereof for reducing the amount of AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor, wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety; and wherein the oligomeric compound decreases to the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% but less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0016] In certain embodiments, use is in a subject having or who is at risk for heart failure, selected from heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0017] Also described herein are uses of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein the oligomeric agent is a modified oligonucleotide consisting of 16-50 linked nucleosides, wherein the modified oligonucleotide has at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a 9 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). Described are uses of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-50 linked nucleosides, wherein the modified oligonucleotide comprises a nucleobase sequence comprising at least 13, or at least 16, contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof. In certain embodiments, the subject has or is at risk for, or the heart failure is, heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0018] Additionally described are unit doses useful in the provided methods. Described are unit doses comprising 50 mg to 200 mg of an oligomeric compound comprising a GalNAc-conjugated modified oligonucleotide represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0019] Also described are unit doses comprising 50 mg to 150 mg of an oligomeric compound represented by the following chemical notation (5’ to 3’): THA-C6-GalNAc3-mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 5) or a salt thereof; wherein A = an adenine nucleobase,mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a 10 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage, and THA-C6-GalNAc3= .
[0020] Also described are unit doses comprising 50 mg to 150 mg of an oligomeric compound represented by the following Structure 1:(SEQ ID NO: 5), 11 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or a salt thereof.(SEQ ID NO: 5).
[0022] Unit doses described comprise an amount of oligomeric compound or salt thereof within the range of about 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 150 mg, 55 mg to 125 mg, 55 mg to 115 mg, 55 mg to 105 mg, 55 mg to 95 mg, 55 mg to 85 mg, 55 mg to 75 mg, 55 mg to 65 mg, 65 12 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application mg to 125 mg, 65 mg to 115 mg, 65 mg to 105 mg, or 65 mg to 95 mg, 65 mg to 85 mg, 65 mg to 75 mg, 85 mg to an 150 mg, about 50 mg to 120 mg, about 60 mg to about 80 mg, mg, 90 mg mg to to about 140 150 mg, mg,about 55 mg to about 95 mg, about 55 mg to about 85 mg, about 55 mg to about 75 mg, about 55 mg to about 65 mg, about 65 mg to about 125 mg, about 65 mg to about 115 mg, about 65 mg to about 105 mg, or about 65 mg to about 95 mg, about 65 mg to about 85 mg, about 65 mg to about 75 mg, about 75 mg to about 125 mg, about 75 mg to about 115 mg, about 75 mg to about 105 mg, about 75 mg to about 95 mg, about 75 mg to about 85 mg, about 85 mg to about 125 mg, about 85 mg to about 115 mg, about 85 mg to about 105 mg, or about 85 mg to about 95 mg. Unit doses are formulated as pharmaceutical compositions comprising a pharmaceutically acceptable carrier, adjuvant or excipient. Certain compositions comprise an oligomeric agent or salt thereof and a pharmaceutically acceptable carrier or excipient. Certain compositions comprise a pharmaceutically acceptable carrier or excipient which is sterile water or sterile saline or phosphate buffered saline. Certain compositions are formulated for parenteral administration. Certain compositions are formulated for subcutaneous, intramuscular, or intravenous administration. Described unit doses and compositions are useful in the methods and uses described herein. 13 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 14 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Each of the following figures is provided by way of example and is not intended to limit the scope of the claimed invention.
[0024] FIG.1 depicts results of reduction of AGT protein levels as compared to placebo following subcutaneous administration of a single dose of ION904.
[0025] FIG.2 depicts results of mean plasma concentrations of ION904 versus time (24-hour profile) by dose following subcutaneous administration (linear scale).
[0026] FIG.3 depicts results of mean plasma concentrations of ION904 versus time (24-hour profile) by dose following subcutaneous administration (semilogarithmic scale).
[0027] FIG.4 depicts an inhibitory effect Emaxmodel of plasma AGT (% of baseline) as a function of plasma concentrations of ION904 measured on day 29 of a study according to Example 2 following a single subcutaneous dose administration of ION904.
[0028] FIG.5 depicts mean percent change from baseline of plasma AGT protein levels as compared to placebo following subcutaneous administration of monthly doses of ION904.
[0029] FIG.6 depicts median percent change from baseline of plasma AGT protein levels as compared to placebo following subcutaneous administration of monthly doses of ION904.
[0030] FIG.7 depicts a waterfall plot of individual subject percent change from baseline of plasma AGT protein levels and systolic blood pressure (SBP) change from baseline at day 99 of a study according to Example 3.
[0031] FIG.8 depicts results of mean change from baseline in seated automated office SBP over time following subcutaneous administration of monthly doses of ION904.
[0032] FIG.9 depicts results of mean change from baseline in seated automated office diastolic blood pressure (DBP) over time following subcutaneous administration of monthly doses of ION904. DETAILED DESCRIPTION
[0033] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit 15 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application and elements and components that comprise more than one subunit, unless specifically stated otherwise.
[0034] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0035] I. DEFINITIONS
[0036] The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant invention. Unless specific definitions are provided, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, the following terms have the following meanings.
[0037] 9b dbTS WTaTX]& n,u'ST^gh]dR[T^bXSTo \TP]b P ]dR[T^bXST R^\_aXbX]V P ,u'ST^ghUdaP]^bh[ bdVPa \^XTch( K][Tbb ^cWTafXbT X]SXRPcTS& P ,u'ST^gh]dR[T^bXST Xb P ,u'w'<'ST^gh]dR[T^bXST fWXRW R^\_aXbTb P ,u'w'<'ST^ghaXQ^bh[ bdVPa \^XTch& fWXRW Xb X] cWT w'< R^]UXVdaPcX^] X] ]PcdaP[[h ^RRdaaX]V ST^ghaXQ^]dR[TXR PRXS $<D9%( 9 ,u'ST^gh]dR[T^bXST ^a P ]dR[T^bXST R^\_aXbX]V P] d]\^SXUXTS ,u'ST^ghaXQ^bh[ bdVPa \^XTch \Ph QT PQPbXR& R^\_aXbT P \^SXUXTS ]dR[T^QPbT& ^a \Ph comprise an RNA nucleobase (uracil).
[0038] 9b dbTS WTaTX]& n,u'ST^gh bdVPa \^XTcho \TP]b P ,u'@$@% ST^ghUdaP]^bh[ bdVPa \^XTch( K][Tbb ^cWTafXbT X]SXRPcTS& P ,u'ST^gh bdVPa \^XTch Xb P ,u'w'<'ST^ghaXQ^bh[ bdVPa \^XTch& fWXRW WPb cWT w'< aXQ^bh[ R^]UXVdaPcX^] X] ]PcdaP[[h ^RRdaaX]V ST^ghaXQ^]dR[TXR PRXS $<D9%(
[0039] 9b dbTS WTaTX]& n,u'CE=o \TP]b P ,u'E;@2CH2OCH3Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( 9 n,u'CE= bdVPa \^XTcho \TP]b P bdVPa \^XTch fXcW P ,u'E;@2CH2OCH3 Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( K][Tbb ^cWTafXbT X]SXRPcTS& P ,u'CE= bdVPa \^XTch Xb X] cWT w'<'aXQ^bh[ bcTaT^RWT\XRP[ R^]UXVdaPcX^]( nCE=o \TP]b E'\TcW^ghTcWh[(
[0040] 9b dbTS WTaTX]& n,u'CE= ]dR[T^bXSTo ^a n,u' E;@2CH2OCH3 nucleoside” means a ]dR[T^bXST R^\_aXbX]V P ,u'CE= bdVPa \^XTch $^a ,u'E;@2CH2OCH3 furanosyl sugar moiety).
[0041] 9b dbTS WTaTX]& n,u'ECTo \TP]b P ,u'E;@3Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( 9 n,u'ECT bdVPa \^XTcho \TP]b P bdVPa \^XTch fXcW P ,u'E;@3 Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( K][Tbb ^cWTafXbT X]SXRPcTS& P ,u'ECT bdVPa \^XTch Xb X] cWT w'<'aXQ^bh[ stereochemical configuration.
[0042] 9b dbTS WTaTX]& n,u'ECT ]dR[T^bXSTo \TP]b P ]dR[T^bXST R^\_aXbX]V P ,u'ECT bdVPa moiety. 16 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0043] 9b dbTS WTaTX]& n,u'>o \TP]b P ,u'U[d^a^ Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( 9 n,u'> bdVPa \^XTcho \TP]b P bdVPa \^XTch fXcW P ,u'> Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( K][Tbb ^cWTafXbT X]SXRPcTS& P ,u'> bdVPa \^XTch Xb X] cWT w'<'aXQ^bh[ R^]UXVdaPcX^](
[0044] 9b dbTS WTaTX]& n,u'> ]dR[T^bXSTo \TP]b P ]dR[T^bXST R^\_aXbX]V P ,u'> bdVPa \^XTch(
[0045] 9b dbTS WTaTX] n,u'DC9o \TP]b P ,u'E;@2C(=O)-N(H)CH3 Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch( 9 n,u'DC9 bdVPa \^XTcho \TP]b P bdVPa \^XTch fXcW P ,u'E;@2C(=O)- N(H)CH3Va^d_ Pc cWT ,u'_^bXcX^] ^U P UdaP]^bh[ bdVPa \^XTch(
[0046] 9b dbTS WTaTX]& n,u'DC9 ]dR[T^bXSTo \TP]b P ]dR[T^bXST R^\_aXbX]V P ,u'DC9 bdVPa moiety.
[0047] 9b dbTS WTaTX]& n,u'bdQbcXcdcTS ]dR[T^bXSTo \TP]b P \^SXUXTS ]dR[T^bXST R^\_aXbX]V P ,u' bdQbcXcdcTS UdaP]^bh[ bdVPa \^XTch( ,u'bdQbcXcdcTS ]dR[T^bXSTb X]R[dST& Qdc PaT ]^c [X\XcTS c^& T(V(& P ,u'ECT ]dR[T^bXST& P ,u'CE= ]dR[T^bXST& P ,u'> ]dR[T^bXST& P ,u'DC9 ]dR[T^bXST& P R=c ]dR[T^bXST& a LNA nucleoside.
[0048] 9b dbTS WTaTX]& n,q'bdQbcXcdcX^]o ^a n,u'bdQbcXcdcTS bdVPa \^XTcho \TP]b P \^SXUXTS UdaP]^bh[ bdVPa \^XTch fWTaTX] cWT ,u'_^bXcX^] Xb PccPRWTS c^ Pc [TPbc ^]T bdQbcXcdT]c ^cWTa cWP] @ ^a E@( 9 ,u'bdQbcXcdcTS bdVPa \^XTch X]R[dSTb P QXRhR[XR bdVPa \^XTch fWTaTX] cWT bTR^]S aX]V Xb Y^X]TS c^ cWT UdaP]^bh[ aX]V Pc cWT ,u'_^bXcX^]( ,u'bdQbcXcdcTS bdVPa \^XTcXTb X]R[dST& Qdc PaT ]^c [X\XcTS c^& ,u'ECT bdVPa \^XTcXTb& ,u'CE= bdVPa \^XTcXTb& ,u'> bdVPa \^XTcXTb& ,u'DC9 bdVPa moieties, cEt sugar moieties, and LNA sugar moieties.
[0049] As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.
[0050] As used herein, “abasic nucleoside” means a modified nucleoside in which the sugar moiety is not attached to a nucleobase.
[0051] As used herein, “about” means plus or minus 7% of the provided value.
[0052] As used herein, “active agent” refers to a composition or compound that has measurable specified activity when administered to a subject. An active agent may be, for example, an oligomeric agent, e.g., an antisense oligonucleotide. In certain embodiments an active agent is other than an oligomeric agent or an antisense oligonucleotide.
[0053] As used herein, “ameliorate” with reference to a symptom of a disease, disorder or condition means improvement in, or lessening of, at least one symptom of a disease, disorder or condition. Amelioration may be reduction in severity or frequency of a symptom or the delayed onset, or slowing of progression in the severity or frequency of, a symptom. Progression, frequency, or 17 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application severity indicators may be determined by subjective or objective measures known in the art and / or described herein.
[0054] As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to hybridization of an antisense oligonucleotide to a target nucleic acid. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay; or, for example compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. Herein, antisense activity is a decrease in the amount or expression of a target nucleic acid, e.g., a target RNA, or a protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the oligonucleotide.
[0055] As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide.
[0056] As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one nucleobase sequence that is complementary to a target nucleic acid (e.g., a nucleobase sequence of a target nucleic acid). An antisense oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”), may be an unpaired antisense oligonucleotide (herein, a single-stranded antisense oligonucleotide), or may be a “hairpin oligonucleotide” that has at least one region that is self-complementary.
[0057] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the ring of the furanosyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein.
[0058] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
[0059] As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that has affinity for a particular cell type or particular cell types. For example, a cell- targeting moiety may have affinity for a cell surface moiety, such as a cell surface receptor on a particular cell type. 18 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0060] As used herein, “cleavable moiety” means a group of atoms comprising at least one bond that is cleaved under physiological conditions, e.g., in a cell, in a subject, such as a cleavable moiety cleaved inside a cell or sub-cellular compartment, e.g., an endosome or lysosome. In certain embodiments, a cleavable moiety may be cleaved by endogenous enzymes, such as nucleases, or under certain conditions, e.g., a certain pH.
[0061] As used herein, “complementary nucleobase(s)” or “complementary” in reference to a nucleobase(s) means nucleobases that form hydrogen bonds with one another. Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I), can pair with adenine, cytosine, thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C).
[0062] As used herein, “complementary sequence(s)” or “complementary” in reference to a sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two sequences are complementary nucleobases when the sequences are aligned. A “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification. Complementary nucleobase sequences may be nucleobase sequences of two separate strands of linked nucleosides or region thereof (e.g., an oligonucleotide and a region of a target nucleic acid, or an antisense oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be two regions of a single strand of linked nucleosides (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked nucleosides (e.g., an oligonucleotide), or region thereof, is described as being complementary to a second strand of linked nucleosides (e.g., a target nucleic acid or another oligonucleotide), it means that the nucleobase sequence of the first strand of linked nucleosides or region thereof is complementary to the nucleobase sequence of the second strand of linked nucleosides or region thereof when aligned. Not every pair of nucleobases in the aligned nucleobase sequences needs to be a base pair match for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where complementarity is expressed as a percent, such percent represents the percent of nucleobases within one nucleobase sequence that are complementary to nucleobases within an equal length second sequence when the 19 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches when the sequences are aligned. If a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of the two nucleobase sequences is complementary when the equal length sequences are aligned.
[0063] As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. A conjugate group comprises as conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
[0064] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
[0065] As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
[0066] As used herein, “complementary region” in reference to a strand of linked nucleosides (e.g., an oligonucleotide or a target nucleic acid) is a region of the strand of linked nucleosides in which the nucleobase sequence of the region is complementary with the nucleobase sequence of an equal- length region of a separate strand of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid, or an antisense oligonucleotide and a sense oligonucleotide), or the nucleobase sequence of an equal-length region within the strand of linked nucleosides (e.g., in a “hairpin oligonucleotide”). A complementary region of a strand of linked nucleosides may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides. A complementary region may include a mismatch, but the nucleobases of the terminal nucleosides of a complementary region are complementary to the nucleobases of the terminal nucleosides of the equal-length region of the separate strand of linked nucleosides or to the nucleobases of the terminal nucleosides of the equal- length region within the strand of linked nucleosides. 20 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0067] 9b dbTS WTaTX]& nR^]bcaPX]TS TcWh[o ^a nR=co ^a nR=c bdVPa \^XTcho \TP]b P w'< aXQ^bh[ bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge R^]]TRcX]V cWT .u'RPaQ^] P]S cWT ,u'RPaQ^] ^U cWT w'< aXQ^bh[ bdVPa \^XTch& fWTaTX] cWT QaXSVT WPb cWT U^a\d[P .u';@$;@3%'E',u& P]S fWTaTX] cWT \TcWh[ Va^d_ ^U cWT QaXSVT Xb X] cWT S configuration.
[0068] As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety.
[0069] As used herein, “deoxy region” means a region of 5-12 contiguous nucleosides, wherein at least 70% of the nucleosides are DNA nucleosides. Each nucleoside of a deoxy region is selected Ua^\ P ,u'ST^gh]dR[T^bXST P]S ,u'bdQbcXcdcTS ]dR[T^bXST( 9 ST^gh aTVX^] bd__^acb HDPbT @ PRcXeXch(
[0070] As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise a uracil nucleobase or a modified nucleobase, or may be an abasic nucleoside.
[0071] As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety.
[0072] As used herein, “dose” means a specified quantity of active agent, e.g., a compound, oligomeric agent, for example, in a pharmaceutical composition, typically measured in metric mass units, such as milligrams (mg). A “fixed dose” refers to a quantity of active agent that is provided to each subject to whom the agent is administered, regardless of subject-specific factors, for example, weight. Typically, a fixed dose is indicated as an amount, e.g., milligrams (mg). A “weight-based dose” refers to a quantity of active agent based on weight, or body mass index of a subject to whom the active agent is administered. Typically, a weight-based dose is indicated in amount per unit of measure of body weight, such as kilograms or pounds (e.g., milligrams / kilogram, or mg / kg). As used herein, “unit dose” refers to a physically discrete composition containing a predetermined quantity of active agent (e.g., compound, oligomeric agent) intended for single administration to a subject. For example, a unit dose may be a single dose for a subject, e.g., an injection or a tablet comprising a dose for a human subject. A unit dose may contain active agent (e.g., a compound, oligomeric agent) and a pharmaceutical diluent, carrier, excipient, and / or vehicle. A unit dose may be in a container, such as a vial, ampule, autoinjector device, capsule, or syringe. In certain embodiments, a unit dose is included in a single dose container, e.g., a single-dose pre-filled syringe. In certain embodiments, a unit dose is included in a multidose container, e.g., multiple single-dose pre-filled syringes supplied in a container. In certain embodiments a fixed dose and / or a weight- based dose comprises one or more unit dose(s), e.g., a fixed dose comprises administration of one or two or three unit doses. 21 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0073] As used herein, a “dosing regimen” refers to specific dose(s), number of dose(s), method of administration, timing of administration of doses and / or frequency of administration of doses (dosing interval) to a subject, and, if relevant, over a specific time period or treatment duration. In certain embodiments, a dosing regimen also includes additional aspects, e.g., administration in conjunction with food and / or drink, administration in conjunction with additional agent(s), administration in conjunction with other lifestyle adjustments (e.g., diet).
[0074] As used herein, “double-stranded” refers to hybridized or bound complementary regions, including those between two separate strands of linked nucleosides (e.g., an antisense oligonucleotide and a sense oligonucleotide) and those within a single strand of linked nucleosides (e.g., a hairpin oligonucleotide). Paired complementary regions of two separate strands of linked nucleosides form a “duplex” of the separate strands. Paired complementary regions of a single strand of linked nucleosides (i.e., a first region of the strand of linked nucleosides and a second region of the strand of linked nucleosides) form a “hairpin”.
[0075] As used herein, “duplex” means a structure formed by two separate strands of linked nucleosides or regions thereof (e.g., two separate oligonucleotides), at least a portion of which are complementary to and hybridize to each other. For clarity, herein a “hairpin oligonucleotide” is a single strand of linked nucleosides that comprises a region that is double-stranded and is not a duplex. A hairpin oligonucleotide that comprises at least one region that is complementary to a target nucleic acid is an antisense oligonucleotide.
[0076] As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring and optional substituents, and is numbered according to the following structure below, with ^_cX^]P[ PSSXcX^]P[ bdQbcXcdT]cb Pc P]h ^U cWT +u& ,u& -u& .u& P]S / u _^bXcX^]b(
[0077] As used herein, “hybridize” or “hybridization” means the act or process of two complementary regions of linked nucleosides (e.g., oligonucleotides, nucleic acids) annealing together to form a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. 22 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0078] As used herein, “internucleoside linkage” means the covalent linkage between adjacent nucleosides in an oligonucleotide. As internucleoside linkage” means a phosphodiester internucleoside linkage. internucleoside linkage” means any internucleoside linkage other than a linkage. A “phosphorothioate internucleoside internucleoside linkage in which one of the non-bridging oxygen atoms of alinkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, and in the context of linked nucleosides each R^\_aXbX]V P UdaP]^bh[ bdVPa \^XTch& P] X]cTa]dR[T^bXST [X]ZPVT Y^X]b cWT -u'RPaQ^] ^U ^]T UdaP]^bh[ bdVPa \^XTch c^ cWT / u'RPaQ^] ^U cWT ^cWTa UdaP]^bh[ bdVPa \^XTch(
[0079] 9b dbTS WTaTX]& nX]eTacTS ]dR[T^bXSTo \TP]b P ]dR[T^bXST WPeX]V P -u c^ -u P]S)^a / u c^ / u internucleoside linkage.
[0080] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., nucleosides immediately adjacent to one another, no additional nucleosides are presented between those that are linked).
[0081] As used herein, “loading dose” refers to one or more dose(s) of active agent (e.g., a compound, oligomeric agent) administered to a subject during an initial phase of a dosing regimen. In certain embodiments, a loading dose is administered to achieve a desired condition in a subject, for example, a desired initial concentration of active agent, a steady state concentration of active agent, or a desired effect in the subject. In certain embodiments a single loading dose achieves the desired state (e.g., concentration of active agent). In certain embodiments multiple loading doses achieve the desired state (e.g., concentration of active agent), wherein an “initial loading dose” means a first loading dose, and a “.ast loading dose” means the dose administered most recently prior to a first maintenance dose.
[0082] As used herein, “maintenance dose” refers to one or more dose(s) of active agent (e.g., a compound, oligomeric agent) administered to a subject after a loading dose. For example, a maintenance dose may be administered during a dosing phase after steady state concentration of active substance has been achieved (e.g., through administration of one or more loading dose). A maintenance dose may be administered to maintain a desired condition that results from administration of the loading dose. “Maintenance period” refers to a time period after a desired 23 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application condition is achieved in a subject during which one or more maintenance doses are administered to the subject.
[0083] As used herein, a “mismatch” between two aligned strands of linked nucleosides means that the two nucleobases at a specified position of the aligned nucleobase sequences are not complementary nucleobases as defined herein.
[0084] As used herein, “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or absent.
[0085] As used herein, “modified sugar moiety” means a group of atoms other than an unmodified bdVPa \^XTch cWPc U^a\b cWT _^acX^] ^U P ]dR[T^bXST R^aaTb_^]SX]V c^ P w'<'aXQ^bh[ bdVPa \^XTch X] HD9 ^a P w'<'ST^ghaXQ^bh[ bdVPa \^XTch X] <D9( 9 \^SXUXTS bdVPa \^XTch Xb bT[TRcTS Ua^\ P modified furanosyl sugar moiety, a sugar surrogate (e.g., a cyclic sugar surrogate, an acyclic sugar surrogate), or a sugar mimic.
[0086] As used herein, a “modified nucleobase” means a group of atoms other than unmodified A, T, C, U or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine.
[0087] As used herein, “motif” means a pattern of independently unmodified and / or independently modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0088] As used herein, “non-bicyclic modified sugar moiety” means a modified furanosyl sugar moiety comprising a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
[0089] As used herein, “nucleobase” means an unmodified nucleobase or modified nucleobase.
[0090] As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides independent of any sugar or internucleoside linkage modification. As used herein, “the nucleobase sequence of” a reference SEQ ID NO refers only to the order of contiguous nucleobases provided in such SEQ ID NO, independent of any sugar or internucleoside linkage modification(s), and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO.
[0091] As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside.”
[0092] As used herein, “nucleoside overhang” or “overhang” refers to unpaired nucleosides at either or both ends of an oligomeric duplex. 24 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0093] As used herein, "oligomeric agent" means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides.
[0094] As used herein, “oligomeric compound” means a compound comprising an oligonucleotide and optionally one or more covalently linked, directly or indirectly, chemical features selected from one or more conjugate group and one or more terminal group.
[0095] As used herein, “oligonucleotide” means a strand of linked nucleosides, wherein each nucleoside and / or each internucleoside linkage of the strand of linked nucleosides may independently be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 12-80 linked nucleosides. Unless otherwise indicated, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired.
[0096] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. A pharmaceutical composition may show activity in certain cell lines.
[0097] As used herein, “pharmaceutically acceptable” in reference to a substance, element, material, compound, or composition means that the substance, element, material, compound, or composition is, within the scope of sound medical judgment, suitable for use in subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. 25 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0098] As used herein, “pharmaceutically acceptable carrier” means an ingredient, e.g., a filler, diluent, preservative, stabilizing agent or excipient, in a pharmaceutical composition suitable for use in administering to a subject. Typically, a pharmaceutically acceptable carrier lacks pharmacological activity but is desirable in preparing a pharmaceutical composition.
[0099] As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
[0100] As used herein, or “RAAS” refers to the renin-angiotensin-aldosterone system, a physiological / hormonal system involved in regulation of vascular tone and fluid homeostasis through regulation of blood volume, electrolyte balance and systemic vascular resistance, which, as such, is a mediator of cardiac, vascular and renal physiology. Multiple organ systems involved in RAAS include the kidneys, lungs, systemic vasculature, adrenal cortex and brain. Components of the systemic RAAS pathway that work to effectuate responses in the organ systems include angiotensinogen (AGT), renin, angiotensin I (Ang I), , angiotensin converting enzyme (ACE), angiotensin II (Ang II), and aldosterone. The first prohormone in this pathway, AGT, is manufactured by hepatocytes in the liver and secreted into circulation. Renin, secreted into circulation from the kidneys in response to decreased renal perfusion,catalyzes the conversion of AGT to Ang I, which in turn is enzymatically cleaved by ACE (expressed in vascular endothelial cells primarily in the pulmonary circulation) to generate the biologically active Ang II. Ang II is the a primary mediator of the physiologic effects of the RAAS, and acts on vascular smooth muscle cells to contract causing vasoconstriction and increased afterload, and it stimulates production of aldosterone from the adrenal cortex. Aldosterone binds to mineralocorticoid receptors (MR) in the kidneys leading to increased sodium reabsorption, potassium excretion, and water retention which also acts to increase cardiac afterload.
[0101] As used herein, “RAAS inhibitor” refers to an agent that antagonizes or interferes with the RAAS pathway and reduces, suppresses, inhibits or blocks activity of the biologically active RAAS pathway hormones Ang II or Aldosterone, typically by targeting a component in the RAAS pathway (e.g., in the AGT-angiotensin-AT1-aldosterone axis), such as, for example, proteins, enzymes and receptors in the RAAS pathway. Examples of RAAS inhibitors include ACE inhibitors, angiotensin receptor blockers (ARBs; which block the angiotensinAT1 receptor), ARB combined with neprilysin inhibitors (ARNi), mineralocorticoid receptor blockers (MRA) and direct renin inhibitors. 26 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0102] As used herein, “RAAS inhibitor intolerant” or “RAAS inhibitor intolerance” refers to a diminished ability or inability of a subject to tolerate certain effects (e.g., adverse effects, side effects) that may occur with inhibition or suppression of the RAAS and / or treatment with one or more RAAS inhibitor, (e.g., an ACEi, ARB, ARNi, MRA). RAAS inhibitor intolerance can involve total intolerance to any dose of RAAS inhibitor or a partial intolerance that results in suboptimal dose (<50% of guideline-recommended target dose) that may be ineffective or less affective at inducing improvements in morbidity and mortality noted in landmark heart failure clinical trials.
[0103] As used herein, “RNA nucleoside” means a nucleoside comprising an unmodified RNA sugar moiety. An RNA nucleoside may comprise a modified or unmodified nucleobase. An RNA nucleoside may comprise a thymine nucleobase or a modified nucleobase, or may be an abasic nucleoside.
[0104] As used herein, “RNA sugar moiety” means an unmodified RNA sugar moiety.
[0105] As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.
[0106] As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2.
[0107] As used herein, “single-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) means that the strand is unpaired; that is, the strand of linked nucleosides is not part of a duplex or part of a double-stranded region. For clarity, herein a “hairpin oligonucleotide” is not a single-stranded oligonucleotide, though it may comprise a portion that is unpaired (e.g., a loop or terminal region) as well as portions that are double-stranded. Single-stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. 27 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0108] 9b dbTS WTaTX]& nbcPQX[XiTS _W^b_WPcT \^XTcho \TP]b P / u'_W^b_WPcT P]P[^V cWPc Xb \TcPQ^[XRP[[h \^aT bcPQ[T cWP] P / u'_W^b_WPcT Pb ]PcdaP[[h ^RRdab ^] <D9 ^a HD9(
[0109] As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. It is understood that a stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to steric and electronic interactions of reagents with the reactant molecule. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside linkage.
[0110] As used herein, a “strand” or “strand of linked nucleosides” means contiguous linked nucleosides connected via internucleoside linkages. A strand of linked nucleosides has a nucleobase sequence.
[0111] As used herein, “subject” means a human or non-human animal, e.g., a mammal. In certain embodiments, the subject is a human subject.
[0112] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.
[0113] As used herein, “symptom” of a disease means any manifestation, indication, sign, or evidence of a disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones.
[0114] As used herein, “target nucleic acid” means a nucleic acid, e.g., an RNA, that an antisense oligonucleotide is designed to affect. As used herein, “target RNA” means a target RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified. For example, a target RNA for an AGT target nucleic acid is an AGT RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified.
[0115] As used herein, “treating,” or “treatment,” with respect to a disease, disorder or condition, means administering a compound or agent to a subject having or at risk for developing such disease, disorder or condition. In certain embodiments, treating a disease, disorder or condition results in amelioration of at least one symptom of such disease, disorder or condition. In certain embodiments, 28 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application treatment reduces, improves, and / or prevents one or more symptom(s) such that a symptom of the disease, disorder or condition is diminished, is no longer apparent, or is never apparent. In certain embodiments, treatment delays the onset of, slows the progression of, or prevents the disease, disorder or condition.
[0116] As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G).
[0117] As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase.
[0118] 9b dbTS WTaTX]& nd]\^SXUXTS bdVPa \^XTcho \TP]b P ,u'E@$@% w'<'aXQ^bh[ bdVPa \^XTch& Pb U^d]S X] HD9 $P] nd]\^SXUXTS HD9 bdVPa \^XTcho%& ^a P ,u'@$@% w'<'ST^ghaXQ^bh[ bdVPa \^XTch& as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or ST^ghUdaP]^bh[ bdVPa \^XTcXTb X] cWT w'<'aXQ^bh[ bcTaT^RWT\XRP[ R^]UXVdaPcX^]& P]S WPeT ^]T WhSa^VT] Pc TPRW ^U cWT +u& -u& P]S .u _^bXcX^]b& P] ^ghVT] Pc cWT -u _^bXcX^]& cf^ WhSa^VT]b Pc cWT / u _^bXcX^]& P]S cf^ WhSa^VT]b $<D9% ^a P WhSa^VT] P]S P] E@ $HD9% Pc cWT ,u _^bXcX^](
[0119] II. CERTAIN EMBODIMENTS
[0120] Embodiment 1. A method for reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor, comprising administering an oligomeric compound or salt thereof to a subject having or at risk for heart failure; wherein the subject is intolerant, or is at risk of being intolerant, to treatment with a RAAS inhibitor; and wherein the amount of AGT protein in the subject is reduced by at least 70%, at least 75%, at least 80% or at least 85% but less than 95% in the subject; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and 29 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0121] Embodiment 2. A method of treating heart failure in a subject, comprising administering an oligomeric compound or a salt thereof to a subject having or at risk of having heart failure, wherein the subject is or is at risk of being intolerant to treatment with a RAAS inhibitor; wherein treatment results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0122] Embodiment 3. A method of treating heart failure in a subject, comprising administering about 50 mg to about 200 mg an oligomeric compound or a salt thereof to a subject; wherein administering oligomeric compound results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, 30 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0123] Embodiment 4. Use of an oligomeric compound or a salt thereof for treating heart failure in a subject intolerant to, or at risk of being intolerant to, treatment with a RAAS inhibitor, wherein: heart failure in the subject does not progress or one or more symptoms are ameliorated; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0124] Embodiment 5. Use of 50 mg to 200 mg of an oligomeric compound or a salt thereof for treating heart failure in a subject having or at risk for heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, 31 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0125] Embodiment 6. Use of an oligomeric compound or a salt thereof for reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin- angiontensin-aldosterone system (RAAS) inhibitor; wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety; and wherein the oligomeric compound reduces AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% but less than 95%.
[0126] Embodiment 7. A method for administering an oligomeric compound to a subject, comprising administering 60 mg to 120 mg of an oligomeric compound or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, 32 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0127] Embodiment 8. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric compound or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
[0128] Embodiment 9. Use of 60 mg to 120 mg of an oligomeric compound or a salt thereof for treating a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, 33 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety
[0129] Embodiment 10. Use of 60 mg to 120 mg of an oligomeric compound or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety.
[0130] Embodiment 11. The method or use of any one of embodiments 1-10, wherein the oligomeric compound is represented by the following chemical notation (5’ to 3’): THA-C6-GalNAc3-mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 5) or a salt thereof; wherein, A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, 34 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application o = a phosphodiester internucleoside linkage, and THA-C6-GalNAc3= .
[0131] Embodiment 12. The method or use of any one of embodiments 1-10, wherein the oligomeric compound is represented by the following Structure 1: (SEQ ID NO: 5), or a salt thereof. 35 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0132] Embodiment 13. The method or use of any one of embodiments 1-12, wherein the oligomeric
[0133] 1-10, wherein the oligomeric 2:36 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or of of the less, orsymptomatic valvular heart disease, left ventricular hypertrophy, left ventricular fibrosis, left ventricular dilatation, and left ventricular hypocontractility.
[0141] Embodiment 22. The method or use of any one of embodiments 1-21, wherein a decrease in the amount of AGT RNA and / or AGT protein in the subject is less than 95%, or less than 94%, or of thanAttorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94%, or no more than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric compound or salt thereof.
[0143] Embodiment 24. The method or use of any one of embodiments 1-21, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the amount of AGT protein prior to administering the oligomeric compound or salt thereof.
[0144] Embodiment 25. The method or use of any one of embodiments 1-21, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric compound or salt thereof.
[0145] Embodiment 26. The method or use of any one of embodiments 1-21, wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 75% and less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, or less than 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric compound or salt thereof.
[0146] Embodiment 27. The method or use of any one of embodiments 1-26, wherein the oligomeric compound or salt thereof is the only RAAS inhibitor administered to the subject.
[0147] Embodiment 28. The method or use of any one of embodiments 1-26, wherein the subject has been previously treated with a GDMT for heart failure.
[0148] Embodiment 29. The method or use of any one of embodiments 1-26, wherein the subject has been previously treated with a RAAS inhibitor.
[0149] Embodiment 30. The method or use of any one of embodiments 1-26, wherein the subject has been previously treated with an ACE inhibitor, an ARB, an ARNi, a MRA and / or a direct renin inhibitor.
[0150] Embodiment 31. The method or use of any one of embodiments 1-26, wherein the subject is being treated concurrently with a RAAS inhibitor in addition to the oligomeric compound.
[0151] Embodiment 32. The method or use of any one of embodiments 1-26, wherein the subject is being treated concurrently with an ACE inhibitor, ARB an ARNi, a MRA and / or a renin inhibitor. 38 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0152] Embodiment 33. The method of any one of embodiments 1-26, comprising administering the oligomeric compound or salt thereof and simultaneously or sequentially administering: (i) a RAAS inhibitor or (ii) an ACE inhibitor, ARB, ARNi, MRA or direct renin inhibitor to the subject.
[0153] Embodiment 34. The method of embodiment 33, wherein the oligomeric compound or salt thereof and (i) or (ii) are administered simultaneously in a single composition.
[0154] Embodiment 35. The method or use of any one of embodiments 31-34, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or a direct renin inhibitor is administered at less than the Guideline-recommended target dosefor treatment of HFrEF.
[0155] Embodiment 36. The method or use of embodiment 35, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or renin inhibitor is administered at less than about 70%, less than about 60%, less than about 50%, or less than about 40% of the Guideline-recommended target dose for treatment of HFrEF.
[0156] Embodiment 37. The method or use of any one of embodiments 28-36, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or renin inhibitor is administered at a frequency that is less than the Guideline-recommended,dosing regimen for treatment of HFrEF.
[0157] Embodiment 38. The method or use of any one of embodiments 1-27, wherein the subject is treated concurrently with a neprilysin inhibitor.
[0158] Embodiment 39. The method or use of any one of embodiments 1-27, further comprising simultaneously or sequentially administering a neprilysin inhibitor to the subject.
[0159] Embodiment 40. The method or use of embodiment 38 or embodiment 39, wherein the neprilysin inhibitor is sacubitril.
[0160] Embodiment 41. The method or use of embodiment 39 or embodiment 40, further comprising simultaneously or sequentially administering an ARB to the subject.
[0161] Embodiment 42. The method or use of embodiment 41, wherein the ARB is valsartan.
[0162] Embodiment 43. The method or use of any one of embodiments 1-42, wherein the subject has asymptomatic left ventricular dysfunction (ALVD).
[0163] Embodiment 44. The method or use of any one of embodiments 1-42, wherein the subject has structural and / or functional abnormalities of the pericardium, myocardium and / or a cardiac valve.
[0164] Embodiment 45. The method or use of any one of embodiments 1-42, wherein the subject has one or more of asymptomatic or symptomatic valvular heart disease, left ventricular 39 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application hypertrophy, left ventricular fibrosis, left ventricular dilatation, and left ventricular hypocontractility.
[0165] Embodiment 46. The method or use of any one of embodiments 1-45, wherein the subject has or is at risk of having angioedema or asthma.
[0166] Embodiment 47. The method or use of any one of embodiments 1-46, wherein the subject has renal insufficiency.
[0167] Embodiment 48. The method or use of embodiment 47, wherein the subject has an estimated glomerular filtration rate (eGFR) of between 30 and 90 ml / min / 1.73 m2, between 30 and 89 ml / min / 1.73 m2, between 30 and 80 ml / min / 1.73 m2, between 20 and 89 ml / min / 1.73 m2, between 20 and 80 ml / min / 1.73 m2, between 45 and 89 ml / min / 1.73 m2, between 40 and 89 ml / min / 1.73 m2, between 40 and 80 ml / min / 1.73 m2, between 60 and 89 ml / min / 1.73 m2, between 30 and 60 ml / min / 1.73 m2, between 30 and 59 ml / min / 1.73 m2, between 40 and 60 ml / min / 1.73 m2, between 30 and 44 ml / min / 1.73 m2, between 35 and 45 ml / min / 1.73 m2, between 15 and 44 ml / min / 1.73 m2, between 15 and 29 ml / min / 1.73 m2, less than about 90 ml / min / 1.73 m2, less than about 89 ml / min / 1.73 m2, less than about 80 ml / min / 1.73 m2, less than about 70 ml / min / 1.73 m2, less than about 60 ml / min / 1.73 m2, less than about 59 ml / min / 1.73 m2, less than about 45 ml / min / 1.73 m2, less than about 44 ml / min / 1.73 m2, less than about 40 ml / min / 1.73 m2, less than about 30 ml / min / 1.73 m2, less than about 29 ml / min / 1.73 m2, or less than about 15 ml / min / 1.73 m2.
[0168] Embodiment 49: The method or use of any one of embodiments 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 150 mg, 55 mg to 125 mg, 55 mg to 115 mg, 55 mg to 105 mg, 55 mg to 95 mg, 55 mg to 85 mg, 55 mg to 75 mg, 55 mg to 65 mg, 65 mg to 125 mg, 65 mg to 115 mg, 65 mg to 105 mg, or 65 mg to 95 mg, 65 mg to 85 mg, 65 mg to 75 mg, 75 mg to 125 mg, 75 mg to 115 mg, 40 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 75 mg to 105 mg, 75 mg to 95 mg, 75 mg to 85 mg, 85 mg to 125 mg, 85 mg to 115 mg, 85 mg to 105 mg, or 85 mg to 95 mg.
[0169] Embodiment 50: The method or use of any one of embodiments 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 50 mg to about 150 mg, about 50 mg to about 140 mg, about 50 mg to about 120 mg, about 50 mg to about 110 mg, about 50 mg to about 100 mg, about 50 mg to about 80 mg, about 50 mg to about 70 mg, about 50 mg to about 60 mg, about 60 mg to about 150 mg, about 60 mg to about 140 mg, about 60 mg to about 120 mg, about 60 mg to about 110 mg, about 60 mg to about 100 mg, about 60 mg to about 80 mg, about 60 mg to about 70 mg, about 70 mg to about 150 mg, about 70 mg to about 140 mg, about 70 mg to about 120 mg, about 70 mg to about 110 mg, about 70 mg to about 100 mg, about 70 mg to about 80 mg, about 80 mg to about 150 mg, about 80 mg to about 140 mg, about 80 mg to about 120 mg, about 80 mg to about 110 mg, about 80 mg to about 100 mg, about 80 mg to about 90 mg, about 90 mg to about 150 mg, about 90 mg to about 140 mg, about 90 mg to about 120 mg, about 90 mg to about 110 mg, about 90 mg to about 100 mg, about 100 mg to about 150 mg, about 100 mg to about 140 mg, about 100 mg to about 120 mg, about 100 mg to about 110 mg, about 110 mg to about 150 mg, about 110 mg to about 140 mg, about 110 mg to about 130 mg, about 110 mg to about 120 mg, about 120 mg to about 150 mg, about 120 mg to about 140 mg, about 120 mg to about 130 mg, about 130 mg to about 150 mg, about 130 mg to about 140 mg, about 140 mg to about 150 mg, about 55 mg to about 125 mg, about 55 mg to about 115 mg, about 55 mg to about 105 mg, about 55 mg to about 95 mg, about 55 mg to about 85 mg, about 55 mg to about 75 mg, about 55 mg to about 65 mg, about 65 mg to about 125 mg, about 65 mg to about 115 mg, about 65 mg to about 105 mg, or about 65 mg to about 95 mg, about 65 mg to about 85 mg, about 65 mg to about 75 mg, about 75 mg to about 125 mg, about 75 mg to about 115 mg, about 75 mg to about 105 mg, about 75 mg to about 95 mg, about 75 mg to about 85 mg, about 85 mg to about 125 mg, about 85 mg to about 115 mg, about 85 mg to about 105 mg, or about 85 mg to about 95 mg.
[0170] Embodiment 51. The method or use of any one of embodiments 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of at least about 50 mg and less than about 150 mg, at least about 50 mg and less than about 145 mg, at least about 50 mg and less than about 140 mg, at least about 50 mg and less than about 135 mg, at least about 50 mg and less than about 130 mg, at least about 50 mg and less than about 125 mg, at least about 50 mg and less than about 120 mg, at least about 50 mg and less than about 115 mg, at 41 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application least about 50 mg and less than about 110 mg, at least about 50 mg and less than about 105 mg, at least about 50 mg and less than about 100 mg, at least about 50 mg and less than about 95 mg, at least about 50 mg and less than about 90 mg, at least about 50 mg and less than about 85 mg, at least about 50 mg and less than about 80 mg, at least about 50 mg and less than about 75 mg, at least about 50 mg and less than about 70 mg, at least about 50 mg and less than about 65 mg, at least about 55 mg and less than about 65 mg, at least about 60 mg and less than about 150 mg, at least about 60 mg and less than about 145 mg, at least about 60 mg and less than about 140 mg, at least about 60 mg and less than about 135 mg, at least about 60 mg and less than about 130 mg, at least about 60 mg and less than about 125 mg, at least about 60 mg and less than about 120 mg, at least about 60 mg and less than about 115 mg, at least about 60 mg and less than about 110 mg, at least about 60 mg and less than about 105 mg, at least about 60 mg and less than about 100 mg, at least about 60 mg and less than about 95 mg, at least about 70 mg and less than about 150 mg, at least about 70 mg and less than about 145 mg, at least about 70 mg and less than about 140 mg, at least about 70 mg and less than about 135 mg, at least about 70 mg and less than about 130 mg, at least about 70 mg and less than about 125 mg, at least about 70 mg and less than about 120 mg, at least about 70 mg and less than about 115 mg, at least about 70 mg and less than about 110 mg, at least about 70 mg and less than about 105 mg, at least about 70 mg and less than about 100 mg, at least about 70 mg and less than about 95 mg, at least about 80 mg and less than about 150 mg, at least about 80 mg and less than about 145 mg, at least about 80 mg and less than about 140 mg, at least about 80 mg and less than about 135 mg, at least about 80 mg and less than about 130 mg, at least about 80 mg and less than about 125 mg, at least about 80 mg and less than about 120 mg, at least about 80 mg and less than about 115 mg, at least about 80 mg and less than about 110 mg, at least about 80 mg and less than about 105 mg, at least about 80 mg and less than about 100 mg, at least about 80 mg and less than about 95 mg, or at least about 85 mg and less than about 95 mg of the oligomeric compound or salt thereof.
[0171] Embodiment 52. The method or use of any one of embodiments 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, or about 150 mg of the oligomeric compound or salt thereof. 42 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0172] Embodiment 53. The method or use of any one of embodiments 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg of the oligomeric compound or salt thereof.
[0173] Embodiment 54. The method or use of any one of embodiments 1-48, wherein administering or use comprises administering or use of a fixed dose of about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound or salt thereof.
[0174] Embodiment 55. The method or use of any one of embodiments 1-48, wherein the administering or use comprises administering or use of a fixed dose of 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof.
[0175] Embodiment 56. The method or use of any one of embodiments 1-48, wherein the administering or use comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 55 mg to about 100 mg, about 60 mg to about 100 mg, about 65 mg to about 100 mg, about 70 mg to about 100 mg, about 75 mg to about 100 mg, about 80 mg to about 100 mg, about 85 mg to about 100 mg, about 85 mg to about 100 mg, or about 85 mg to about 95 mg.
[0176] Embodiment 57. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 55 mg of the oligomeric compound or salt thereof.
[0177] Embodiment 58. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 60 mg of the oligomeric compound or salt thereof.
[0178] Embodiment 59. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 65 mg of the oligomeric compound or salt thereof.
[0179] Embodiment 60. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 70 mg of the oligomeric compound or salt thereof.
[0180] Embodiment 61. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 75 mg of the oligomeric compound or salt thereof.
[0181] Embodiment 62. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 80 mg of the oligomeric compound or salt thereof.
[0182] Embodiment 63. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 85 mg of the oligomeric compound or salt thereof. 43 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0183] Embodiment 64. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 90 mg of the oligomeric compound or salt thereof.
[0184] Embodiment 65. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 95 mg of the oligomeric compound or salt thereof.
[0185] Embodiment 66. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of about 100 mg of the oligomeric compound or salt thereof.
[0186] Embodiment 67. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 55 mg to 105 mg of the oligomeric compound or salt thereof.
[0187] Embodiment 68. The method or use of any one of embodiments 1-48, comprising administering or use of a unit dose of 60 mg of the oligomeric compound or salt thereof.
[0188] Embodiment 69. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 65 mg of the oligomeric compound or salt thereof.
[0189] Embodiment 70. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 70 mg of the oligomeric compound or salt thereof.
[0190] Embodiment 71. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 75 mg of the oligomeric compound or salt thereof.
[0191] Embodiment 72. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 80 mg of the oligomeric compound or salt thereof.
[0192] Embodiment 73. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 85 mg of the oligomeric compound or salt thereof.
[0193] Embodiment 74. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 90 mg of the oligomeric compound or salt thereof.
[0194] Embodiment 75. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 95 mg of the oligomeric compound or salt thereof.
[0195] Embodiment 76. The method or use of any one of embodiments 1-48, comprising administering or use of a fixed dose of 100 mg of the oligomeric compound or salt thereof.
[0196] Embodiment 77. The method or use of any one of embodiments 1-48, wherein the oligomeric compound or salt thereof is ION904 or a salt thereof.
[0197] Embodiment 78. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered once about every 4 weeks or once about every 28 days. 44 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0198] Embodiment 79. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered at an interval of about once a month, about once every two months, or about once every three months.
[0199] Embodiment 80. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, or about once every 10 weeks.
[0200] Embodiment 81. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered once every 4 weeks or once every 28 days.
[0201] Embodiment 82. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered at an interval of once a month, once every two months, or once every three months.
[0202] Embodiment 83. The method of any one of embodiments 1-77, wherein the oligomeric compound or salt thereof is administered once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, or once every 10 weeks.
[0203] Embodiment 84. The method or use of any one of embodiments 1-83, wherein administering or use comprises administering or use of a fixed dose of 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof once every 3 weeks, once every 4 weeks, once every 5 weeks or once every 6 weeks.
[0204] Embodiment 85. The method or use of any one of embodiments 1-83, wherein administering or use comprises administering or use of a fixed dose of about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound or salt thereof once about every 3 weeks, once about every 4 weeks, once about every 5 weeks or once about every 6 weeks, wherein the oligomeric compound is formulated for parenteral administration.
[0205] Embodiment 86. The method or use of embodiment 85, wherein administering or use comprises administering or use of a fixed dose of about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg of the oligomeric compound or salt thereof once about every 25 days, once about every 26 days, once about every 27 days, once about every 28 days, once about every 29 days, once about every 30 days, or once about every 31 days, wherein the oligomeric compound is formulated for parenteral administration. 45 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0206] Embodiment 87. The method or use of embodiment 85, wherein administering or use comprises administering or use of a fixed dose of 60 mg or about 60 mg, or 90 mg or about 90 mg of the oligomeric compound or salt thereof once every 28 days or about every 28 days, or once every 4 weeks or about every 4 weeks, or once a month or about once a month, wherein the oligomeric compound is formulated for subcutaneous administration.
[0207] Embodiment 88. The method or use of embodiment 85, wherein administering or use comprises administering or use of a fixed dose of about 60 mg or about 90 mg of the oligomeric compound or salt thereof once about every 28 days or once about every 4 weeks, or once about every month, wherein the oligomeric compound is formulated for subcutaneous administration.
[0208] Embodiment 89. The method or use of any one of embodiments 1-88, wherein the oligomeric compound or salt thereof comprises administering or use of a loading dose.
[0209] Embodiment 90. The method or use of embodiment 89, wherein the administering or use comprises one or more maintenance doses of the oligomeric compound or salt thereof.
[0210] Embodiment 91. The method or use of embodiment 90, wherein the loading dose comprises a greater amount of the oligomeric compound or salt thereof than a maintenance dose.
[0211] Embodiment 92. The method or use of embodiment 90, wherein the loading dose and the maintenance dose comprises the same amount of the oligomeric compound or salt thereof.
[0212] Embodiment 93. The method or use of any one of embodiments 1-92, wherein the administration or use of the oligomeric compound or salt thereof is effective to decrease the amount of AGT RNA and / or AGT protein in the subject by at least 70%, at least 75%, at least 80%, or at least 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration or use of the oligomeric compound or salt thereof.
[0213] Embodiment 94. The method or use of any one of embodiments 1-93, wherein such method or use is effective to treat heart failure and / or ameliorate one or more symptoms of heart failure, but does not significantly reduce systolic blood pressure and / or diastolic blood pressure in a subject having, or at risk for, heart failure.
[0214] Embodiment 95. The method or use of any one of embodiments 1-93, wherein such method or use improves cardiac function, reduces cardiac dilation, reduces cardiac fibrosis, reverses or attenuates cardiac remodeling, increases LVEF, improves left ventricular end systolic volume (LVESV) or left ventricular indexed end systolic volume (LVESVi), improves left ventricular end diastolic volume (LVEDV), improves left ventricle (LV) strain, improves 6-minute walk test, and / or improves quality of life in the subject having, or at risk for, heart failure. 46 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0215] Embodiment 96. The method or use of any one of embodiments 1-93, wherein such method or use decreases the level of NT-proBNP, BNP, high-sensitive cardiac troponin T (hs-cTnT), and / or cTnT in blood, plasma, or serum of the subject having, or at risk for, heart failure
[0216] Embodiment 97. The method or use of any one of embodiments 1-93, wherein such method or use ameliorates at least one symptom of heart failure selected from fatigue, rapid or irregular heartbeat, palpitation, shortness of breath, chest pain, dizziness, weakness, dyspnea, orthopnea, edema, hepatic congestion, or ascites in the subject having, or at risk for, heart failure.
[0217] Embodiment 98. The method or use of any one of embodiments 1-93, wherein such method or use slows or prevents progression of one or more symptoms or signs of heart failure in the subject having, or at risk for, heart failure.
[0218] Embodiment 99. The method or use of any one of embodiments 1-93, wherein such method or use improves or eliminates one or more symptoms or signs of heart failure in the subject having, or at risk for, heart failure.
[0219] Embodiment 100. The method or use of any one of embodiments 1-99, wherein the oligomeric compound or salt thereof is administered in a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
[0220] Embodiment 101. The method or use of embodiment 100, wherein the pharmaceutical composition comprises water, saline, or 2mM phosphate buffered isotonic saline, pH 7.4.
[0221] Embodiment 102. The method or use of any one of embodiments 1-101, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered parenterally.
[0222] Embodiment 103. The method or use of embodiment 102, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered subcutaneously.
[0223] Embodiment 104. The method or use of embodiment 103wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered by a syringe.
[0224] Embodiment 105. The method or use of embodiment 103, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered by an autoinjector device.
[0225] Embodiment 106. A method of treating heart failure in a subject, comprising administering a fixed dose of 55 mg to 100 mg of an oligomeric compound or a salt thereof to a subject; wherein administering the oligomeric compound results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is represented by the following sodium salt: 47 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (SEQ ID NO: 5), wherein the oligomeric compound is formulated with a pharmaceutically acceptable carrier or excipient selected from sterile water or sterile saline or phosphate buffered saline, formulated for parenteral administration.
[0226] Embodiment 107. Use of a fixed dose of 55 mg to 100 mg of an oligomeric compound or a salt thereof for reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor; wherein the oligomeric compound is compound represented by the following sodium salt: 48 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application carrier or for thepre- filled syringe or an autoinjector device.
[0228] Embodiment 109. A unit dose comprising 50 mg to 200 mg of an oligomeric compound comprising a GalNAc-conjugated modified oligonucleotide represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, 49 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application e = a 2’-MOE sugar moiety, 5) or a saltTHA-C6-GalNAc3= .
[0230] Embodiment 111. A unit dose comprising 50 mg to 150 mg of an oligomeric compound represented by the following Structure 1: 50 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (SEQ ID NO: 5), or a salt thereof.
[0231] Embodiment 112. A unit dose comprising 50 mg to 150 mg an oligomeric compound represented by the following sodium salt Structure 2:57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application an amount mg to 140 50 mgmg, mg mg, mg mg, mg mg, mg mg, mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 150 mg, 55 mg to 125 mg, 55 mg to 115 mg, 55 mg to 105 mg, 55 mg to 95 mg, 55 mg to 85 mg, 55 mg to 75 mg, 55 mg to 65 mg, 65 mg to 125 mg, 65 mg to 115 mg, 65 mg to 105 mg, or 65 mg to 95 mg, 65 mg to 85 mg, 65 mg to 75 mg, 75 mg to 125 mg, 75 mg to 115 mg, 52 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 75 mg to 105 mg, 75 mg to 95 mg, 75 mg to 85 mg, 85 mg to 125 mg, 85 mg to 115 mg, 85 mg to 105 amount of about 50 50 mg to about 60 mg, mg, 60 mg to about 80 mg, mg, 90 mg mg to to about 140 150 mg, mg,about 55 mg to about 95 mg, about 55 mg to about 85 mg, about 55 mg to about 75 mg, about 55 mg to about 65 mg, about 65 mg to about 125 mg, about 65 mg to about 115 mg, about 65 mg to about 105 mg, or about 65 mg to about 95 mg, about 65 mg to about 85 mg, about 65 mg to about 75 mg, about 75 mg to about 125 mg, about 75 mg to about 115 mg, about 75 mg to about 105 mg, about 75 mg to about 95 mg, about 75 mg to about 85 mg, about 85 mg to about 125 mg, about 85 mg to about 115 mg, about 85 mg to about 105 mg, or about 85 mg to about 95 mg.
[0234] Embodiment 115. The unit dose of any one of embodiments 109-112, comprising at least about 50 mg and less than about 150 mg, at least about 50 mg and less than about 145 mg, at least about 50 mg and less than about 140 mg, at least about 50 mg and less than about 135 mg, at least about 50 mg and less than about 130 mg, at least about 50 mg and less than about 125 mg, at least about 50 mg and less than about 120 mg, at least about 50 mg and less than about 115 mg, at least about 50 mg and less than about 110 mg, at least about 50 mg and less than about 105 mg, at least about 50 mg and less than about 100 mg, at least about 50 mg and less than about 95 mg, at least 53 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application about 50 mg and less than about 90 mg, at least about 50 mg and less than about 85 mg, at least about 50 mg and less than about 80 mg, at least about 50 mg and less than about 75 mg, at least about 50 mg and less than about 70 mg, at least about 50 mg and less than about 65 mg, at least about 55 mg and less than about 65 mg, at least about 60 mg and less than about 150 mg, at least about 60 mg and less than about 145 mg, at least about 60 mg and less than about 140 mg, at least about 60 mg and less than about 135 mg, at least about 60 mg and less than about 130 mg, at least about 60 mg and less than about 125 mg, at least about 60 mg and less than about 120 mg, at least about 60 mg and less than about 115 mg, at least about 60 mg and less than about 110 mg, at least about 60 mg and less than about 105 mg, at least about 60 mg and less than about 100 mg, at least about 60 mg and less than about 95 mg, at least about 70 mg and less than about 150 mg, at least about 70 mg and less than about 145 mg, at least about 70 mg and less than about 140 mg, at least about 70 mg and less than about 135 mg, at least about 70 mg and less than about 130 mg, at least about 70 mg and less than about 125 mg, at least about 70 mg and less than about 120 mg, at least about 70 mg and less than about 115 mg, at least about 70 mg and less than about 110 mg, at least about 70 mg and less than about 105 mg, at least about 70 mg and less than about 100 mg, at least about 70 mg and less than about 95 mg, at least about 80 mg and less than about 150 mg, at least about 80 mg and less than about 145 mg, at least about 80 mg and less than about 140 mg, at least about 80 mg and less than about 135 mg, at least about 80 mg and less than about 130 mg, at least about 80 mg and less than about 125 mg, at least about 80 mg and less than about 120 mg, at least about 80 mg and less than about 115 mg, at least about 80 mg and less than about 110 mg, at least about 80 mg and less than about 105 mg, at least about 80 mg and less than about 100 mg, at least about 80 mg and less than about 95 mg, or at least about 85 mg and less than about 95 mg of the oligomeric compound or salt thereof.
[0235] Embodiment 116. The unit dose of any one of embodiments 109-112, comprising about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, or about 150 mg of the oligomeric compound or salt thereof.
[0236] Embodiment 117. The unit dose of any one of embodiments 109-112, comprising 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg of the oligomeric compound or salt thereof. 54 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0237] Embodiment 118. The unit dose of any one of embodiments 109-112, comprising about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound or salt thereof.
[0238] Embodiment 119. The unit dose of any one of embodiments 109-112, comprising 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof.
[0239] Embodiment 120. The unit dose of any one of embodiments 109-112, comprising an amount of the oligomeric compound or salt thereof within the range of about 55 mg to about 100 mg, about 60 mg to about 100 mg, about 65 mg to about 100 mg, about 70 mg to about 100 mg, about 75 mg to about 100 mg, about 80 mg to about 100 mg, about 85 mg to about 100 mg, about 85 mg to about 100 mg, or about 85 mg to about 95 mg.
[0240] Embodiment 121. The unit dose of any one of embodiments 109-112, comprising about 55 mg of the oligomeric compound or salt thereof.
[0241] Embodiment 122. The unit dose of any one of embodiments 109-112, comprising about 60 mg of the oligomeric compound or salt thereof.
[0242] Embodiment 123. The unit dose of any one of embodiments 109-112, comprising about 65 mg of the oligomeric compound or salt thereof.
[0243] Embodiment 124. The unit dose of any one of embodiments 109-112, comprising about 70 mg of the oligomeric compound or salt thereof.
[0244] Embodiment 125. The unit dose of any one of embodiments 109-112, comprising about 75 mg of the oligomeric compound or salt thereof.
[0245] Embodiment 126. The unit dose of any one of embodiments 109-112, comprising about 80 mg of the oligomeric compound or salt thereof.
[0246] Embodiment 127. The unit dose of any one of embodiments 109-112, comprising about 85 mg of the oligomeric compound or salt thereof.
[0247] Embodiment 128. The unit dose of any one of embodiments 109-112, comprising about 90 mg of the oligomeric compound or salt thereof.
[0248] Embodiment 129. The unit dose of any one of embodiments 109-112, comprising about 95 mg of the oligomeric compound or salt thereof.
[0249] Embodiment 130. The unit dose of any one of embodiments 109-112, comprising about 100 mg of the oligomeric compound or salt thereof. 55 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0250] Embodiment 131. The unit dose of any one of embodiments 109-112, comprising 55 mg to 95 mg of the oligomeric compound or salt thereof.
[0251] Embodiment 132. The unit dose of any one of embodiments 109-131, further comprising a neprilysin inhibitor.
[0252] Embodiment 133. The unit dose of embodiment 132, wherein the neprilysin inhibitor is sacubitril.
[0253] Embodiment 134. The unit dose of any one of embodiments 109-133, further comprising an ACEi, ARB, ARNi or MRA.
[0254] Embodiment 135. The unit dose of any embodiment 132 or embodiment 133, further comprising an ARB which is valsartan.
[0255] Embodiment 136. The unit dose of embodiment 134 or embodiment 135, wherein the dose of the ACEi, ARB, ARNi or MRA is lower than the Guideline-recommended, target dose for treating HFrEF.
[0256] Embodiment 137. The unit dose of embodiment 136, wherein the dose of the ACEi, ARB, ARNi or MRA is less than about 80%, 70%, 60%, 55%, 50%, 45%, or 40% of the Guideline- recommendedtarget dose for treating HFrEF.
[0257] Embodiment 138. The unit dose of any one of embodiments 109-131, wherein the unit dose does not contain any other RAAS inhibitor.
[0258] Embodiment 139. The unit dose of any one of embodiments 109-138, further comprising a pharmaceutically acceptable carrier, adjuvant or excipient.
[0259] Embodiment 140. The unit dose of embodiments 139, consisting of the oligomeric compound or salt thereof and a pharmaceutically acceptable carrier or excipient.
[0260] Embodiment 141. The unit dose of embodiment 139, wherein the pharmaceutically acceptable carrier or excipient is sterile water or sterile saline or phosphate buffered saline.
[0261] Embodiment 142. The unit dose of embodiment 141, consisting of the oligomeric compound or salt thereof and sterile water or sterile saline or phosphate buffered saline.
[0262] Embodiment 143. The unit dose of any one of embodiments 109-142, formulated for parenteral administration.
[0263] Embodiment 144. The unit dose of embodiment 143, formulated for subcutaneous, intramuscular, or intravenous administration.
[0264] Embodiment 145. The unit dose of embodiment 143, formulated for subcutaneous administration. 56 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0265] Embodiment 146. The unit dose of any one of embodiments 109-145, contained in a single- dose vial.
[0266] Embodiment 147. The unit dose of any one of embodiments 109-145, provided in multi-dose vials.
[0267] Embodiment 148. The unit dose of any one of embodiments 109-145, contained in a prefilled syringe.
[0268] Embodiment 149. The unit dose of any one of embodiments 109-145, contained in a single- dose prefilled syringe.
[0269] Embodiment 150. The unit dose of any one of embodiments 109-145, contained in an autoinjector device.
[0270] Embodiment 151. A kit, comprising: (a) the unit dose of any one of embodiments 109-150, and (b) instructions for use, and, optionally, (c) means for administering the unit dose.
[0271] Embodiment 152. The kit of embodiment 151, wherein the instructions are for use in reducing the amount of AGT RNA and / or AGT protein in a subject having or at risk for heart failure.
[0272] Embodiment 153. The kit of embodiment 151, wherein the instructions are for use in treating, or ameliorating one or more symptoms of, heart failure in a subject having or at risk for heart failure.
[0273] Embodiment 154: The method or use or unit dose of any one of embodiments 1-153, wherein the modified oligonucleotide is single-stranded.
[0274] Embodiment 155: The method or use or unit dose of any one of embodiments 1-153, wherein the modified oligonucleotide is the only oligonucleotide in the oligomeric compound.
[0275] Embodiment 156: The method or use or unit dose of any one of embodiments 1-153, wherein the modified oligonucleotide is double-stranded.
[0276] Embodiment 157. A unit dose comprising 55 mg to 100 mg of an oligomeric compound represented by the following sodium salt: 57 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (SEQ ID NO: 5), and a pharmaceutically acceptable carrier or excipient selected from sterile water or sterile saline or phosphate buffered saline, formulated for parenteral administration.
[0277] Embodiment 158. The unit dose of embodiment 157, formulated for subcutaneous administration and contained in a single use vial, pre-filled syringe or an autoinjector device.
[0278] Embodiment 159. A method for reducing the amount of angiotensinogen (AGT) RNA and / or AGT protein in a subject who is or is at risk of being intolerant to treatment with a renin- angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; wherein: 58 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. heart at least 75%, at having or at at leastamount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
[0281] Embodiment 162. Use of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein: the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2, or salt thereof to a subject having or at risk for heart failure; and 59 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
[0282] Embodiment 163. Use of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein:
[0283] the oligomeric agent comprises a modified oligonucleotide consisting of 16-50 linked nucleosides, wherein the modified oligonucleotide comprises at least 13 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; and
[0284] the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0285] Embodiment 164. Use of 60 mg to 120 mg of an oligomeric agent or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; and wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
[0286] Embodiment 165. The method or use of any one of embodiments 159-164, wherein the subject has or is at risk for, or the heart failure is, heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0287] Embodiment 166. The method or use of any one of embodiments 159-164, wherein the subject has a left ventricular ejection fraction of about 50% or less, about 40% or less, or about 35% or less, or about 30% or less. 60 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0288] Embodiment 167. The method or use of any one of embodiments 159-164, wherein the subject has one or more of asymptomatic left ventricular dysfunction (ALVD), asymptomatic or symptomatic valvular heart disease, left ventricular hypertrophy, left ventricular fibrosis, left ventricular dilatation, and left ventricular hypocontractility.
[0289] Embodiment 168. The method or use of any one of embodiments 159-167, wherein the amount of AGT protein in the liver of the subject is reduced.
[0290] Embodiment 169. The method or use of any one of embodiments 159-167, wherein the amount of AGT protein in the blood, serum or plasma of the subject is reduced.
[0291] Embodiment 170. The method or use of any one of embodiments 159-169, wherein a decrease in the amount of AGT RNA and / or AGT protein in the subject is less than 95%, or less than 94%, or less than 93%, or less than 92%, or less than 91%, or less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0292] Embodiment 171. The method or use of any one of embodiments 159-169, wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by no more than 85%, or no more than 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94%, or no more than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0293] Embodiment 172. The method or use of any one of embodiments 159-169, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 75%, at least 80% or at least 85% and less than 95% compared to the amount of AGT protein prior to administering the oligomeric agent or salt thereof.
[0294] Embodiment 173. The method or use of any one of embodiments 159-169, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 70% or at least 75%, at least 80% or at least 85% and less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0295] Embodiment 174. The method or use of any one of embodiments 159-169, wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70% or at least 75% and less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, or less than 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof. 61 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0296] Embodiment 175. The method or use of any one of embodiments 159-174, wherein the nucleobase sequence comprises at least 13, at least 14, at least 15 or at least 16 contiguous nucleobases at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2.
[0297] Embodiment 176. The method or use of any one of embodiments 159-174, wherein the nucleobase sequence comprises at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any one of the nucleobase sequence of SEQ ID NOs: 3-5.
[0298] Embodiment 177. The method or use of any one of embodiments 159-174, wherein the modified oligonucleotide consists of 16 to 17, 16 to 18,16 to 20, 16 to 25, 16 to 30, 17 to 20, 17 to 25, 17 to 30, 18 to 20, 18 to 25, 18 to 30, 19 to 20, 19 to 25, 19 to 30, 20 to 25, 20 to 30, 21-23, 21 to 25, 21 to 30, 22 to 25, 22 to 30, 23 to 25, or 23 to 30 linked nucleosides.
[0299] Embodiment 178 The method or use of any one of embodiments 159-174, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides and comprises or consists of a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 3-5.
[0300] Embodiment 179. The method or use of any one of embodiments 159-178, wherein the modified oligonucleotide comprises one or more i) modified nucleosides comprising a modified sugar moiety, ii) cyclic sugar surrogate, iii) acyclic sugar surrogate, iii) modified internucleoside linkage, and / or iv) modified nucleobase.
[0301] Embodiment 180. The method or use of embodiment 179, wherein the modified sugar moiety is a modified furanosyl sugar moiety or a sugar surrogate.
[0302] Embodiment 181. The method or use of embodiment 179, wherein the modified nucleoside comprises a bicyclic modified sugar moiety comprising a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'.
[0303] Embodiment 182. The method or use of embodiment 179, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety selected from a 2’-MOE sugar moiety, 2’-OMe sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety.
[0304] Embodiment 183. The method or use of embodiment 179, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside. 62 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0305] Embodiment 184. The method or use of embodiment 179, wherein the modified nucleobase is 5-methylcytosine or hypoxanthine.
[0306] Embodiment 185. The method or use of embodiment 179, wherein each nucleoside of the modified oligonucleotide comprises a nucleobase.
[0307] Embodiment 186. The method or use of embodiment 179, wherein each nucleoside of the modified oligonucleotide is independently selected from a furanosyl nucleoside, a cyclic sugar surrogate nucleoside, and an acyclic sugar surrogate nucleoside comprising a nucleobase.
[0308] Embodiment 187. The method or use of embodiment 179, wherein at least one nucleoside of the modified oligonucleotide comprises an unmodified sugar moiety.
[0309] Embodiment 188. The method or use of embodiment 179, wherein at least one nucleoside of the modified oligonucleotide comprises an unmodified DNA sugar moiety.
[0310] Embodiment 189. The method or use of any one of embodiments 1-188, wherein the oligomeric agent or salt thereof comprises a conjugate group comprising a conjugate linker and a conjugate moiety comprising a cell-targeting moiety.
[0311] Embodiment 190. The method or use of embodiment 189, wherein the cell-targeting moiety comprises a moiety that interacts with or binds to a liver cell.
[0312] Embodiment 191. The method or use embodiment 190, wherein the conjugate group comprises a N-acetyl galactosamine (GalNAc) moiety.
[0313] Embodiment 192. The method or use of embodiment 191, wherein the conjugate group comprises the following structure: , or 63 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application .
[0314] Embodiment 193. The method or use of any one of embodiments 189-192, wherein the conjugate group comprises a conjugate linker consisting of a single bond and / or comprises a cleavable linker.
[0315] Embodiment 194. The method or use of any one of embodiments 189-193, wherein the conjugate group is attached to the 5’-terminal nucleoside or to the 3’-terminal nucleoside of the modified oligonucleotide.
[0316] Embodiment 195. The method or use of any one of embodiments 159-194, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 linked nucleosides.
[0317] Embodiment 196. The method or use of embodiment 195, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
[0318] Embodiment 197. The method or use of embodiment 195 or embodiment 196, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
[0319] Embodiment 198. The method or use of embodiment 196, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 nucleosides and on the 3’-side by a 3’-region consisting of 1-6 linked nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety.
[0320] Embodiment 199. The method or use of embodiment 198, wherein each nucleoside of the 3’- region comprises a modified sugar moiety and / or wherein each nucleoside of the 5’-region comprises a modified sugar moiety.
[0321] Embodiment 200. The method or use of any one of embodiments 199, wherein each nucleoside of the 5’-region independently is a cEt nucleoside, a 2’-OMe nucleoside, or a 2’-MOE 64 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application nucleoside and each nucleoside of the 3’-region independently is a cEt nucleoside, a 2’-OMe nucleoside, or a
[0322] wherein the modified region consisting of 6-
[0323] wherein the modified sugar moiety, ‘k’ represents a cEt ‘y’ represents a 2’-OMe sugar
[0324] wherein each internucleoside from a phosphodiester
[0325] wherein the modified wherein s is a linkage.
[0326] RNA and / or AGT protein in a renin-angiotensin- system 15 mg to about 200 mg an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2;
[0327] wherein: the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and
[0328] wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF). 65 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0329] Embodiment 206. A method of treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0330] Embodiment 207. Use of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein:
[0331] the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides and wherein the modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2, or salt thereof to a subject having or at risk for heart failure; and
[0332] wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0333] Embodiment 208. Use of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein:
[0334] the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at 66 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and
[0335] the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
[0336] Embodiment 209. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0337] Embodiment 210. Use of 60 mg to 120 mg of an oligomeric agent or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
[0338] A. Angiotensinogen (AGT)
[0339] Angiotensinogen (AGT) has been proposed as a genetic target for treating hypertension and cardiovascular disorders because chronic overactivity of the renin-angiotensin-aldosterone system (RAAS) pathway is a major contributor to the pathogenesis of cardiovascular disorders, including 67 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application hypertension, chronic kidney disease and heart failure. A representative nucleobase sequence for a human AGT gene (encoding human AGT RNA, wherein angiotensinogen protein is the expression product) is the complement of the nucleotides of GenBank Accession No. NC_000001.11 truncated from nucleotides 230700001 to 230718000 (designated herein as SEQ ID NO: 2). A representative nucleobase sequence for a human AGT RNA is GENBANK Accession No. NM_000029.3 (designated herein as SEQ ID NO: 1). The systemic RAAS cascade begins with renin-mediated cleavage of angiotensinogen (AGT), whose plasma levels are primarily liver derived, to generate angiotensin I, which is converted to the potent vasoactive peptide angiotensin II (Ang II), which mediates vasoconstriction of vascular smooth muscle cells and aldosterone release from the adrenal cortex. The RAAS pathway acts as a key regulator of acute hemodynamic changes in the body and is responsive to decreases in cardiac output that occur during heart failure, but persistent overactivation results in excessive vasoconstriction, salt and water retention, cardiac remodeling and hypertrophy, and fibrosis. Thus, inhibition of the most proximal prohormone in the RAAS pathway is proposed to mitigate effects of RAAS overactivity.
[0340] For instance, methods have been described of treating hypertension by administering antisense oligonucleotides, for example, compound 757456 (also referred to as IONIS-AGT-LRX), which targets human AGT (see, e.g., WO2017 / 062816). Several clinical trials of compound 757456 have been conducted to evaluate safety, efficacy in reducing AGT levels, and lowering blood pressure in hypertensive subjects (see, e.g., Morgan et al. (2021) J Am Coll Cardiol Basic Science 6(6):485-496). A phase 1 (NCT03101878) and three phase 2 trials of compound 757456 were conducted to evaluate treatment of subjects having controlled hypertension with the compound as a monotherapy (NCT03714776) and treatment of subjects having uncontrolled hypertension with the compound as an add-on therapy to 2-3 antihypertensive medications (NCT04083222) or 3 or more antihypertensive medications (NCT04714320). Results of all four studies of compound 757456 demonstrated safety and tolerability of the compound at single doses up to 80 mg and weekly doses at 80 mg or 120 mg. Results indicated a higher reduction in systolic and diastolic blood pressure (as compared to placebo) that was clinically meaningful (> 5 mmHg) though not statistically significant in studies. The maximum mean reduction in plasma AGT in these trials was 67% as compared to baseline. Another phase 2 trial was conducted to evaluate compound 757456 safety, tolerability and effect of weekly subcutaneous (SC) injection of compound 757456 on plasma AGT concentration in subjects with chronic heart failure with reduced ejection fraction (HFrEF) receiving standard of care therapy (e.g., an ACEi, ARB or sacubitril / valsartan, or a beta-blocker or an MRA) 68 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (see Example 1B). No hypotension, hepatic, renal or potassium safety signals were observed in this study, and dose-dependent reductions in plasma AGT were observed in all treated subjects. No significant change in NT-proBNP levels in treatment groups was observed compared to the placebo group, though the study was not powered for significance to detect changes in NT-proBNP. Similar to earlier studies, reduction in plasma AGT was 63% as compared to baseline, and no significant change in blood pressure was observed, though the study was not powered to detect changes in blood pressure.
[0341] Additionally, methods of treating hypertension by administering siRNAs which target human AGT have been proposed, including, e.g., zilebesiran (also referred to as ALN-AGT01), see, e.g., WO2019 / 222166; Ranasinghe et al. (2022) J Am Heart Assoc.11(20); e027694 (Ranasinghe et al. (2022). It has been postulated that essentially complete depletion of AGT by siRNA therapy could prevent RAAS escape (such as occurs with a compensatory increase in renin levels due to decreased blood pressure and loss of negative feedback mediated by Ang II when standard RAAS inhibitors, e.g., ACEi and ARB, are used), yielding more effective RAAS inhibition and long-term blood pressure control (see, e.g., Ren et al. (2020) Curr Opin Nephrol Hypertens 29(2):180-189). It has also been suggested that a major advantage of RNAi-based therapeutic applications over antisense oligonucleotide (ASO)-based therapies is a purported relatively more potent and longer inhibitory effect of RNAi-based therapeutics (see, e.g., Ren et al. (2020) Curr Opin Nephrol Hypertens 29(2):180-189). A report of a phase 1 study of zilebesiran involving subjects with hypertension describes decreases in serum AGT levels and blood pressure after single subcutaneous doses (up to 800 mg) of the compound were sustained for up to 4 weeks (See Desai et al. (2023) N Eng J Med 389(3):228-238 (Desai et al. (2023)). Mean decreases in AGT levels of more than 90% (zilebesiran doses of 100 mg or more) sustained from week 3 through week 12, or through week 24 (800 mg zilebesiran) were observed. Hypotension, hyperkalemia, or worsening of renal function resulting in medical intervention was not reported; however, the study was not large enough or of sufficient duration to assess uncommon serious events (enrollment was restricted to younger persons with stage 1-2 hypertension who did not have serious co-existing medical conditions). Blood pressure changes after zilebesiran treatment could be reversed through high dietary salt intake and were augmented by coadministration of an ARB (irbesartan). It has been noted that recovery of zilebesiran-associated decreases in blood pressure after exposure to high dietary salt intake suggests that development of hypotension during zilebesiran treatment could be partially reversed by raising salt intake as an adjunct to standard interventions, including volume resuscitation and pressor 69 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application support (Desai et al. (2023)). Ranasinghe et al. (2022) also note that results suggest that oral sodium (or if severe, intravenous, alongside vasopressors) could be used clinically where hypotension and hypovolemia must be reversed. Based on the potential for clinical need to reverse effects of AGT- targeting siRNA, strategies to overcome the blood pressure-lowering effects of these agents have been examined in spontaneously hypertensive rats: AGT-targeting siRNA caused a near complete depletion of AGT (by 99.2±0.1%) and a reduction in mean arterial pressure by 19mm Hg, similar to results observed with zilebesiran (800 mg) in the phase 1 trial; and effects could be reversed by continuous infusion of intravenous vasopressors (Ang II or norepinephrine) ((Uijl et al. (2022) J Am Heart Assoc 11(15); e026426); Ranasinghe et al. (2022)).
[0342] Additional antisense oligonucleotides, including compound 1205407, have been described previously wherein compound 1205407 (also known as ION904) was identified to be more potent than earlier identified compounds. (see WO2022 / 109139). As described herein, studies of ION904 in healthy subject and in subjects with uncontrolled hypertension maintaining their existing antihypertension medication regimen demonstrated that it is well tolerated with no drug related SAEs, no AE signals, no clinically meaningful changes in laboratory assessments, no hypotensive events, no acute renal changes or changes in renal function, no clinically relevant hyperkalemia, and no thrombocytopenia; and while reduction in plasma AGT protein level was significantly greater than reported for compound 757456, and achieved up to 86% reduction as compared to baseline, insignificant reduction in systolic blood pressure was observed in the treatment groups compared to placebo. (see Examples 3 and 4). Without being bound by theory, it is believed compositions and methods provided herein sufficiently reduce the amount or level of AGT RNA and / or AGT protein in a subject having or at risk for heart failure to provide a therapeutic benefit but with limited effect on blood pressure (and other cardiovascular / renal parameters affected by the RAAS), thereby markedly reducing risk of adverse events or side effects associated with other RAAS inhibitors.
[0343] Thus, provided herein, are compositions and methods for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure and for treating, or ameliorating at least one symptom of heart failure in, a subject having or at risk for heart failure. In certain embodiments, the heart failure is HFrEF. In certain embodiments, compositions and methods are provided for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure (e.g., HFrEF) and for treating a subject having or at risk for heart failure (e.g., HFrEF) wherein the subject is, or is at risk of being, susceptible to adverse side effects of existing RAAS inhibitor therapies, including, but not limited to, ACE inhibitors (ACEi), ARBs, ARNi, and MRAs. In certain embodiments, a subject is 70 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application unable to tolerate treatment with optimal, Guideline-recommended target doses or dosing regimens of RAAS inhibitors (e.g., ACEi, ARB, ARNi, MRA) for treatment of heart failure. In certain embodiments, a subject has hyperkalemia, renal dysfunction, renal insufficiency (including AKI and CKD), hypotension, and / or pulmonary disease. In certain embodiments, a subject has or is at risk of having angioedema, asthma or chronic obstructive pulmonary disease (COPD). In certain embodiments, compositions provided herein, and methods for reducing AGT RNA and / or AGT protein or for treating a subject having or at risk for heart failure, provide for at least a 70%, at least a 75%, at least an 80%, or at least an 85% decrease in the amount or level of AGT RNA and / or AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT plasma protein of the subject, or circulating level of AGT protein) compared to the level of AGT RNA and / or AGT protein prior to any treatment with the compositions and methods (i.e., baseline AGT RNA or AGT protein levels) wherein the maximum decrease in the amount of AGT RNA and / or AGT protein is less than 95%, or less 94%, or less than 93%, or less than 92%, or less than 91%, or less than of 90%, or less than 88%, or less than 86%, or less than 85%, compared to the amount or level of AGT RNA and / or AGT protein prior to any treatment with the compositions and methods (i.e., baseline level). In certain embodiments of the compositions and methods, the composition contains or consists essentially of, or the method for reducing AGT RNA and / or AGT protein, or for treating a subject having or at risk for heart failure (e.g., HFrEF) includes administration of, a single-stranded oligomeric agent (such as, for example, a single-stranded modified oligonucleotide, e.g., a single- stranded modified antisense oligonucleotide) having a nucleobase sequence complementary to a target region sequence in an AGT nucleic acid. In certain embodiments, the oligomeric agent is ION904. In certain embodiments, the amount of ION904 is within the range of about 60 mg to about 120 mg, about 75 mg to about 120 mg, about 80 mg to about 120 mg, or about 90 to about 100 mg. In certain embodiments, ION904 is administered once every 4 weeks or once a month. In certain embodiments, ION904 or a composition containing ION904 is administered for a period of about 1 month to about 12 months, or about 6 months to about 36 months, or about 12 months to about 60 months or more.
[0344] B. Oligomeric Agents
[0345] In certain embodiments of compositions and methods described herein, a composition contains, or a method includes administering to a cell or subject, an oligomeric agent comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional oligonucleotides, each of which may be modified 71 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or unmodified, hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached directly or indirectly to an oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. In certain embodiments, an oligomeric agent comprises or consists of a modified oligonucleotide comprising a nucleobase sequence that is complementary to an equal length target region of a target nucleic acid, such as an AGT target nucleic acid (e.g., a human AGT target nucleic acid). In certain embodiments, the AGT nucleic acid has the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0346] In certain embodiments, an oligomeric agent contains or consists of a modified oligonucleotide, such as, for example, an antisense oligonucleotide, containing a nucleobase sequence complementary to an AGT RNA, e.g., a human AGT RNA, such as a mature AGT mRNA or an AGT pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the modified oligonucleotide, is single-stranded. In certain embodiments, the modified oligonucleotide, is double-stranded. In certain embodiments, contacting a cell with an oligomeric agent containing a modified oligonucleotide, containing a nucleobase sequence that is complementary to an equal-length target region of SEQ ID NOs: 1 or 2 decreases the amount or level of AGT RNA in the cell, and in certain embodiments decreases the amount or level of AGT protein produced in the cell. In certain embodiments, the oligonucleotide is attached to a conjugate group, e.g., a conjugate group containing a cell-targeting moiety that interacts with or binds to a cell surface protein of a hepatic cell. In certain embodiments, the oligonucleotide is attached to a conjugate group containing one or more N-acetyl galactosamine (GalNAc) moieties. In certain embodiments, the oligomeric agent consists of an oligonucleotide attached to a conjugate group, e.g., a conjugate group containing one or more GalNAc moieties. In certain embodiments, the conjugate group is attached to a terminus of the oligonucleotide, e.g., the 5’ terminal nucleobase of the oligonucleotide. In certain embodiments, a modified oligonucleotide of the oligomeric agent is an antisense oligonucleotide. In certain embodiments, the oligomeric agent comprises or consists of an antisense oligonucleotide. In certain embodiments, the oligomeric agent comprises or consists of an antisense oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide attached to a conjugate group, e.g., a conjugate group containing one or more GalNAc moieties. In certain embodiments, the oligomeric agent comprises or consists of an antisense oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent comprises or consists of an antisense oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, the oligomeric agent 72 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application comprises or consists of an antisense oligonucleotide comprising a nucleobase sequence that is complementary to a target region of an AGT nucleic acid, and a sense oligonucleotide comprising a duplexing region that is complementary to the antisense oligonucleotide, or a region thereof. In certain embodiments, one or both of the antisense and sense oligonucleotides is / are modified. In certain embodiments, the antisense oligonucleotide and / or the sense oligonucleotide is attached to a conjugate group and / or a terminal group. Modified antisense and / or sense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified antisense and / or sense oligonucleotides are described herein. In certain embodiments, an oligomeric agent is an RNase H agent. In certain embodiments, an oligomeric agent is an RNAi agent.
[0347] In certain embodiments, the oligomeric agent containing a modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), containing a nucleobase sequence complementary to an equal length target region of an AGT target nucleic acid (e.g., a human AGT target nucleic acid, such as, for example, the AGT nucleic acid having the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80%, or at least 85% and less than 95% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the maximum decrease in the amount or level of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT protein) is less than 95%, or less than 94%, or less than 93%, or less than 92%, or less than 91%, or less than 90% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent. In certain embodiments, the amount or level of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT protein) decreases no more than 85%, or no more than 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent. In certain embodiments, the oligomeric agent, when 73 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 94% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 93% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 92% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 91% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the 74 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 90% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 89% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 75% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 80% but 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 85% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, or less than 89% compared to the baseline level 75 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligomeric agent, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by 70%-90%, 70%-89%, 70%-88%, 70%-87%, 70%-86%, 70%-85%, 70%-84%, 70%-83%, 70%-82%, 70%-81%, 70%-80%, 75%-90%, 75%-89%, 75%-88%, 75%-87%, 75%-86%, 75%-85%, 75%-84%, 75%-83%, 75%-82%, 75%-81%, 75%-80%, 76%-90%, 76%-89%, 76%-88%, 76%-87%, 76%-86%, 76%-85%, 76%-84%, 76%-83%, 76%-82%, 76%-81%, 76%-80%, 77%-90%, 77%-89%, 77%-88%, 77%-87%, 77%-86%, 77%-85%, 77%-84%, 77%-83%, 77%-82%, 77%-81%, 77%-80%, 78%-90%, 78%-89%, 78%-88%, 78%-87%, 78%-86%, 78%-85%, 78%-84%, 78%-83%, 78%-82%, 78%-81%, 78%-80%, 79%-90%, 79%-89%, 79%-88%, 79%-87%, 79%-86%, 79%-85%, 79%-84%, 79%-83%, 79%-82%, 79%-81%, 79%-80%, 80%-90%, 80%-89%, 80%-88%, 80%-87%, 80%-86%, 80%-85%, 80%-84%, 80%-83%, 80%-82%, 81%-90%, 81%-89%, 81%-88%, 81%-87%, 81%-86%, 81%-85%, 81%-84%, 81%-83%, 81%-82%, 82%-90%, 82%-89%, 82%-88%, 82%-87%, 82%-86%, 82%-85%, 82%-84%, 82%-83%, 83%-90%, 83%-89%, 83%-88%, 83%-87%, 83%-86%, 83%-85%, 83%-84%, 84%-90%, 84%-89%, 84%-88%, 84%-87%, 84%-86%, 84%-85%, 85%-90%, 85%-89%, 85%-88%, 85%-87%, 85-86%, 86%-90%, 86%-89%, 86%-88%, 86%-87%, 87%-90%, 87%-89%, 87%-88%, 88%-90%, or 88%- 89% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject.
[0348] In certain embodiments of compositions and methods described herein, a composition contains, or a method includes administering to a cell or subject, an oligomeric agent comprising or consisting of a modified oligonucleotide, containing a nucleobase sequence at least 80% complementary to an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, the oligomeric agent contains a conjugate group. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide, containing a nucleobase sequence at least 80% complementary to an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2 attached to a conjugate group. In certain embodiments, the conjugate group contains a cell-targeting moiety that interacts with or binds to a cell surface protein of a hepatic cell. In certain embodiments, the oligonucleotide is attached to a conjugate group containing one or more GalNAc moieties. In certain embodiments, the conjugate group is attached to a terminus of the oligonucleotide, e.g., the 5’ terminal nucleobase of the oligonucleotide. 76 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0349] In certain embodiments of compositions and methods described herein, a composition contains, or a method includes administering to a cell or subject, an oligomeric agent comprising or consisting of a modified oligonucleotide, having a nucleobase sequence of SEQ ID NO: 3. In certain embodiments, the oligomeric agent contains a conjugate group. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide, having a nucleobase sequence of SEQ ID NOs: 3, 4 or 5 attached to a conjugate group. In certain embodiments, the conjugate group contains a cell-targeting moiety that interacts with or binds to a cell surface protein of a hepatic cell. In certain embodiments, the oligonucleotide is attached to a conjugate group containing one or more GalNAc moieties. In certain embodiments, the conjugate group is attached to a terminus of the oligonucleotide, e.g., the 5’ terminal nucleobase of the oligonucleotide.
[0350] In certain embodiments of compositions and methods described herein, a composition contains or consists of, or a method includes administering to a cell or subject, a compound comprising or consisting of a modified oligonucleotide according to the following chemical notation (5’ to 3’): mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4); wherein, A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.
[0351] In certain embodiments of compositions and methods described herein, a composition contains or consists of, or a method includes administering to a cell or subject, ION904. In certain embodiments, ION904 is represented by the following chemical notation (5’ to 3’):
[0352] THA-C6-GalNAc3-mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 5); wherein, A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, 77 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and THA-C6-GalNAc3= .
[0353] In certain embodiments, ION904 is represented by the following chemical structure: 78 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application (SEQ ID NO: 5 having the nucleobase sequence of SEQ ID NO: 3) (Structure 1), or a salt thereof.
[0354] Under certain conditions, an oligomeric agent, e.g., ION904, acts as an acid. For example, although an oligomeric agent such as ION904 may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of the oligomeric agent, e.g., ION904, exist in equilibrium among such forms. For example, a phosphate linkage of ION904 in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, the term, “ION904,” is intended to include all such forms. Moreover, ION904 has several such linkages, each of which is in equilibrium. Thus, ION904 exists in solution in an ensemble of forms at multiple positions all at equilibrium. The term “ION904” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of ION904 followed by the term “or a salt thereof” expressly 79 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation. In certain instances, one or more specific cation is identified.
[0355] In certain embodiments, is in phosphate- embodiments,
[0356] In certain or more cations ION904 is a
[0357] In certain following(SEQ ID NO: 5 having the nucleobase sequence of SEQ ID NO: 3) (Structure 2).
[0358] C. Oligonucleotides 80 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0359] In certain embodiments, modified oligonucleotides useful in the methods and compositions a is the ator an sequence of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide comprises or consists of a nucleobase sequence that is 100% complementary to a nucleobase sequence of SEQ ID NOs: 1 or 2. In certain embodiments, a modified oligonucleotide comprises or consists of a nucleobase sequence that is 100% complementary to an equal length sequence of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide, has a nucleobase sequence comprising or consisting of any of SEQ ID NOs: 3, 4 or 5, with 0, 1 or 2 mismatches. In certain embodiments, a modified oligonucleotide, has a nucleobase sequence comprising or consisting of any of SEQ ID NOs: 3, 4 or 5.
[0362] In certain embodiments, the oligonucleotide (e.g., modified oligonucleotide) is complementary to a target region of an AGT nucleic acid over the entire length of the 81 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application oligonucleotide. In certain embodiments, a modified oligonucleotide) is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal length portion of the AGT nucleic acid. In certain embodiments, the modified oligonucleotide is at least 80% complementary to a region of the AGT nucleic acid over the entire length of the oligonucleotide and comprises a nucleobase sequence that is 100% or fully complementary to a target region of the AGT nucleic acid.
[0363] In certain embodiments, a targeting region nucleobase sequence of a modified oligonucleotide is from 6 to 20, 10 to 18, 14 to 18, 15 to 16, 16 to 17, 16 to 20, or 18 to 20 nucleosides in length. In certain embodiments, the targeting region nucleobase sequence comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleosides. In certain embodiments, the targeting region nucleobase sequence is 8, 9, 10, 11, 12, in In at of a 11 ofX 82 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, -0& -1& -2& -3& .*& .+& .,& .-& ..& . / & .0& .1& .2& .3& P]S / *5 _a^eXSTS cWPc Nl O( >^a TgP\_[T& X] certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
[0366] In certain embodiments, modified oligonucleotides consist of 16 linked nucleosides. In certain embodiments, oligonucleotides modified oligonucleotides consist of 14 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 15 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 22 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23 linked nucleosides. In certain embodiments, modified oligonucleotides have no more than 1 to 3 mismatches to a target nucleic acid. 83 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0367] In certain embodiments, modified oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14-23 linked nucleosides. In certain embodiments modified oligonucleotides consist of 14-20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14-18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14-17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14-16 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-23 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-22 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18-19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 22 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23 linked nucleosides.
[0368] In certain embodiments, a modified oligonucleotide contains one or more mismatches relative to the nucleobase sequence of the target AGT nucleic acid. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, antisense activity against the target nucleic acid is reduced by such a mismatch, and activity against a non-target nucleic acid is reduced. In certain embodiments, activity against the non-target nucleic acid is reduced by a greater amount than activity against the target nucleic acid. Thus, in certain embodiments selectivity of the antisense oligonucleotide is improved. In certain embodiments, the oligonucleotide, e.g., 84 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application antisense oligonucleotide, is at least 80% complementary to the target region of the AGT nucleic acid over the entire length of the oligonucleotide and comprises no more than one to three mismatches with the AGT nucleic acid. In certain embodiments, the oligonucleotide comprises a nucleobase sequence that is at least 80% complementary to a nucleobase sequence of the AGT nucleic acid over the entire length, and comprises no more than one to three mismatches with the target nucleic acid. In certain embodiments, the oligonucleotide, e.g., an antisense oligonucleotide, comprises a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a the AGT nucleic acid over the entire length of the nucleobase sequence. In certain embodiments, a mismatch is specifically positioned within an oligonucleotide, e.g., an antisense oligonucleotide. In certain embodiments, a mismatch is at position 3, 4, 5, 6, 7, 8, 9, 10, ++& ^a +, Ua^\ cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P \Xb\PcRW Xb Pc _^bXcX^] ++& +*& 3& 2& 1& 0& / & .& -& ^a , Ua^\ cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& +', additional mismatches may be present at a terminus or at both termini of the oligonucleotide. In RTacPX] T\Q^SX\T]cb& P \Xb\PcRW Xb Pc _^bXcX^] +& ,& -& ^a . Ua^\ cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P \Xb\PcRW Xb Pc _^bXcX^] .& -& ,& ^a + Ua^\ cWT -u'T]S ^U cWT oligonucleotide.
[0369] In certain embodiments, a modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), containing a nucleobase sequence complementary to an equal length target region of an AGT target nucleic acid (e.g., a human AGT target nucleic acid, such as, for example, the AGT nucleic acid having the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80%, or at least 85% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the maximum decrease in the amount or level of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT protein) is less than less than 95%, or less than 94%, or less than 93%, or less than 92%, or less than 91%, or less than 90% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the amount or level of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating 85 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application level of AGT protein) decreases no more than 85%, or no more than 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94%, or no more than 95%, compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single- stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 94% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 93% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 92% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 91% compared to the baseline level or amount of AGT RNA and / or AGT 86 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 90% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 89% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 75% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 80% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less 87 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application than 87%, less than 86%, or less than 85% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single-stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 85% but less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, or less than 89% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the oligonucleotide, e.g., modified oligonucleotide (such as, for example, a single- stranded modified oligonucleotide), when administered to a cell or subject, decreases the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by 70%- 90%, 70%-89%, 70%-88%, 70%-87%, 70%-86%, 70%-85%, 70%-84%, 70%-83%, 70%-82%, 70%-81%, 70%-80%, 75%-90%, 75%-89%, 75%-88%, 75%-87%, 75%-86%, 75%-85%, 75%-84%, 75%-83%, 75%-82%, 75%-81%, 75%-80%, 76%-90%, 76%-89%, 76%-88%, 76%-87%, 76%-86%, 76%-85%, 76%-84%, 76%-83%, 76%-82%, 76%-81%, 76%-80%, 77%-90%, 77%-89%, 77%-88%, 77%-87%, 77%-86%, 77%-85%, 77%-84%, 77%-83%, 77%-82%, 77%-81%, 77%-80%, 78%-90%, 78%-89%, 78%-88%, 78%-87%, 78%-86%, 78%-85%, 78%-84%, 78%-83%, 78%-82%, 78%-81%, 78%-80%, 79%-90%, 79%-89%, 79%-88%, 79%-87%, 79%-86%, 79%-85%, 79%-84%, 79%-83%, 79%-82%, 79%-81%, 79%-80%, 80%-90%, 80%-89%, 80%-88%, 80%-87%, 80%-86%, 80%-85%, 80%-84%, 80%-83%, 80%-82%, 81%-90%, 81%-89%, 81%-88%, 81%-87%, 81%-86%, 81%-85%, 81%-84%, 81%-83%, 81%-82%, 82%-90%, 82%-89%, 82%-88%, 82%-87%, 82%-86%, 82%-85%, 82%-84%, 82%-83%, 83%-90%, 83%-89%, 83%-88%, 83%-87%, 83%-86%, 83%-85%, 83%-84%, 84%-90%, 84%-89%, 84%-88%, 84%-87%, 84%-86%, 84%-85%, 85%-90%, 85%-89%, 85%-88%, 85%-87%, 85-86%, 86%-90%, 86%-89%, 86%-88%, 86%-87%, 87%-90%, 87%-89%, 87%-88%, 88%-90%, or 88%-89% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject.
[0370] In certain embodiments, a modified oligonucleotide contains a nucleobase sequence complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 or within nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide contains a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 88 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or within nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide contains a nucleobase sequence that is 100% complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 or within nucleobases 14940-14955 of SEQ ID NO: 2.
[0371] In certain embodiments, the nucleobase sequence of the oligonucleotide, e.g., modified oligonucleotide, containing a nucleobase sequence that is complementary to an equal length target region of an AGT target nucleic acid contains at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of a nucleobase sequence provided in Table 1. In certain embodiments, the nucleobase sequence of the oligonucleotide, e.g., modified oligonucleotide, containing a nucleobase sequence that is complementary to an equal length target region of an AGT target nucleic acid consists of a nucleobase sequence provided in Table 1.
[0372] Table 1: Examples of nucleobase sequences. SEQ ID NO: 1 SEQ ID NO: 2 NUCLEOBASE SEQ Start Site-Stop Start Site-Stop SEQUENCE ID NO: Site Site 2046-2061 14940-14955 CGCTGATTTGTCCGGG 3 2047-2062 14941-14956 TCGCTGATTTGTCCGG 6 2048-2063 14942-14957 ATCGCTGATTTGTCCG 7 2049-2064 14943-14958 CATCGCTGATTTGTCC 8 2050-2065 14944-14959 ACATCGCTGATTTGTC 9 2051-2066 14945-14960 CACATCGCTGATTTGT 10
[0373] D. Modified Oligonucleotides
[0374] In certain embodiments of compositions and methods described herein comprise an oligomeric agent comprising or consisting of a modified oligonucleotide targeting AGT. Modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described herein. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following 89 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application modified nucleobases, and internucleoside linkages comprising the following modifications, may be incorporated into modified oligonucleotides described herein.
[0375] 1. Modified Sugar Moieties
[0376] Modified sugar moieties include modified furanosyl sugar moieties, sugar surrogates (e.g., cyclic sugar surrogates, acyclic sugar surrogates), and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
[0377] In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the ,u& -u& .u& P]S)^a / u _^bXcX^]b( A] RTacPX] T\Q^SX\T]cb& cWT \^SXUXTS UdaP]^bh[ bdVPa \^XTch Xb P aXQ^bh[ sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety.
[0378] A] RTacPX] T\Q^SX\T]cb& ]^]'QXRhR[XR \^SXUXTS bdVPa \^XTcXTb PaT ,u'bdQbcXcdcTS bdVPa \^XTcXTb P]S R^\_aXbT P bdQbcXcdT]c Va^d_ Pc cWT ,u'_^bXcX^]( A] RTacPX] T\Q^SX\T]cb ^]T ^a \^aT ]^]' bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of substituent Va^d_b bdXcPQ[T U^a cWT ,u'_^bXcX^] ^U \^SXUXTS bdVPa \^XTcXTb X]R[dST Qdc PaT ]^c [X\XcTS c^4 ,u'>& ,u' OCH3$nECTo ^a nE'\TcWh[o%& P]S ,u'E$;@2)2OCH3(“MOE” or “O-methoxyethyl”). In certain T\Q^SX\T]cb& ,u'bdQbcXcdT]c Va^d_b PaT bT[TRcTS Ua^\4 WP[^& P[[h[& P\X]^& PiXS^& I@& ;D& E;D& ;>3, OCF3, C1-C10 alkoxy, C1-C10 substituted alkoxy, C1-C10 alkyl, C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O- alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, O(CH2)2ON(CH3)2 (“DMAOE”), ^a ,u'E$;@2)2O(CH2)2N(CH3)2$n<C9=E=o%( Ih]cWTcXR \TcW^Sb U^a b^\T ^U cWTbT ,u'bdQbcXcdT]c groups may be found, e.g., in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al.& K(I( 0&** / &*21( ;TacPX] T\Q^SX\T]cb ^U cWTbT ,u'bdQbcXcdT]c Va^d_b \Ph QT UdacWTa bdQbcXcdcTS with one or more substituent groups independently selected from: halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, heterocyclyl, C1-C6 alkylene-NH2, C1-C6alkylene-NHRa2, C1-C6 alkylene-N(Ra2)2, 90 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(C1-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4 alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4 alkyl)S(O)2Ra3; each Ra2is independently selected from C2-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3- C10cycloalkyl, C6-C10aryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, OH, C1- C6 alkyl, C1-C6 haloalkyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, or heterocyclyl. In certain T\Q^SX\T]cb& P bdVPa \^XTch R^\_aXbTb cf^ ^U cWT PQ^eT bdQbcXcdT]cb Pc cWT ,u'_^bXcX^]( A] RTacPX] T\Q^SX\T]cb& P bdVPa \^XTch R^\_aXbTb P ,u'U[d^a^ P]S P bTR^]S ,u'bdQbcXcdT]c( A] RTacPX] T\Q^SX\T]cb& P ,u'bdQbcXcdcTS bdVPa \^XTch R^\_aXbTb P ]^]'QaXSVX]V ,u'bdQbcXcdT]c Va^d_ bT[TRcTS from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 P[Zh[( A] RTacPX] T\Q^SX\T]cb& P ,u'bdQbcXcdcTS bdVPa \^XTch R^\_aXbTb P ]^]'QaXSVX]V ,u'bdQbcXcdT]c Va^d_ bT[TRcTS Ua^\4 >& E;>3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”). In certain T\Q^SX\T]cb& P ,u'bdQbcXcdcTS bdVPa \^XTch R^\_aXbTb P ,u'bdQbcXcdT]c Va^d_ bT[TRcTS Ua^\4 >& E;@3, and OCH2CH2OCH3.
[0379] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, P ,u'ST^ghUdaP]^bh[ bdVPa \^XTch $i.e.& ,u'$@%@ UdaP]^bh[ bdVPa \^XTch% \Ph QT X] bTeT] Xb^\TaXR R^]UXVdaPcX^]b ^cWTa cWP] cWT ]PcdaP[[h ^RRdaaX]V w'<'ST^ghaXQ^bh[ R^]UXVdaPcX^]( IdRW \^SXUXTS sugar moieties are described in, e.g.& ME ,*,*)*1,33+& X]R^a_^aPcTS Qh aTUTaT]RT WTaTX]( 9 ,u' \^SXUXTS bdVPa \^XTch WPb P] PSSXcX^]P[ bcTaT^RT]cTa Pc cWT ,u'_^bXcX^] aT[PcXeT c^ P ,u'ST^ghUdaP]^bh[ sible stereochemical X] cWT w'<'aXQ^bh[ a substituent group at SXUXTS bdVPa \^XTcXTb in Manoharan et al.,Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0381] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at cWT -u'_^bXcX^]( =gP\_[Tb ^U bdQbcXcdT]c Va^d_b bdXcPQ[T U^a cWT -u'_^bXcX^] ^U \^SXUXTS bdVPa \^XTcXTb include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
[0382] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at cWT / u'_^bXcX^]( =gP\_[Tb ^U bdQbcXcdT]c Va^d_b bdXcPQ[T U^a cWT / u'_^bXcX^] ^U \^SXUXTS bdVPa \^XTcXTb include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkynyl, allyl, and alkyl (e.g., methyl (R or S), ethyl (R or S)).
[0383] In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non- QaXSVX]V bdVPa bdQbcXcdT]c& U^a TgP\_[T& ,u'>' / u'\TcWh[ bdVPa \^XTcXTb& bdRW Pb STbRaXQTS X] CXVPfP et al.& KI ,*+*)*+3*2-1& fWXRW Xb X]R^a_^aPcTS WTaTX] Qh aTUTaT]RT& ^a P[cTa]PcXeT ,u' P]S / u'\^SXUXTS sugar moieties as described in Rajeev et al., US 2013 / 0203836, which is incorporated herein by reference.
[0384] Certain modified sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic bdVPa \^XTch R^\_aXbTb P QaXSVT QTcfTT] cWT .u P]S cWT ,u UdaP]^bT aX]V Pc^\b( =gP\_[Tb ^U bdRW .u c^ ,u QaXSVX]V bdVPa bdQbcXcdT]cb X]R[dST& Qdc PaT ]^c [X\XcTS c^4.u';@2',u& .u'$;@2)2',u& .u'$;@2)3',u& .u';@2'E',u $nBD9o%& .u';@2'I',u& .u'$;@2)2'E',u $n=D9o%& .u';@$;@3%'E',u $aTUTaaTS c^ Pb “constrained ethyl” or “cEt” when in the S R^]UXVdaPcX^]%& .u';@2-O-CH2',u& .u';@2'D$H%',u& .u' CH(CH2OCH3%'E',u $nR^]bcaPX]TS CE=o ^a nRCE=o% P]S P]P[^Vb cWTaT^U& .u';$;@3)(CH3%'E',u P]S P]P[^Vb cWTaT^U& .u';@2-N(OCH3%',u P]S P]P[^Vb cWTaT^U& .u';@2-O-N(CH3%',u& .u';@2- C(H)(CH3%',u& .u';@2-C(=CH2%',u P]S P]P[^Vb cWTaT^U& .u';$HaRb%'D$H%'E',u& .u';$HaRb)-O-N(R)- ,u& .u';@2'E'D$H%',u& P]S .u';@2'D$H%'E',u& fWTaTX] TPRW H& Ha, and Rb is, independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S. 7,741,457; Swayze et al., U.S. 8,022,193; Seth et al., U.S. 8,278,283; Prakash et al., U.S. 8,278,425; and Seth et al., U.S.8,278,426, each of which are incorporated herein by reference.
[0385] A] RTacPX] T\Q^SX\T]cb& bdRW .u c^ ,u QaXSVTb X]ST_T]ST]c[h R^\_aXbT Ua^\ + c^ . [X]ZTS groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, - C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; wherein x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1- C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-10aryl, heteroaryl, heterocyclyl, C1-C6 alkylene-NH2, C1-C6 alkylene-NHRa2, C1-C6 alkylene-N(Ra2)2, C(O)Ra3, 92 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application C(O)ORa3, C(O)NHRa3, C(O)N(C1-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4 alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4 alkyl)S(O)2Ra3; each Ra2is independently selected from C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6- C10aryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, OH, C1-C6alkyl, C1-C6haloalkyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, or heterocyclyl.
[0386] A] RTacPX] T\Q^SX\T]cb& cWT QXRhR[XR bdVPa \^XTch R^\_aXbTb P QaXSVT QTcfTT] cWT / u P]S cWT -u UdaP]^bT aX]V Pc^\b( =gP\_[Tb ^U bdRW / u c^ -u QaXSVX]V bdVPa bdQbcXcdT]cb X]R[dST& Qdc PaT ]^c [X\XcTS c^& / u'$;@2)2'-u $QR<D9%& / u'$;@2)3'-u $QR4,3<D9%& / u';$>%7;@';@2'-u& P]S / u';@2-CHQ- -u& fWTaTX] G Xb P] PccPRW\T]c c^ P] X]cTa]dR[T^bXST [X]ZPVT( 9SSXcX^]P[ QXRhR[XR bdVPa \^XTcXTb PaT known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S.8,080,644; Ramasamy et al., U.S.6,525,191; Seth et al., U.S.7,547,684; and Seth et al., U.S. 7,666,854, which are each incorporated herein by reference. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by bcTaT^RWT\XRP[ R^]UXVdaPcX^]( >^a TgP\_[T& P] BD9 ]dR[T^bXST $STbRaXQTS WTaTX]% \Ph QT X] cWT t'B R^]UXVdaPcX^] ^a X] cWT w'< R^]UXVdaPcX^]( t'B'\TcWh[T]T^gh $.u';@2'E',u% ^a t'B'BD9 QXRhR[XR nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Res.2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown, in certain studies, to increase siRNA stability in serum, and to reduce off-target effects (Elmén, J. et al. Nucleic Acids Res.2005, 33(1), 439-447; Mook, O. R. et al. Mol. Canc. Ther.2007, 6(3), 833- 843; Grunweller, A. et al. Nucleic Acids Res.2003, 31(12), 3185-3193). Herein, general descriptions of bicyclic nucleosides include both stereochemical configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in cWT w'< bcTaT^RWT\XRP[ R^]UXVdaPcX^]& d][Tbb ^cWTafXbT b_TRXUXTS(
[0387] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g.& / u'bdQbcXcdcTS P]S .u',u QaXSVTS bdVPab%(
[0388] In certain embodiments, modified sugar moieties are sugar surrogates, selected from cyclic sugar surrogates and acyclic sugar surrogates.
[0389] In certain embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom (X is S, C(R1R2), or N(R3)). In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For TgP\_[T& RTacPX] bdVPa bdaa^VPcTb R^\_aXbT P .u'bd[Uda Pc^\ P]S P bdQbcXcdcX^] Pc cWT ,u'_^bXcX^] P]S)^a cWT / u _^bXcX^]( 93 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0390] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”), where X is O-C(R1R2), p is 1, Q is CH, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (G1=OH; G2=H; “ANA”), and fluoro HNA “FHNA”, see e.g., Egli, M. et al. J. Am. Chem. Soc.2011, 133(41), 16642- 16649; Swayze et al., U.S.8,088,904; and Swayze et al., U.S.8,440,803); FHNA can also be referred c^ Pb P >'J@F ^a -u'U[d^a^ cTcaPWhSa^_haP] ^a -u'>@D9% & fWXRW PaT TPRW X]R^a_^aPcTS WTaTX] Qh reference.
[0391] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having Formula Ia, above, wherein X is O, Y and Z are each CH2, and Q is N. In certain embodiments, a morpholino is modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
[0392] In certain embodiments, sugar surrogates are acyclic sugar surrogates In certain embodiments, acyclic sugar surrogates are the “unlocked” sugar structure of UNA (“unlocked nucleic acid”) nucleosides. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020. In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (“glycol nucleic acid”) nucleosides. Further acyclic sugar surrogates include those described in Manoharan et al., U.S. 10,913,767; US patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940.
[0393] In certain embodiments, modified oligonucleotides include one or more sugar mimic, in which a group of atoms other than a “furanosyl sugar moiety” or a “sugar surrogate” form the portion of a ]dR[T^bXST R^aaTb_^]SX]V c^ cWT w'<'aXQ^bh[ bdVPa X] HD9( A] RTacPX] T\Q^SX\T]cb& P bdVPa \X\XR Xb a portion of the backbone of a peptide nucleic acid, while the remainder of the backbone of the peptide nucleic acid is an internucleoside linkage. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.
[0394] 2. Modified Nucleobases
[0395] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise 94 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides contain no abasic nucleosides. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases, e.g., inosine (I).
[0396] In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2- aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6- N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CºC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8- substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5- halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7- deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N- benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed. 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. 95 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0397] Preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases are known in the art and can be readily identified in publications that include without limitation, Rogers et al., U.S. 5,134,066 ; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,502,177 ; Froehler et al., U.S.5,594,121 ; and Cook et al., U.S.5,681,941.
[0398] In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, andmC. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U,mC, or hypoxanthine. In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.
[0399] 3. Modified Internucleoside Linkages
[0400] In In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified internucleoside linkage. The naturally ^RRdaaX]V X]cTa]dR[T^bXST [X]ZPVT ^U HD9 P]S <D9 Xb P -u c^ / u _W^b_W^SXTbcTa [X]ZPVT( @TaTX]& P[[ X]cTa]dR[T^bXST [X]ZPVTb QTcfTT] UdaP]^bh[ bdVPa \^XTcXTb PaT -u c^ / u X]cTa]dR[T^bXST [X]ZPVTb d][Tbb otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides are linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS- P=S”). Representative non-phosphorus containing internucleoside linkages include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O- C(=O)(NH)-S-), siloxane (-O-SiH2'E'%& P]S D&Du'SX\TcWh[WhSaPiX]T $';@2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester linkages, may be used to alter, typically increase, nuclease resistance of the oligonucleotide.
[0401] In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778, incorporated by reference herein. Certain internucleoside linkages having reduced charge (referred to as “neutral internucleoside linkages”) have been described. Such neutral X]cTa]dR[T^bXST [X]ZPVTb X]R[dST& fXcW^dc [X\XcPcX^]& _W^b_W^caXTbcTab& \TcWh[_W^b_W^]PcTb& CCA $-u' CH2-N(CH3%'E' / u%& P\XST'- $-u';@2';$7E%'D$@%' / u%& P\XST'. $-u';@2'D$@%';$7E%' / u%& U^a\PRTcP[ 96 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application $-u'E';@2'E' / u%& \TcW^gh_a^_h[ $CEF% $bTT KI 3&3,0& / / 0%& P]S cWX^U^a\PRTcP[ $-#'I';@2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
[0402] In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, internucleoside [X]ZPVTb PaT ]^c -u'c^' / u X]cTa]dR[T^bXST [X]ZPVTb(
[0403] In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide. In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside may be attached to either or both ends of an oligonucleotide.
[0404] A] RTacPX] T\Q^SX\T]cb& ]dR[T^bXSTb PaT [X]ZTS ,u c^ / u aPcWTa cWP] cWT -u c^ / u [X]ZPVT(
[0405] In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non- furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’.
[0406] In certain embodiments, internucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates.
[0407] D. Motifs
[0408] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In certain embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. 97 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the nucleobase sequence).
[0409] 1. Sugar Motifs
[0410] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, a sugar motif includes but is not limited to any of the sugar modifications discussed herein. In certain embodiments, the sugar moiety of at least one nucleoside of a modified oligonucleotide is a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. A] RTacPX] T\Q^SX\T]cb& TPRW ]dR[T^bXST ^U P d]XU^a\[h \^SXUXTS ^[XV^]dR[T^cXST Xb P ,u'bdQbcXcdcTS ]dR[T^bXST R^\_aXbX]V cWT bP\T ,u'bdQbcXcdT]c( A] RTacPX] T\Q^SX\T]cb& TeTah ^cWTa ]dR[T^bXST ^U P Ud[[h \^SXUXTS ^[XV^]dR[T^cXST R^\_aXbTb cWT bP\T ,u'bdQbcXcdcT]c& aTbd[cX]V X] P[cTa]PcX]V ,u' substituents. In certain embodiments, at least one nucleoside of a modified oligonucleotide comprises P ,u'ECT bdVPa \^XTch $i.e.& Xb P ,u'ECT \^SXUXTS ]dR[T^bXST%( A] RTacPX] T\Q^SX\T]cb& Pc [TPbc ^]T ]dR[T^bXST ^U P \^SXUXTS ^[XV^]dR[T^cXST R^\_aXbTb P ,u'> bdVPa \^XTch $i.e.& Xb P ,u'> \^SXUXTS nucleoside). In certain embodiments, at least one nucleoside of a modified oligonucleotide comprises a cEt sugar moiety In certain embodiments, a sugar moiety of an antisense oligonucleotide is modified, fWTaTX] cWT \^SXUXTS ]dR[T^bXST R^\_aXbTb P bdVPa \^XTch bT[TRcTS Ua^\ ,u'>& ,u'CE=& ,u'ECT& ,u' DC9& ,u'ST^gh& R=c& P]S >@D9(
[0411] A] RTacPX] T\Q^SX\T]cb& Pc [TPbc ^]T ]dR[T^bXST ^U P \^SXUXTS ^[XV^]dR[T^cXST R^\_aXbTb P ,u' deoxy sugar moiety. In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In 98 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application certain embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain T\Q^SX\T]cb& TPRW ]dR[T^bXST ^U cWT ST^gh aTVX^] Xb P ,u'w'<'ST^gh]dR[T^bXST( A] RTacPX] T\Q^SX\T]cb& cWT ST^gh aTVX^] Xb U[P]ZTS ^] cWT / u'bXST Qh P / u'aTVX^] R^]bXbcX]V ^U [X]ZTS / u'aTVX^] ]dR[T^bXSTb P]S ^] cWT -u'bXST Qh P -u'aTVX^] R^]bXbcX]V ^U [X]ZTS -u'aTVX^] ]dR[T^bXSTb5 fWTaTX] cWT -u'\^bc ]dR[T^bXST ^U cWT / u'aTVX^] R^\_aXbTb P \^SXUXTS bdVPa \^XTch P]S cWT / u'\^bc ]dR[T^bXST ^U cWT -u'aTVX^] Xb R^\_aXbTb P \^SXUXTS bdVPa \^XTch( A] RTacPX] T\Q^SX\T]cb& cWT bdVPa \^XTch ^U cWT -u'\^bc ]dR[T^bXST ^U cWT / u'aTVX^] P]S cWT bdVPa \^XTch ^U cWT / u'\^bc ]dR[T^bXST ^U cWT -u'aTVX^] each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus STUX]X]V cWT Q^d]SPah QTcfTT] cWT / u'aTVX^]& cWT ST^gh aTVX^]& P]S cWT -u'aTVX^]( A] RTacPX] T\Q^SX\T]cb& TPRW ]dR[T^bXST ^U cWT / u'aTVX^] P]S TPRW ]dR[T^bXST ^U cWT -u'aTVX^] R^\_aXbTb P modified sugar moiety.
[0412] A] RTacPX] T\Q^SX\T]cb& \^SXUXTS ^[XV^]dR[T^cXSTb WPeT P bdVPa \^cXU Ua^\ / u c^ -u4 TTZSSSSSSSSSSZZT5 fWTaTX] TPRW nSo aT_aTbT]cb P ,u'w'<'ST^ghaXQ^bh[ bdVPa \^XTch& TPRW nZo aT_aTbT]cb P R=c bdVPa \^XTch P]S TPRW nTo aT_aTbT]cb P ,u'CE= bdVPa \^XTch(
[0413] 2. Nucleobase Motifs
[0414] In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, at least one purine and / or at least pyrimidine is modified. In certain embodiments, at least one adenine is modified. In certain embodiments, at least one guanine is modified. In certain embodiments, at least one thymine is modified. In certain embodiments, at least one uracil is modified. In certain embodiments, at least one cytosine is modified. In certain embodiments, at least one of the cytosine nucleobases in a modified oligonucleotide is 5- methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, one or two of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0415] 3. Internucleoside Linkage Motifs
[0416] In certain embodiments, oligonucleotides comprise modified and unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate 99 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a mesyl phosphoramidate internucleoside linkage, and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a mesyl phosphoramidate internucleoside linkage and a phosphorothioate internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, each mesyl phosphoramidate internucleoside linkage is independently selected from a stereorandom mesyl phosphoramidate, a (Sp) mesyl phosphoramidate, and a (Rp) mesyl phosphoramidate. In certain embodiments an antisense oligonucleotide has an X]cTa]dR[T^bXST [X]ZPVT \^cXU $Ua^\ / u c^ -u% ^U4 b^^bbbbbbbbbb^b& fWTaTX] TPRW p^q aT_aTbT]cb P phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.
[0417] In certain embodiments, a modified oligonucleotide is characterized by sequence, modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, internucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the internucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the internucleoside linkages or internucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence. Furthermore, each modification, whether internucleoside linkage, modified sugar moiety, or modified nucleobase, of a modified oligonucleotide, e.g., a modified antisense oligonucleotide, is independent of each modification of a paired oligonucleotide, e.g., sense oligonucleotide, unless specifically indicated otherwise.
[0418] E. Antisense Oligonucleotides 100 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0419] In certain embodiments, an oligomeric agent comprises a modified oligonucleotide that is an antisense oligonucleotide, e.g., modified antisense oligonucleotide; wherein such oligomeric agent is an antisense agent. In certain embodiments, an oligomeric agent comprises a modified single- stranded antisense oligonucleotide. In certain embodiments, the oligomeric agent is an RNase H agent. In certain embodiments, a single-stranded oligonucleotide, e.g., modified oligonucleotide, comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleosides complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 or within nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, the single-stranded oligonucleotide, e.g., modified oligonucleotide, consists of 16 to 25, 16 to 23, 16 to 20, 16 to 18, 16 to 17, or 16 linked nucleosides, wherein at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleosides complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 or within nucleobases 14940-14955 of SEQ ID NO: 2.
[0420] In certain embodiments, an oligomeric agent comprising a modified oligonucleotide, e.g., modified antisense oligonucleotide is a duplex wherein a modified antisense oligonucleotide is paired with a second oligonucleotide, e.g., a second modified oligonucleotide, to form an oligomeric duplex. In certain embodiments, an oligomeric duplex comprises a first modified oligonucleotide comprising at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleosides complementary to an equal length region within nucleobases 2046-2061 of SEQ ID NO: 1 or within nucleobases 14940- 14955 of SEQ ID NO: 2. In certain embodiments, an oligomeric duplex comprises a first modified oligonucleotide comprising modified oligonucleotide consisting of 16 to 25, 16 to 23, 16 to 20, 16 to 18, 16 to 17, or 16 linked nucleosides, wherein at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleosides complementary to an equal length region within nucleobases 2046- 2061 of SEQ ID NO: 1 or within nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, an oligomeric agent comprises an oligomeric duplex, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide (e.g., an antisense oligonucleotide), (2) a second oligonucleotide (e.g., a sense oligonucleotide), and (3) optionally a terminal group and / or a conjugate group. Either or both oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both oligonucleotides of an oligomeric duplex may comprise a terminal group. Each oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging nucleosides. In certain embodiments, the nucleobase of the non-complementary or unpaired overhanging nucleosides is adenine or thymine. In certain embodiments, the two oligonucleotides have at least one mismatch relative to one another. In certain embodiments, a first modified 101 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application oligonucleotide of an oligomeric duplex is an antisense oligonucleotide and a second oligonucleotide of the oligomeric duplex is a sense oligonucleotide and the oligomeric duplex is an antisense agent. In certain embodiments, the antisense activity of the oligomeric duplex involves loading of the antisense oligonucleotide into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense agents that comprise an antisense oligonucleotide that is loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In certain embodiments, RNAi agents are capable of RISC-mediated modulation of a target nucleic acid in a cell.
[0421] F. Antisense Activity
[0422] Antisense activities may be observed directly or indirectly. In certain embodiments, antisense activity involves a decrease in an amount or level of AGT RNA and / or AGT protein (e.g., human AGT RNA and / or human AGT protein) in a cell or subject. Methods for detecting a change in an amount or level of AGT RNA and / or AGT protein in a cell or subject include, for example, measuring the amount of AGT RNA and / or AGT protein in a cell or in a sample from a subject (e.g., blood, plasma, or serum) at different times or under different conditions and comparing the amounts, which, if different, indicates a change in the amount or level or AGT RNA and / or AGT protein. For example, the amount or level of AGT RNA and / or AGT protein in a cell or a sample from a subject may be measured before administering an oligomeric agent described herein, e.g., ION904 (e.g., baseline amount or level of AGT RNA and / or AGT protein), and the amount compared to the level or amount of AGT RNA and / or AGT protein measured after administering an oligomeric agent described herein, e.g., ION904. Methods of measuring AGT RNA and AGT protein are known in the art and / or described herein (see, e.g., International Application PCT / US2021 / 059896 publication WO2022 / 109139). For example, AGT RNA (e.g., human AGT RNA) can be measured by extracting RNA from cells or tissues and performing real-time PCR analysis using a primer probe set (e.g., human AGT primer probe) One such human AGT primer probe set is RTS3721 (forward sequence CCCTGATGGGAGCCAGTGT, designated herein as SEQ ID NO: 11; reverse sequence AGCAGGGAGAAGCCCTTCA, designated herein as SEQ ID NO: 12; and probe sequence CCCTGGCTTTCAACACCTACGTCCACTX, where X is a fluorescent label, designated herein as SEQ ID NO: 13). Results can be normalized to total RNA content, for example, measure by RIBOGREEN®and / or to GAPDH (e.g., human GAPDH) using PCR. AGT protein (e.g., human AGT protein) in a sample, e.g., plasma, can be measured, e.g., using an ELISA method. For example, 102 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application ELISA kits are available for performing ELISA measurements (Human Total Angiotensinogen Assay Kit, IBL (Immuno-Biological Laboratories Co., Ltd.), Cat #27412) according to the manufacturer’s instructions.
[0423] G. Conjugate and Terminal Groups
[0424] In certain embodiments, provided herein are oligomeric compounds comprising one or more modified oligonucleotide and one or more conjugate groups. In certain embodiments, an oligomeric compound optionally further comprises one or more terminal groups. Conjugate groups comprise or R^]bXbc ^U P R^]YdVPcT \^XTch P]S P R^]YdVPcT [X]ZTa( 9 R^]YdVPcT Va^d_ \Ph QT PccPRWTS Pc cWT -u T]S P]S)^a cWT / u T]S ^U P] ^[XV^]dR[T^cXST P]S)^a Pc P]h X]cTa]P[ _^bXcX^]( A] RTacPX] T\Q^SX\T]cb& conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric compounds comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker.
[0425] 1. Conjugate Groups
[0426] In certain embodiments, a conjugate group comprises a conjugate moiety and a conjugate linker.
[0427] a. Conjugate Moieties
[0428] In certain embodiments, a conjugate moiety modifies one or more properties of an attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, a conjugate moiety imparts a new property on the attached oligonucleotide.
[0429] In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety is capable of binding the cell-surface receptor or the cell-surface moiety. In certain embodiments, an agent comprising a cell-targeting moiety is capable of being internalized when it interacts with or binds the cell-surface receptor or the cell-surface moiety. In certain embodiments, a cell-targeting moiety comprises a liver cell targeting moiety or a liver cell ligand. In certain embodiments, a liver cell-targeting moiety consists of a cell-targeting moiety having affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, the cell-targeting moiety comprises more than one ligand, and each ligand has affinity for the ASGP- R. In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is 103 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application independently selected from galactose, N-acetyl galactosamine (GalNAc), mannose, glucose, glucosamine, and fucose.
[0430] In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem. 2004, 47, 5798-5808). In certain embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be bT[TRcTS Ua^\ P]h ]d\QTa ^U R^\_^d]Sb Z]^f] X] cWT Pac& bdRW Pb bXP[XR PRXS& t'<'VP[PRc^bP\X]T& w' muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O- methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N'V[hR^[^h['t']TdaP\X]XR PRXS( >^a TgP\_[T& cWX^ bdVPab \Ph QT bT[TRcTS Ua^\ / 'JWX^'w'<' glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O'caXch['t'<'V[dR^_haP]^bXST& .'cWX^'w'<' galactopyranose, and ethyl 3,4,6,7-tetra-O'PRTch[','ST^gh'+& / 'SXcWX^'t'<'gluco-heptopyranoside.
[0431] In certain embodiments, each ligand is N-acetyl galactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises one GalNAc ligand. In certain embodiments, the cell-targeting moiety comprises two GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises a GalNAc ligand cluster. In certain embodiments, the cell-targeting moiety comprises a three GalNAc ligand cluster. In certain embodiments, the cell-targeting moiety is any one of those described in US 9,127,276, the entire contents of which is incorporated herein by reference. In certain embodiments, a conjugate group comprises a cell-targeting moiety selected from any one of the formula set forth in Table 2:
[0432] Table 2: Conjugate groups. 104 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application Structure: Name: GalNAc3- 7 HO OH GalNAc3- O H HOON10 4 AcHN O HO OH O H ONH HO 4 N AcHN O HO OH O H HOON4 AcHN O GalNAc3- 1 105 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application Structure: Name: HO OH GalNAc3- HOOOH 3 AcHNNHO NOOH H O N O N (CH HO OH O NHN2)6 OO O H O O O HO NHAc HN N H O OH O O HOOHO NHAc GalNAc3- 23 (with a cleavable linker moiety) GalNAc3- 8 (with a cleavable linker moiety) 106 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application Structure: Name: GalNAc3- 5 (with a cleavable linker moiety) GalNAc3- 13 (with a cleavable 3- e107 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application Structure: Name:4- e ate ain ain hed ker108 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chemical byl . In yl, ain xo, ups e or ker s at tral ein, ate nal to ide not ith ore n a s, a ate xed ble led ion, , ied oligonucleotide, maleimide-thiol Michael addition, ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thio ether formation, disulfide formation, reductive alkylation, catalyst- 109 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application free N-arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels Alder ion , et ew. n,” ion al., ers, es., S. n”, ew. 01; and , et al., ials ofp g py , 3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0439] In certain embodiments, conjugate linkers comprise 1-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an 110 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or om ne, er- gly, eric are gly, f a o a ing ide nce ing ous s in rise of ise nts, ate ers no the g aeric compound has been taken up, it is desirable that the conjugate moiety be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In 111 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
[0442] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety.
[0443] In certain embodiments, a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0444] In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligomeric compound is prepared using Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligomeric compound attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc. 2012, 134(28), 11618-11631), which is incorporated by reference herein in its entirety. Additional conjugate linkers suitable for use in several embodiments are prepared by Click chemistry described in “Click Chemistry for Biotechnology and Materials Science” Ed. Joerg Laham, Wiley 2009, which is incorporated by reference herein in its entirety.
[0445] In certain embodiments, compounds comprise an oligonucleotide, a cell-targeting moiety, and a conjugate linker. In certain embodiments, oligomeric compounds comprise an oligonucleotide, a hepatic asialoglycoprotein receptor (ASGP-R) ligand, and a conjugate linker. In certain embodiments, oligomeric compounds comprise an oligonucleotide, a N-acetyl galactosamine (GalNAc) ligand, and a conjugate linker. In certain embodiments, oligomeric compounds comprise an oligonucleotide, a 112 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application GalNAc trimer, a branching group, a conjugate linker, and optionally modifications to the GalNAc ligands. In certain embodiments, oligomeric compounds comprise an oligonucleotide, two or more GalNAc ligands, a branching group, a conjugate linker, and optionally modifications to the GalNAc ligands. In certain embodiments, a conjugate linker connects GalNAc ligand to an oligonucleotide.
[0446] In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 3’ end of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 3’ end of an oligonucleotide. In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 5’ end of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 5’ end of an oligonucleotide. In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to an internal position of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to an internal position of an oligonucleotide. In certain embodiments, an internal position of an oligonucleotide is a 2’- position of a modified sugar moiety of a nucleoside within the internal region of an oligonucleotide that is not the 5’ terminal nucleoside or the 3’ terminal nucleoside. In certain embodiments, an internal position of an oligonucleotide is a modified internucleoside linkage of the oligonucleotide.
[0447] In certain embodiments, a conjugate group comprises a conjugate trishexylamino (THA)-C6 linker. In certain embodiments, a conjugate group comprises GalNAc is trishexylamino-(THA)-C6 GalNAc3. In certain embodiments, the trishexylamino-(THA)-C6 GalNAc3 is attached to the 5’- terminal nucleoside of an oligonucleotide. In certain embodiments, a 5'-Trishexylamino-(THA)-C6 GalNAc3conjugate group has the formula: 113 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application .
[0448] In certain embodiments, a modified oligonucleotide is linked to the Trishexylamino-(THA)- C6 GalNAc3conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group. In certain embodiments, the phosphate group is attached to the 5’-oxygen atom of the 5’-nucleoside of the oligonucleotide. In certain embodiments, a 5'-Trishexylamino-(THA)-C6 GalNAc3conjugate group containing a cleavable moiety has the formula: .
[0449] In certain embodiments, a GalNAc-containing conjugate group is HPPO-GalNAc. In certain embodiments, the HPPO-GalNAc-containing conjugate group is attached to the 3’-terminal nucleoside of an oligonucleotide. In certain embodiments, HPPO-GalNAc conjugate group containing a cleavable moiety has the formula: 114 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application .
[0450] 2. Terminal Groups
[0451] As used herein, “terminal group” means a group of atoms that is covalently linked to a terminus of an oligonucleotide. Examples of a terminal group include, but are not limited to, a capping group, a phosphate moiety, a stabilized phosphate group, and a protecting group, wherein one or more groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, an oligonucleotide is linked to a terminal group comprising a stabilized 5’-phosphate. A] RTacPX] T\Q^SX\T]cb& ^]T ^a \^aT cTa\X]P[ Va^d_b Xb PccPRWTS Pc cWT -u P]S)^a / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& ^]T ^a \^aT cTa\X]P[ Va^d_b Xb PccPRWTS Pc cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& ^]T ^a \^aT cTa\X]P[ Va^d_b Xb PccPRWTS Pc cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& ^]T ^a \^aT cTa\X]P[ Va^d_b Xb PccPRWTS Pc cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST P]S ^]T ^a \^aT cTa\X]P[ Va^d_b Xb PccPRWTS Pc cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS Pc cWT -u P]S)^a / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS Pc cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS ]TPa cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS Pc cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS ]TPa cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST( A] RTacPX] T\Q^SX\T]cb& P cTa\X]P[ Va^d_ Xb PccPRWTS Pc cWT -u'T]S ^U cWT ^[XV^]dR[T^cXST P]S P cTa\X]P[ Va^d_ Xb PccPRWTS Pc cWT / u'T]S ^U cWT ^[XV^]dR[T^cXST(
[0452] In certain embodiments, a modified oligonucleotide is linked to a terminal group comprising a stabilized phosphate moiety attached to the 5’-end of the oligonucleotide. The stabilized phosphate moiety results in stabilization of a 5’-phosphate moiety of the 5’-terminal nucleoside of an 115 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application oligonucleotide, relative to the stability of an unmodified 5’-phosphate of an unmodified nucleoside under biologic conditions. Such stabilization of a 5’-phosphate group includes but is not limited to resistance to removal by phosphatases. Stabilized phosphate moieties, but are not limited to 5’- phosphonates, including, but not limited to 5’-vinylphosphonate, 5’-methylphosphonate, and 5’- cyclopropyl phosphonate. In certain embodiments, the stabilized phosphate moiety is a cyclopropyl phosphonate or an (E)-vinyl phosphonate.
[0453] III. COMPOSITIONS
[0454] A. Pharmaceutical Compositions
[0455] In certain embodiments, described herein are compositions comprising or consisting of, or consisting essentially of, an oligomeric agent. In certain embodiments, an oligomeric agent (e.g., a unit dose) contains a modified oligonucleotide (e.g., comprising a nucleobase sequence consisting of 16-30 nucleosides) having a nucleobase sequence complementary to a nucleobase sequence of an equal length target region in an AGT nucleic acid, e.g., a human AGT nucleic acid such as, e.g., SEQ ID NO: 1 or 2. In certain embodiments, the oligomeric agent is any such oligomeric agent described herein and / or containing any such oligonucleotide described herein. In certain embodiments, a composition containing an oligomeric agent is a pharmaceutical composition, e.g., a pharmaceutical formulation. In certain embodiments, the composition contains a pharmaceutically acceptable carrier or excipient. In certain embodiments, the pharmaceutical composition consists of the oligomeric agent and a pharmaceutically acceptable carrier or excipient. In certain embodiments, the oligonucleotide of the oligomeric agent is single-stranded. In certain embodiments, the oligonucleotide of the oligomeric agent is a single-stranded antisense agent, and in certain embodiments is a single-stranded RNase H agent. In certain embodiments, the composition is a pharmaceutical composition consisting of an oligomeric agent consisting of a single-stranded antisense agent, and optionally a conjugate group, and a pharmaceutically acceptable carrier or excipient. In certain embodiments, the nucleobase sequence of the modified oligonucleotide includes at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases complementary to an equal length portion of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide includes at least 112, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of SEQ ID NO: 3, 4 or 5. In certain embodiments of the oligomeric agent- containing compositions provided herein, the nucleobase sequence of the modified oligonucleotide is SEQ ID NO: 3, 4 or 5. In certain embodiments, the oligomeric agent contains a conjugate group 116 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application attached to the modified oligonucleotide. In certain embodiments, the conjugate group includes one or more the oligomeric and the conjugate of a modified A = mC G = T = e = ak = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.
[0456] In certain embodiments, the oligomeric agent is ION904 (represented in certain any salt (e.g., and sodium
[0457] In (5’ to 3’): THA-C6- 5); wherein, A mC G T =e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and 117 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application THA-C6-GalNAc3=.
[0458] In certain embodiments, compositions containing an oligomeric agent that contains a modified oligonucleotide having a nucleobase sequence complementary to a nucleobase sequence of an equal length in an AGT nucleic acid (e.g., a human AGT nucleic acid such as, e.g., SEQ ID NO: 1 or 2), for example, ION904, are used in methods provided herein for reducing the amount of AGT RNA and / or AGT protein in a cell or a subject having or at risk for heart failure, or for treating a subject having or at risk for heart failure. In certain embodiments, a composition containing the oligomeric agent is a pharmaceutical composition. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier or excipient. In certain embodiments, the pharmaceutical composition consists of, or consists essentially of, the oligomeric agent, e.g., ION904, and a pharmaceutically acceptable carrier or excipient. In certain embodiments, the pharmaceutical composition comprises, consists of, or consists essentially of a sterile saline solution and the oligomeric agent, e.g., ION904. In certain embodiments, the pharmaceutical composition comprises, consists of, or consists essentially of a buffered sterile saline solution and the oligomeric agent, e.g., ION904. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises, consists of, or consists essentially of sterile water and the oligomeric agent, e.g., ION904. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises, consists of, or consists essentially of the oligomeric agent, e.g., ION904, in 2mM phosphate buffered isotonic saline, pH 7.4.
[0459] In certain embodiments, a composition, e.g., pharmaceutical compositions, comprising the 118 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application oligomeric agent, e.g., ION904, encompass any salt, e.g., any pharmaceutically acceptable salt, of the oligomeric agent, e.g., ION904, esters of the oligomeric agent, e.g., ION904, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent, e.g., ION904, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof upon administration to a human subject. Accordingly, for example, the disclosure is also drawn to salts, e.g., pharmaceutically acceptable salts, of the oligomeric agent, e.g., ION904, prodrugs of the oligomeric agent, e.g., ION904, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0460] Under certain conditions, an oligomeric agent, e.g., ION904, acts as an acid in a composition. For example, although an oligomeric agent such as ION904 may be drawn or described in protonated (free acid) form, and / or ionized and / or in association with a cation (salt) form, aqueous solutions of the oligomeric agent, e.g., ION904, exist in equilibrium among such forms when in an aqueous composition. For example, a phosphate linkage of ION904 in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, the term, “ION904,” is intended to include all such forms. Moreover, ION904 has several such linkages, each of which is in equilibrium. Thus, ION904 exists in solution in an ensemble of forms at multiple positions all at equilibrium. The term “ION904” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of ION904 followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation. In certain instances, one or more specific cation is identified.
[0461] In certain embodiments, ION904 is in aqueous solution composition with sodium. In certain embodiments, ION904 is in aqueous solution composition with potassium. In certain embodiments, ION904 is in phosphate-buffered saline (PBS). In certain embodiments, ION904 is in water. In certain embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve a desired pH.
[0462] Certain pharmaceutical compositions are formulated based on a mode of delivery. Pharmaceutical compositions described herein can be administered in a number of different ways, e.g., depending on whether local or systemic treatment is desired and upon the area to be treated. Administration can be, for example, transdermal, epidermal, oral or parenteral. Parenteral 119 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In certain embodiments, a composition (e.g., pharmaceutical composition) containing an oligomeric agent, e.g., ION904, is administered by subcutaneous injection. In certain embodiments, a composition containing an oligomeric agent, e.g., ION904, is administered by a syringe.
[0463] 2. Doses
[0464] Herein, certain specific doses or quantities are described. For clarity, a dose or quantity of an oligomeric agent, e.g., ION904, in milligrams indicates the mass of the free acid form of the oligomeric agent, e.g., ION904. As described above, in aqueous solution, a free acid is in equilibrium with anionic and salt forms. However, for simplicity of calculating dose or quantity, it is assumed that an oligomeric agent, e.g., ION904, exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where ION904 is in solution comprising sodium (e.g., saline), ION904 may be partially or fully de-protonated and in association with Na+ ions, including equilibrium over a combination of multiple different sites throughout the oligomeric compound. However, a mass of proton forms is nevertheless counted toward weight of the dose, and the mass of Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose or quantity of 80 mg of ION904 equals the number of fully protonated molecules that weighs 80 mg. This would be equivalent to 83.8 mg of solvent-free, sodium-acetate free, anhydrous sodiated ION904.
[0465] In certain embodiments, provided herein are unit doses of an oligomeric agent containing an oligomeric agent (e.g., a unit dose) that contains a modified oligonucleotide (e.g., comprising a nucleobase sequence consisting of 16-30 nucleosides) having a nucleobase sequence complementary to a nucleobase sequence of an equal length target region in an AGT nucleic acid, e.g., a human AGT nucleic acid such as, e.g., SEQ ID NO: 1 or 2. In certain embodiments, the oligomeric agent is any such oligomeric agent described herein containing any such oligonucleotide described herein. Also provided are unit doses of a composition, e.g., pharmaceutical composition, containing such oligomeric agents. In certain embodiments, the composition contains ION904 in any or all forms, including any salt (e.g., pharmaceutically acceptable salt) of ION904, e.g., potassium, calcium, magnesium, and sodium salts (see, e.g., Structure 2), ester of ION904, or salts of such esters. In certain embodiments, the composition containing an oligomeric agent, e.g., ION904, that contains a oligomeric agent (e.g., a modified oligonucleotide comprising a nucleobase sequence consisting of 16-30 nucleosides) having a nucleobase sequence complementary to a nucleobase sequence of an equal length in an AGT nucleic acid, e.g., a human AGT nucleic acid such as, e.g., SEQ ID NO: 1 or 120 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 2, does not contain any other any RAAS inhibitor, e.g., an ACEi, ARB, ARNI, renin inhibitor or MRA. In certain embodiments, the composition does not contain a neprilysin inhibitor. In certain embodiments, the composition does not contain any GDMT for heart failure. In certain embodiments, the composition does not contain any other active agent.
[0466] In certain embodiments, a composition, e.g., pharmaceutical composition, containing an oligomeric a to a nucleic acid such as, the is an ACEi, ARB, In certain certain at a dose that is less targetthat is less than about 70%, less than about 60%, less than about 50%, or less than about 40% of the Guideline- recommended target dose.
[0467] Guideline-directed medical therapy (GDMT) definitions were developed by the American (American College of Cardiology (ACC), American Heart Association, (AHA) and Heart Failure Society of America (HFSA)) and European (European Society of Cardiology; ESC) societies based on the results of multiple landmark randomized controlled clinical trials and, using this evidence- based approach, provided guideline recommendations for the management of heart failure, including HFrEF, HFmrEF and HFpEF. A recent statement of GDMT for heart failure developed by the American College of Cardiology / American Heart Association Joint Committee on Clinical Practice Guidelines describes four classes of drugs (1) RAASi (ARNi as a first line, though ACEi and / or 9H: RP] QT dbTS XU RP]]^c c^[TaPcT 9HDX%& $,% CH9& $-% w'Q[^RZTab P]S $.% I?BJ, X]WXQXc^ab (Heidenreich et al (2022) Circulation 145(18):e895-e1032, 2022 AHA / ACC / HFSA Guideline for the Management of Heart Failure: A Report of the American College of Cardiology / American Heart Association Joint Committee on Clinical Practice Guidelines) recommended for use in treating heart failure (e.g., HFrEF). The professional society guidelines advise against use of ACEi in patients with a history of angioedema and advise use of ARB in these cases, although some very rare cases 121 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application of angioedema have been reported with ARB use in landmark trials. ACEi use is also associated with chronic cough in some patients, and society guidelines recommend use of ARB in these cases. The professional societies also direct that ACEi, ARB, ARNi and MRA should be administered with caution to patients with low systemic blood pressures, renal insufficiency or elevated serum potassium (> 5.0 mEq / L), and, if maximal doses are not tolerated, intermediate doses should be tried. Table 14 of the 2022 GDMT (an excerpt of which is shown in Table 3, provides initial and cPaVTc S^bTb ^U 9;=X& 9H:& 9HDX& CH9& w'Q[^RZTab P]S I?BJ, X]WXQXc^a SadVb dbTS U^a @>a=>(
[0468] Table 3: Guideline recommended doses of drugs used for treating HFrEF. Drug ESC Target Dose ACC / AHA / HFSA < 50% Target Dose (mg Target Dose daily) Captopril 50 mg 3 times 50 mg 3 times daily <75 (25 mg 3 times daily) daily Enalapril 10-20 mg twice 10-20 mg twice daily <10 (5 mg twice daily) daily Fosinopril 40 mg once daily <20 mg daily Lisinopril 20-35 mg once 20-40 mg once daily <10 mg daily daily Perindopril 8-16 mg once daily <4 mg daily Quinapril 20 mg twice daily <20 (10 mg twice daily) Ramipril 5 mg twice daily 10 mg once daily <5 mg daily (2.5 mg twice daily) Trandolipril 4 mg once daily 4 mg once daily <2 mg daily Candesartan 32 mg once daily 32 mg once daily <16 mg daily Losartan 150 mg once daily 50-150 mg once daily <25 mg daily Valsartan 160 mg twice 160 mg twice daily <160 mg (80 mg twice daily) daily 122 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application Drug ESC Target Dose ACC / AHA / HFSA < 50% Target Dose (mg Target Dose daily) Sacubitril- 97 mg sacubitril 97 mg sacubitril and <200 mg (24 mg sacubitril and Valsartan and 103 mg 103 mg valsartan 26 mg valsartan twice daily) valsartan twice twice daily daily Spironolactone 50 mg once daily 25-50 mg once daily <12.5 mg daily Eplerenone 50 mg once daily 50 mg once daily <25 mg daily Bisoprolol 10 mg once daily Carvedilol 25-50 mg twice daily Carvedilol CR 80 mg once daily Metoprolol 200 mg once daily succinate extended release (metoprolol CR / XL) Dapagliflozin 10 mg once daily Empagliflozin 10 mg once daily
[0469] In certain embodiments of a unit dose of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80%, or at least 85% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (e.g., the baseline level or amount, or pre-administration level, of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the maximum decrease in the amount or level 123 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT protein) is less than 95%, or less than 94%, or less than 93%, or less than 92%, or less than 91%, or less than 90% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the amount or level of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT protein) decreases no more than 85%, or no more than 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94%, or no more than 95%, compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject. In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 94% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 93% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at 124 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application least 75%, at least 80% or at least 85% and less than 92% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 91% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in a cell or subject). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to, when administered to a cell or subject, decrease the amount of AGT RNA and / or AGT protein in the cell or subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by at least 70%, at least 75%, at least 80% or at least 85% and less than 90% compared to the amount or level of AGT RNA and / or AGT protein prior to any administration of the oligomeric agent (i.e., the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject). In certain the e at A e of n ess ntAttorney Docket: 277023 / BIOL0479WO / 556906 PCT Application blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by nt e GT d the e he the e %, %, %, %, %, %, %, %, %, %, %,, , , , , , , , %, 84%-86%, 84%-85%, 85%-90%, 85%-89%, 85%-88%, 85%-87%, 85-86%, 86%-90%, 86%-89%, 126 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 86%-88%, 86%-87%, 87%-90%, 87%-89%, 87%-88%, 88%-90%, or 88%-89% compared to the baseline level or amount of AGT RNA and / or AGT protein in the cell or subject.
[0471] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is effective to treat, and / or ameliorate one or more symptoms of, heart failure, such as HFrEF, HFmrEF or HFpEF, but does not significantly alter (e.g., decrease) systemic blood pressure (e.g., systolic blood or diastolic blood pressure) in a subject having, or at risk for, heart failure, including, e.g., a subject having, or at risk for heart failure who has hypotension (low blood pressure) or normal blood pressure (normotension). In certain embodiments, a significant alteration in systolic or diastolic blood pressure is a greater than about 10 mm Hg change in blood pressure, or a greater than about 11 mm Hg change in blood pressure, or a greater than about 12 mm Hg change in blood pressure, or a greater than about 13 mm Hg change in blood pressure, or a greater than about 14 mm Hg change in blood pressure, or a greater than about 15 mm Hg change in blood pressure. In certain embodiments, normal systolic blood pressure is within the range of about 90 mm Hg or 100 mm Hg to about 120 mm Hg or 125 mm Hg, and normal diastolic blood pressure is within the range of about 60 mm Hg and about 80 mm Hg. In certain embodiments, low systolic blood pressure is less than about 90 mm Hg and low diastolic blood pressure is less than about 60 mm Hg. In certain embodiments, elevated systolic blood pressure is about 125 mm Hg to about 129 mm Hg and high systolic blood pressure (i.e., hypertension) is about 130 mm Hg or higher. In certain embodiments, the quantity of oligomeric agent, e.g., ION904, in the unit dose is effective in treating, and / or ameliorating one or more symptoms of, HFrEF, but does not significantly alter (e.g., decrease) systemic blood pressure (e.g., systolic blood or diastolic blood pressure) in a subject having, or at risk for, HFrEF, including, e.g., a subject having, or at risk for heart failure who has hypotension or normal blood pressure.
[0472] In certain embodiments, the quantity of oligomeric agent, e.g., ION904, in the unit dose is effective in treating, and / or ameliorating one or more symptoms of, heart failure, such as HFrEF, HFmrEF or HFpEF, but does not significantly alter (e.g., increase) potassium levels (e.g., blood, serum or plasma potassium levels) in a subject having, or at risk for heart failure (such as HFrEF, HFmrEF or HFpEF), including, for example, a subject having, or at risk for, heart failure who has hyperkalemia, renal dysfunction, or renal insufficiency, acute kidney injury (AKI), or chronic kidney disease (CKD). In certain embodiments, hyperkalemia is a high potassium level (e.g., serum potassium level) of greater than about 5.0 mEq / L or about 5.5 mEq / L, elevated serum potassium level is greater than about 4.0 mEq / L, and normal potassium levels are within the range of about 3.5 127 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application mEq / L to about 5.0 mEq / L. In certain embodiments, renal insufficiency is associated with an eGFR of less than about 90 ml / min / 1.73 m² or about 100 ml / min / 1.73 m² (or eGFR between 30 and 90 ml / min / 1.73 m2& l.* \[)\X])+(1- \2& l- / \[)\X])+(1- \2& ^a l-* \[)\X])+(1- \2), stage 2 kidney disease is associated with an eGFR within the range of about 60 ml / min / 1.73 m² to about 89 ml / min / 1.73 m², stage 3 kidney disease is associated with an eGFR within the range of about 30 ml / min / 1.73 m² to about 59 ml / min / 1.73 m², stage 4 kidney disease is associated with an eGFR within the range of about 15 ml / min / 1.73 m² to about 29 ml / min / 1.73 m², and stage 5 kidney disease (kidney failure) is associated with an eGFR of less than about 15 ml / min / 1.73 m². In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose is effective in treating, and / or ameliorating one or more symptoms of, HFrEF, but does not significantly alter (e.g., increase) potassium levels (e.g., blood, serum or plasma potassium levels) in a subject having, or at risk for HFrEF, including, e.g., a subject having, or at risk for HFrEF who has renal insufficiency.
[0473] In certain embodiments, the amount of oligomeric agent e.g., ION904, in the unit dose is effective in treating, and / or ameliorating one or more symptoms of, heart failure, such as HFrEF, HFmrEF or HFpEF, but does not significantly alter bradykinin homeostasis and / or increase bradykinin levels (e.g., blood, serum, or plasma bradykinin levels) in a subject having, or at risk for heart failure (such as HFrEF, HFmrEF or HFpEF), including, for example, a subject having, or at risk for heart failure who has pulmonary disease or angioedema. In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose is effective in treating, and / or ameliorating one or more symptoms of, HFrEF, but does not significantly alter bradykinin homeostasis and / or increase bradykinin levels (e.g., blood, serum, or plasma bradykinin levels)in a subject having, or at risk for HFrEF, including, e.g., a subject having, or at risk for heart failure who has pulmonary disease or angioedema. Bradykinin homeostasis is maintained through balanced levels of bradykinin formation and degradation. Alteration of bradykinin homeostasis can result in relatively elevated bradykinin levels which leads to increased vascular permeability. Increased vascular permeability allows for increased fluid leakage from blood vessels into tissues which can result in angioedema (e.g., non-allergic angioedema). Additionally, bradykinin can trigger bronchoconstriction in the respiratory tract, which may lead to cough development.
[0474] In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose improves cardiac function, reduces cardiac dilation, reduces cardiac fibrosis, reverses or attenuates cardiac remodeling, and / or increases LVEF in a subject having, or at risk for, heart failure (such as HFrEF, HFmrEF or HFpEF). In certain embodiments the quantity of oligomeric agent e.g., ION904, 128 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application in the unit dose improves cardiac function, reduces cardiac dilation, reduces cardiac fibrosis, reverses or attenuates cardiac remodeling, and / or increases LVEF in a subject having, or at risk for, HFrEF. In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose improves improve left ventricular end diastolic volume (LVEDV), improves left ventricle (LV) strain, improves 6-minute walk test, and / or improves quality of life as assessed by patient reported outcomes of a subject having, or at risk for, heart failure. In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose improves left ventricular indexed end systolic volume (ESVi) or left ventricular end systolic volume (LVESV) of a subject having, or at risk for, heart failure (such as HFrEF, HFmrEF, HFimpEF or HFpEF). In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose improves ESVi or LVESV of a subject having, or at risk for, HFrEF. In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose decreases the level of N-terminal prohormone B-type natriuretic peptide (NT-proBNP), B- type natriuretic peptide (BNP), high-sensitive cardiac troponin T (hs-cTnT), and / or cardiac troponin T (cTnT) in plasma of a subject having, or at risk for, heart failure (such as HFrEF, HFmrEF or HFpEF) compared to the level prior to administration of the unit dose, or to the baseline level in a subject before any administration of the oligomeric agent, e.g., ION904. In certain embodiments, the quantity of oligomeric agent e.g., ION904, in the unit dose decreases the level NT-proBNP, BNP, high-sensitive cardiac troponin T (hs-cTnT) and / or cTnT in plasma of a subject having, or at risk for, HFrEF compared to the level prior to administration of the unit dose, or to the baseline level in a subject before any administration of the oligomeric agent, e.g., ION904.
[0475] In certain embodiments of the unit doses of a composition provided herein, the unit dose is administered as a loading dose. In certain embodiments, administration of one or more loading dose is effective in achieving a desired condition in a subject, for example, a desired initial concentration of oligomeric agent, e.g., ION904. In certain embodiments, administration of the loading dose(s) is / are effective in decreasing the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) compared to the amount or level of AGT RNA and / or AGT protein prior to administration of the loading dose of the oligomeric agent (e.g., the baseline or pre- administration level of AGT). In certain embodiments, a unit dose, e.g., a loading dose, is effective to decrease the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) by 20%-95%, 20%-90%, 20%-89%, 20%-88%, 20%-87%, 20%-86%, 20%- 129 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 85%, 20%-84%, 20%-83%, 20%-82%, 20%-81%, 20%-80%, 20%-79%, 20%-78%, 20%-77%, 20%-76%, 20%-75%, 20%-74%, 20%-73%, 20%-72%, 20%-71%, 20%-70%, 20%-65%, 20%-60%, 20%-55%, 20%-50%, 50%-95%, 50%-90%, 50%-89%, 50%-88%, 50%-87%, 50%-86%, 50%-85%, 50%-84%, 50%-83%, 50%-82%, 50%-81%, 50%-80%, 50%-79%, 50%-78%, 50%-77%, 50%-76%, 50%-75%, 50%-74%, 50%-73%, 50%-72%, 50%-71%, 50%-70%, 50%-65%, 50%-60%, 60%-95%, 60%-90%, 60%-89%, 60%-88%, 60%-87%, 60%-86%, 60%-85%, 60%-84%, 60%-83%, 60%-82%, 60%-81%, 60%-80%, 60%-79%, 60%-78%, 60%-77%, 60%-76%, 60%-75%, 60%-74%, 60%-73%, 60%-72%, 60%-71%, 60%-70%, 60%-65%, 70%-95%, 70%-90%, 70%-89%, 70%-88%, 70%-87%, 70%-86%, 70%-85%, 70%-84%, 70%-83%, 70%-82%, 70%-81%, 70%-80%, 80%-95%, 80%-90%, 80%-89%, 80%-88%, 80%-87%, 80%-86%, 80%-85%, 90%-95%, 90%-94%, 90%-93%, or 90%- 92% compared to the amount or level of AGT RNA and / or AGT protein prior to administration of the loading dose of the oligomeric agent. In certain embodiments, administration of the loading dose(s) is more effective to decrease the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) than administration of a maintenance dose is to decrease the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein). In certain embodiments, administration of a loading dose(s) is less effective in decreasing the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) than administration of a maintenance dose is to decrease the amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a loading dose is greater than the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a maintenance dose. In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a loading dose is less than the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a maintenance dose.
[0476] In certain embodiments of the unit doses of a composition provided herein, the unit dose is administered as a maintenance dose. In certain embodiments, administration of the maintenance dose is effective in maintaining a desired condition in a subject that results from administration of the loading dose. In certain embodiments, administration of the maintenance dose is effective in 130 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application maintaining an amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) that is less than the amount or level of AGT RNA and / or AGT protein prior to administration of the loading dose of the oligomeric agent (e.g., the baseline or pre-administration level of AGT). In certain embodiments, administration of the maintenance dose is effective in maintaining an amount or level of AGT RNA and / or AGT protein in the subject (e.g., the amount of AGT protein in the blood, serum or plasma of the subject, or the circulating level of AGT RNA and / or AGT protein) that is about the same as the amount or level of AGT RNA and / or AGT protein after administration of the loading dose, that is less than the amount or level of AGT RNA and / or AGT protein after administration of the loading dose, or that is more than the amount or level of AGT RNA and / or AGT protein after administration of the loading dose but less than the amount or level of AGT RNA and / or AGT protein prior to administration of the loading dose of the oligomeric agent (e.g., the baseline or pre-administration level of AGT). In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a maintenance dose is greater than the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a loading dose. In certain embodiments, the quantity of the oligomeric agent, e.g., ION904, in a unit does that is a maintenance dose is less than the quantity of the oligomeric agent, e.g., ION904, in a unit dose that is a loading dose.
[0477] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is within the range of about 15 mg to about 200 mg, about 20 mg to about 200 mg, about 40 mg to about 150 mg, about 60 mg to about 150 mg, about 60 mg to about 140 mg, about 65 mg to about 140 mg, about 70 mg to about 140 mg, about 75 mg to about 120 mg, about 80 mg to about 120 mg, about 85 mg to about 120 mg, about 90 mg to about 120 mg, about 95 mg to about 120 mg, about 100 mg to about 120 mg, about 60 mg to about 110 mg, about 65 mg to about 110 mg, about 70 mg to about 110 mg, about 75 mg to about 110 mg, about 80 mg to about 110 mg, about 85 mg to about 110 mg, about 90 mg to about 110 mg, about 95 mg to about 110 mg, about 100 mg to about 110 mg, about 60 mg to about 100 mg, about 65 mg to about 100 mg, about 70 mg to about 100 mg, about 75 mg to about 100 mg, about 80 mg to about 100 mg, about 85 mg to about 100 mg, about 90 mg to about 100 mg, or about 95 mg to about 100 mg.
[0478] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is within the range of about 40 mg to 200 mg, 40 131 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, from 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg, 70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg 105 mg to 120 mg, 110 mg to 135 mg, 110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, or 135 mg to 140 mg.
[0479] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is at least about 20 mg and less than 200 mg, at least about 20 mg and less than 195 mg, at least about 20 mg and less than 190 mg, at least about 20 mg and less than 185 mg, at least about 20 mg and less than 180 mg, at least about 20 mg and less 132 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application than 175 mg, at least about 20 mg and less than 170 mg, at least about 20 mg and less than 165 mg, at least about 20 mg and less than 160 mg, at least about 20 mg and less than 155 mg, at least about 20 mg and less than 150 mg, at least about 20 mg and less than 145 mg, at least about 20 mg and less than 140 mg, at least about 20 mg and less than 135 mg, at least about 20 mg and less than 130 mg, at least about 20 mg and less than 125 mg, at least about 20 mg and less than 120 mg, at least about 20 mg and less than 115 mg, at least about 20 mg and less than 110 mg, at least about 20 mg and less than 105 mg, at least about 20 mg and less than 100 mg, at least about 20 mg and less than 95 mg, at least about 20 mg and less than 90 mg, at least about 20 mg and less than 85 mg, at least about 20 mg and less than 80 mg, at least about 20 mg and less than 75 mg, at least about 20 mg and less than 70 mg, at least about 20 mg and less than 65 mg, at least about 20 mg and less than 60 mg, at least about 20 mg and less than 55 mg, at least about 20 mg and less than 50 mg, at least about 20 mg and less than 45 mg, at least about 20 mg and less than 40 mg, at least about 20 mg and less than 35 mg, or at least about 20 mg and less than 30 mg.
[0480] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is at least about 20 mg and less than about 200 mg, at least about 20 mg and less than about 195 mg, at least about 20 mg and less than about 190 mg, at least about 20 mg and less than about 185 mg, at least about 20 mg and less than about 180 mg, at least about 20 mg and less than about 175 mg, at least about 20 mg and less than about 170 mg, at least about 20 mg and less than about 165 mg, at least about 20 mg and less than about 160 mg, at least about 20 mg and less than about 155 mg, at least about 20 mg and less than about 150 mg, at least about 20 mg and less than about 145 mg, at least about 20 mg and less than about 140 mg, at least about 20 mg and less than about 135 mg, at least about 20 mg and less than about 130 mg, at least about 20 mg and less than about 125 mg, at least about 20 mg and less than about 120 mg, at least about 20 mg and less than about 115 mg, at least about 20 mg and less than about 110 mg, at least about 20 mg and less than about 105 mg, at least about 20 mg and less than about 100 mg, at least about 20 mg and less than about 95 mg, at least about 20 mg and less than about 90 mg, at least about 20 mg and less than about 85 mg, at least about 20 mg and less than about 80 mg, at least about 20 mg and less than about 75 mg, at least about 20 mg and less than about 70 mg, at least about 20 mg and less than about 65 mg, at least about 20 mg and less than about 60 mg, at least about 20 mg and less than about 55 mg, at least about 20 mg and less than about 50 mg, at least about 20 mg and less than about 45 mg, at least about 20 mg and less than about 40 mg, at least about 20 mg and less than about 35 mg, or at least about 20 mg and less than about 30 mg. 133 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application
[0481] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is about 15 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, or about 150 mg. In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, or about 110 mg.
[0482] In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in a unit dose is 15 mg, 20 mg, 30 mg, 40 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg. In certain embodiments of the unit doses of a composition provided herein, the quantity of the oligomeric agent, e.g., ION904, in the unit dose is 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 m...
Claims
Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application CLAIMS:
1. A method for reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor, comprising administering an oligomeric compound or salt thereof to a subject having or at risk for heart failure; wherein the subject is intolerant, or is at risk of being intolerant, to treatment with a RAAS inhibitor; and wherein the amount of AGT protein in the subject is reduced by at least 70%, at least 75%, at least 80% or at least 85% but less than 95% in the subject; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
2. A method of treating heart failure in a subject, comprising administering an oligomeric compound or a salt thereof to a subject having or at risk of having heart failure, wherein the subject is or is at risk of being intolerant to treatment with a RAAS inhibitor; wherein treatment results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, 247 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
3. A method of treating heart failure in a subject, comprising administering about 50 mg to about 200 mg an oligomeric compound or a salt thereof to a subject; wherein administering oligomeric compound results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
4. Use of an oligomeric compound or a salt thereof for treating heart failure in a subject intolerant to, or at risk of being intolerant to, treatment with a RAAS inhibitor, wherein: heart failure in the subject does not progress or one or more symptoms are ameliorated; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety. 248 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 5. Use of 50 mg to 200 mg of an oligomeric compound or a salt thereof for treating heart failure in a subject having or at risk for heart failure; wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
6. Use of an oligomeric compound or a salt thereof for reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor; wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety; and wherein the oligomeric compound reduces AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% but less than 95%.
7. A method for administering an oligomeric compound to a subject, comprising administering 60 mg to 120 mg of an oligomeric compound or salt thereof to a subject having or at risk for heart failure with 249 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
8. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric compound or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc-conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; and wherein GalNAc is an N-acetyl galactosamine conjugate moiety.
9. Use of 60 mg to 120 mg of an oligomeric compound or a salt thereof for treating a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, 250 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety 10. Use of 60 mg to 120 mg of an oligomeric compound or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric compound is a GalNAc conjugated modified oligonucleotide, wherein the modified oligonucleotide is represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe (SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage; wherein GalNAc= is an N-acetyl galactosamine conjugate moiety.
11. The method or use of any one of claims 1-10, wherein the oligomeric compound is represented by the following chemical notation (5’ to 3’): THA-C6-GalNAc3-mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 5) or a salt thereof; wherein, A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = an unmodified DNA sugar moiety, s = a phosphorothioate internucleoside linkage, 251 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application o = a phosphodiester internucleoside linkage, and THA-C6-GalNAc3= .
12. The compound is represented by the following(SEQ ID NO: 5) or a salt thereof.
13. The method or use of any one of claims 1-12, wherein the oligomeric compound is a sodium salt or a potassium salt. 252 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 14. The method or use of any one of claims 1-10, wherein the oligomeric compound is a sodium salt(SEQ ID NO: 5).
15. The method or use of any one of claims 1-10, wherein the conjugate group comprises the following structure: 253 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or 16. The terminal oligonucleotide.
17. The the subject is 18. The serum or plasma 19. The or the heart ejection fraction preserved 20. The fraction of about 21. The asymptomatic ventricularhypocontractility.
22. The method or use of any one of claims 1-21, wherein a decrease in the amount of AGT RNA and / or AGT protein in the subject is less than 95%, or less than 94%, or less than 93%, or less than 92%, or 254 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application less than 91%, or less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric compound or salt thereof. wherein the amount of AGT RNA and / or AGT or no more than 86%, or no more than 87%, or no or no more than 91%, or no more than 92%, or 95% compared to the baseline amount of AGT of the oligomeric compound or salt wherein the amount of AGT RNA and / or AGT 80% or at least 85% and less than 95% compared compound or salt thereof. wherein the amount of AGT RNA and / or AGT 80% or at least 85% and less than 90% compared in the subject prior to any administration of thewherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 75% and less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, or less than 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric compound or salt thereof.
27. The method or use of any one of claims 1-26, wherein the oligomeric compound or salt thereof is the only RAAS inhibitor administered to the subject.
28. The method or use of any one of claims 1-26, wherein the subject has been previously treated with a GDMT for heart failure.
29. The method or use of any one of claims 1-26, wherein the subject has been previously treated with a RAAS inhibitor.
30. The method or use of any one of claims 1-26, wherein the subject has been previously treated with an ACE inhibitor, an ARB, an ARNi, a MRA and / or a direct renin inhibitor.
31. The method or use of any one of claims 1-26, wherein the subject is being treated concurrently with a RAAS inhibitor in addition to the oligomeric compound.
32. The method or use of any one of claims 1-26, wherein the subject is being treated concurrently with an ACE inhibitor, ARB an ARNi, a MRA and / or a renin inhibitor.
33. The method of any one of claims 1-26, comprising administering the oligomeric compound or salt thereof and simultaneously or sequentially administering: (i) a RAAS inhibitor or (ii) an ACE inhibitor, ARB, ARNi, MRA or direct renin inhibitor to the subject. 255 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 34. The method of claim 33, wherein the oligomeric compound or salt thereof and (i) or (ii) are administered simultaneously in a single composition.
35. The method or use of any one of claims 31-34, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or a direct renin inhibitor is administered at less than the Guideline-recommended target dosefor treatment of HFrEF.
36. The method or use of claim 35, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or renin inhibitor is administered at less than about 70%, less than about 60%, less than about 50%, or less than about 40% of the Guideline-recommended target dose for treatment of HFrEF.
37. The method or use of any one of claims 28-36, wherein the RAAS inhibitor, ACE inhibitor, ARB, ARNi, MRA or renin inhibitor is administered at a frequency that is less than the Guideline- recommended,dosing regimen for treatment of HFrEF.
38. The method or use of any one of claims 1-27, wherein the subject is treated concurrently with a neprilysin inhibitor.
39. The method or use of any one of claims 1-27, further comprising simultaneously or sequentially administering a neprilysin inhibitor to the subject.
40. The method or use of claim 38 or claim 39, wherein the neprilysin inhibitor is sacubitril.
41. The method or use of claim 39 or claim 40, further comprising simultaneously or sequentially administering an ARB to the subject.
42. The method or use of claim 41, wherein the ARB is valsartan.
43. The method or use of any one of claims 1-42, wherein the subject has asymptomatic left ventricular dysfunction (ALVD).
44. The method or use of any one of claims 1-42, wherein the subject has structural and / or functional abnormalities of the pericardium, myocardium and / or a cardiac valve.
45. The method or use of any one of claims 1-42, wherein the subject has one or more of asymptomatic or symptomatic valvular heart disease, left ventricular hypertrophy, left ventricular fibrosis, left ventricular dilatation, and left ventricular hypocontractility.
46. The method or use of any one of claims 1-45, wherein the subject has or is at risk of having angioedema or asthma.
47. The method or use of any one of claims 1-46, wherein the subject has renal insufficiency.
48. The method or use of claim 47, wherein the subject has an estimated glomerular filtration rate (eGFR) of between 30 and 90 ml / min / 1.73 m2, between 30 and 89 ml / min / 1.73 m2, between 30 and 80 ml / min / 1.73 m2, between 20 and 89 ml / min / 1.73 m2, between 20 and 80 ml / min / 1.73 m2, between 45 and 89 ml / min / 1.73 m2, between 40 and 89 ml / min / 1.73 m2, between 40 and 80 ml / min / 1.73 m2, between 60 and 89 ml / min / 1.73 m2, between 30 and 60 ml / min / 1.73 m2, between 30 and 59 ml / min / 1.73 m2, between 40 and 60 ml / min / 1.73 m2, between 30 and 44 ml / min / 1.73 m2, between 35 and 45 ml / min / 1.73 m2, between 15 and 44 256 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application ml / min / 1.73 m2, between 15 and 29 ml / min / 1.73 m2, less than about 90 ml / min / 1.73 m2, less than about 89 ml / min / 1.73 m2, less than about 80 ml / min / 1.73 m2, less than about 70 ml / min / 1.73 m2, less than about 60 ml / min / 1.73 m2, less than about 59 ml / min / 1.73 m2, less than about 45 ml / min / 1.73 m2, less than about 44 ml / min / 1.73 m2, less than about 40 ml / min / 1.73 m2, less than about 30 ml / min / 1.73 m2, less than about 29 ml / min / 1.73 m2, or less than about 15 ml / min / 1.73 m2. 49: The method or use of any one of claims 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 150 mg, 55 mg to 125 mg, 55 mg to 115 mg, 55 mg to 105 mg, 55 mg to 95 mg, 55 mg to 85 mg, 55 mg to 75 mg, 55 mg to 65 mg, 65 mg to 125 mg, 65 mg to 115 mg, 65 mg to 105 mg, or 65 mg to 95 mg, 65 mg to 85 mg, 65 mg to 75 mg, 75 mg to 125 mg, 75 mg to 115 mg, 75 mg to 105 mg, 75 mg to 95 mg, 75 mg to 85 mg, 85 mg to 125 mg, 85 mg to 115 mg, 85 mg to 105 mg, or 85 mg to 95 mg. 50: The method or use of any one of claims 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 50 mg to about 150 mg, about 50 mg to about 140 mg, about 50 mg to about 120 mg, about 50 mg to about 110 mg, about 50 mg to about 100 mg, about 50 mg to about 80 mg, about 50 mg to about 70 mg, about 50 mg to about 60 mg, about 60 mg to about 150 mg, about 60 mg to about 140 mg, about 60 mg to about 120 mg, about 60 mg to about 110 mg, about 60 mg to about 100 mg, about 60 mg to about 80 mg, about 60 mg to about 70 mg, about 70 mg to about 150 mg, about 70 mg to about 140 mg, about 70 mg to about 120 mg, about 70 mg to about 110 mg, about 70 mg to about 100 mg, about 70 mg to about 80 mg, about 80 mg to about 150 mg, about 80 mg to about 140 mg, about 80 mg to about 120 mg, about 80 mg to about 110 mg, about 80 mg to about 100 mg, about 80 mg to about 90 mg, about 90 mg to about 150 mg, about 90 mg to about 140 mg, about 90 mg to about 120 mg, about 90 mg to about 110 mg, about 90 mg to about 100 mg, about 100 mg to about 150 mg, about 100 mg to about 140 mg, about 100 mg to about 120 mg, about 100 mg to about 110 mg, about 110 mg to about 150 mg, about 110 mg to about 140 mg, about 110 mg to about 130 mg, about 110 mg to about 120 mg, about 120 mg to about 150 mg, about 120 mg to about 140 mg, about 120 mg to about 130 mg, about 130 mg to about 150 mg, about 130 mg to about 140 mg, about 140 mg to about 150 mg, about 55 mg to about 125 mg, about 55 mg to about 115 mg, 257 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application about 55 mg to about 105 mg, about 55 mg to about 95 mg, about 55 mg to about 85 mg, about 55 mg to about 75 mg, about 55 mg to about 65 mg, about 65 mg to about 125 mg, about 65 mg to about 115 mg, about 65 mg to about 105 mg, or about 65 mg to about 95 mg, about 65 mg to about 85 mg, about 65 mg to about 75 mg, about 75 mg to about 125 mg, about 75 mg to about 115 mg, about 75 mg to about 105 mg, about 75 mg to about 95 mg, about 75 mg to about 85 mg, about 85 mg to about 125 mg, about 85 mg to about 115 mg, about 85 mg to about 105 mg, or about 85 mg to about 95 mg.
51. The method or use of any one of claims 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of at least about 50 mg and less than about 150 mg, at least about 50 mg and less than about 145 mg, at least about 50 mg and less than about 140 mg, at least about 50 mg and less than about 135 mg, at least about 50 mg and less than about 130 mg, at least about 50 mg and less than about 125 mg, at least about 50 mg and less than about 120 mg, at least about 50 mg and less than about 115 mg, at least about 50 mg and less than about 110 mg, at least about 50 mg and less than about 105 mg, at least about 50 mg and less than about 100 mg, at least about 50 mg and less than about 95 mg, at least about 50 mg and less than about 90 mg, at least about 50 mg and less than about 85 mg, at least about 50 mg and less than about 80 mg, at least about 50 mg and less than about 75 mg, at least about 50 mg and less than about 70 mg, at least about 50 mg and less than about 65 mg, at least about 55 mg and less than about 65 mg, at least about 60 mg and less than about 150 mg, at least about 60 mg and less than about 145 mg, at least about 60 mg and less than about 140 mg, at least about 60 mg and less than about 135 mg, at least about 60 mg and less than about 130 mg, at least about 60 mg and less than about 125 mg, at least about 60 mg and less than about 120 mg, at least about 60 mg and less than about 115 mg, at least about 60 mg and less than about 110 mg, at least about 60 mg and less than about 105 mg, at least about 60 mg and less than about 100 mg, at least about 60 mg and less than about 95 mg, at least about 70 mg and less than about 150 mg, at least about 70 mg and less than about 145 mg, at least about 70 mg and less than about 140 mg, at least about 70 mg and less than about 135 mg, at least about 70 mg and less than about 130 mg, at least about 70 mg and less than about 125 mg, at least about 70 mg and less than about 120 mg, at least about 70 mg and less than about 115 mg, at least about 70 mg and less than about 110 mg, at least about 70 mg and less than about 105 mg, at least about 70 mg and less than about 100 mg, at least about 70 mg and less than about 95 mg, at least about 80 mg and less than about 150 mg, at least about 80 mg and less than about 145 mg, at least about 80 mg and less than about 140 mg, at least about 80 mg and less than about 135 mg, at least about 80 mg and less than about 130 mg, at least about 80 mg and less than about 125 mg, at least about 80 mg and less than about 120 mg, at least about 80 mg and less than about 115 mg, at least about 80 mg and less than about 110 mg, at least about 80 mg and less than about 105 mg, at least about 80 mg and less than about 100 mg, at least about 80 mg and less than about 95 mg, or at least about 85 mg and less than about 95 mg of the oligomeric compound or salt thereof. 258 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 52. The method or use of any one of claims 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, or about 150 mg of the oligomeric compound or salt thereof.
53. The method or use of any one of claims 1-48, wherein administering or use of the oligomeric compound or salt thereof comprises administering or use of a fixed dose of 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg of the oligomeric compound or salt thereof.
54. The method or use of any one of claims 1-48, wherein administering or use comprises administering or use of a fixed dose of about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound or salt thereof.
55. The method or use of any one of claims 1-48, wherein the administering or use comprises administering or use of a fixed dose of 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof.
56. The method or use of any one of claims 1-48, wherein the administering or use comprises administering or use of a fixed dose of the oligomeric compound or salt thereof within the range of about 55 mg to about 100 mg, about 60 mg to about 100 mg, about 65 mg to about 100 mg, about 70 mg to about 100 mg, about 75 mg to about 100 mg, about 80 mg to about 100 mg, about 85 mg to about 100 mg, about 85 mg to about 100 mg, or about 85 mg to about 95 mg.
57. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 55 mg of the oligomeric compound or salt thereof.
58. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 60 mg of the oligomeric compound or salt thereof.
59. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 65 mg of the oligomeric compound or salt thereof.
60. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 70 mg of the oligomeric compound or salt thereof.
61. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 75 mg of the oligomeric compound or salt thereof.
62. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 80 mg of the oligomeric compound or salt thereof.
63. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 85 mg of the oligomeric compound or salt thereof. 259 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 64. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 90 mg of the oligomeric compound or salt thereof.
65. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 95 mg of the oligomeric compound or salt thereof.
66. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of about 100 mg of the oligomeric compound or salt thereof.
67. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 55 mg to 105 mg of the oligomeric compound or salt thereof.
68. The method or use of any one of claims 1-48, comprising administering or use of a unit dose of 60 mg of the oligomeric compound or salt thereof.
69. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 65 mg of the oligomeric compound or salt thereof.
70. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 70 mg of the oligomeric compound or salt thereof.
71. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 75 mg of the oligomeric compound or salt thereof.
72. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 80 mg of the oligomeric compound or salt thereof.
73. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 85 mg of the oligomeric compound or salt thereof.
74. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 90 mg of the oligomeric compound or salt thereof.
75. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 95 mg of the oligomeric compound or salt thereof.
76. The method or use of any one of claims 1-48, comprising administering or use of a fixed dose of 100 mg of the oligomeric compound or salt thereof.
77. The method or use of any one of claims 1-48, wherein the oligomeric compound or salt thereof is ION904 or a salt thereof.
78. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered once about every 4 weeks or once about every 28 days.
79. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered at an interval of about once a month, about once every two months, or about once every three months.
80. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once 260 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, or about once every 10 weeks.
81. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered once every 4 weeks or once every 28 days.
82. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered at an interval of once a month, once every two months, or once every three months.
83. The method of any one of claims 1-77, wherein the oligomeric compound or salt thereof is administered once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, or once every 10 weeks.
84. The method or use of any one of claims 1-83, wherein administering or use comprises administering or use of a fixed dose of 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof once every 3 weeks, once every 4 weeks, once every 5 weeks or once every 6 weeks.
85. The method or use of any one of claims 1-83, wherein administering or use comprises administering or use of a fixed dose of about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound or salt thereof once about every 3 weeks, once about every 4 weeks, once about every 5 weeks or once about every 6 weeks, wherein the oligomeric compound is formulated for parenteral administration.
86. The method or use of claim 85, wherein administering or use comprises administering or use of a fixed dose of about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg of the oligomeric compound or salt thereof once about every 25 days, once about every 26 days, once about every 27 days, once about every 28 days, once about every 29 days, once about every 30 days, or once about every 31 days, wherein the oligomeric compound is formulated for parenteral administration.
87. The method or use of claim 85, wherein administering or use comprises administering or use of a fixed dose of 60 mg or about 60 mg, or 90 mg or about 90 mg of the oligomeric compound or salt thereof once every 28 days or about every 28 days, or once every 4 weeks or about every 4 weeks, or once a month or about once a month, wherein the oligomeric compound is formulated for subcutaneous administration.
88. The method or use of claim 85, wherein administering or use comprises administering or use of a fixed dose of about 60 mg or about 90 mg of the oligomeric compound or salt thereof once about every 28 days or once about every 4 weeks, or once about every month, wherein the oligomeric compound is formulated for subcutaneous administration.
89. The method or use of any one of claims 1-88, wherein the oligomeric compound or salt thereof comprises administering or use of a loading dose.
90. The method or use of claim 89, wherein the administering or use comprises one or more maintenance doses of the oligomeric compound or salt thereof. 261 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 91. The method or use of claim 90, wherein the loading dose comprises a greater amount of the oligomeric compound or salt thereof than a maintenance dose.
92. The method or use of claim 90, wherein the loading dose and the maintenance dose comprises the same amount of the oligomeric compound or salt thereof.
93. The method or use of any one of claims 1-92, wherein the administration or use of the oligomeric compound or salt thereof is effective to decrease the amount of AGT RNA and / or AGT protein in the subject by at least 70%, at least 75%, at least 80%, or at least 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration or use of the oligomeric compound or salt thereof.
94. The method or use of any one of claims 1-93, wherein such method or use is effective to treat heart failure and / or ameliorate one or more symptoms of heart failure, but does not significantly reduce systolic blood pressure and / or diastolic blood pressure in a subject having, or at risk for, heart failure.
95. The method or use of any one of claims 1-93, wherein such method or use improves cardiac function, reduces cardiac dilation, reduces cardiac fibrosis, reverses or attenuates cardiac remodeling, increases LVEF, improves left ventricular end systolic volume (LVESV) or left ventricular indexed end systolic volume (LVESVi), improves left ventricular end diastolic volume (LVEDV), improves left ventricle (LV) strain, improves 6-minute walk test, and / or improves quality of life in the subject having, or at risk for, heart failure.
96. The method or use of any one of claims 1-93, wherein such method or use decreases the level of NT-proBNP, BNP, high-sensitive cardiac troponin T (hs-cTnT), and / or cTnT in blood, plasma, or serum of the subject having, or at risk for, heart failure 97. The method or use of any one of claims 1-93, wherein such method or use ameliorates at least one symptom of heart failure selected from fatigue, rapid or irregular heartbeat, palpitation, shortness of breath, chest pain, dizziness, weakness, dyspnea, orthopnea, edema, hepatic congestion, or ascites in the subject having, or at risk for, heart failure.
98. The method or use of any one of claims 1-93, wherein such method or use slows or prevents progression of one or more symptoms or signs of heart failure in the subject having, or at risk for, heart failure.
99. The method or use of any one of claims 1-93, wherein such method or use improves or eliminates one or more symptoms or signs of heart failure in the subject having, or at risk for, heart failure.
100. The method or use of any one of claims 1-99, wherein the oligomeric compound or salt thereof is administered in a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
101. The method or use of claim 100, wherein the pharmaceutical composition comprises water, saline, or 2mM phosphate buffered isotonic saline, pH 7.
4. 262 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 102. The method or use of any one of claims 1-101, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered parenterally.
103. The method or use of claim 102, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered subcutaneously.
104. The method or use of claim 103wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered by a syringe.
105. The method or use of claim 103, wherein the oligomeric compound or salt thereof, or pharmaceutical composition is administered by an autoinjector device.
106. A method of treating heart failure in a subject, comprising administering a fixed dose of 55 mg to 100 mg of an oligomeric compound or a salt thereof to a subject; wherein administering the oligomeric compound results in amelioration of one or more symptoms and / or lack of progression of heart failure; wherein the oligomeric compound is represented by the following sodium salt: (SEQ ID NO: 5), wherein the oligomeric compound is formulated with a pharmaceutically acceptable carrier or excipient selected from sterile water or sterile saline or phosphate buffered saline, formulated for parenteral administration.
107. Use of a fixed dose of 55 mg to 100 mg of an oligomeric compound or a salt thereof for 263 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application reducing AGT RNA and / or AGT protein in a subject intolerant, or at risk of being intolerant, to treatment with a renin-angiontensin-aldosterone system (RAAS) inhibitor; wherein the oligomeric compound is compound represented by the following sodium salt: (SEQ ID NO: 5), and wherein the oligomeric compound is formulated with a pharmaceutically acceptable carrier or excipient selected from sterile water or sterile saline or phosphate buffered saline, formulated for parenteral administration.
108. The method of claim 106 or the use of claim 107, wherein the fixed dose is formulated for subcutaneous administration and contained in a single use vial, pre-filled syringe or an autoinjector device.
109. A unit dose comprising 50 mg to 200 mg of an oligomeric compound comprising a GalNAc- conjugated modified oligonucleotide represented by the following chemical notation (5’ to 3’):mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe(SEQ ID NO: 4) or a salt thereof; wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, 264 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application k = a cEt sugar moiety,. 265 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 111. A unit dose comprising 50 mg to 150 mg of an oligomeric compound represented by the following(SEQ ID NO: 5) or a salt thereof. 266 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 112. A unit dose comprising 50 mg to 150 mg an oligomeric compound represented by the following sodium salt Structure 2: (SEQ ID NO: 5). 113: The compound or salt mg to 120 mg, 50 mg to 110 mg, 50 to 150 mg, 60 mg to 140 mg, 60 mg to 70 mg, 70 mg to 150 mg, 70 mg to to 80 mg, 80 mg to 150 mg, 80 mg to to 90 mg, 90 mg to 150 mg, 90 mg toto 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 150 mg, 55 mg to 125 mg, 55 mg to 115 mg, 55 mg to 105 mg, 55 mg to 95 mg, 55 mg to 85 mg, 55 mg to 75 mg, 55 mg to 65 mg, 65 mg to 125 mg, 65 mg to 115 mg, 65 mg to 105 mg, or 65 mg to 95 mg, 65 mg to 85 mg, 65 mg to 75 mg, 75 mg to 125 mg, 75 mg to 115 mg, 75 mg to 105 mg, 75 mg to 95 mg, 75 mg to 85 mg, 85 mg to 125 mg, 85 mg to 115 mg, 85 mg to 105 mg, or 85 mg to 95 mg. 267 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 114: The unit dose of any one of claims 109-112, comprising an amount of the oligomeric compound or salt thereof within the range of about 50 mg to about 150 mg, about 50 mg to about 140 mg, about 50 mg to about 80 mg, 60 mg to about 100 mg, about 60 mg to about 140 mg, about 70 mg to about 120 mg, about 90 mg to about 110 mg, about 100 mg to to about 140 mg, mg, about 120 mg 130 mg to about 115 mg, about 55 mg to about 75 mg, about 65 mg to about 75 mg, about 75 mg to about 115 mg, 115. The about 150 mg, at mg, at least about about 50 mg and mg and less than less than about about 95 mg, atat least about 50 mg and less than about 80 mg, at least about 50 mg and less than about 75 mg, at least about 50 mg and less than about 70 mg, at least about 50 mg and less than about 65 mg, at least about 55 mg and less than about 65 mg, at least about 60 mg and less than about 150 mg, at least about 60 mg and less than about 145 mg, at least about 60 mg and less than about 140 mg, at least about 60 mg and less than about 135 mg, at least about 60 mg and less than about 130 mg, at least about 60 mg and less than about 125 mg, at least about 60 mg and less than about 120 mg, at least about 60 mg and less than about 115 mg, at least about 60 mg and less than about 110 mg, at least about 60 mg and less than about 105 mg, at least about 60 mg and 268 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application less than about 100 mg, at least about 60 mg and less than about 95 mg, at least about 70 mg and less than about 150 mg, at least about 70 mg and less than about 145 mg, at least about 70 mg and less than about 140 mg, at least about 70 mg and less than about 135 mg, at least about 70 mg and less than about 130 mg, at least 70 than 145 at least 80 than 95 60 135 mg, mg, 65 of the119. The unit dose of any one of claims 109-112, comprising 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, or 100 mg of the oligomeric compound or salt thereof.
120. The unit dose of any one of claims 109-112, comprising an amount of the oligomeric compound or salt thereof within the range of about 55 mg to about 100 mg, about 60 mg to about 100 mg, about 65 mg to about 100 mg, about 70 mg to about 100 mg, about 75 mg to about 100 mg, about 80 mg to about 100 mg, about 85 mg to about 100 mg, about 85 mg to about 100 mg, or about 85 mg to about 95 mg.
121. The unit dose of any one of claims 109-112, comprising about 55 mg of the oligomeric compound or salt thereof.
122. The unit dose of any one of claims 109-112, comprising about 60 mg of the oligomeric compound or salt thereof.
123. The unit dose of any one of claims 109-112, comprising about 65 mg of the oligomeric compound or salt thereof. 269 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 124. The unit dose of any one of claims 109-112, comprising about 70 mg of the oligomeric compound or salt thereof.
125. The unit dose of any one of claims 109-112, comprising about 75 mg of the oligomeric compound or salt thereof.
126. The unit dose of any one of claims 109-112, comprising about 80 mg of the oligomeric compound or salt thereof.
127. The unit dose of any one of claims 109-112, comprising about 85 mg of the oligomeric compound or salt thereof.
128. The unit dose of any one of claims 109-112, comprising about 90 mg of the oligomeric compound or salt thereof.
129. The unit dose of any one of claims 109-112, comprising about 95 mg of the oligomeric compound or salt thereof.
130. The unit dose of any one of claims 109-112, comprising about 100 mg of the oligomeric compound or salt thereof.
131. The unit dose of any one of claims 109-112, comprising 55 mg to 95 mg of the oligomeric compound or salt thereof.
132. The unit dose of any one of claims 109-131, further comprising a neprilysin inhibitor.
133. The unit dose of claim 132, wherein the neprilysin inhibitor is sacubitril.
134. The unit dose of any one of claims 109-133, further comprising an ACEi, ARB, ARNi or MRA.
135. The unit dose of any claim 132 or claim 133, further comprising an ARB which is valsartan.
136. The unit dose of claim 134 or claim 135, wherein the dose of the ACEi, ARB, ARNi or MRA is lower than the Guideline-recommended, target dose for treating HFrEF.
137. The unit dose of claim 136, wherein the dose of the ACEi, ARB, ARNi or MRA is less than about 80%, 70%, 60%, 55%, 50%, 45%, or 40% of the Guideline-recommendedtarget dose for treating HFrEF.
138. The unit dose of any one of claims 109-131, wherein the unit dose does not contain any other RAAS inhibitor.
139. The unit dose of any one of claims 109-138, further comprising a pharmaceutically acceptable carrier, adjuvant or excipient.
140. The unit dose of claims 139, consisting of the oligomeric compound or salt thereof and a pharmaceutically acceptable carrier or excipient.
141. The unit dose of claim 139, wherein the pharmaceutically acceptable carrier or excipient is sterile water or sterile saline or phosphate buffered saline.
142. The unit dose of claim 141, consisting of the oligomeric compound or salt thereof and sterile water or sterile saline or phosphate buffered saline. 270 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 143. The unit dose of any one of claims 109-142, formulated for parenteral administration.
144. The unit dose of claim 143, formulated for subcutaneous, intramuscular, or intravenous administration.
145. The unit dose of claim 143, formulated for subcutaneous administration.
146. The unit dose of any one of claims 109-145, contained in a single-dose vial.
147. The unit dose of any one of claims 109-145, provided in multi-dose vials.
148. The unit dose of any one of claims 109-145, contained in a prefilled syringe.
149. The unit dose of any one of claims 109-145, contained in a single-dose prefilled syringe.
150. The unit dose of any one of claims 109-145, contained in an autoinjector device.
151. A kit, comprising: (a) the unit dose of any one of claims 109-150, and (b) instructions for use, and, optionally, (c) means for administering the unit dose.
152. The kit of claim 151, wherein the instructions are for use in reducing the amount of AGT RNA and / or AGT protein in a subject having or at risk for heart failure.
153. The kit of claim 151, wherein the instructions are for use in treating, or ameliorating one or more symptoms of, heart failure in a subject having or at risk for heart failure. 154: The method or use or unit dose of any one of claims 1-153, wherein the modified oligonucleotide is single-stranded. 155: The method or use or unit dose of any one of claims 1-153, wherein the modified oligonucleotide is the only oligonucleotide in the oligomeric compound. 156: The method or use or unit dose of any one of claims 1-153, wherein the modified oligonucleotide is double-stranded. 271 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 157. A unit dose comprising 55 mg to 100 mg of an oligomeric compound represented by the following sodium salt: (SEQ ID NO: 5), and a pharmaceutically acceptable carrier or excipient selected from sterile water or sterile saline or phosphate buffered saline, formulated for parenteral administration.
158. The unit dose of claim 157, formulated for subcutaneous administration and contained in a single use vial, pre-filled syringe or an autoinjector device.
159. A method for reducing the amount of angiotensinogen (AGT) RNA and / or AGT protein in a subject who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; wherein: 272 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
160. A method of treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; and wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
161. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2; and wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent.
162. Use of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein: the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides and wherein the modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length region of nucleobases 2046-2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO: 2, or salt thereof to a subject having or at risk for heart failure; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent. 273 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 163. Use of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein: ID least 2061 and any or the166. The method or use of any one of claims 159-164, wherein the subject has a left ventricular ejection fraction of about 50% or less, about 40% or less, or about 35% or less, or about 30% or less.
167. The method or use of any one of claims 159-164, wherein the subject has one or more of asymptomatic left ventricular dysfunction (ALVD), asymptomatic or symptomatic valvular heart disease, left ventricular hypertrophy, left ventricular fibrosis, left ventricular dilatation, and left ventricular hypocontractility.
168. The method or use of any one of claims 159-167, wherein the amount of AGT protein in the liver of the subject is reduced.
169. The method or use of any one of claims 159-167, wherein the amount of AGT protein in the blood, serum or plasma of the subject is reduced.
170. The method or use of any one of claims 159-169, wherein a decrease in the amount of AGT RNA and / or AGT protein in the subject is less than 95%, or less than 94%, or less than 93%, or less than 274 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 92%, or less than 91%, or less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
171. The method or use of any one of claims 159-169, wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by no more than 85%, or no more than 86%, or no more than 87%, or no more than 88%, or no more than 89%, or no more than 90%, or no more than 91%, or no more than 92%, or no more than 93%, or no more than 94%, or no more than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
172. The method or use of any one of claims 159-169, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 75%, at least 80% or at least 85% and less than 95% compared to the amount of AGT protein prior to administering the oligomeric agent or salt thereof.
173. The method or use of any one of claims 159-169, wherein the amount of AGT RNA and / or AGT protein is decreased by at least 70% or at least 75%, at least 80% or at least 85% and less than 90% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
174. The method or use of any one of claims 159-169, wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70% or at least 75% and less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, or less than 85% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
175. The method or use of any one of claims 159-174, wherein the nucleobase sequence comprises at least 13, at least 14, at least 15 or at least 16 contiguous nucleobases at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length region of nucleobases 2046- 2061 of SEQ ID NO: 1 or nucleobases 14940-14955 of SEQ ID NO:
2.
176. The method or use of any one of claims 159-174, wherein the nucleobase sequence comprises at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any one of the nucleobase sequence of SEQ ID NOs: 3-5.
177. The method or use of any one of claims 159-174, wherein the modified oligonucleotide consists of 16 to 17, 16 to 18,16 to 20, 16 to 25, 16 to 30, 17 to 20, 17 to 25, 17 to 30, 18 to 20, 18 to 25, 18 to 30, 19 to 20, 19 to 25, 19 to 30, 20 to 25, 20 to 30, 21-23, 21 to 25, 21 to 30, 22 to 25, 22 to 30, 23 to 25, or 23 to 30 linked nucleosides.
178. The method or use of any one of claims 159-174, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides and comprises or consists of a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 3-5. 275 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 179. The method or use of any one of claims 159-178, wherein the modified oligonucleotide comprises one or more i) modified nucleosides comprising a modified sugar moiety, ii) cyclic sugar surrogate, iii) acyclic sugar surrogate, iii) modified internucleoside linkage, and / or iv) modified nucleobase.
180. The method or use of claim 179, wherein the modified sugar moiety is a modified furanosyl sugar moiety or a sugar surrogate.
181. The method or use of claim 179, wherein the modified nucleoside comprises a bicyclic modified sugar moiety comprising a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'.
182. The method or use of claim 179, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety selected from a 2’-MOE sugar moiety, 2’-OMe sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety.
183. The method or use of claim 179, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside.
184. The method or use of claim 179, wherein the modified nucleobase is 5-methylcytosine or hypoxanthine.
185. The method or use of claim 179, wherein each nucleoside of the modified oligonucleotide comprises a nucleobase.
186. The method or use of claim 179, wherein each nucleoside of the modified oligonucleotide is independently selected from a furanosyl nucleoside, a cyclic sugar surrogate nucleoside, and an acyclic sugar surrogate nucleoside comprising a nucleobase.
187. The method or use of claim 179, wherein at least one nucleoside of the modified oligonucleotide comprises an unmodified sugar moiety.
188. The method or use of claim 179, wherein at least one nucleoside of the modified oligonucleotide comprises an unmodified DNA sugar moiety.
189. The method or use of any one of claims 1-188, wherein the oligomeric agent or salt thereof comprises a conjugate group comprising a conjugate linker and a conjugate moiety comprising a cell- targeting moiety.
190. The method or use of claim 189, wherein the cell-targeting moiety comprises a moiety that interacts with or binds to a liver cell.
191. The method or use claim 190, wherein the conjugate group comprises a N-acetyl galactosamine (GalNAc) moiety.
192. The method or use of claim 191, wherein the conjugate group comprises the following structure: 276 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application or .
193. The method or use of any one of claims 189-192, wherein the conjugate group comprises a conjugate linker consisting of a single bond and / or comprises a cleavable linker.
194. The method or use of any one of claims 189-193, wherein the conjugate group is attached to the 5’-terminal nucleoside or to the 3’-terminal nucleoside of the modified oligonucleotide.
195. The method or use of any one of claims 159-194, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 linked nucleosides.
196. The method or use of claim 195, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
197. The method or use of claim 195 or claim 196, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
198. The method or use of claim 196, wherein the deoxy region is flanked on the 5’-side by a 5’- region consisting of 1-6 nucleosides and on the 3’-side by a 3’-region consisting of 1-6 linked nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety.
199. The method or use of claim 198, wherein each nucleoside of the 3’-region comprises a modified sugar moiety and / or wherein each nucleoside of the 5’-region comprises a modified sugar moiety.
200. The method or use of any one of claims 199, wherein each nucleoside of the 5’-region independently is a cEt nucleoside, a 2’-OMe nucleoside, or a 2’-MOE nucleoside and each nucleoside of the 3’-region independently is a cEt nucleoside, a 2’-OMe nucleoside, or a 2’-MOE nucleoside.
201. The method or use of any one of claims 195-200, wherein the modified oligonucleotide has a 5’-region consisting of 3 linked nucleosides, a deoxy region consisting of 6-10 linked nucleosides, and a 3’- region consisting of 1-6 linked nucleosides.
202. The method or use of any one of claims 195-200, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from: eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddkkk, kkkddddddddddkkk, or eeeeeddddddddddeeeee; wherein ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, ‘d’ represents an unmodified DNA sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety. 277 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application 203. The method or use of any one of claims 159-202, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
204. The method or use of any one of claims 159-202, wherein the modified oligonucleotide has an internucleoside linkage motif of soossssssssssos; wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.
205. A method for reducing the amount of angiotensinogen (AGT) RNA and / or AGT protein in a subject who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; wherein: the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
206. A method of treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, comprising administering about 15 mg to about 200 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure, wherein the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides, and wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the amount of AGT RNA and / or AGT protein in the subject is decreased by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
207. Use of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein: 278 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides and wherein the modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an heart by of withfailure with preserved ejection fraction (HFpEF).
208. Use of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein: the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
209. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
210. Use of 60 mg to 120 mg of an oligomeric agent or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the 279 57983492.1Attorney Docket: 277023 / BIOL0479WO / 556906 PCT Application oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof. 280 57983492.1207. Use of an oligomeric agent or salt thereof for treating heart failure in a subject having or at risk for heart failure who is or is at risk of being intolerant to treatment with a renin-angiotensin-aldosterone system (RAAS) inhibitor, wherein: the oligomeric agent comprises a modified oligonucleotide consisting of 16-30 linked nucleosides wherein the modified oligonucleotide comprises a nucleobase sequence of at least 16 contiguous nucleosides and wherein the modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2, or salt thereof to a subject having or at risk for heart failure; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
208. Use of an oligomeric agent or salt thereof in the manufacture of a medicament for reducing the amount of AGT RNA and / or AGT protein in a subject or for treating heart failure and / or ameliorating one or more symptoms of heart failure, wherein: the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof; and wherein the subject has or is at risk for heart failure with reduced ejection fraction (HFrEF), heart failure with mid-range ejection fraction (HFmrEF), heart failure with improved ejection fraction (HFimpEF), or heart failure with preserved ejection fraction (HFpEF).
209. A method for reducing AGT RNA and / or AGT protein in a subject, comprising administering 60 mg to 120 mg of an oligomeric agent or salt thereof to a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95%287SUBSTITUTE SHEET (RULE 26)compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.
210. Use of 60 mg to 120 mg of an oligomeric agent or a salt thereof for reducing AGT RNA and / or AGT protein in a subject having or at risk for heart failure with reduced ejection fraction (HFrEF); wherein the oligomeric agent comprises a modified oligonucleotide consisting of 12-80 linked nucleosides, wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides at least 80% complementary to the nucleobase sequence of an equal length region of SEQ ID NO: 1 or SEQ ID NO: 2; and wherein the oligomeric agent decreases the amount of AGT RNA and / or AGT protein in a subject by at least 70%, at least 75%, at least 80% or at least 85% and less than 95% compared to the baseline amount of AGT RNA and / or AGT protein in the subject prior to any administration of the oligomeric agent or salt thereof.288SUBSTITUTE SHEET (RULE 26)