Methods for treating multiple sclerosis and other autoimmune diseases using Anti-cd19 car-t cell therapies
Patent Information
- Application Number
- EP2024886909
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-14
- Filing Date
- 2024-10-31
- Publication Date
- 2026-09-09
AI Technical Summary
Current therapies for multiple sclerosis (MS) are limited in their ability to effectively manage progressive forms of the disease and often come with significant adverse effects, necessitating the development of new treatments that can target B cells associated with MS relapses and progression.
The use of T cells engineered to express anti-CD19 chimeric antigen receptors (CARs), which can selectively deplete B cells responsible for MS symptoms, providing a potential alternative to conventional therapies with reduced toxicity and improved efficacy.
The anti-CD19 CAR therapy effectively reduces or depletes B cells at sites inaccessible to conventional MS treatments, offering a promising approach for managing both relapsing and progressive forms of MS with potentially fewer adverse effects.
Smart Images

Figure US2024053943_08052025_PF_FP_ABST
Abstract
Description
METHODS FOR TREATING MULTIPLE SCLEROSIS AND OTHER AUTOIMMUNE DISEASES USING ANTLCD19 CAR-T CELL THERAPIESRELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 594,837, filed on October 31, 2023; U.S. Provisional Patent Application No. 63 / 620,723, filed on January 12, 2024; U.S. Provisional Patent Application No.63 / 549,317, filed on February 2, 2024; and U.S. Provisional Patent Application No.63 / 660,411, filed on June 14, 2024, the entire contents of each of which are incorporated by reference herein for all purposes.TECHNICAL FIELD
[0002] The present disclosure generally relates to T cells engineered to express chimeric antigen receptors (CARs) (e.g., fully human anti-CD19 CARs) and their use in the treatment and / or prevention of autoimmune diseases, including multiple sclerosis, autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA- associated vasculitis, chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), neuromyelitis optica spectrum disorder (NMOSD), and idiopathic inflammatory myopathy (IIM) (e.g., antisynthetase syndrome (ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM)).BACKGROUND
[0003] Autoimmune diseases contribute substantially to morbidity, mortality, and health care cost each year. More than 50 million Americans are currently living with an autoimmune disease. Autoimmunity is the highest cause of morbidity in women in the United States and is one of the top 10 causes of death in women under the age of 65. Autoimmune diseases are frequently chronic illnesses, and it is estimated that more than 100 billion health care dollars are spent each year in the management of autoimmune patients, which places autoimmunity among the most costly diseases to diagnose and treat. There remains a need for new therapies to treat autoimmune diseases.
[0004] Multiple sclerosis (MS) is the most common immune-mediated disorder affecting the central nervous system. In 2020, there were an estimated ~2.8 million people living with MS globally. The disease usually begins between the ages of 20 and 40 and is twice as common in women as in men. MS is a demyelinating disease, in which the insulating myelinsheath surrounding nerve cells in the brain and spinal cord are attacked by the immune system resulting in the formation of plaques or scars called lesions. This damage disrupts the ability of parts of the nervous system to transmit signals, resulting in a range of clinical manifestations including physical, mental, and sometimes psychiatric problems. Specific symptoms can include double vision, visual loss, muscle weakness, and trouble with sensation or coordination.
[0005] The progression of MS from patient to patient is variable, with new symptoms occurring in isolated attacks (relapsing forms) or building up over time (progressive forms). The most common form of MS is relapsing -remitting MS (RRMS), which is characterized by unpredictable relapses (e.g., caused by new lesion formation in the brain or spinal cord) followed by periods of months or years of remission with no new signs of disease activity. Secondary progressive MS (SPMS) occurs in around 65% of those with initial RRMS, who eventually have progressive neurologic decline between acute attacks without any definite periods of remission. Occasional relapses and minor remissions may appear. The most common length of time between disease onset and conversion from RRMS to SPMS is 19 years. Primary progressive MS (PPMS) occurs in roughly 10-20% of individuals with the disease, with no remission after the initial symptoms of MS appear. It is characterized by progression of disability from onset, with no, or only occasional and minor, remissions and improvements. The usual age of onset for the primary progressive subtype is later than of the relapsing-remitting subtype. It is similar to the age that secondary progressive usually begins in RRMS, around 40 years of age.
[0006] There is no cure for MS. Accordingly, the primary aims of existing therapies are returning function after a relapse, preventing new relapses, and preventing disability. Notably, most therapeutic options for treating MS are not suitable for use in patients with progressive forms. Initial management of an acute MS flare up typically includes administration of high doses of corticosteroids; however, corticosteroids only work short term in reliving some symptoms associated with the disease. For chronic management, MS is generally treated with medications known as disease-modifying therapies (DMTs), which merely alter the course of the disease e.g., increase time between relapses). Nevertheless, many therapies used for chronic management of MS, including DMTs, have been observed to have serious adverse effects (e.g., liver damage, systolic dysfunction, infertility, cancer, progressive multifocal leukoencephalopathy, hypertension, slowed heart rate, macular edema, and lymphocyte reduction), and accordingly, may be poorly tolerated when used as a longterm therapeutic option. As such, there remains a need for new therapies that overcome these limitations.SUMMARY
[0007] The present disclosure appreciates that while T cells are widely considered to be major contributors to inflammatory demyelination in MS, growing evidence suggests a significant role for B cells in disease pathogenesis. Indeed, both antibody-dependent and independent mechanisms are thought to underlie B-cell mediated central nervous system (CNS) injury in MS. In addition to antibody secretion by plasmablasts and plasma cells, B- cell functions implicated in pathogenesis include (i) antigen presentation to T cells driving proliferation of brain-homing T cells (e.g., by memory B cells), (ii) production of pro- inflammatory cytokines and chemokines that propagate inflammation, (iii) production of soluble toxic factors contributing to oligodendrocyte and neuronal injury, (iv) contribution to the formation of ectopic lymphoid aggregates in the meninges, and (v) providing a reservoir for Epstein-Barr (EBV) virus infection. These B cell actions may contribute to both MS relapses and disease progression. The present disclosure provides, among other things, methods and compositions for treating a subject with multiple sclerosis (e. ., relapsing forms and progressive forms of MS) with T cells engineered to express an anti-CD19 CAR construct, which reduces or depletes B cells associated with one or more clinical manifestations of MS.
[0008] Provided herein are methods and compositions for treating a subject with multiple sclerosis. Notably, provided herein are methods and compositions for treating a subject with multiple sclerosis for which conventional therapeutic regimens (e.g., corticosteroids, immunomodulators, DMTs, etc.) have been shown to be ineffective or intolerable (e.g., due to their toxicity profiles or limitations in their pharmacological action, e.g., inability to prevent or slow formation of new MS lesions and / or progressive disability). In some embodiments, conventional therapeutic regimens (i.e., standard of care (SOC) therapy, such as corticosteroids, DMTs, immunomodulators, etc.) are withdrawn so that patients are free of any supportive drugs for a duration of time (e.g., at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 6 months, 8 months, 1 year, 2 years, 3 years, or more) after receiving provided methods and compositions. In some embodiments, conventional therapeutic regimens (i.e., SOC therapy, such as corticosteroids, DMTs, immunomodulators, etc.) are withdrawn ahead of collecting host cells (e.g., lymphocytes,such as T cells) to be engineered by any method described herein (e.g., at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 day, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, or more before collecting host cells). Further provided herein are methods and compositions for treating a subject with multiple sclerosis, where said methods and compositions are used in place of known conventional therapeutic regimens. In some embodiments, the multiple sclerosis is RRMS, SPMS, or PPMS. In some embodiments, the multiple sclerosis is RRMS. In some embodiments, the multiple sclerosis is SPMS. In some embodiments, the multiple sclerosis is PPMS. In some embodiments, the multiple sclerosis is refractory MS. In some embodiments, the multiple sclerosis is progressive MS. In some embodiments, the present disclosure provides for methods and compositions that result in elimination of B cells at tissue sites (e.g., in a subject with multiple sclerosis) normally not accessible to, or targeted by, conventional MS treatments.
[0009] The methods of the present disclosure use T cells engineered to express anti-CD19 CAR constructs, which can reduce or deplete B cells responsible for one or more clinical symptoms of multiple sclerosis. In many embodiments, the anti-CD19 CAR constructs have a lower toxicity profile as compared to conventional treatment (e.g., the anti-CD19 CAR constructs results in fewer adverse side effects as compared to conventional treatment). In some embodiments, an anti-CD19 CAR is substantially non-toxic to a subject receiving treatment with the CAR therapy. In some embodiments, such low toxicity or non-toxic CAR therapies provided by the present disclosure allow for higher doses and / or multiple doses (e.g., chronic administration) which result in depletion of B cells at sites not treatable with conventional autoimmune treatments due to their toxicity profile. Indeed, CAR therapies provided herein remarkably exhibit low levels of toxicity commonly associated with CAR therapy (e.g., anti-CD19 CAR therapy), including cytokine-release syndrome (CRS) and neurologic toxicities. In some embodiments, the present disclosure provides methods of and compositions for treating multiple sclerosis (e.g., relapsing forms of MS such as RRMS, or progressive forms of MS such as SPMS or PPMS) with an anti-CD19 CAR. In many embodiments of any of the provided methods and compositions described herein, an antiCD 19 CAR comprises a fully human chimeric antigen receptor comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the intracellular domain comprises a cytoplasmic signaling domain and one or more costimulatory domains. See, e.g., U.S. Patent No. 10,287,350, which is incorporated by reference herein in its entirety.
[0010] The present disclosure provides, among other things, a method of treating multiple sclerosis, the method comprising administering to a subject in need thereof a therapeutically effective amount of T cells that comprises a vector comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises, from N-terminus to C- terminus: (a) an antigen-binding fragment of an anti-CD19 antibody; (b) a transmembrane domain; and (c) an intracellular T cell signaling domain from human CD3^.
[0011] In some embodiments, an anti-CD19 antibody is a human antibody.
[0012] In some embodiments, an antigen-binding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 1, 2, and 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively.
[0013] In some embodiments, an antigen-binding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 25, 26, and 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively.
[0014] In some embodiments, a heavy chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 7, and the light chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 8. In some embodiments, a heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 8.
[0015] In some embodiments, an antigen-binding fragment of the anti-CD19 antibody comprises the amino acid sequence of SEQ ID NO: 17.
[0016] In some embodiments, a transmembrane domain is from human CD8.
[0017] In some embodiments, a transmembrane domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 11. In some embodiments, a transmembrane domain comprises the amino acid sequence of SEQ ID NO: 1 1.
[0018] In some embodiments, an intracellular T cell signaling domain from human CD3^ comprises an amino acid sequence at least 90% identical to SEQ ID NO: 23. In some embodiments, an intracellular T cell signaling domain from human CD3^ comprises the amino acid sequence of SEQ ID NO: 23.
[0019] In some embodiments, a CAR further comprises an intracellular T cell signaling domain from human CD28. In some embodiments, an intracellular T cell signaling domain from human CD28 comprises the amino acid sequence of SEQ ID NO: 21.
[0020] In some embodiments, a CAR does not comprise an intracellular T cell signaling domain from 4- IBB.
[0021] In some embodiments, a CAR comprises an amino acid sequence of SEQ ID NO: 10 or 13.
[0022] In some embodiments, a vector is a lentivirus vector. In some embodiments, a vector further comprises a murine stem cell virus (MSCV) U3 promoter operably linked to the nucleic acid.
[0023] In some embodiments, at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the provided T cells express a CAR (e.g., any CAR provided herein). In some embodiments, provided T cells comprise at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%) of CD8+ cytotoxic T cells. In some embodiments, provided T cells comprise at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%) of CD4+ helper T cells.
[0024] In some embodiments, the multiple sclerosis is RRMS, SPMS, or PPMS. In some embodiments, the multiple sclerosis is RRMS. In some embodiments, the multiple sclerosis is SPMS. In some embodiments, the multiple sclerosis is PPMS. In some embodiments, the multiple sclerosis is refractory to a conventional therapeutic regimen such as a corticosteroid or a disease-modifying therapy. In some embodiments, the multiple sclerosis is refractory to a DMT such as an anti-CD20 antibody. In some embodiments, the multiple sclerosis is progressive MS.
[0025] In some embodiments, the multiple sclerosis is PPMS or SPMS refractory to an anti-CD20 antibody therapy. In some embodiments, the multiple sclerosis is PPMS or SPMS and is diagnosed according to the 2017 McDonald criteria. In some embodiments, a subject with PPMS or SPMS has an expanded disability status scale (EDSS) of 3.0 to 5.5. In some embodiments, a subject has continuing evidence of worsening physical disability over a period of 6 months or longer, with documented evidence of clinical disability progression. In some embodiments, a subject has a baseline EDSS less than or equal to 5.5, and a sustained increase of EDSS by at least 1 point. In some embodiments, a subject has a baseline EDSS greater than 5.5, and a sustained increase of EDSS by at least 0.5 point. In some embodiments, a subject has an increase of timed 25-foot walk (TW25) by at least 20% in thelast 2 years sustained for at least 6 months. In some embodiments, a subject has a documented change in neurological examination despite at least 1 year of prior treatment with the anti-CD20 antibody. In some embodiments, a documented change in neurological examination comprises a change in mental status, cranial nerves, motor, sensory, or gait domains. In some embodiments, a subject has active SPMS and further has inadequate response or intolerance to an additional disease-modifying therapy. In some embodiments, an additional disease-modifying therapy comprises a sphingosine- 1 -phosphate receptor modulator.
[0026] In some embodiments, the subject exhibits progression independent of relapse activity (PIRA).
[0027] In some embodiments, the treatment (e.g., any T cell treatment provided herein) is administered as a first-line therapy.
[0028] In some embodiments, a therapeutically effective dose is in a range of about 2xl07to 5xl07, about 2xl07to 4xl07, about 2xl07to 3xl07, about 3xl07to 5xl07, about 4xl07to 5xl07, about 5xl07to IxlO8, about 5xl07to 9xl07, about 5xl07to 8xl07, about 5xl07to 7xl07, about 5xl07to 6xl07, about 6xl07to IxlO8, about 7xl07to 1x10s, about 8xl07to 1x10s, about 9xl07to IxlO8, about 6xl07to 9xl07, or about 7xl07to 8xl07of the T cells. In some embodiments, a therapeutically effective dose is in a range of about 5xl07to IxlO8of the T cells. In some embodiments, a therapeutically effective dose is about 5xl07of the T cells. In some embodiments, a therapeutically effective dose is about IxlO8of the T cells. In some embodiments, a therapeutically effective dose is about 0.33x10sof the T cells.
[0029] In some embodiments, provided T cells are administered by intravenous infusion. In some embodiments, provided T cells are administered by intrathecal infusion.
[0030] In some embodiments, the subject receives a single dose of the T cells.
[0031] In some embodiments, the subject has received a lymphodepletion treatment. In some embodiments, the subject has received a minimized lymphodepletion treatment resulting in about 50% reduction of lymphocytes in the subject relative to the subject before receiving lymphodepletion treatment or another suitable control. In some embodiments, the subject has not received a lymphodepletion treatment.
[0032] Also provided herein are methods and compositions for treating a subject with an autoimmune disease, such as autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), neuromyelitis optica spectrum disorder (NMOSD), and idiopathic inflammatory myopathy (IIM) (e.g., antisynthetase syndrome(ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM)).
[0033] In some embodiments of any one of the methods and compositions for use provided herein, the subject has received a lymphodepletion treatment. In some embodiments, lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 300 mg / m2) and of fludarabine (e.g., at a dose of 30 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 5 to 7 days prior to administration of the T cells. In some embodiments, lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 300 mg / m2) and of fludarabine (e.g., at a dose of 30 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 6 days prior to administration of the T cells. In some embodiments, lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 300 mg / m2) and of fludarabine (e.g., at a dose of 30 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 5 days prior to administration of the T cells. In some embodiments, the subject does not receive a lymphodepletion treatment prior to administration of the T cells. In some embodiments, the subject has received a minimized lymphodepletion treatment. In some embodiments, a minimized lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 150 mg / m2) and of fludarabine (e.g., at a dose of 15 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 5 to 7 days prior to administration of the T cells. Tn some embodiments, a minimized lymphodepletion treatment reduces lymphocytes in a subject by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% relative to the subject before receiving lymphodepletion treatment or another suitable control. In some embodiments, the subject has received a minimized lymphodepletion treatment resulting in about 50% reduction of lymphocytes in the subject relative to the subject before receiving lymphodepletion treatment or another suitable control. In some embodiments, the subject has not received a lymphodepletion treatment. In some embodiments, lymphodepletion treatment comprises intravenous administration of fludarabine at 25 mg / m2once every day for 3 days starting 5 days prior to administration of the provided T cells and cyclophosphamide at 1000 mg / m2once (i.e. , only one dose) 3 days prior to administration of the provided T cells. In some embodiments, lymphodepletion treatment comprises intravenous administration of fludarabine at 12.5 mg / m2once every day for 3 days starting 5 days prior to administration of the provided T cells and cyclophosphamide at 500 mg / m2once (i.e., only one dose) 3 days prior toadministration of the provided T cells. In some embodiments, a subject that has been administered a provided CAR T therapy will be administered cotrimoxazole and acyclovir for at least one, at least two, at least three, at least four, or more months after receiving the provided CAR T therapy.
[0034] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, patent application, or item of information was specifically and individually indicated to be incorporated by reference. To the extent publications, patents, patent applications, and items of information incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.
[0035] Where values are described in terms of ranges, it should be understood that the description includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used in accordance with the present disclosure, suitable methods and materials are described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0037] The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and drawings, and from the claims.BRIEF DESCRIPTION OF THE DRAWINGS
[0038] FIG. 1 is a schematic of a lentivirus vector encoding an anti-CD19 CAR transgene.
[0039] FIG. 2, panel A, is a schematic timeline for Patient 1. FIG. 2, panel B, is a summary of blood CAR-T cell expansion, expanded disability status scale (EDSS), and episodes of cytokine release syndrome (CRS; indicated by red vertical bars) during theobservational period for Patient 1. FIG. 2, panel C, is a schematic timeline for Patient 2. FIG. 2, panel D, is a summary of blood CAR-T cell expansion, expanded disability status scale (EDSS), and episodes of cytokine release syndrome (CRS; indicated by red vertical bars) during the observational period for Patient 2.
[0040] FIG. 3, panel A, is a graph showing daily maximum body temperature for Patient 1. FIG. 3, panel B, is a graph showing a levels of aspartate aminotransferase (ASAT) in Patient 1. FIG. 3, panel C, is a graph showing lymphocyte count after lymphodepletion with sufficient lymphocyte suppression in Patient 1. FIG. 3, panel D, is a graph showing daily maximum body temperature for Patient 2. FIG. 3, panel E, is a graph showing a levels of aspartate aminotransferase (ASAT) in Patient 2. FIG. 3, panel F, is a graph showing lymphocyte count after lymphodepletion with sufficient lymphocyte suppression in Patient 2.
[0041] FIG. 4, panel A, shows a representative flow cytometric analysis of CAR positive T cells in the peripheral blood at day 10 of Patient 1 with gating on living CD45+CD3+ cells. FIG. 4, panel B, shows a sagittal spinal cord MRI of Patient 1 at baseline and day +64 with newly developed T2 lesion at Th2 / Th3 (marked with white arrow head).
[0042] FIG. 5, panel A, is a graph showing CAR-T cell expansion measured in the blood in Patient 1. FIG. 5, panel B, is a graph showing CAR-T cell expansion measured in the blood in Patient 2. FIG. 5, panel C, is a graph showing CAR-T cell expansion in the CSF in Patient 1. FIG. 5, panel D, is a graph showing CAR-T cell expansion in the CSF in Patient 2. FIG. 5, panel E, is a graph showing CAR-T cell expansion in the blood and CSF proportional to all leukocytes showing an enrichment of CAR-T cells in the CSF compared to the blood in Patient 1. FIG. 5, panel F, is a graph showing CAR-T cell expansion in the blood and CSF proportional to all leukocytes showing an enrichment of CAR-T cells in the CSF compared to the blood in Patient 2. FIG. 5, panel G, is a graph showing B cell counts measured using flow cytometry in Patient 1. FIG. 5, panel H, is a graph showing B cell counts measured using flow cytometry in Patient 2. FIG. 5, panel I, is a graph showing measurement of immunoglobulin G (IgG) in serum and CSF in Patient 1. FIG. 5, panel J, is a graph showing measurement of immunoglobulin G (IgG) in serum and CSF in Patient 2. FIG. 5, panel K, is a graph showing assessment of CSF oligoclonal bands (OCBs; measured by standardized isoelectric focusing confirmed by two independent assessors based on two technical replicates) in Patient 1. FIG. 5, panel L, is a graph showing assessment of CSF oligoclonal bands (OCBs; measured by standardized isoelectric focusing confirmed by two independent assessors based on two technical replicates) in Patient 2.
[0043] FIG. 6 is a set of graphs showing measurements for CAR T cells in blood and CSF, and change in oligoclonal bands, in Patients 1-5.DETAILED DESCRIPTION
[0044] The present disclosure provides methods and compositions that can be used to treat a subject identified as having multiple sclerosis (MS). In some embodiments, the multiple sclerosis is relapsing-remitting MS (RRMS), secondary progressive MS (SPMS), or primary progressive MS (PPMS). In some embodiments, the multiple sclerosis is RRMS. In some embodiments, the multiple sclerosis is SPMS. In some embodiments, the multiple sclerosis is PPMS. In some embodiments, the multiple sclerosis is refractory MS. In some embodiments, the multiple sclerosis is progressive MS.
[0045] In some embodiments, a subject to be treated by a provided method or composition is identified as having MS (e.g., RRMS, SPMS, PPMS) according to the 2017 McDonald Criteria. In some embodiments, a subject is identified as having MS (e.g., RRMS, SPMS, PPMS) according to the 2014 Lublin MS phenotypic criteria.
[0046] The present disclosure provides, among other things, methods and compositions for reducing the number of B cells (e.g., CD19-expressing B cells) in a tissue in a subject having multiple sclerosis. The present disclosure also provides engineered T cells (e.g., T cells engineered to express any CAR described herein) and method of making engineered T cells for use in treating multiple sclerosis.
[0047] The present disclosure also provides methods and compositions that can be used to treat a subject identified as having autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), neuromyelitis optica spectrum disorder (NMOSD), or idiopathic inflammatory myopathy (IIM) (e.g., antisynthetase syndrome (ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM)) using the engineered T cells.
[0048] The present disclosure appreciates that B cells express a wide array of cell surface molecules during their differentiation and proliferation, e.g., CD 19. CD 19 is widely expressed on B cells during all phases of B cell development from pro-B cells to plasmablasts. The present disclosure further appreciates, that because of the ubiquity of CD19 on B cells, CD 19 can function as a therapeutic target for certain provided methods and compositions (e.g., methods and compositions for treating multiple sclerosis). Accordingly,in some embodiments, provided herein are methods and compositions for reducing the number of B cells in a subject (e.g., in a tissue of a subject) via targeting of CD 19. In some embodiments, the present disclosure provides for methods and compositions for treating a subject having multiple sclerosis via targeting of CD19. In some embodiments, the present disclosure provides for engineered T cells that target CD 19. In some embodiments, the present disclosure provides for engineered nucleic acids that express one or more polypeptides that target CD19. In many embodiments of the present disclosure a CAR that binds to CD19 is used to target cells that express CD19 e.g., B cells).Definitions
[0049] “About” a number, as used herein, refers to range including the number and ranging from 10% below that number to 10% above that number. “About” a range refers to 10% below the lower limit of the range, spanning to 10% above the upper limit of the range.
[0050] As used herein, the term “antibody” refers to any immunoglobulin, whether naturally occurring or wholly or partially synthetically produced. All derivatives thereof which maintain specific binding ability are also included in the term. In some embodiments, the term “antibody” refers to any protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. Antibody proteins may be derived from natural sources, or partly or wholly synthetically produced. An antibody may be monoclonal or polyclonal. An antibody may be a member of any immunoglobulin class, including any of the human classes: IgG, IgM, IgA, IgD, and IgE. In certain embodiments, an antibody may be a member of the IgG immunoglobulin class.
[0051] As used herein, “derived from” or “derivative” indicates a structural similarity and a functional similarity between a subject molecule and a reference molecule (e.g., between polynucleotides, polypeptides, etc.). With respect to structural similarity, the subject molecule does not necessarily comprise the same sequence (e.g., nucleic acid sequence, amino acid sequence, etc.) as the reference molecule, but has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity to the sequence (e.g., nucleic acid sequence, amino acid sequence, etc.) of the reference molecule or a fragment thereof, the fragment comprising at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of the sequence of the reference molecule. With respect to functional similarity, the subject molecule has at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of an activity of the reference molecule or the fragment thereof as determined in a suitableassay. For example, a subject polypeptide may be considered to be derived from a reference polypeptide when the subject polypeptide has structural similarity, as defined above, to the reference polypeptide and retains certain function(s), such as certain intermolecular or intramolecular interactions (e.g., binding to a protein, e.g., a particular receptor, or a signaling activity), though such interactions could be stronger, equivalent, or weaker than that of the reference polypeptide. As another non-limiting example, a subject polynucleotide may be considered to be derived from a reference polynucleotide when the subject polynucleotide has structural similarity to the reference polynucleotide, as defined above, and encodes a protein or protein fragment that is a derivative of the protein encoded by the reference polynucleotide, or has the same or similar function (e.g., as a regulatory element, e.g., promoter or enhancer) as the reference polynucleotide. Functional similarity takes into account the context of the disclosure. For example, when applied to a subject intracellular T cell signaling domain derived from a reference protein (e.g., CD3ij, CD28), the subject intracellular T cell signaling domain has structural and functional similarities to an intracellular T cell signaling domain of the reference protein as known in the art. Similarly, when applied to a subject transmembrane domains derived from a reference protein, the subject transmembrane domain has structural and functional similarities to a transmembrane domain of the reference protein as known in the art. In one non- limiting example, an intracellular T cell signaling domain derived from a CD3ij molecule retains sufficient CD3 j structure such that it has the ability to transduce a signal (e.g., ZAP-70 activation) under appropriate conditions.
[0052] As used herein, the term “functional fragment” of a reference biomolecule, e.g., a polynucleotide or polypeptide, refers to a shorter and / or smaller derivative of the reference biomolecule that has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of a fragment of the reference biomolecule.
[0053] As used herein the term “operably linked” refers to polynucleotide sequences placed into a functional relationship with one another. For instance, a promoter or enhancer is operably linked to a coding sequence if it regulates, or contributes to modulation of, the transcription of a coding sequence. Operably linked DNA sequences encoding regulatory sequences are typically contiguous to a coding sequence. However, enhancers can function when separated from a promoter by up to several kilobases or more. Additionally, multi- cistronic constructs can include multiple coding sequences which use only one promoter byincluding a 2A self-cleaving peptide, an IRES element, etc. Accordingly, some polynucleotide elements may be operably linked but not contiguous.
[0054] As used herein, the term “patient” or “subject” are used interchangeably to refer to any organism to which a compositions disclosed herein may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, a patient or subject is a human. In many embodiments, a patient is a human subject suffering from multiple sclerosis or another autoimmune disease. In some embodiments, a patient is an adult human subject suffering from multiple sclerosis for another autoimmune disease. In some embodiments, a patient (e.g., a patient having any of the diseases or disorders described herein) is an adult human. In some embodiments, a patient is an adult human subject 18 to 60 years of age.Chimeric Antigen Receptors
[0055] In some embodiments, a chimeric antigen receptor (CAR) of the present disclosure comprises an extracellular domain, a transmembrane domain, and an intracellular domain. In some embodiments, an extracellular domain is or comprises an antigen-binding domain (e.g., a CD19 binding domain, such as an anti-CD19 scFv). In some embodiments, the extracellular domain is or comprises a means for binding CD 19. In some embodiments, a transmembrane domain is or comprises a transmembrane domain or functional fragment thereof derived from any suitable cell membrane-associated polypeptide, e.g., obtained from a membrane-binding polypeptide or transmembrane polypeptide. In some embodiments, a transmembrane domain is or comprises a transmembrane domain or functional fragment thereof derived from a T cell receptor alpha chain, a T cell receptor beta chain, a CD3 zeta chain, a CD28 polypeptide, or a CD8 polypeptide (e.g., a CD8a polypeptide). In some embodiments, an intracellular domain is or comprises an intracellular signaling domain (e.g., any of intracellular signaling domains described herein, e.g., derived from a CD28 or CD3 polypeptide). In some embodiments, an intracellular signaling domain comprises one or more signaling sequences or motifs. In some embodiments, one or more signaling sequences, or signaling motifs, are essential for the functional signaling capacity of a polypeptide (e.g., an intracellular signaling domain). In some embodiments, a signaling sequence is a sequence derived from a CD3 polypeptide (e.g., a CD3 zeta polypeptide). In some embodiments, a signaling sequence is derived from a CD28 polypeptide. In some embodiments, a signaling sequence is or comprises a co-stimulatory domain (e.g., any co-stimulatory domain describedherein, e.g., derived from a CD28 polypeptide). In some embodiments, a CAR of the present disclosure is a human CAR.Extracellular Domain
[0056] In some embodiments, an extracellular domain used in accordance with the present disclosure comprises an antigen-binding domain (e.g., any antigen-binding domain described herein). The extracellular domain can be or include a means for binding CD 19 (e.g., human CD 19). In some embodiments, an antigen- binding domain is or comprises an antibody sequence (e.g., an immunoglobulin) or antigen-binding fragment thereof (e.g., any antibody or antigen-binding fragment thereof described herein). Anticalins or other alternative scaffolds are also contemplated.
[0057] In some embodiments, the antigen-binding domain comprises one or more Fab, Fab’, F(ab’)2, Fv, domain antibody (dAb), single-chain antibody (scFv), chimeric antibody, diabody, triabody, tetrabody, scAb, or single domain antibody (e.g., VHH or VNAR) polypeptide sequences. In some embodiments, the antigen-binding domain comprises at least a portion of an immunoglobulin that is sufficient to confer specific antigen-binding to a polypeptide (e.g., an antibody fragment comprising an antigen-binding portion). In some embodiments, the antigen-binding domain comprises an scFv. In some embodiments, the scFv comprises a VH and VL domain of an antibody. In some embodiments, the scFv comprises a spacer sequence between the VH and the VL. In some embodiments, the scFv comprises a spacer sequence as set forth in SEQ ID NO: 9 between the VH and the VL. In some embodiments, the antigen-binding domain is humanized, or fully human (e.g., derived from a suitable human polypeptide). Exemplary methods of generating fully human antibodies are described in Lu et al., (2020) J. Biomed. Sci. (2020) 27( 1) : 1.
[0058] In some embodiments, the antigen-binding domain binds to a target antigen (e.g., a polypeptide). In some embodiments, the antigen-binding domain binds specifically to a target antigen (e.g., a polypeptide). In some embodiments, the antigen-binding domain binds to a CD 19 polypeptide (e.g., a CD 19 polypeptide present at the surface of a cell, e.g., a B cell). In some embodiments, the antigen-binding domain binds specifically to a CD19 polypeptide. In some embodiments, the antigen- binding domain comprises an antibody, or antigen-binding fragment thereof, that binds to a CD 19 polypeptide. In some embodiments, the antigen-binding domain comprises a scFv sequence that binds to a CD 19 polypeptide (e.g., an anti-CD19 scFv).
[0059] It is generally understood that CD 19 expression is largely restricted to B lymphocytes. CD 19 has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. The CD 19 protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signaling pathway and the subsequent release of intracellular stores of calcium ions. An example of a human CD 19 polypeptide sequence includes, without limitation, NCBI reference sequence: NP_001171569.1, and fragments and derivatives thereof.
[0060] In some embodiments, an antigen-binding domain comprises a variable region of an anti-CD19 antibody. In some embodiments, an antigen-binding domain comprises a variable region of an anti-CD19 monoclonal antibody. In some embodiments, an antigenbinding domain comprises a variable region of a mouse or human anti-CD19 monoclonal antibody. An anti-CD19 monoclonal antibody can be obtained or derived from a subject (e.g., a mouse, a rat, a rabbit, a human, etc.) using any suitable method. In some embodiments, an antigen-binding domain comprises a light chain variable region and a heavy chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. In some embodiments, an antigen-binding domain comprises a light chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. In some embodiments, an antigenbinding domain comprises a heavy chain variable region of a mouse, human, or humanized anti-CD19 monoclonal antibody. The 47G4 antibody (described in U.S. Patent Application Publication No. 2010 / 0104509, which is incorporated herein by reference in its entirety) is one example of a human anti-CD19 monoclonal antibody that can be used in accordance with the present disclosure.
[0061] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1 , CDR2, and CDR3 amino acid sequences asset forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.
[0062] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.
[0063] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively. In some embodiments, the antigenbinding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 1 , SEQ ID NO: 2, and SEQ ID NO: 3, respectively.
[0064] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 3, respectively. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 3, respectively.
[0065] In some embodiments, the antigen-binding domain that binds CD 19 comprises a light chain variable domain, the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively. In some embodiments, the antigenbinding domain that binds CD 19 comprises a light chain variable domain, the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.
[0066] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 7, and the light chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 7, and the light chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 7, and the light chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 7, and the light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 8.
[0067] In some embodiments, the antigen- binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 7. In some embodiments, the antigen-binding domain that binds CD19 comprises a heavy chain variable domain, the heavy chain variable domain comprising anamino acid sequence with at least 90% sequence identity to SEQ ID NO: 7. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 7. In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain, the heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 7.
[0068] In some embodiments, the antigen- binding domain that binds CD 19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD 19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 8. In some embodiments, the antigen-binding domain that binds CD19 comprises a light chain variable domain, the light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 8.
[0069] In some embodiments, the antigen-binding domain that binds CD 19 comprises a spacer sequence between two domains or components. In some embodiments, an antigenbiding domain comprises a spacer sequence between a heavy chain variable domain and a light chain variable domain. In some embodiments, a spacer comprises a sequence as set forth in SEQ ID NO: 9.
[0070] In some embodiments, the antigen-binding domain that binds CD 19 comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 17. In some embodiments, the antigen-binding domain that binds CD 19 comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 17. In some embodiments, the antigen-binding domain that binds CD19 comprises an amino acid sequence as set forth in SEQ ID NO: 17.
[0071] In some embodiments, the antigen-binding domain that binds CD 19 is encoded by a nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 18. In some embodiments, the antigen-binding domain that bindsCD19 is encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 18. In some embodiments, an antigen-binding domain is encoded a nucleic acid sequence as set forth in SEQ ID NO: 18.
[0072] Other antigen-binding domains that bind CD 19 can also be included in the CAR disclosed herein. Exemplary antigen-binding domains are described in International Application Publication No. WO2017062952 and U.S. Application Publication No. US20220220200.
[0073] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 35, 36, and 37, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 38, 39, and 40, respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 29, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 30.
[0074] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1 , CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 41, 42, and 43, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 44, 45, and 46, respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 31, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 32.
[0075] In some embodiments, the antigen-binding domain that binds CD 19 comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 47, 48, and 49, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences as set forth in SEQ ID NOs: 50, 51, and 52,respectively. In some embodiments, the heavy chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 33, and the light chain variable domain comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 34.
[0076] In some embodiments, the extracellular domain of the CAR further comprises a hinge region. In some embodiments, a hinge region is positioned between (e.g., links together), an extracellular domain and a transmembrane domain. In some embodiments, the hinge region is a short sequence of amino acids that can facilitate structural flexibility between polypeptide domains, e.g., between an extracellular domain and a transmembrane domain (see, e.g. Woof et al., Nat. Rev. Immunol. 4(2):89-99 (2004)). In some embodiments, a hinge region may include all, or a portion of, an extracellular region of any suitable transmembrane protein (e.g., CD8a).
[0077] In some embodiments, the hinge region is derived from a CD8a protein or a CD28 protein. In some embodiments, a hinge region is derived from a CD8a protein. In some embodiments, the hinge region is derived from a CD28 protein. In some embodiments, a hinge region is or comprises a hinge region or functional fragment thereof from a CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a CD8a protein. In some embodiments, the hinge region is derived from a human CD8a protein or a human CD28 protein. In some embodiments, the hinge region is derived from a human CD8a protein. In some embodiments, the hinge region is derived from a human CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a human CD28 protein. In some embodiments, the hinge region is or comprises a hinge region or functional fragment thereof from a human CD 8 a protein.
[0078] In some embodiments, a hinge region comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 28. In some embodiments, a hinge region comprises an amino acid sequence as set forth in SEQ ID NO: 28. In some embodiments, a hinge region comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 56. Insome embodiments, a hinge region comprises an amino acid sequence as set forth in SEQ ID NO: 56.
[0079] In some embodiments, a hinge region is derived from the same polypeptide as a transmembrane domain. In some embodiments, a hinge region and a transmembrane domain are derived from a CD8 polypeptide. In some embodiments, a hinge region and a transmembrane domain are derived from a CD8a polypeptide. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 19. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 19. In some embodiments, a hinge region and transmembrane domain comprise an amino acid sequence as set forth in SEQ ID NO: 19.
[0080] In some embodiments, a hinge region and transmembrane domain are encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 20. In some embodiments, a hinge region and transmembrane domain are encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 20. In some embodiments, a hinge region and transmembrane domain are encoded by a nucleic acid sequence as set forth in SEQ ID NO: 20.Transmembrane Domain
[0081] In some embodiments, the transmembrane domain of the CAR is derived from a natural source (e.g., a natural or wild-type polypeptide). In some embodiments, the transmembrane domain, as used in accordance with the present disclosure, is derived from any suitable transmembrane protein or polypeptide known in the art. In some embodiments, a transmembrane domain is derived from a CD3 epsilon polypeptide, a CD4 polypeptide, a CD5 polypeptide, a CD8 polypeptide, a CD9 polypeptide, a CD 16 polypeptide, a CD22 polypeptide, a CD28 polypeptide, a CD33 polypeptide, a CD37 polypeptide, a CD45 polypeptide, a CD64 polypeptide, a CD80 polypeptide, a CD86 polypeptide, a CD 134 polypeptide, a CD 137 polypeptide, a CD 154 polypeptide, a T cell receptor alpha chain polypeptide, a T cell receptor beta chain polypeptide, a T cell receptor zeta chain polypeptide, or any combination thereof. In some embodiments, a transmembrane is or comprises a transmembrane domain or functional fragment thereof from a CD3 epsilon polypeptide, a CD4 polypeptide, a CD5 polypeptide, a CD8 polypeptide, a CD9 polypeptide, a CD 16polypeptide, a CD22 polypeptide, a CD28 polypeptide, a CD33 polypeptide, a CD37 polypeptide, a CD45 polypeptide, a CD64 polypeptide, a CD80 polypeptide, a CD86 polypeptide, a CD 134 polypeptide, a CD 137 polypeptide, a CD 154 polypeptide, a T cell receptor alpha chain polypeptide, a T cell receptor beta chain polypeptide, a T cell receptor zeta chain polypeptide, or any derivatives thereof and / or any combination thereof. In some embodiments, a transmembrane is synthetically derived, or engineered. In some embodiments, a synthetically derived or engineered transmembrane domain comprises predominantly hydrophobic residues (e.g., leucine, valine, etc.). In some embodiments, an engineered transmembrane domain is or comprises any engineered transmembrane domain known in the field.
[0082] The present disclosure appreciates that CD8 is a transmembrane glycoprotein that functions as a co-receptor for the T-cell receptor (TCR), and is expressed primarily on the surface of T-cells (e.g., cytotoxic T-cells). The most common form of CD8 exists as a dimer composed of a CD8a and CD8P chain. In some embodiments, a transmembrane domain is derived from a CD8a protein. In some embodiments, a transmembrane protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 11. In some embodiments, a transmembrane protein comprises an amino acid sequence as set forth in SEQ ID NO: 11. In some embodiments, a transmembrane protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 67. In some embodiments, a transmembrane protein comprises an amino acid sequence as set forth in SEQ ID NO: 67.
[0083] The present disclosure further appreciates that CD28 is expressed on T-cells and provides co-stimulatory signals required for T-cell activation. CD28 is the receptor for CD80 (B7.1) and CD86 (B7.2). In some embodiments, a CAR of the present disclosure comprises a CD28 transmembrane domain. In some embodiments, the transmembrane protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 12. In some embodiments, a transmembrane protein comprises an amino acid sequence as set forth in SEQ ID NO: 12.Intracellular Signaling Domain
[0084] In some embodiments, an intracellular signaling domain of the CAR disclosed herein is derived from a polypeptide found in humans (e.g., an intracellular signaling domainor fragment thereof found in any suitable human polypeptide). In some embodiments, the intracellular signaling domain provided herein is derived from a 4- IBB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcsRI polypeptide (e.g., an FcsRI gamma chain polypeptide), an FcyRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, 0X40 polypeptide, PD- 1 polypeptide, or any derivatives thereof or any combination thereof. In some embodiments, the intracellular signaling domain is derived from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain is derived from a CD28 polypeptide. In some embodiments, the intracellular signaling domain is derived from a CD28 polypeptide and a CD3 zeta polypeptide.
[0085] In some embodiments, the intracellular signaling domain comprises at least one intracellular signaling domain or functional fragment thereof from a 4- IBB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcsRI polypeptide (e.g. , an FcsRI gamma chain polypeptide), an FcyRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, 0X40 polypeptide, PD-1 polypeptide, or any derivatives thereof or any combination thereof. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain or functional fragment thereof from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide and an intracellular signaling domain or functional fragment thereof from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises, from N-terminus to C-terminus, an intracellular signaling domain or functional fragment thereof from a CD28 polypeptide and an intracellular signaling domain or functional fragment thereof from a CD3 zeta polypeptide.
[0086] In some embodiments, the intracellular signaling domain of the present disclosure comprises at least one signaling sequence from a 4- IBB polypeptide, a B7-H3 polypeptide, a CD2 polypeptide, a CD3 gamma polypeptide, a CD3 delta polypeptide, a CD3 zeta polypeptide, a CD7 polypeptide, a CD27 polypeptide, a CD28 polypeptide, a CD30 polypeptide, a CD40 polypeptide, an FcsRI polypeptide e.g., an FcsRI gamma chain polypeptide), an FcyRI polypeptide, LIGHT polypeptide, NKG2C polypeptide, 0X40polypeptide, PD-1 polypeptide, or any combination thereof. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD28 polypeptide. In some embodiments, the intracellular signaling domain comprises at least one signaling sequence from a CD28 polypeptide and at least one signaling sequence from a CD3 zeta polypeptide. In some embodiments, the intracellular signaling domain comprises, from N-terminus to C-terminus, at least one signaling sequence from a CD28 polypeptide and at least one signaling sequence from a CD3 zeta polypeptide.
[0087] In some embodiments, an intracellular signaling domain is or comprises at least one signaling sequence or signaling motif. In some embodiments, a signaling sequence (or signaling motif) comprises one or more (e.g., two, three, four, five, or more) co-stimulatory domains e.g., any co-stimulatory domain described herein). In some embodiments, a signaling sequence comprises one co-stimulatory domain. In some embodiments, a signaling sequence comprises two co-stimulatory domains. In some embodiments, a signaling sequence comprises three co-stimulatory domains. In some embodiments, a signaling sequence comprises two or more of the same co-stimulatory domains. In some embodiments, a signaling sequence comprises two or more different co-stimulatory domains.
[0088] In some embodiments, a signaling sequence as used in accordance with the present disclosure is or comprises one or more immunoreceptor tyrosine-based activation motifs (IT AMs). In some embodiments, a signal sequence is or comprises a consensus sequence of YXXL / I, where Y is a tyrosine residue, L / I is a leucine or isoleucine residue, and X is any amino acid residue. In some embodiments, a signal sequence is or comprises a consensus sequences of YXXL / IX(6-8)YXXL (SEQ ID NO: 54), where Y is a tyrosine residue, L / I is a leucine or isoleucine residue, and X is any amino acid residue. In some embodiments, a signaling sequence comprises a YNMN (SEQ ID NO: 53) motif. In some embodiments, a signaling sequence comprises at least one IT AM sequence from a CD3 polypeptide (e.g., a CD3 zeta polypeptide). In some embodiments, a signaling sequence comprises at least one IT AM sequence from a CD28 polypeptide.
[0089] It is understood that the most common intracellular signaling domain used in CAR therapies is an intracellular signaling domain of CD3 zeta (CD3Q. CD3 zeta associates with T cell receptors to produce a signal and contains IT AMs. In some embodiments, an intracellular signaling domain is or comprises a CD3 zeta intracellular signaling domain. Insome embodiments, an intracellular signaling domain comprises an intracellular signaling domain or a functional fragment thereof from a CD3 zeta polypeptide.
[0090] In some embodiments, an intracellular signaling domain comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 23. In some embodiments, an intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 23. In some embodiments, an intracellular signaling domain comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 65. In some embodiments, an intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 65.
[0091] In some embodiments, an intracellular signaling domain is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 24. In some embodiments, an intracellular signaling domain is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 24.
[0092] In some embodiments, an intracellular signaling domain comprises a CD28 intracellular signaling domain. In some embodiments, an intracellular signaling domain comprises an intracellular signaling domain or a functional fragment thereof from a CD28 polypeptide. In some embodiments, a CD28 polypeptide intracellular signaling domain or functional fragment thereof comprises a co- stimulatory domain.
[0093] In some embodiments, an intracellular signaling domain disclosed herein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 21. In some embodiments, the intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 21.
[0094] In some embodiments, an intracellular signaling domain is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 22. In some embodiments, an intracellular signaling domain is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 22.
[0095] In some embodiments, an intracellular signaling domain comprises a 4- IBB intracellular signaling domain. In some embodiments, an intracellular signaling domaincomprises an intracellular signaling domain or a functional fragment thereof from a 4- IBB polypeptide. In some embodiments, a 4- IBB polypeptide intracellular signaling domain or functional fragment thereof comprises a co- stimulatory domain.
[0096] In some embodiments, an intracellular signaling domain disclosed herein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 57. In some embodiments, the intracellular signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 57.Chimeric Antigen Receptors (CARs)
[0097] In some embodiments, a CAR of the present disclosure comprises an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises a signal peptide sequence (also referred to as a targeting signal, localization signal, localization sequence, leader sequence, or leader peptide), an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises, from N-terminus to C-terminus, an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, a CAR of the present disclosure comprises, from N-terminus to C-terminus, a signal peptide sequence, an extracellular domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the signal peptide sequence is cleaved from the CAR during or after its insertion into a membrane (e.g., ER membrane) during synthesis of the CAR protein. In some embodiments, domains or components (e.g., extracellular domains, hinge regions, transmembrane domains, intracellular signaling domains, etc.) of a CAR are directly linked, or are contiguous. In some embodiments, domains or components of a CAR are not-directly linked, or are non-contiguous.
[0098] In some embodiments, a CAR as described herein comprises an intracellular signaling domain, wherein the intracellular signaling domain comprises: (a) a CD3 zeta intracellular signaling domain or functional fragment thereof; and (b) at least one of a 4- IBB, an 0X40, or a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a 4- IBB intracellular signaling domain or functional fragment thereof, an 0X40 intracellular signaling domain, and / or a CD28 intracellular signaling domain or functional fragment thereof is or comprises a co- stimulatory domain.
[0099] In some embodiments, a CAR of the present disclosure comprises: (a) a CD28 transmembrane domain; and (b) an intracellular signaling domain comprising: (i) a CD3intracellular signaling domain or functional fragment thereof; and (ii) a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co- stimulatory domain.
[0100] In some embodiments, a CAR of the present disclosure comprises: (a) a CD8a transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a CD28, an FcsRI gamma chain, and / or a 4- IBB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8a transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a CD28, an FcsRI gamma chain, and a 4- IBB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8a transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) an FcsRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises: (a) a CD8a transmembrane domain; (b) an intracellular signaling domain comprising: (i) a CD3 intracellular signaling domain or functional fragment thereof; and (ii) a 4- IBB intracellular signaling domain or functional fragment thereof. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co-stimulatory domain. In some embodiments, a FcsRI intracellular signaling domain or functional fragment thereof is or comprises a FcsRI co-stimulatory domain. In some embodiments, a 4- IBB intracellular signaling domain or functional fragment thereof is or comprises a 4- IBB co-stimulatory domain.
[0101] In some embodiments, a CAR of the present disclosure comprises (a) a CD8a transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof, and (ii) a CD27 and / or a CD28 intracellular signaling domain or functional fragment thereof. In some embodiments, a CD27 intracellular signaling domain or functional fragment thereof is or comprises a CD27 co- stimulatory domain. In some embodiments, a CD28 intracellular signaling domain or functional fragment thereof is or comprises a CD28 co-stimulatory domain.
[0102] In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a CD27, a 4- IBB,and / or an FcsRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a CD27, a 4- IBB, and an FcsRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a CD27 intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) a 4- IBB intracellular signaling domain or functional fragment thereof. In some embodiments, a CAR of the present disclosure comprises (a) a CD28 transmembrane domain, and (b) an intracellular signaling domain comprising: (i) a CD3^ intracellular signaling domain or functional fragment thereof; and (ii) an FcsRI gamma chain intracellular signaling domain or functional fragment thereof. In some embodiments, a CD27 intracellular signaling domain or functional fragment thereof is or comprises a CD27 co- stimulatory domain. In some embodiments, a FcsRI intracellular signaling domain or functional fragment thereof is or comprises a FcsRI co-stimulatory domain. In some embodiments, a 4- IBB intracellular signaling domain or functional fragment thereof is or comprises a 4- IBB co-stimulatory domain.
[0103] The present disclosure also includes functional variants of any of CAR, or CAR domain / component, described herein. CAR functional variants encompass, for example, variants of a CAR described herein (a parent CAR) that retains the ability to recognize a particular target cell to a similar extent, the same extent, or to a higher extent, as the parent CAR. In reference to a nucleic acid sequence encoding a parent CAR, a nucleic acid sequence encoding a functional variant of the CAR can be for example, about 10% identical, about 25% identical, about 30% identical, about 50% identical, about 65% identical, about 80% identical, about 90% identical, about 95% identical, or about 99% identical to the nucleic acid sequence encoding the parent CAR. In some embodiments, a parent CAR comprises an amino acid sequence as set forth in SEQ ID NO: 10 or 13. Alternatively or additionally, in some embodiments, a CAR functional variant comprises the amino acid sequence of a parent CAR with at least one non-conservative amino acid substitution. In some embodiments, a non-conservative amino acid substitution does not compromise orinhibit a biological activity of a CAR functional variant. In some embodiments, a nonconservative amino acid substitution may enhance a biological activity of a CAR functional variant, such that biological activity of the functional variant is increased relative to its parent CAR.
[0104] The present disclosure further provides for CARs comprising an extracellular domain directed to any target molecule of interest (e.g., comprising any of known antigenbinding domain, e.g., antibody, scFv, etc.), and further comprising any transmembrane domain described herein (including any hinge domain described herein), any intracellular signaling domain described herein (including any signal sequences or motifs, any costimulatory domains, etc., described herein), present in any combination.
[0105] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain or fragment thereof; and (ii) a human CD28 intracellular signaling domain or fragment thereof, wherein the CD28 intracellular signaling domain or fragment thereof is or comprises a co-stimulatory domain. In some embodiments, a CAR comprises: (a) a hinge region derived from a human CD8a polypeptide, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain; and (ii) a human CD28 intracellular signaling domain. In some embodiments, a CAR comprises a sequence as set forth in SEQ ID NO: 27.
[0106] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain or fragment thereof; and (ii) a CD27 and / or a CD28 intracellular signaling domain or fragment thereof, wherein the CD27 and / or CD28 intracellular signaling domain or fragment thereof is or comprises a costimulatory domain.
[0107] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain or fragment thereof; and (ii) a human CD28, a human CD27, and / or an FcsRI gamma chain intracellular signaling domain or fragment thereof, wherein the human CD28, the human CD27, and / or the FcsRI gamma chain intracellular signaling domain or fragment thereof are or comprise a co-stimulatory domain.
[0108] In some embodiments, a CAR can comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3 intracellular signaling domain; and (ii) a human CD28 and / or an FcsRI gamma chain intracellular signaling domain, wherein the CD28 and / or the FceRI gamma chain intracellular signaling domain or fragment thereof are or comprise a co-stimulatory domain.
[0109] In some embodiments, a CAR as described herein, further comprises a signal peptide sequence. In some embodiments, a signal peptide is positioned at the amino terminus of an extracellular domain (e.g., at the N-terminus of an antigen-binding domain). A signal peptide as used in accordance with the present disclosure may comprise any suitable signal peptide sequence. In some embodiments, a signal peptide sequence is a human granulocyte macrophage colony- stimulating factor (GM-CSF) receptor signal peptide sequence or a CD8a signal peptide sequence. In some embodiments, a CAR provided herein comprises a human scFv comprising a CD8a signal peptide sequence. In some embodiments, a signal peptide sequence comprises an amino acid sequence as set forth in SEQ ID NO: 15. In some embodiments, a CAR provided herein comprises a human scFv comprising a GM-CSF signal peptide sequence. In some embodiments, a signal peptide sequence comprises an amino acid sequence as set forth in SEQ ID NO: 61.
[0110] In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 28 or 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 1 1 , (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 21 , and (d) a CD3C, intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 28, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11, (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (d) a CD3 intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 28 or 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11, (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (d) a CD3 intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 28, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11, (c) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (d) a CD3 intracellular signaling domain comprising SEQ ID NO: 23.
[0111] In some embodiments, a provided CAR comprises: (a) an antigen-binding domain comprising SEQ ID NO: 17, (b) a CD8a hinge region comprising SEQ ID NO: 28, (c) a CD8a transmembrane domain comprising SEQ ID NO: 1 1, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) an antigen-binding domain comprising SEQ ID NO: 17, (b) a CD8a hinge region comprising SEQ ID NO: 28, (c) a CD8a transmembrane domain comprising SEQ ID NO: 11, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23.
[0112] In some embodiments, a provided CAR comprises: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domain comprising SEQ ID NO: 17, (c) a CD8a hinge region as set forth in SEQ ID NO: 28, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 11, (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 21, and (f) a CD3^ intracellular signaling domain as set forth in SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domain comprising SEQ ID NO: 17, (c) a CD8a hinge region as set forth in SEQ ID NO: 28, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 11, (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 21, and (f) a CD3f intracellular signaling domain as set forth in SEQ ID NO: 23.
[0113] In some embodiments, a CAR having any of the combinations of transmembrane domain, intracellular domain(s), and optionally hinge domain, as described above, further comprises an extracellular domain that binds CD 19 (e.g., human CD 19). In some embodiments, the extracellular domain comprises a means for binding CD 19. Exemplary CD19-binding domains are described in the “Extracellular Domain” subsection above.
[0114] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acidsequence having at least 95% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 97% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 10. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 10.
[0115] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 97% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 13. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 13.
[0116] In some embodiments, a CAR of the present disclosure is encoded by nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of thepresent disclosure is encoded by a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 14. In some embodiments, a CAR of the present disclosure is encoded by a nucleic acid sequence as set forth in SEQ ID NO: 14.
[0117] In some embodiments, a provided CAR comprises: (a) an antigen-binding domain comprising SEQ ID NO: 62, (b) a CD8a hinge region comprising SEQ ID NO: 28, (c) a CD8a transmembrane domain comprising SEQ ID NO: 11, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) an antigen-binding domain comprising SEQ ID NO: 62, (b) a CD8a hinge region comprising SEQ ID NO: 28, (c) a CD8a transmembrane domain comprising SEQ ID NO: 11, (d) a CD28 intracellular signaling domain comprising SEQ ID NO: 21, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23.
[0118] In some embodiments, a provided CAR comprises: (a) a signal peptide sequence comprising SEQ ID NO: 61, (b) an antigen-binding domain comprising SEQ ID NO: 62, (c) a CD8a hinge region as set forth in SEQ ID NO: 28, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 11 , (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 21, and (f) a CD3 intracellular signaling domain as set forth in SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a signal peptide sequence comprising SEQ ID NO: 61, (b) an antigen-binding domain comprising SEQ ID NO: 62, (c) a CD8a hinge region as set forth in SEQ ID NO: 28, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 11, (e) a CD28 intracellular signaling domain as set forth in SEQ ID NO: 21, and (f) a CD3^ intracellular signaling domain as set forth in SEQ ID NO: 23.
[0119] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity toSEQ ID NO: 63. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 63. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 64. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 64.
[0120] In some embodiments, a CAR comprises: (a) a hinge region, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain or fragment thereof; and (ii) a human 4- IBB intracellular signaling domain or fragment thereof, wherein the 4- IBB intracellular signaling domain or fragment thereof is or comprises a co-stimulatory domain. In some embodiments, a CAR comprises: (a) a hinge region derived from a human CD8a polypeptide, (b) a transmembrane domain derived from a human CD8a polypeptide, (c) an intracellular signaling domain comprising: (i) a human CD3^ intracellular signaling domain; and (ii) a human 4- IBB intracellular signaling domain. In some embodiments, a CAR comprises a sequence as set forth in SEQ ID NO: 55. In some embodiments, a CAR comprises a sequence as set forth in SEQ ID NO: 68.
[0121] In some embodiments, a CAR as described herein, further comprises a signal peptide sequence. In some embodiments, a signal peptide is positioned at the amino terminus of an extracellular domain (e.g., at the N-terminus of an antigen-binding domain). A signal peptide as used in accordance with the present disclosure may comprise any suitable signal peptide sequence. In some embodiments, a signal peptide sequence is a CD8a signal peptide sequence. In some embodiments, a CAR provided herein comprises a human scFv comprising a CD8a signal peptide sequence. In some embodiments, a signal peptide sequence comprises an amino acid sequence as set forth in SEQ ID NO: 15.
[0122] In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4- IBB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 67, (c) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3f intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8atransmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4- IBB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 67, (c) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23.
[0123] In some embodiments, a provided CAR comprises: (a) an antigen-binding domain comprising SEQ ID NO: 58, (b) a CD8a hinge region comprising SEQ ID NO: 56, (c) a CD8a transmembrane domain comprising SEQ ID NO: 67, (d) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) an antigen-binding domain comprising SEQ ID NO: 58, (b) a CD8a hinge region comprising SEQ ID NO: 56, (c) a CD8a transmembrane domain comprising SEQ ID NO: 67, (d) a 4- IBB intracellular signaling domain comprising SEQ ID NO: 57, and (e) a CD3C, intracellular signaling domain comprising SEQ ID NO: 23.
[0124] In some embodiments, a provided CAR comprises: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domain comprising SEQ ID NO: 58, (c) a CD8a hinge region as set forth in SEQ ID NO: 56, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 67, (e) a 4- IBB intracellular signaling domain as set forth in SEQ ID NO: 57, and (f) a CD3(^ intracellular signaling domain as set forth in SEQ ID NO: 23. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domain comprising SEQ ID NO: 58, (c) a CD8a hinge region as set forth in SEQ ID NO: 56, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 67, (e) a 4- IBB intracellular signaling domain as set forth in SEQ ID NO: 57, and (f) a CD3 intracellular signaling domain as set forth in SEQ ID NO: 23.
[0125] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 59. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%,or greater sequence identity to SEQ ID NO: 60. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 60.
[0126] In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4- IBB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23 or SEQ ID NO: 65. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 23 or SEQ ID NO: 65.
[0127] In some embodiments, a provided CAR comprises: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 65. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a CD8a hinge region comprising SEQ ID NO: 56, (b) a CD8a transmembrane domain comprising SEQ ID NO: 11 or 67, (c) a 4- 1BB intracellular signaling domain comprising SEQ ID NO: 57, and (d) a CD3^ intracellular signaling domain comprising SEQ ID NO: 65.
[0128] In some embodiments, a provided CAR comprises: (a) an antigen-binding domain comprising SEQ ID NO: 66, (b) a CD8a hinge region comprising SEQ ID NO: 56, (c) a CD8a transmembrane domain comprising SEQ ID NO: 67, (d) a 4- IBB intracellular signaling domain comprising SEQ ID NO: 57, and (e) a CD3 intracellular signaling domain comprising SEQ ID NO: 65. In some embodiments, a provided CAR comprises, from N- terminus to C-terminus: (a) an antigen-binding domain comprising SEQ ID NO: 66, (b) a CD8a hinge region comprising SEQ ID NO: 56, (c) a CD8a transmembrane domain comprising SEQ ID NO: 67, (d) a 4-1BB intracellular signaling domain comprising SEQ ID NO: 57, and (e) a CD3^ intracellular signaling domain comprising SEQ ID NO: 65.
[0129] In some embodiments, a provided CAR comprises: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domain comprising SEQ ID NO: 66, (c) a CD8a hinge region as set forth in SEQ ID NO: 56, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 67, (e) a 4- IBB intracellular signaling domain as set forth in SEQ ID NO: 57, and (f) a CD3^ intracellular signaling domain as set forth in SEQ ID NO: 65. In some embodiments, a provided CAR comprises, from N-terminus to C-terminus: (a) a CD8a signal peptide sequence comprising SEQ ID NO: 15, (b) an antigen-binding domaincomprising SEQ ID NO: 66, (c) a CD8a hinge region as set forth in SEQ ID NO: 56, (d) a CD8a transmembrane domain as set forth in SEQ ID NO: 67, (e) a 4- IBB intracellular signaling domain as set forth in SEQ ID NO: 57, and (f) a CD3 intracellular signaling domain as set forth in SEQ ID NO: 65.
[0130] In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 69. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 70. In some embodiments, a CAR of the present disclosure comprises an amino acid sequence as set forth in SEQ ID NO: 70.Nucleic Acid Constructs
[0131] The present disclosure further provides for an engineered nucleic acid, or nucleic acid construct, comprising a nucleic acid sequence that encodes any polypeptide described herein, e.g., any CAR described herein. To direct the expressed polypeptide (e.g., CAR) to the plasma membrane, the amino acid sequence encoded by the nucleic acid can include a signal peptide, which is generally removed from the mature polypeptide. In some embodiments, an engineered nucleic acid comprises a promoter operably linked to a nucleic acid sequence that encodes a CAR (e.g., any CAR described herein). Any appropriate promoter may be operably linked to any of the engineered nucleic acid sequences described herein. Non-limiting examples of promoters that may be used in accordance with the present disclosure include EFla, SFFV, PGK, CMV, CAG, UbC, murine stem cell virus (MSCV), MND, EFla hybrid promoters, CAG hybrid promoters, or derivatives or functional fragments thereof. In some embodiments, a promoter is an EFla promoter. In some embodiments, promoter is a SFFV promoter. In some embodiments, a promoter is a PGK promoter. In some embodiments, a promoter is a CMV promoter. In some embodiments, a promoter is a CAG promoter. In some embodiments, a promoter is a UbC promoter. In some embodiments, a promoter is a MSCV promoter. In some embodiments, a promoter is a MND promoter.
[0132] In some cases, an engineered nucleic acid comprises sufficient cis-acting elements (e.g., a promoter and / or an enhancer) that supplement expression of a provided engineerednucleic acid sequence where the remaining elements needed for expression can be supplied by a host cell (e.g., a mammalian cell, e.g., a T cell) or in an in vitro expression system.
[0133] The present disclosure also provides for vectors, or plasmids, comprising any engineered nucleic acid as described herein. The present disclosure provides for transposons, cosmids, viral vectors (e.g., any adenoviral vectors (e.g., pSV or pCMV vectors), adeno- associated virus (AAV) vectors, lentivirus vectors, and retroviral vectors), and any Gateway® vectors comprising any engineered nucleic acid described herein. In some embodiments, a viral vector is selected from the group consisting of: a lentiviral vector, a retroviral vector, an adenoviral vector, and an adeno-associated viral (AAV) vector. In some embodiments, a viral vector is a lentiviral vector. In some embodiments, a viral vector is a retroviral vector. In some embodiments, a viral vector is an adenoviral vector. In some embodiments, a viral vector is a AAV vector.
[0134] Exemplary lentiviral vectors that may be used in accordance with the present disclosure include vectors derived from human immunodeficiency virus- 1 (HIV-1), human immunodeficiency virus-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), lembrana Disease Virus (IDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV).
[0135] Retroviral vectors typically are constructed such that the majority of sequences coding for the structural genes of the virus are deleted and replaced by a gene of interest or expression cassette of interest (e.g., an engineered nucleic acid as described here). Most often, the structural genes (i.e., gag, pol, and env), are removed from the retroviral backbone using genetic engineering techniques known in the art. This may include digestion with the appropriate restriction endonuclease or, in some instances, with Bal 31 exonuclease to generate fragments containing appropriate portions of the packaging signal. Accordingly, in some embodiments, a minimum retroviral vector comprises from 5’ to 3’: a 5’ long terminal repeat (LTR), a packaging signal, an optional exogenous promoter and / or enhancer, an exogenous gene of interest (or engineered nucleic acid), and a 3' LTR. In some embodiments, if no exogenous promoter is provided, gene expression may be driven by the 5' LTR, which is a weak promoter and requires the presence of Tat to activate expression. In many embodiments, structural genes can be provided in separate vectors for manufacture of the lentivirus, rendering the produced virions replication-defective. Specifically, with respect to lentivirus, the packaging system may comprise a single packaging vector encoding the Gag, Pol, Rev, and Tat genes, and a third, separate vector encoding the envelope protein Env(usually VSV-G due to its wide infectivity). To improve the safety of the packaging system, the packaging vector can be split, expressing Rev from one vector, Gag and Pol from another vector. Tat can also be eliminated from the packaging system by using a retroviral vector comprising a chimeric 5’ LTR, wherein the U3 region of the 5’ LTR is replaced with a heterologous regulatory element.
[0136] Nucleic acids (e.g., genes) to be packaged into a retrovirus (e.g., a lentivirus) can be incorporated into the proviral backbone in several general ways. The most straightforward constructions are ones in which the structural genes of the retrovirus are replaced by a single gene which then is transcribed under the control of the viral regulatory sequences within the LTR. Retroviral vectors have also been constructed which can introduce more than one gene into target cells. Usually, in such vectors one gene is under the regulatory control of the viral LTR, while the second gene is expressed either off a spliced message or is under the regulation of its own, internal promoter.
[0137] Accordingly, nucleic acids (e.g., genes) to be packaged into a retrovirus are flanked by 5' and 3' LTRs, which serve to promote transcription and polyadenylation of the virion RNAs, respectively. The term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs which, in their natural sequence context, are direct repeats and contain U3, R and U5 regions. LTRs generally provide functions fundamental to the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. The LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals, and sequences needed for replication and integration of the viral genome. The U3 region contains the enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence. The R (repeat) region is flanked by the U3 and U5 regions. In certain embodiments, the R region comprises a trans-activation response (TAR) genetic element, which interacts with the trans- activator (tat) genetic element to enhance viral replication. This element is not required in embodiments wherein the U3 region of the 5' LTR is replaced by a heterologous promoter.
[0138] In some embodiments, a retroviral vector comprises a modified 5' LTR and / or 3' LTR. Modifications of the 3' LTR are often made to improve the safety of lentiviral or retroviral systems by rendering viruses replication-defective. In some embodiments, a retroviral vector is a self-inactivating (SIN) vector. As used herein, a SIN retroviral vector refers to a replication-defective retroviral vector in which the 3' LTR U3 region has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the firstround of viral replication. This is because the 3' LTR U3 region is used as a template for the 5' LTR U3 region during viral replication and, thus, the viral transcript cannot be made without the U3 enhancer-promoter. In some embodiments, a 3' LTR is modified such that the U5 region is replaced, for example, with an ideal polyadenylation sequence. It should be noted that modifications to the LTRs such as modifications to the 3' LTR, the 5' LTR, or both 3' and 5' LTRs, are also included in some embodiments of the present disclosure.
[0139] In some embodiments, the U3 region of the 5' LTR is replaced with a heterologous promoter to drive transcription of the viral genome during production of viral particles. Examples of heterologous promoters which can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters. Typical promoters are able to drive high levels of transcription in a Tat-independent manner. This replacement reduces the possibility of recombination to generate replication-competent virus, because there is no complete U3 sequence in the virus production system.
[0140] Adjacent to a 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient packaging of viral RNA into particles (the Psi site). As used herein, the term “packaging signal” or “packaging sequence” refers to sequences located within the retroviral genome which are required for encapsidation of retroviral RNA strands during viral particle formation see e.g., Clever et al., 1995 J. Virology, 69(4):2101 -09). The packaging signal may be a minimal packaging signal (also referred to as the psi ['P] sequence) needed for encapsidation of the viral genome.
[0141] In some embodiments, a retroviral vector (e.g., lenti viral vector) further comprises a FLAP. As used herein, the term “FLAP” refers to a nucleic acid whose sequence includes the central polypurine tract and central termination sequences (cPPT and CTS) of a retrovirus, e.g., HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Patent No. 6,682,907 and in Zennou et al. (2000) Cell 101:173. During reverse transcription, central initiation of the plus-strand DNA at the cPPT and central termination at the CTS lead to the formation of a three- stranded DNA structure: a central DNA flap. While not wishing to be bound by any theory, the DNA flap may act as a cis-active determinant of lentiviral genome nuclear import and / or may increase the titer of the virus. In some embodiments, retroviral vector backbones comprise one or more FLAP elements upstream or downstream of the heterologous genes of interest in the vectors. For example, in some embodiments, a transferplasmid includes a FLAP element. In some embodiments, a vector of the present disclosure comprises a FLAP element isolated from HIV-1.
[0142] In some embodiments, a retroviral vector (e.g., lenti viral vector) further comprises an export element. In some embodiments, retroviral vectors comprise one or more export elements. The term “export element” refers to a cis-acting post-transcriptional regulatory element which regulates the transport of an RNA transcript from the nucleus to the cytoplasm of a cell. Examples of RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) RRE (see e.g., Cullen et al., (1991) J. Virol. 65: 1053; and Cullen et al., (1991) Cell 58: 423) and the hepatitis B virus post-transcriptional regulatory element (HPRE). Generally, the RNA export element is placed within the 3' UTR of a gene, and can be inserted as one or multiple copies.
[0143] In some embodiments, a retroviral vector (e.g., lenti viral vector) further comprises a posttranscriptional regulatory element. A variety of posttranscriptional regulatory elements can increase expression of a heterologous nucleic acid, e.g., woodchuck hepatitis virus posttranscriptional regulatory element (WPRE; see Zufferey et al., (1999) J. Virol., 73:2886); the posttranscriptional regulatory element present in hepatitis B virus (HPRE) (Huang et al. , Mol. Cell. Biol., 5:3864); an optimized posttranscriptional regulatory element (oPRE; see Schambach et al., (2006) Gene Therapy 13, 641-45); and the like (Liu et al., (1995), Genes Dev., 9:1766). The posttranscriptional regulatory element is generally positioned at the 3' end the heterologous nucleic acid sequence. This configuration results in synthesis of an mRNA transcript whose 5' portion comprises the heterologous nucleic acid coding sequences and whose 3' portion comprises the posttranscriptional regulatory element sequence. In some embodiments, vectors of the present disclosure lack or do not comprise a posttranscriptional regulatory element such as a WPRE or HPRE, because in some instances these elements increase the risk of cellular transformation and / or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in certain embodiments, vectors of the present disclosure lack or do not comprise a WPRE or HPRE as an added safety measure.
[0144] Elements directing the efficient termination and polyadenylation of the heterologous nucleic acid transcripts increase heterologous gene expression. Transcription termination signals are generally found downstream of the polyadenylation signal. Accordingly, in some embodiments, a retroviral vector (e.g., lentiviral vector) further comprises a polyadenylation signal. The term “polyadenylation signal” or “polyadenylation sequence” as used herein denotes a DNA sequence which directs both the termination andpolyadenylation of the nascent RNA transcript by RNA polymerase H. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a polyadenylation signal are unstable and are rapidly degraded. Illustrative examples of polyadenylation signals that can be used in a vector of the present disclosure, include an ideal polyadenylation sequence (e.g., AATAAA, ATT AAA AGTAAA), a bovine growth hormone polyadenylation sequence (BGHpA), a rabbit P-globin polyadenylation sequence (r gpA), or another suitable heterologous or endogenous polyadenylation sequence known in the art.
[0145] In some embodiments, a retroviral vector further comprises an insulator element. Insulator elements may contribute to protecting retrovirus-expressed sequences, e.g., therapeutic genes, from integration site effects, which may be mediated by cis-acting elements present in genomic DNA and lead to deregulated expression of transferred sequences (i.e., position effect; see, e.g., Burgess-Beusse et al., (2002) Proc. Natl. Acad. Sci., USA, 99:16433; and Zhan et al., 2001, Hum. Genet., 109:471). In some embodiments, a retroviral vector comprises an insulator element in one or both LTRs or elsewhere in the region of the vector that integrates into the cellular genome. Suitable insulators for use in the present disclosure include, but are not limited to, the chicken P-globin insulator (see Chung et al., (1993). Cell 74:505; Chung et al., (1997) Proc. Natl. Acad. Sci., USA 94:575; and Bell et al., 1999. Cell 98:387). Examples of insulator elements include, but are not limited to, an insulator from a P-globin locus, such as chicken HS4.
[0146] Non-limiting examples of lentiviral vectors include pLVX-EFlalpha-AcGFPl-Cl (Clontech Catalog #631984), pLVX-EFl alpha- IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6 / V5-DEST™ (Thermo Fisher), pEenti6.2 / V5-DEST™ (Thermo Fisher), pEKO.l (Plasmid #10878 at Addgene), pEKO.3G (Plasmid #14748 at Addgene), pSico (Plasmid #11578 at Addgene), pLJMl-EGFP (Plasmid #19319 at Addgene), FUGW (Plasmid #14883 at Addgene), pLVTHM (Plasmid #12247 at Addgene), pLVUT-tTR-KRAB (Plasmid #11651 at Addgene), pLE3.7 (Plasmid #11795 at Addgene), pEB (Plasmid #11619 at Addgene), pWPXL (Plasmid #12257 at Addgene), pWPI (Plasmid #12254 at Addgene), EF.CMV.RFP (Plasmid #17619 at Addgene), pLenti CMV Puro DEST (Plasmid #17452 at Addgene), pLenti-puro (Plasmid #39481 at Addgene), pULTRA (Plasmid #24129 at Addgene), pLX301 (Plasmid #25895 at Addgene), pHIV-EGFP (Plasmid #21373 at Addgene), pLV-mCherry (Plasmid #36084 at Addgene), pLionll (Plasmid #1730 at Addgene), plnducerlO-mir-RUP- PheS (Plasmid #44011 at Addgene). These vectors can be modified to be suitable for therapeutic use. For example, a selection marker (e.g., puro, EGFP, or mCherry) can bedeleted or replaced with a second exogenous gene of interest. Further examples of lentiviral vectors are disclosed in U.S. Patent Nos. 7,629,153, 7,198,950, 8,329,462, 6,863,884, 6,682,907, 7,745,179, 7,250,299, 5,994,136, 6,287,814, 6,013,516, 6,797,512, 6,544,771, 5,834,256, 6,958,226, 6,207,455, 6,531,123, and 6,352,694, and PCT Publication No. WO2017 / 091786.
[0147] In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence encoding a CAR, wherein the nucleic acid sequence has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 14. In some embodiments, an engineered nucleic acid of the present disclosure comprises a nucleic acid sequence as set forth in SEQ ID NO: 14.
[0148] In certain embodiments, a lentivirus vector disclosed herein comprises a truncated 5’ LTR (e.g., with deletion of its U3 region), an HIV-1T packaging sequence, a MSCV promoter operably linked to a nucleic acid encoding a CAR (e.g., any of the CARs as disclosed herein), and a truncated 3’ LTR (e.g., with deletion of its U3 region). In certain embodiments, the lentivirus vector further comprises a RRE, a cPPT / CTS, and / or an oPRE. In certain embodiments, the lentivirus vector comprises a truncated 5’ LTR (e.g., with deletion of its U3 region), an HIV- I packaging sequence, a RRE, a cPPT / CTS, a MSCV promoter operably linked to a nucleic acid encoding a CAR (e.g., any of the CARs asdisclosed herein), an oPRE, and a truncated 3’ LTR (e.g., with deletion of its U3 region). In certain embodiments, the lentivirus vector is pseudotyped with VSV-G envelope protein.Methods of Making Engineered T Cells
[0149] Also provided herein are methods of making an engineered T cell, the methods comprising introducing into a host T cell an engineered nucleic acid comprising a nucleic acid sequence encoding a CAR (e.g., any CAR described herein). Accordingly in some embodiments, an engineered T cell refers to a genetically modified T cell that has been modified to express a CAR, e.g., any provided anti-CD19 CAR.
[0150] In some embodiments, a host T cell used to make an engineered T cell can be any T cell such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupTl, etc., or a T cell obtained from a mammal. In some embodiments, a T cell used to make an engineered T cell can be selected from naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or sub-populations thereof. In some embodiments, a host T cell used to make an engineered T cell can be a CD3+ cell. In some embodiments, a host T cell can be CD4+, CD8+, or CD4+ and CD8+. In some embodiments, a host T cell can be any type of T cell, e.g., CD4+ / CD8+ double positive T cells, CD4+ helper T cells (e.g., Thl and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), memory T cells, naive T cells, regulatory T cells, yST cells, etc. In some embodiments, a host T cell used to make an engineered T cell can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Thl7 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tern cells and TEMRA cells). In some embodiments, obtained host T cells are substantially free of non-T cells.
[0151] The T cells can be obtained from various biological samples of a subject (e.g., a human subject). Non-limiting examples of biological sample include cells, tissue (e.g., tissue obtained by biopsy), blood, serum, plasma, or any sample derived therefrom. In certain embodiments, the sample is a whole blood sample or an apheresis (e.g., leukapheresis) sample obtained from the subject. In certain embodiments, the method comprises obtaining the sample from the subject. In certain embodiments, the method comprises having obtained the sample from the subject.
[0152] In certain embodiments, the T cells are isolated from the sample. Isolation of T cells may include an initial purification of T cells from a mixture of plasma, lymphocytes, platelets, red blood cells, monocytes, and granulocytes. Methods for isolation of T cells from a biological sample, such as a whole blood sample or a leukapheresis sample, are well- known. Exemplary methods may include leukapheresis, elutriation, density gradient centrifugation, enrichment by selection, and the like. For example, the method may include obtaining or having obtained a biological sample, such as a fresh, refrigerated, frozen, or cryopreserved leukapheresis product or alternative source of hematopoietic tissue, such as a whole blood sample, bone marrow sample, or a tumor or organ biopsy or removal (e.g., thymectomy) from an entity, such as a laboratory, hospital, or healthcare provider, and performing the aforementioned isolation steps to produce an enriched population of T cells (e.g. , starting population of T cells) suitable for expression of a heterologous protein.
[0153] Furthermore, the purity of the T cell population can be increased by using one or more selection steps, such as negative selection or positive selection. Negative selection typically involves removal of undesired cell types from a mixed population of cells in a sample using one or more agents that selectively bind to the undesired cell type, whereas positive selection typically involves isolation of the desired cell population using one or more agents that selectively bind to the desired cell type. Enrichment of a T cell population by negative selection can be accomplished, for example, with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method is cell sorting and / or selection via negative magnetic immuno-adherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the negatively selected cells. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail can include antibodies to CD 14, CD20, CDb, CD16, HLA-DR, and CD8. On the other hand, a positive selection step can be used to specifically select for the desired cell type. Positive selection of T cells can, in certain embodiments, include incubation of a mixed population of cells that contains the T cells with a CD3 -binding agent (e.g., anti-CD3 antibody-conjugated beads) for a time sufficient for positive selection of the desired T cells.
[0154] In some embodiments, engineered T cells are made using a mixture of cells (e.g., a mixture of host cells). For example, a mixture of cells may be obtained (e.g., from a subject), and an engineered nucleic acid may be inserted into the mixture of cells such that a mixture of engineered cells is made. In some embodiments, a mixture of cells comprises a mixture of T cells (e.g., any T cells described herein). In some embodiments, a mixture of cells comprises CD4+ and / or CD8+ T cells. In some embodiments, a mixture of cellscomprises CD4+ and CD 8+ T cells. In some embodiments, a mixture of cells is obtained by enriching for CD4+ and CD8+ T cells, yielding an enriched mixture of CD4+ and CD8+ cells. In certain embodiments, the mixture of cells comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 20-30%, 20-40%, 20-50%, 20- 60%, 30-40%, 30-50%, or 30-60% of CD8+T cells (e.g., CD8+cytotoxic T cells) out of all T cells in the population. In certain embodiments, the mixture of cells further comprises 1-10%, 1-20%, 1-30%, 1-40%, 1-50%, 1-60%, 1-70%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 30-40%, 30-50%, 30-60%, or 30-70% of CD4+T cells (e.g., CD4+helper T cells) out of all T cells in the population. In certain embodiments, the mixture of cells comprise CD8+T cells (e.g., CD8+cytotoxic T cells) and CD4+T cells (e.g., CD4+helper T cells) at a ratio of 1 :5 to 5: 1, 1 :4 to 4: 1, 1 :3 to 3:1, 1:2 to 2:1 , 1 :5 to 2: 1 , 1 :4 to 2: 1 , 1 :3 to 1 : 1 , or 1 :2 to 1 : 1. In some embodiments, the mixture of cells comprise CD8+ T cells and CD4+ T cells at a ratio of about 1 :2. In some embodiments, a host cell or mixture of host cells are expanded before introduction of an engineered nucleic acid or vector or plasmid comprising an engineered nucleic acid. In some embodiments, a host cell or mixture of host cells are allogeneic. In some embodiments, a host cell or mixture of host cells are autologous.
[0155] In some embodiments, introducing an engineered nucleic acid (or a vector or plasmid comprising an engineered nucleic acid) to a host cell comprises contacting the host cell with a viral vector (e.g., any viral vector described herein). In some embodiments, a viral vector is selected from the group consisting of: a lentiviral vector, a retroviral vector, an adenoviral vector, transposons, cosmids, and an AAV vector. In some embodiments, a viral vector is a lentiviral vector. In some embodiments, a step of introducing an engineered nucleic acid (or a vector or plasmid comprising an engineered nucleic acid) to a host cell comprises use of viral transduction. Any known method of introducing nucleic acids (including nucleic acid vectors and plasmids) into a host cell may be used in accordance with the present disclosure.
[0156] Methods of introducing nucleic acid constructs into a cell (e.g., a eukaryotic cell) are known in the art. Non-limiting examples of methods that can be used to introduce an engineered nucleic acid or nucleic acid construct (e.g., a vector or plasmid comprising an engineered nucleic acid) into a cell include lipofection, transfection, electroporation, microinjection, calcium phosphate transfection, dendrimer-based transfection, cationic polymer transfection, cell squeezing, sonoporation, optical transfection, impalefection, hydrodynamic delivery, magnetofection, viral transduction (e.g., adenoviral and lentiviraltransduction), and nanoparticle transfection. As used herein, “transformed” and “transduced” are used interchangeably.
[0157] In some embodiments, an engineered nucleic acid is introduced to a cell using a lentiviral vector. In some embodiments, the lenti viral vector is used at a multiplicity of infection (MOI) of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, or greater. In some embodiments, the lentiviral vector is used at an MOI of about 1. In some embodiments, the lentiviral vector is used at an MOI of about 2. In some embodiments, the lentiviral vector is used at an MOI of about 3. In some embodiments, the lentiviral vector is used at an MOI of about 4. In some embodiments, the lentiviral vector is used at an MOI of about 5. In some embodiments, the lentiviral vector is used at an MOI of about 6. In some embodiments, the lentiviral vector is used at an MOI of about 7. In some embodiments, the lentiviral vector is used at an MOI of about 8. In some embodiments, the lentiviral vector is used at an MOI of about 9. In some embodiments, the lentiviral vector is used at an MOI of about 10.
[0158] In some embodiments, a provided method further includes a step of contacting a host T cell with an effective amount of one or more CD3-stimulation agents in the absence of a CD28 stimulating agent under conditions that allow for the stimulation of the host T cell. In other embodiments, a provided method further includes a step of contacting a host T cell with an effective amount of one or more agents that activate both CD3 and CD28 (e.g., a solid surface, such as a polymeric nanomatrix, coated with an anti-CD3 antibody and an anti- CD28 antibody) under conditions that allow for the stimulation of the host T cell.
[0159] In some embodiments, the present disclosure provides a method of making an engineered T cell, the method comprising steps of: (a) obtaining a host T cell from a subject; and (b) introducing an engineered nucleic acid (e.g., any engineered nucleic acid described herein) to the host T cell. In some embodiments, a method of making an engineered T cell further comprises a step of contacting a host T cell with an effective amount of one or more CD3- stimulation agents in the absence of a CD28 stimulating agent under conditions that allow for the stimulation of the host T cell. In other embodiments, a method of making an engineered T cell further comprises a step of contacting a host T cell with an effective amount of one or more agents that activate both CD3 and CD28 (e.g., a magnetic bead coated with an anti-CD3 antibody and an anti-CD28 antibody) under conditions that allow for the stimulation of the host T cell. In certain embodiments, the stimulation step is taken prior to step (b).
[0160] In some embodiments, the present disclosure provides a method of making an engineered T cell, the method comprising steps of: (a) obtaining a host T cell from a subject; and (b) introducing an engineered nucleic acid (e.g., any engineered nucleic acid described herein, e.g., a vector comprising an engineered nucleic acid, using any method of introducing provided herein) to the host T cell.
[0161] In some embodiments, the present disclosure provides a method of making an engineered T cell, the method comprising steps of: (a) obtaining a host T cell mixture from a subject; and (b) introducing an engineered nucleic acid e.g., any engineered nucleic acid described herein, e.g., a vector comprising an engineered nucleic acid, using any method of introducing provided herein) to the host T cell mixture. In some embodiments, a method of making an engineered T cell further comprises a step of enriching a host T cell mixture for CD4+ and CD8+ T cells prior to introducing an engineered nucleic acid to the host T cell mixture.
[0162] In some embodiments, a method of making an engineered T cell further comprises a step of expanding a host T cell or T cell mixture before introduction of an engineered nucleic acid or vector or plasmid comprising an engineered nucleic acid. In certain embodiments, the T cells are expanded after introduction of the engineered nucleic acid, while the nucleic acid is still in the cell culture medium. In certain embodiments, the T cells are expanded for at least 3, 4, 5, 6, 7, or 8 days in the presence of one or more cytokines, including but not limited to IL-2, IL-7, and / or IL- 15. In certain embodiments, the T cells are expanded for at least 3, 4, 5, 6, 7, or 8 days in the presence of IL-7 and IL- 15.
[0163] Also provided herein are engineered T cells produced using any of the methods described herein. The present disclosure provides for engineered T cells comprising an engineered nucleic acid (e.g., any of the engineered nucleic acid described herein). In many embodiments of the present disclosure an engineered T cell comprises an engineered nucleic acid encoding a CAR (e.g., any CAR described herein). In some embodiments, the present disclosure provides an engineered T cell comprising a nucleic acid sequence encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the present disclosure provides an engineered T cell comprising an engineered nucleic acid sequence as set forth in SEQ ID NO: 14.
[0164] The population of engineered T cells produced may include T cells of various phenotypes, such as naive T (TN) cells characterized as CD45RO-, CCR7+, and CD95-, central memory T (TCM) cells characterized as CD45RO+ and CCR7+, effector memory T (TF.M) cells characterized as CD45RO+ and CCR7-, stem memory T (TSCM) cellscharacterized as CD45RO-, CCR7+, and CD95+, and effector memory cells re-expressing CD45RA T (TEMRA) cells characterized as CD45RO- and CCR7-. Alternative characterizations of these T cell subsets include but are not limited to naive T (TN) cells characterized as CD45RA+, CCR7+, and CD95-, central memory T (TCM) cells characterized as CD45RA- and CCR7+, effector memory T (TEM) cells characterized as CD45RA- and CCR7-, stem memory T (TSCM) cells characterized as CD45RA+, CCR7+, and CD95+, and effector memory cells re-expressing CD45RA T (TEMRA) cells characterized as CD45RA+ and CCR7-. In some embodiments, the population comprises at least 25%, 30%, 40%, 50%, 60%, 70%, 75%, or 80% CD4+ T cells, out of all T cells in the population. In some embodiments, the population comprises at least 20%, 25%, 30%, 40%, 50%, 55%, or 60% CD8+ T cells, out of all T cells in the population. In some embodiments, the population comprises at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, or 7% CD4+ TN, out of all T cells in the population. In some embodiments, the population comprises at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, or 35% CD4+ TSCM, out of all T cells in the population. In some embodiments, the population comprises at least 10%, 15%, 20%, 25%, or 30% CD4+ TCM, out of all T cells in the population. In some embodiments, the population comprises at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% CD4+ TEM, out of all T cells in the population. In some embodiments, the population comprises at least 5%, 10%, 15%, 20%, 25%, or 30% CD4+ TE RA, out of all T cells in the population. In some embodiments, the population comprises at least 0.05%, 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 5%, 10%, 15%, 20%, or 25% CD8+ TN, out of all T cells in the population. In some embodiments, the population comprises at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60% CD8+ TSCM, out of all T cells in the population. In some embodiments, the population comprises at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 5%, 10%, 15%, 20%, 25%, or 30% CD8+ TCM, out of all T cells in the population. In some embodiments, the population comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% CD8+ TEM, out of all T cells in the population. In some embodiments, the population comprises at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60% CD8+ TTEMRA, out of all T cells in the population. It will be understood by a skilled artisan that the percentage of certain T cells present in a population of engineered T cells may vary from patient to patient.Compositions
[0165] Also provided herein are compositions (e.g., pharmaceutical compositions) comprising any engineered T cell described herein or any engineered nucleic acid described herein. In some embodiments, a provided pharmaceutical compositions can be formulated for intravenous administration. In some embodiments, a pharmaceutical compositions can include a pharmaceutically acceptable carrier (e.g., phosphate buffered saline).
[0166] In some embodiments, a provided composition (e.g., pharmaceutical composition) is formulated in a chemically defined freezing medium. In some embodiments, the chemically defined freezing medium comprises about 1 % human serum albumin and about 5% dimethyl sulfoxide. In some embodiments, the chemically defined freezing medium comprises about 50% Plasma-Lyte A™ containing about 2% human serum albumin (for final human serum albumin concentration of about 1%) and about 50% CryoStorlO containing dimethyl sulfoxide to a final concentration of about 5%.Methods of TreatmentMultiple Sclerosis
[0167] Provided herein are methods and compositions for reducing the number of B cells in a subject having multiple sclerosis. In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue (e.g., tissue of the nervous system, including but not limited to the cerebrospinal fluid (CSF)) in a subject having multiple sclerosis, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. Also provided herein are methods of treating a subject having multiple sclerosis, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject. In some embodiments, the multiple sclerosis is RRMS, SPMS, or PPMS. In some embodiments, the multiple sclerosis is RRMS. In some embodiments, the multiple sclerosis is SPMS. In some embodiments, the multiple sclerosis is PPMS. In some embodiments, the multiple sclerosis is refractory MS. In some embodiments, the multiple sclerosis is progressive MS. In some embodiments, a subject treated with a provided composition or method has a history of diagnosis of PPMS or SPMS according to the 2017 McDonald criteria and expanded disability status scale (EDSS) of 3.0 to 5.5 prior to receiving the provided treatment. In some embodiments, a subject treated with a provided composition or method has a history of diagnosis of PPMS or SPMS according to the 2017 McDonaldcriteria and expanded disability status scale (EDSS) of 3.0 to 6.0 prior to receiving the provided treatment.
[0168] In some embodiments, a subject that has multiple sclerosis (e.g., RRMS, SPMS, PPMS, etc.) is treated with a provided treatment in place of a standard of care or approved treatment (e.g., any standard of care or approved treatment described herein, such as anti- CD20 therapy for treating SPMS or PPMS) or any other therapeutic modality that may be used for treating multiple sclerosis, where the subject meets the criteria for receiving the standard of care or approved treatment and / or other therapeutic modality as judged by a clinician. In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for multiple sclerosis that was ineffective and / or caused one or more adverse side effects. In some embodiments, the subject has not previously received an anti-CD20 antibody therapy. In some embodiments, a subject having RRMS receiving a provided treatment has previous received a standard of care or approved treatment but not an anti-CD20 antibody therapy. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with an immunosuppressive drug. In some embodiments, a subject receiving a presently provided treatment has previously been treated with corticosteroids (e.g., betamethasone, dexamethasone, cortisone, hydrocortisone, prednisone, prednisolone, methylprednisolone). In some embodiments, a subject receiving a presently provided treatment has previously been treated with plasmapheresis. In some embodiments, a subject receiving a presently provided treatment has previously been treated with intravenous immunoglobulin therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a disease modifying therapy (DMT). In some embodiments, a subject receiving a presently provided treatment has been previously treated with an anti-CD20 antibody therapy (e.g., an obinutuzumab therapy (e.g., Gazyva), an ocrelizumab therapy (e.g., Ocrevus), an ofatumumab therapy (e.g., Kesimpta), a rituximab therapy (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.). In some embodiments, a subject receiving a presently provided treatment has been previously treated with ocrelizumab therapy (e.g., Ocrevus). In some embodiments, a subject receiving a presently provided treatment has been previously treated with an anti- CD20 antibody and has experienced continuing evidence of worsening physical disability over a period of about 6 months or longer. In some embodiments, a subject receiving a presently provided treatment has documented evidence of clinical disability progression within about 2 years prior to receiving the provided treatment, where clinical disability progression may be characterized by: a) progression of EDSS during the about 2 years of atleast 1 point sustained if the baseline EDSS is less than or equal to 5.5 points; or b) increase of timed 25-foot walk by at least 20% in the about 2 years sustained for at least 6 months; or c) other well documented objective worsening despite at least 1 year prior treatment for progressive forms of MS (e.g., anti-CD20 mAb). In some embodiments, a subject receiving a presently provided treatment has been previously treated with an anti-CD20 antibody, has experienced continuing evidence of worsening physical disability over a period of about 6 months or longer, and has documented evidence of clinical disability progression within about 2 years prior to receiving the provided treatment, where clinical disability progression may be characterized by: a) progression of EDSS during the about 2 years of at least 1 point sustained if the baseline EDSS is less than or equal to 5.5 points; or b) increase of timed 25- foot walk by at least 20% in the about 2 years sustained for at least 6 months; or c) other well documented objective worsening despite at least 1 year prior treatment for progressive forms of MS (e.g., anti-CD20 mAb). In some embodiments, a subject receiving a presently provided treatment has previously been treated with interferon beta- la (e.g., Avonex, Rebif, Plegridy), interferon- lb (e.g., Betaseron, Extavia), glatiramer acetate (e.g., Copaxone, Glatopa), alemtuzumab (e.g., Lemtrada), mitoxantrone (e.g., Novantrone), natalizumab (e.g., Tysabri), teriflunomide (e.g., Aubagio), fingolimod (e.g., Gilenya), dimethyl fumarate (e.g., Tecfidera), cladribine (e.g., Mavenclad), siponimod (e.g., Mayzent), ponesimod (e.g., Ponvory), ozanimod (e.g., Zeposia), diroximel fumarate (e.g., Vumerity), monomethyl fumarate (e.g., Bafiertam), or any combination thereof. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a stem cell therapy (e.g., a mesenchymal stem cell (MSC) therapy). In some embodiments, a subject with multiple sclerosis (e.g., any form of MS described herein) is treated with a composition or method of the present disclosure as a first line therapy.
[0169] In some embodiments, a subject receiving a presently provided treatment has previously received a standard of care or approved treatment for multiple sclerosis (e.g., an immunosuppressive drug, a DMT, or any common treatment described herein, e.g., those discussed above), and the standard of care or approved treatment dose is reduced (e.g., by tapering) or terminated (e.g., by washing out) before T cells are obtained from the subject for making engineered T cells (e.g., via any method described herein). In some embodiments, a standard of care or approved treatment dose is reduced or terminated at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks before T cells are obtained from the subject for making engineered T cells (e.g.. by apheresis). In some embodiments, a standard of care or approved treatment dose isreduced at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks prior to a subject receiving a provided treatment. In some embodiments, a standard of care or approved treatment dose is reduced at least 6 weeks prior to a subject receiving a provided treatment. In some embodiments, a subject continues to receive a standard of care or approved treatment (e.g., at a standard dose, at a reduced dose, and / or keeping only a limited number of individual therapeutic components from the original SOC treatment) while also receiving the presently provided treatment. In some embodiments, a subject does not continue to receive a standard of care or approved treatment while receiving the presently provided treatment. In some embodiments, a subject continues to receive a corticosteroid (e.g., a glucocorticoid, such as prednisone) at a reduced dose while also receiving the presently provided treatment.
[0170] In some embodiments, a subject having multiple sclerosis undergoes a treatment scheme that comprises steps of: (1) reducing and / or washing out one or more previous multiple sclerosis medications (e.g., as described herein); (2) obtaining T cells from the subject for making engineered T cells (e.g., by apheresis); (3) optionally resuming one or more of the previous medications from step (1) if required (e.g., as determined by a clinician to maintain disease stability) for a duration of time; (4) optional lymphodepletion (e.g., via any method described herein); and (5) administration of the engineered T cells of the present disclosure. In some embodiments, the time between step (1) and step (2) is about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 3 weeks, about 4 weeks, about 8 weeks, about 12 weeks, or more. It will be understood by a skilled artisan that the time to effectively reduce and / or wash out one or more previous medications (e.g., the time between step (1) and step (2)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the type or class of previous medication and its half-life, among other things. In some embodiments, the time between step (2) and step (4) is about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, or more. It will be understood by a skilled artisan that the time between obtaining T cells from a subject for making engineered T cells (e.g., by apheresis) and lymphodepletion (e.g., the time between step (2) and step (4)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the health of the subject and the quality of the cells recovered for engineering, among other things. In some embodiments, the time between step (4) and step(5) is about 5 days, about 6 days, about 7 days, or more. It will be understood by a skilled artisan that the time between lymphodepletion and administration of the engineered T cells (e.g., the time between step (4) and step (5)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the method of lymphodepletion and the health of the subject, among other things. In some embodiments, a treatment scheme does not comprise a lymphodepletion step (e.g., a step (4)).
[0171] The present disclosure appreciates that therapeutic regimens for multiple sclerosis generally require chronic administration or administration of multiple treatment cycles to effectively treat the disease or disorder. The most common treatments include corticosteroids and immunosuppressive drugs, which can be very toxic to a subject. In some cases, these drugs can also suppress a subject’s immune system, resulting in serious infections and / or adverse side effects, e.g., liver damage, systolic dysfunction, infertility, cancer, progressive multifocal leukoencephalopathy hypertension, slowed heart rate, macular edema, and lymphocyte reduction. Accordingly, standard of care treatments such as immunosuppressive and DMT drugs present challenges to chronic use. In contrast, use of engineered T cells provided herein offers the premise of a single infusion possibly controlling disease for a prolonged period of time. Use of an engineered T cells as provided herein also permits repeated treatments (e.g., chronic administration, multiple treatment cycles, etc.) due to low toxicity profile and subsequent reduced side effects, e.g., as a result of the fully human nature the scFv, among other things. In many embodiments, use of the provided engineered T cells results in lower toxicity with subsequent reduced adverse effects over time and can be repeated in the future as needed.
[0172] In some embodiments, prior to receiving a provided treatment, a subject is administered an antihistamine and / or an antipyretic as a premedication. In some embodiments, an antihistamine is administered orally. In some embodiments, an antihistamine is administered intravenously. In some embodiments, an antihistamine is diphenhydramine. In some embodiments, diphenhydramine is administered at a dose in range of about 25 mg to about 50 mg. In some embodiments, diphenhydramine is administered orally, optionally 45-75 minutes (e.g., 1 hour) prior to administering a provided treatment. In some embodiments, diphenhydramine is administered intravenously, optionally 15-45 minutes (e.g., 30 minutes) prior to administering a provided treatment. In some embodiments, an antipyretic is acetaminophen. In some embodiments, acetaminophen is administered at a dose in a range of about 650 mg to about 1000 mg. In some embodiments, acetaminophen is administered orally or intravenously, optionally 15-45 minutes (e.g., 30 minutes) prior toadministering a provided treatment. In some embodiments, a premedication (e.g., antihistamine and / or antipyretic) is administered about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 1.5 hours, about 2 hours, or more prior to administering a provided treatment.
[0173] In some embodiments of any of the methods described herein, a step of administering comprises administering two or more doses of an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, a step of administering comprises administering five or more doses of an engineered T cell. In some embodiments, a step of administering comprises administering ten or more doses of an engineered T cell. In some embodiments, a dose of an engineered T cell is fractionated such that the total dose is administered over the course at least two, three, four, five, six, seven, or more days.
[0174] In some embodiments, a subject receiving a provided treatment (e.g., any engineered nucleic acid, engineered T cell, or CAR provided herein) has previously been treated with a lymphodepletion agent (e.g., cyclophosphamide and / or fludarabine), to increase the proliferation and persistence of CAR-T cells. In some embodiments, the subject has received a lymphodepletion treatment. In some embodiments, lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 300 mg / m2) and of fludarabine (e.g., at a dose of 30 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 5 to 7 days prior to administration of the T cells. In some embodiments, the subject does not receive a lymphodepletion treatment prior to administration of the T cells. In some embodiments, the subject has received a minimized lymphodepletion treatment. In some embodiments, a minimized lymphodepletion treatment comprises intravenous administration of cyclophosphamide (e.g., at a dose of 150 mg / m2) and of fludarabine (e.g., at a dose of 15 mg / m2) prior to administration of the T cells, e.g., once every day for 3 days, starting 5 to 7 days prior to administration of the T cells. In some embodiments, a minimized lymphodepletion treatment reduces lymphocytes in a subject by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% relative to the subject before receiving lymphodepletion treatment or another suitable control. In some embodiments, the subject has received a minimized lymphodepletion treatment resulting in about 50% reduction of lymphocytes in the subject relative to the subject before receiving lymphodepletion treatment or another suitable control.
[0175] The engineered T cells used in the methods of the present disclosure can be generated by a process disclosed herein. In some embodiments, an engineered T cell is generated by introducing into a T cell an engineered nucleic acid comprising a nucleic acidsequence encoding a CAR (e.g., any CAR described herein, e.g, an anti-CD19 CAR). In some embodiments, an engineered nucleic acid further comprises a promoter operably linked to a nucleic sequence encoding a CAR. In some embodiments, an engineered T cell is generated by further contacting the T cell with an effective amount of one or more agents that activate CD3 and CD28 under conditions that allow for stimulation of the T cell. In some embodiments, a T cell is obtained from a subject (e.g., an autologous or allogeneic subject), prior to a step of generating an engineered T cell and a step of administering the engineered T cell. An engineered T cell can be generated or made using any method of making an engineered T cell described herein, e.g., in the “Methods of Making Engineered T Cells” section above.
[0176] In some embodiments, the present disclosure provides for a method of reducing the number of B cells in a tissue in a subject having multiple sclerosis, the method comprising a step of administering to the subject an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of reducing the number of B cells in a tissue in a subject having multiple sclerosis, the method comprising a step of administering to the subject an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0177] In some embodiments, the present disclosure provides for a method of treating multiple sclerosis, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating multiple sclerosis, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0178] In some embodiments, the present disclosure provides for a method of treating RRMS, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating RRMS, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cellis an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0179] In some embodiments, the present disclosure provides for a method of treating SPMS, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating SPMS, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0180] In some embodiments, the present disclosure provides for a method of treating PPMS, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating PPMS, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0181] In some embodiments, the present disclosure provides for a method of treating progressive MS, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating progressive MS, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14. In some embodiments, progressive MS is characterized by relapse associated worsening of one or more symptoms of MS. In some embodiments, progressive MS is characterized by progression independent of relapse activity (PIRA). In some embodiments, a PIRA event is characterized by observed disease progression (e.g., asmeasured using any method common in the field) that occurs independently of relapse activity (e.g., new lesion identification, etc.).
[0182] In some embodiments, the present disclosure provides for a method of treating refractory multiple sclerosis, the method comprising a step of administering to a subject in need thereof an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating refractory multiple sclerosis, the method comprising a step of administering to a subject in need thereof an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. The refractory multiple sclerosis can be refractory to any of the previous treatments disclosed herein, such as a corticosteroid (e.g., betamethasone, dexamethasone, cortisone, hydrocortisone, prednisone, prednisolone, methylprednisolone), an anti-CD20 antibody (e.g., obinutuzumab (e.g., Gazyva), ocrelizumab (e.g., Ocrevus), ofatumumab (e.g., Kesimpta), rituximab (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.), interferon beta-la (e.g., Avonex, Rebif, Plegridy), interferon- lb (e.g., Betaseron, Extavia), glatiramer acetate (e.g., Copaxone, Glatopa), alemtuzumab (e.g., Lemtrada), mitoxantrone (e.g., Novantrone), natalizumab (e.g., Tysabri), teriflunomide (e.g., Aubagio), fingolimod (e.g., Gilenya), dimethyl fumarate e.g., Tecfidera), cladribine (e.g., Mavenclad), siponimod (e.g., Mayzent), ponesimod (e.g., Ponvory), ozanimod (e.g., Zeposia), diroximel fumarate (e.g., Vumerity), monomethyl fumarate (e.g., Bafiertam), a bruton tyrosine kinase (BTK) inhibitor, or any combination thereof. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0183] In some embodiments, provided engineered T cells are administered using parenteral administration (e.g., intravenous administration). In some embodiments, provided engineered T cells are administered using intrathecal administration (e.g., directly into the cerebrospinal fluid (CSF)). Methods and compositions of the present disclosure may be administered using any suitable method.
[0184] In some embodiments, administering of methods and compositions provided herein to a subject with multiple sclerosis results in a reduction in the number, severity, or frequency of one or more symptoms of multiple sclerosis in the subject (e.g., as compared to the number, severity, or frequency of the one or more symptoms of multiple sclerosis in the subject prior to receiving treatment with provided methods or compositions). In some embodiments, a subject having multiple sclerosis having been administered an engineered T cell as described here can experience a reduction in inflammation and / or auto-antibodyproduction. In some embodiments, a subject having multiple sclerosis having been administered an engineered T cell as described here can experience a remission in clinical manifestations of MS (e.g., new lesions (e.g., brain or spinal lesions), progression of disability, etc.).
[0185] A pharmaceutical composition useful in the method disclosed herein can contain an engineered T cell and a pharmaceutically acceptable carrier or buffer. In some embodiments, the pharmaceutical composition can be formulated in an injectable form (e.g., as solution and / or suspension). In some embodiments, a pharmaceutical composition comprising an engineered T cell as provided herein can further include phosphate buffered saline. Pharmaceutically acceptable carriers, fillers, and vehicles that can be used in a pharmaceutical composition described herein can include, without limitation, ion exchangers, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, and sodium chloride.
[0186] An effective dosage (e.g., for a provided T cell composition) to administer to a patient intravenously can vary depending on the severity of multiple sclerosis, the age and general health condition of a subject, excipient usage, the possibility of co-usage with other therapeutic treatments, and the judgment of the treating physician. An effective amount of an engineered T cell can be any amount that reduces inflammation and auto-antibody production within a subject having multiple sclerosis (e.g., via deletion or reduction of autoreactive B cells) without producing significant toxicity to the subject. In some embodiments, an effective dosage may vary depending on the types of engineered T cells present in a provided engineered T cell composition (e.g., the effective dosage may be higher or lower depending on if the engineered T cell composition comprises more of one engineered T cell type, e.g., any T cell type described herein, such as a TEMRA cell, a Tscm cell, etc.). In many embodiments, an effective dosage may also be dependent on the level of CAR expression in the provided engineered T cells and / or the percentage of engineered T cells within a provided composition. In some cases, engineered T cells can be a purified population of engineered T cells generated as described herein. In some cases, the purity of a population of engineered T cells can be assessed using any appropriate method, including, without limitation, flow cytometry. In some embodiments, purity of a population of engineered T cells can be assessed by quantifying the amount of T cells expressing the CAR relative to all the T cells in the population. In some cases, a population of engineered T cells to be administered to asubject can include a range of purities from about 5% to about 80%, about 10% to about 80%, about 15% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 5% to about 70%, about 5% to about 60%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 70% to about 100%, from about 70% to about 90%, from about 70% to about 80%, from about 80% to about 90%, from about 90% to about 100%, from about 80% to about 100%, from about 80% to about 90%, or from about 90% to 100%. In some cases, a dosage of a provided therapy (e.g., number of engineered T cells to be administered) can adjusted based on the level of purity of the therapy.
[0187] In some embodiments, a therapeutically effective dose is in a range of about 5xl07to IxlO8, about 5xl07to 9xl07, about 5xl07to 8xl07, about 5xl07to 7xl07, about 5xl07to 6xl07, about 6xl07to IxlO8, about 7xl07to IxlO8, about 8xl07to IxlO8, about 9xl07to IxlO8, about 6xl07to 9xl07, or about 7xl07to 8xl07of the T cells. In some embodiments, a therapeutically effective dose is in a range of about 5xl07to 1x10sof the T cells. In some embodiments, a therapeutically effective dose is about 5xl07of the T cells. In some embodiments, a therapeutically effective dose is about IxlO8of the T cells.
[0188] In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 0. IxlO8, about 0.2xl08, about 0.3xl08, about 0.4x10s, about 0.5x10s, about 0.6xl08, about 0.7xl08, about 0.8xl08, about 0.9x10s, about 1.0x10s, about l . l xlO8, about 1.2xl 08, about 1 .3x108, about 1.4xl 08, or about 1.5xlO8engineered cells. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 0.33xl08engineered cells. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 0.5x10sengineered cells. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about l.OxlO8engineered cells.
[0189] In some embodiments, provided T cells are administered by intravenous infusion. In some embodiments, the subject receives a single dose of the T cells.
[0190] The frequency of administration of an engineered T cell can be any frequency that adequately controls disease per clinical assessment and / or reduces inflammation or autoantibody production (e.g. production of oligoclonal bands in CSF) within a subject having multiple sclerosis (e.g., via deletion or reduction of autoreactive B cells) without producing toxicity to the subject. In some embodiments, frequency of administration is based onreappearance of CSF biomarkers which may be indicative of re-emerging auto-antibody producing B cells in the meninges (e.g., oligoclonal bands). In some embodiments, the actual frequency of administration can vary depending on various factors including, without limitation, the effective amount, duration of treatment, use of multiple treatment agents, and severity of the condition may require an increase or decrease in frequency of administration.
[0191] An effective duration for administering a composition containing an anti-CD19 CAR T cell or a nucleic acid encoding the same can be any duration that reduces inflammation or auto-antibody production within the subject having multiple sclerosis (e.g., via deletion or reduction of autoreactive B cells) without producing toxicity to the subject. In some embodiments, the effective duration can vary from several days to several months. In some embodiments, the effective treatment duration for administering a composition containing an engineered T cell to treat multiple sclerosis can range in duration from about one month to about five years (e.g., from about two months to about five years, from about three months to about five years, from about six months to about five years, from about eight months to about five years, from about one year to about five years, from about one month to about four years, from about one month to about three years, from about one month to about two years, from about six months to about four years, from about six months to about three years, or from about six months to about two years). In some embodiments, the effective treatment duration is at least one year, two years, three years, or more. In some embodiments, a subject receives an infusion of a provided treatment and is cured (e.g., via initiation of an immune reset).
[0192] In some embodiments, a course of treatment and / or the severity of one or more symptoms (e.g., development of new CNS lesions, progression of disability, etc.) related to multiple sclerosis can be monitored. Any appropriate method can be used to determine whether multiple sclerosis is being treated. For example, signs of a subject with MS (e.g., a refractory form of MS) being treated may include the subject entering a period of remission characterized by a reduction in new lesion formation, improvement in one or more clinical symptoms of MS that are present at the time of treatment (e.g. , complete or partial recovery of an MS associated disability), and / or reduction in the progression or new incidence of one or more clinical symptoms of MS (e.g., MS associated disability in a subject is stabilized for a duration of time). As another example, signs of a subject with a relapsing form of MS being treated may include the subject entering a period of remission, or exhibiting a prolonged period of remission, characterized by a reduction in new lesion formation and / or improvement in one or more clinical symptoms of MS. In some embodiments, the expandeddisability status scale (EDSS) is used to monitor the course of treatment of a subject receiving a provided composition (e.g., lack of disease progression may be indicated by stable EDSS value or EDSS value not exceeding a certain threshold value). In some embodiments, lack of disease progression is indicated by a stable EDSS value (e.g., where an EDSS value is measured and compared to a previously measured baseline EDSS value, and both values are substantially the same). In some embodiments, lack of disease progression is indicated by an EDSS value not exceeding a certain threshold value over a duration of time. In some embodiments, lack of disease progression is indicated by an EDSS value that is not increased from a baseline EDSS value by 0.5 or greater over a duration of time.
[0193] In some embodiments, a subject lacks disease progression over a duration of time after receiving the method of treatment of the present disclosure. In some embodiments, the lack of disease progression is indicated by absence of Confirmed Disability Progression (CPD), where an EDSS value is not increased by 0.5 or greater from a baseline EDSS value greater than 5.5, or is not increased by 1.0 or greater from a baseline EDSS value of less than or equal to 5.5, over a duration of time. In some embodiments, the lack of disease progression is indicated by absence of Composite Confirmed Disability Progression (CCDP), where CCDP is defined as: (1) disability progression measured by EDSS (increase by 1.0 point or greater if the baseline EDSS is less than or equal to 5.5 points, or an increase by 0.5 point or greater if the baseline EDSS is >5.5 points; (2) increase in Timed 25-Foot Walk (T25FW) by at least 20%; or (3) increase in 9-Hole Peg Test (9HPT) by at least 20%, measured over a period of time compared to baseline. In some embodiments, over the period of time, a lack of disease progression in the subject is indicated by: (1) an EDSS value is stable compared to a baseline EDSS value (e.g., both values are substantially the same), an EDSS value is not increased by 1.0 or greater from a baseline EDSS value of less than or equal to 5.5, or an EDSS value is not increased by 0.5 or greater from a baseline value of greater than 5.5; (2) there is substantially no change in Timed 25-Foot Walk (T25FW) compared to a baseline measurement, or increase in T25FW is less than 20% compared to a baseline measurement; and / or (3) there is substantially no change in 9-Hole Peg Test (9HPT) compared to a baseline measurement, or increase in 9HPT is less than 20% compared to a baseline measurement. In some embodiments, the duration of time for measuring the disease progression indicators is about 12 weeks, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 14 months, about 16 months, about 18 months, about 20 months, about 22 months, about 24 months, or longer.
[0194] In some embodiments, the number of days from baseline to disease progression, measured by CDP or CCDP, is increased by the treatment of the present disclosure, for example, by at least 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold. In some embodiments, the annualized relapse rate in patients with active SPMS (relapse in the past 2 years or active lesions on MRI) is reduced by the treatment of the present disclosure, for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In some embodiments, the T2 burden of demyelinating disease by brain MRI, including whole brain volume and grey matter volume changes, is reduced by the treatment of the present disclosure, for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In some embodiments, the intrathecal oligoclonal bands from cerebrospinal fluid (CSF) are reduced by the treatment of the present disclosure, for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. It is understood that the above parameters can be measured in a population of subjects receiving the treatment of the present disclosure compared to a population of control subjects, e.g., not receiving any treatment for MS or only receiving DMT.
[0195] For continued efficacy, a subject can receive 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or more doses of any engineered T cell described herein. In some embodiments, a subject receives at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 doses of an engineered T cell (e.g., a T cell expressing a CAR, e.g., a CAR comprising an amino acid sequence as set forth in SEQ ID NO: 13).
[0196] In some embodiments, administration of a provided method and composition results in a reduction e.g., at least a 1% reduction, at least a 5% reduction, at least a 10% reduction, at least a 15% reduction, at least a 20% reduction, at least a 25% reduction, at least a 30% reduction, at least a 35% reduction, at least a 40% reduction, at least a 45% reduction, at least a 50% reduction, at least a 55% reduction, at least a 60% reduction, at least a 65% reduction, at least a 70% reduction, at least a 75% reduction, at least a 80% reduction, at least a 85% reduction, at least a 90% reduction, at least a 95% reduction, or at least a 99% reduction, or about a 1% reduction to about a 99% reduction, about a 1% reduction to about a 90% reduction, about a 1% reduction to about a 80% reduction, about a 1% reduction to about a 70% reduction, about a 1% reduction to about a 60% reduction, about a 1% reductionto about a 50% reduction, about a 1% reduction to about a 45% reduction, about a 1% reduction to about a 40% reduction, about a 1% reduction to about a 35% reduction, about a 1% reduction to about a 30% reduction, about a 1% reduction to about a 25% reduction, about a 1% reduction to about a 20% reduction, about a 1% reduction to about a 15% reduction, about a 1% reduction to about a 10% reduction, about a 1% reduction to about a 5% reduction, about a 5% reduction to about a 99% reduction, about a 5% reduction to about a 90% reduction, about a 5% reduction to about a 80% reduction, about a 5% reduction to about a 70% reduction, about a 5% reduction to about a 60% reduction, about a 5% reduction to about a 50% reduction, about a 5% reduction to about a 45% reduction, about a 5% reduction to about a 40% reduction, about a 5% reduction to about a 35% reduction, about a 5% reduction to about a 30% reduction, about a 5% reduction to about a 25% reduction, about a 5% reduction to about a 20% reduction, about a 5% reduction to about a 15% reduction, about a 5% reduction to about a 10% reduction, about a 10% reduction to about a 99% reduction, about a 10% reduction to about a 90% reduction, about a 10% reduction to about a 80% reduction, about a 10% reduction to about a 70% reduction, about a 10% reduction to about a 60% reduction, about a 10% reduction to about a 50% reduction, about a 10% reduction to about a 45% reduction, about a 10% reduction to about a 40% reduction, about a 10% reduction to about a 35% reduction, about a 10% reduction to about a 30% reduction, about a 10% reduction to about a 25% reduction, about a 10% reduction to about a 20% reduction, about a 10% reduction to about a 15% reduction, about a 15% reduction to about a 99% reduction, about a 15% reduction to about a 90% reduction, about a 15% reduction to about a 80% reduction, about a 15% reduction to about a 70% reduction, about a 15% reduction to about a 60% reduction, about a 15% reduction to about a 50% reduction, about a 15% reduction to about a 45% reduction, about a 15% reduction to about a 40% reduction, about a 15% reduction to about a 35% reduction, about a 15% reduction to about a 30% reduction, about a 15% reduction to about a 25% reduction, about a 15% reduction to about a 20% reduction, about a 20% reduction to about a 99% reduction, about a 20% reduction to about a 90% reduction, about a 20% reduction to about a 80% reduction, about a 20% reduction to about a 70% reduction, about a 20% reduction to about a 60% reduction, about a 20% reduction to about a 50% reduction, about a 20% reduction to about a 45% reduction, about a 20% reduction to about a 40% reduction, about a 20% reduction to about a 35% reduction, about a 20% reduction to about a 30% reduction, about a 20% reduction to about a 25% reduction, about a 25% reduction to about a 99% reduction, about a 25% reduction to about a 90% reduction, about a 25% reduction to about a 80% reduction, about a25% reduction to about a 70% reduction, about a 25% reduction to about a 60% reduction, about a 25% reduction to about a 50% reduction, about a 25% reduction to about a 45% reduction, about a 25% reduction to about a 40% reduction, about a 25% reduction to about a 35% reduction, about a 25% reduction to about a 30% reduction, about a 30% reduction to about a 99% reduction, about a 30% reduction to about a 90% reduction, about a 30% reduction to about a 80% reduction, about a 30% reduction to about a 70% reduction, about a 30% reduction to about a 60% reduction, about a 30% reduction to about a 50% reduction, about a 30% reduction to about a 45% reduction, about a 30% reduction to about a 40% reduction, about a 30% reduction to about a 35% reduction, about a 35% reduction to about a 99% reduction, about a 35% reduction to about a 90% reduction, about a 35% reduction to about a 80% reduction, about a 35% reduction to about a 70% reduction, about a 35% reduction to about a 60% reduction, about a 35% reduction to about a 50% reduction, about a 35% reduction to about a 45% reduction, about a 35% reduction to about a 40% reduction, about a 40% reduction to about a 99% reduction, about a 40% reduction to about a 90% reduction, about a 40% reduction to about a 80% reduction, about a 40% reduction to about a 70% reduction, about a 40% reduction to about a 60% reduction, about a 40% reduction to about a 50% reduction, about a 40% reduction to about a 45% reduction, about a 45% reduction to about a 99% reduction, about a 45% reduction to about a 90% reduction, about a 45% reduction to about a 80% reduction, about a 45% reduction to about a 70% reduction, about a 45% reduction to about a 60% reduction, about a 45% reduction to about a 50% reduction, about a 50% reduction to about a 99% reduction, about a 50% reduction to about a 90% reduction, about a 50% reduction to about a 80% reduction, about a 50% reduction to about a 70% reduction, about a 50% reduction to about a 60%> reduction, about a 60% reduction to about a 99% reduction, about a 60% reduction to about a 90% reduction, about a 60% reduction to about a 80% reduction, about a 60% reduction to about a 70% reduction, about a 70% reduction to about a 99% reduction, about a 70% reduction to about a 90% reduction, about a 70% reduction to about a 80% reduction, about a 80% reduction to about a 99% reduction, about a 80% reduction to about a 90% reduction, or about a 90% reduction to about a 99% reduction) in the number of B cells in a tissue of the subject (e.g., in peripheral blood, and / or CSF) having multiple sclerosis, e.g., as compared to the levels in the subject prior to treatment or the levels in a similar subject not treated or receiving a different treatment. In some embodiments, after deep measured depletion of B cells in a tissue of a subject (e.g., in peripheral blood), B cell counts may increase and substantially recover to normal levels, e.g., as compared to levels in the subject prior to treatment or the levels in asimilar subject not treated or receiving a different treatment or any other suitable control. In some embodiments, B cell counts will substantially recover to normal levels after about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. In some embodiment, recovered B cells will show a sustained naive phenotype profile, indicating the potential for an immune reset and a longterm functional cure of the subject. Without wishing to be bound by theory, it is contemplated that the B cell depletion caused by the CAR T cells may lead to an immune reset, e.g., as evidenced by the durable absence of symptoms of the disease even in the presence of reconstituted B cell numbers.
[0197] In some embodiments, administration of methods and compositions described herein result in a reduction (e.g., at least a 1% reduction, at least a 5% reduction, at least a 10% reduction, at least a 15% reduction, at least a 20% reduction, at least a 25% reduction, at least a 30% reduction, at least a 35% reduction, at least a 40% reduction, at least a 45% reduction, at least a 50% reduction, at least a 55% reduction, at least a 60% reduction, at least a 65% reduction, at least a 70% reduction, at least a 75% reduction, at least a 80% reduction, at least a 85% reduction, at least a 90% reduction, at least a 95% reduction, or at least a 99% reduction, or about a 1% reduction to about a 99% reduction (or any of the subranges of this range described herein) in the level of auto-antibodies (e.g., as indicated by changes in the pattern and / or number of oligoclonal bands in CSF) in the subject having multiple sclerosis, e.g., as compared to the levels in the subject prior to treatment or the levels in a similar subject not treated or receiving a different treatment. In some embodiments, the level of autoantibodies (e.g., as indicated by oligoclonal bands in CSF) in the subject having multiple sclerosis remains stable, e.g., as compared to the levels in the subject prior to treatment or the levels in a similar subject not treated or receiving a different treatment.
[0198] In some embodiments, the T cells expand to a peak level of at least 50, 100, or 200 cells per pL of blood sample after the administration. In some embodiments, the T cells expand to a peak level of at least 20, 30, or 40 cells per L of cerebrospinal fluid (CSF) sample after the administration. In some embodiments, the number of oligoclonal bands in the subject is reduced by at least 5, 6, 7, 8, 9, or 10. In some embodiments, the subject does not experience immune effector cell-associated neurotoxicity syndrome (ICANS).Other Autoimmune Diseases
[0199] Also provided herein are methods and compositions for reducing the number of B cells in a subject having an autoimmune disease, such as autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, chronicinflammatory demyelinating polyradiculoneuropathy (CIDP), neuromyelitis optica spectrum disorder (NMOSD), or idiopathic inflammatory myopathy (IIM) (e.g., antisynthetase syndrome (ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM)).
[0200] The methods of the present disclosure use T cells engineered to express anti-CD19 CAR constructs, which can reduce or deplete B cells responsible for one or more clinical symptoms of the autoimmune disease. In many embodiments, the anti-CD19 CAR constructs have a lower toxicity profile as compared to conventional treatment. In some embodiments, an anti-CD19 CAR is substantially non- toxic to a subject receiving treatment with the CAR therapy. In some embodiments, such low toxicity or non- toxic CAR therapies provided by the present disclosure allow for higher doses and / or multiple doses which result in depletion of B cells at sites not treatable with conventional autoimmune treatments due to their toxicity profile. In some embodiments, a provided CAR therapy exhibits low risk of immunogenicity even when used in multiple dosing regimens at least in part due the CAR being a human construct, incorporating a fully human CD19-binding site. Indeed, CAR therapies provided herein remarkably exhibit low levels of toxicity commonly associated with CAR therapy (e.g., anti-CD19 CAR therapy), including cytokine-release syndrome (CRS) and neurologic toxicities.
[0201] The present disclosure provides, among other things, a method of treating an autoimmune disease (e.g., autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM such as ASyS), the method comprising administering to a subject in need thereof a therapeutically effective amount of T cells that comprises a vector comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises, from N-terminus to C-terminus: (a) an antigen-binding fragment of an anti-CD19 antibody; (b) a transmembrane domain; and (c) an intracellular T cell signaling domain from human CD3ij.
[0202] In some embodiments, an anti-CD19 antibody is a fully human antibody. In some embodiments, an antigen-binding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 1, 2, and 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively. In some embodiments, an antigenbinding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, andCDR3 amino acid sequences of SEQ ID NOs: 25, 26, and 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively. In some embodiments, a heavy chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 7, and the light chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 8. In some embodiments, a heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, an antigen-binding fragment of the anti- CD19 antibody comprises the amino acid sequence of SEQ ID NO: 17.
[0203] In some embodiments, a transmembrane domain is from human CD8. In some embodiments, a transmembrane domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 1 1. In some embodiments, a transmembrane domain comprises the amino acid sequence of SEQ ID NO: 11.
[0204] In some embodiments, an intracellular T cell signaling domain from human CD3 comprises an amino acid sequence at least 90% identical to SEQ ID NO: 23. In some embodiments, an intracellular T cell signaling domain from human CD3 comprises the amino acid sequence of SEQ ID NO: 23.
[0205] In some embodiments, a CAR further comprises an intracellular T cell signaling domain from human CD28. In some embodiments, an intracellular T cell signaling domain from human CD28 comprises the amino acid sequence of SEQ ID NO: 21.
[0206] In some embodiments, a CAR does not comprise an intracellular T cell signaling domain from 4- IBB.
[0207] In some embodiments, a CAR comprises an amino acid sequence of SEQ ID NO: 10 or 13. See, e.g., U.S. Patent 10,287,350, which is incorporated by reference herein in its entirety.
[0208] In some embodiments, a vector is a lentivirus vector. In some embodiments, a vector further comprises a murine stem cell virus (MSCV) U3 promoter operably linked to the nucleic acid.
[0209] In some embodiments, at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the provided T cells express a CAR (e.g., any CAR provided herein). In some embodiments, provided T cells comprise at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%) of CD8+ cytotoxic T cells. In someembodiments, provided T cells comprise at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%) of CD4+ helper T cells.
[0210] In some embodiments, a subject having an autoimmune disease (e.g., autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA- associated vasculitis, CIDP, NMOSD, or IIM such as ASyS) undergoes a treatment scheme that comprises steps of: (1) reducing and / or washing out one or more previous autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA- associated vasculitis, CIDP, NMOSD, or IIM such as ASys medications (e.g., as described herein); (2) obtaining T cells from the subject for making engineered T cells (e.g., by apheresis); (3) optionally resuming one or more of the previous medications from step (1) if required (e.g., as determined by a clinician to maintain disease stability) for a duration of time; (4) optional lymphodepletion (e.g., via any method described herein); and (5) administration of the engineered T cells of the present disclosure. In some embodiments, the time between step (1) and step (2) is about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 3 weeks, about 4 weeks, about 8 weeks, about 12 weeks, or more. It will be understood by a skilled artisan that the time to effectively reduce and / or wash out one or more previous medications (e.g., the time between step (1) and step (2)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the type or class of previous medication and its half-life, among other things. In some embodiments, the time between step (2) and step (4) is about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, or more. It will be understood by a skilled artisan that the time between obtaining T cells from a subject for making engineered T cells (e.g., by apheresis) and lymphodepletion (e.g., the time between step (2) and step (4)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the health of the subject and the quality of the cells recovered for engineering, among other things. In some embodiments, the time between step (4) and step (5) is about 5 days, about 6 days, about 7 days, or more. It will be understood by a skilled artisan that the time between lymphodepletion and administration of the engineered T cells (e.g., the time between step (4) and step (5)) may vary, e.g., may be longer or shorter, or fall between values provided herein, depending on many factors including the method of lymphodepletion and the health of thesubject, among other things. In some embodiments, a treatment scheme does not comprise a lymphodepletion step (e.g., a step (4)).
[0211] The present disclosure appreciates that therapeutic regimens for autoimmune diseases, such as autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), neuromyelitis optica spectrum disorder (NMOSD), or idiopathic inflammatory myopathy (IIM) (e.g., antisynthetase syndrome (ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM)), generally require chronic administration or administration of multiple treatment cycles to effectively treat the disease or disorder. The most common treatments include corticosteroids and immunosuppressive drugs, which can be very toxic to a subject. In some cases, these drugs can also suppress a subject’s immune system, resulting in serious infections and / or adverse side effects in bone marrow, liver, and / or kidneys. Accordingly, standard of care treatments such as corticosteroid and immunosuppressive drug combinations present challenges to chronic use. In contrast, use of engineered T cells provided herein offers the premise of a single infusion possibly controlling disease for a prolonged period of time. Use of an engineered T cells as provided herein also permits repeated treatments (e.g., chronic administration, multiple treatment cycles, etc.) due to low toxicity profile and subsequent reduced side effects, e.g., as a result of the fully human nature the scFv, among other things. In many embodiments, use of the provided engineered T cells results in lower toxicity with subsequent reduced adverse effects over time and can be repeated in the future as needed.
[0212] In some embodiments, prior to receiving a provided treatment, a subject is administered an antihistamine and / or an antipyretic as a premedication. In some embodiments, an antihistamine is administered orally. In some embodiments, an antihistamine is administered intravenously. In some embodiments, an antihistamine is diphenhydramine. In some embodiments, an antipyretic is acetaminophen.
[0213] In some embodiments of any of the methods described herein, a step of administering comprises administering two or more doses of an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, a step of administering comprises administering five or more doses of an engineered T cell. In some embodiments, a step of administering comprises administering ten or more doses of an engineered T cell. In some embodiments, a dose of an engineered T cell is fractionated such that the total dose is administered over the course at least two, three, four, five, six, seven, or more days.
[0214] The engineered T cells used in the methods of the present disclosure can be generated by a process disclosed herein. In some embodiments, an engineered T cell is generated by introducing into a T cell an engineered nucleic acid comprising a nucleic acid sequence encoding a CAR (e.g., any CAR described herein, e.g, an anti-CD19 CAR). In some embodiments, an engineered nucleic acid further comprises a promoter operably linked to a nucleic sequence encoding a CAR. In some embodiments, an engineered T cell is generated by further contacting the T cell with an effective amount of one or more agents that activate CD3 and CD28 under conditions that allow for stimulation of the T cell. In some embodiments, a T cell is obtained from a subject (e.g., an autologous or allogeneic subject), prior to a step of generating an engineered T cell and a step of administering the engineered T cell. An engineered T cell can be generated or made using any method of making an engineered T cell described herein, e.g., in the “Methods of Making Engineered T Cells” section above.
[0215] In some embodiments, the present disclosure provides for a method of reducing the number of B cells in a tissue in a subject having autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS), the method comprising a step of administering an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of reducing the number of B cells in a tissue in a subject having autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS), the method comprising a step of administering an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0216] In some embodiments, the present disclosure provides for a method of treating autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS), the method comprising a step of administering an engineered T cell (e.g., any engineered T cell described herein). In some embodiments, the present disclosure provides for a method of treating autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA- associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS), the method comprising a step of administering an engineered T cell, wherein the engineered T cell is an anti-CD19 CAR T cell. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid encoding anamino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, an anti-CD19 CAR T cell comprises a nucleic acid as set forth in SEQ ID NO: 14.
[0217] In some embodiments, provided engineered T cells are administered using parenteral administration (e.g., intravenous administration). Methods and compositions of the present disclosure may be administered using any suitable method.
[0218] In some embodiments, administering of methods and compositions provided herein to a subject with autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS) results in amelioration of one or more symptoms of the autoimmune disease in the subject. In some embodiments, administering of methods and compositions provided herein to a subject with autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS) results in a reduction in the number, severity, or frequency of one or more symptoms of the autoimmune disease in the subject (e.g., as compared to the number, severity, or frequency of the one or more symptoms of the autoimmune disease in the subject prior to receiving treatment with provided methods or compositions). In some embodiments, a subject having autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4- related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS) having been administered an engineered T cell as described here can experience a reduction in inflammation and / or auto-antibody production.
[0219] A pharmaceutical composition useful in the method disclosed herein can contain an engineered T cell and a pharmaceutically acceptable carrier or buffer. In some embodiments, the pharmaceutical composition can be formulated in an injectable form (e.g., as solution and / or suspension). In some embodiments, a pharmaceutical composition comprising an engineered T cell as provided herein can further include phosphate buffered saline. Pharmaceutically acceptable carriers, fillers, and vehicles that can be used in a pharmaceutical composition described herein can include, without limitation, ion exchangers, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, and sodium chloride.
[0220] An effective dosage (e.g., for a provided T cell composition) to administer to a patient intravenously can vary depending on the severity of the autoimmune disease (e.g., autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease,ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS)), the age and general health condition of a subject, excipient usage, the possibility of co-usage with other therapeutic treatments, and the judgment of the treating physician. An effective amount of an engineered T cell can be any amount that reduces inflammation and auto-antibody production within a subject having the autoimmune disease (e.g., via deletion or reduction of autoreactive B cells) without producing significant toxicity to the subject. In many embodiments, an effective dosage may also be dependent on the level of CAR expression in the provided engineered T cells and / or the percentage of engineered T cells within a provided composition. In some cases, engineered T cells can be a purified population of engineered T cells generated as described herein. In some cases, the purity of a population of engineered T cells can be assessed using any appropriate method, including, without limitation, flow cytometry. In some embodiments, purity of a population of engineered T cells can be assessed by quantifying the amount of T cells expressing the CAR relative to all the T cells in the population. In some cases, a population of engineered T cells to be administered to a subject can include a range of purities from about 5% to about 80%, about 10% to about 80%, about 15% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 5% to about 70%, about 5% to about 60%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 70% to about 100%, from about 70% to about 90%, from about 70% to about 80%, from about 80% to about 90%, from about 90% to about 100%, from about 80% to about 100%, from about 80% to about 90%, or from about 90% to 100%. In some cases, a dosage of a provided therapy (e.g., number of engineered T cells to be administered) can adjusted based on the level of purity of the therapy.
[0221] In some embodiments, a therapeutically effective dose is in a range of about 5xl07to IxlO8, about 5xl07to 9xl07, about 5xl07to 8xl07, about 5xl07to 7xl07, about 5xl07to 6xl07, about 6xl07to IxlO8, about 7xl07to IxlO8, about 8xl07to IxlO8, about 9xl07to IxlO8, about 6xl07to 9xl07, or about 7xl07to 8xl07of the T cells. In some embodiments, a therapeutically effective dose is in a range of about 5xl07to IxlO8of the T cells. In some embodiments, a therapeutically effective dose is about 5xl07of the T cells. In some embodiments, a therapeutically effective dose is about IxlO8of the T cells.
[0222] In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about O. lxlO8, about 0.2xl08, about 0.3xl08, about 0.4x10s, about 0.5xl08, about 0.6xl08, about 0.7xl08, about 0.8xl08, aboutO.9xlO8, about l.OxlO8, about l.lxlO8, about 1.2xl08, about 1.3xl08, about 1.4xl08, or about 1.5xl08engineered cells. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 0.5x10sengineered cells. In some embodiments, provided compositions e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about l.OxlO8engineered cells.
[0223] In some embodiments, provided T cells are administered by intravenous infusion. In some embodiments, the subject receives a single dose of the T cells.
[0224] In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about IxlO5, about 1.5xl05, about 2xl05, about 2.5xl05, about 3xl05, about 3.5x10’’, about 4xl05, about 4.5xl0\ about 5xl0 , about 5.5xl05, about 6xl05, about 6.5xl05, about 7xl05, about 7.5xl05, about 8xl05, about 8.5xl05, about 9xl05, about 9.5xl05, about IxlO6, about 1.2xl06, about 1.4xl06, about 1.6xl06, about 1.8xl06, about 2xl06, about 2.2xl06, or about 2.4xl06engineered cells per kg of body weight. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 7xl05engineered cells per kg of body weight. In some embodiments, provided compositions (e.g., pharmaceutical compositions) of engineered T cells are administered at a dose of about 1.4xl06engineered cells per kg of body weight.
[0225] The frequency of administration of an engineered T cell can be any frequency that reduces inflammation or auto-antibody production within a subject having the autoimmune disease (e.g., via deletion or reduction of autoreactive B cells) without producing toxicity to the subject. In some embodiments, the actual frequency of administration can vary depending on various factors including, without limitation, the effective amount, duration of treatment, use of multiple treatment agents, and severity of the condition may require an increase or decrease in frequency of administration.
[0226] An effective duration for administering a composition containing an anti-CD19 CAR T cell or a nucleic acid encoding the same can be any duration that reduces inflammation or auto-antibody production within the subject having the autoimmune disease (e.g., via deletion or reduction of autoreactive B cells) without producing toxicity to the subject. In some embodiments, the effective duration can vary from several days to several months. In some embodiments, the effective treatment duration for administering a composition containing an engineered T cell to treat autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS) can range in duration from about one month to about five years(e.g., from about two months to about five years, from about three months to about five years, from about six months to about five years, from about eight months to about five years, from about one year to about five years, from about one month to about four years, from about one month to about three years, from about one month to about two years, from about six months to about four years, from about six months to about three years, or from about six months to about two years). In some embodiments, the effective treatment duration is at least one year, two years, three years, or more. In some embodiments, a subject receives an infusion of a provided treatment and is cured (e.g., via initiation of an immune reset).
[0227] In some embodiments, a course of treatment and / or the severity of one or more symptoms related to autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS) can be monitored. Any appropriate method can be used to determine whether the autoimmune disease is being treated. For example, immunological techniques (e.g., ELISA) can be performed to determine if the level of auto-antibodies present within the subject being treated as described herein is reduced following the administration of an engineered T cell. Remission and relapse can be monitored by testing for one or more markers of the autoimmune disease, including but not limited to titers of one or more autoantibodies associated with the autoimmune disease and clinical signs of disease activity.
[0228] For continued efficacy, a subject can receive 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or more doses of any engineered T cell described herein. In some embodiments, a subject receives at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 doses of an engineered T cell (e.g., a T cell expressing a CAR, e.g., a CAR comprising an amino acid sequence as set forth in SEQ ID NO: 13).
[0229] In some embodiments, a subject receiving a presently provided treatment has previously received a standard of care or approved treatment for the autoimmune disease (e.g., any common treatment described herein with respect to the autoimmune disease), and the standard of care or approved treatment dose is reduced (e.g., by tapering) or terminated (e.g., by washing out) before T cells are obtained from the subject for making engineered T cells (e.g., via any method described herein). In some embodiments, a standard of care or approved treatment dose is reduced or terminated at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeksbefore T cells are obtained from the subject for making engineered T cells (e.g., by apheresis). In some embodiments, a standard of care or approved treatment dose is reduced or terminated at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks prior to a subject receiving a provided treatment. In some embodiments, a standard of care or approved treatment dose is reduced at least 6 weeks prior to a subject receiving a provided treatment. In some embodiments, a subject continues to receive a standard of care or approved treatment (e.g., at a standard dose, at a dose used prior to receiving the treatment of the present disclosure, at a reduced dose, and / or keeping only a limited number of individual therapeutic components from the original SOC treatment) while also receiving the presently provided treatment. In some embodiments, a subject does not continue to receive a standard of care or approved treatment while receiving the presently provided treatment. In some embodiments, a subject continues to receive a corticosteroid (e.g., a glucocorticoid, such as prednisone) at a reduced dose while also receiving the presently provided treatment.
[0230] For example, provided herein are methods and compositions for treating a subject with an autoimmune disease, such as autoimmune encephalitis, Sjogren’s syndrome, kidney transplantation, IgG4-related disease, ANCA-associated vasculitis, CIDP, NMOSD, or IIM (e.g., ASyS), for which conventional therapeutic regimens have been shown to be ineffective (e.g., due to their toxicity profiles or limitations in their pharmacological action). In some embodiments, conventional therapeutic regimens (i.e., standard of care (SOC) therapy) are withdrawn so that patients are free of any supportive immunomodulatory drugs for a duration of time (e.g., at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 6 months, 8 months, 1 year, 2 years, 3 years, or more) after receiving provided methods and compositions. In some embodiments, conventional therapeutic regimens (i.e., SOC therapy) are withdrawn ahead of collecting host cells (e.g., lymphocytes, such as T cells) to be engineered by any method described herein (e.g., at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 day, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, or more before collecting host cells).
[0231] In some embodiments, administration of a provided method and composition results in a reduction (e.g., at least a 1% reduction, at least a 5% reduction, at least a 10% reduction, at least a 15% reduction, at least a 20% reduction, at least a 25% reduction, at least a 30% reduction, at least a 35% reduction, at least a 40% reduction, at least a 45% reduction, at least a 50% reduction, at least a 55% reduction, at least a 60% reduction, at least a 65% reduction, at least a 70% reduction, at least a 75% reduction, at least a 80% reduction, at leasta 85% reduction, at least a 90% reduction, at least a 95% reduction, or at least a 99% reduction, or about a 1% reduction to about a 99% reduction, about a 1% reduction to about a 90% reduction, about a 1% reduction to about a 80% reduction, about a 1% reduction to about a 70% reduction, about a 1% reduction to about a 60% reduction, about a 1% reduction to about a 50% reduction, about a 1% reduction to about a 45% reduction, about a 1% reduction to about a 40% reduction, about a 1% reduction to about a 35% reduction, about a 1% reduction to about a 30% reduction, about a 1% reduction to about a 25% reduction, about a 1% reduction to about a 20% reduction, about a 1% reduction to about a 15% reduction, about a 1% reduction to about a 10% reduction, about a 1% reduction to about a 5% reduction, about a 5% reduction to about a 99% reduction, about a 5% reduction to about a 90% reduction, about a 5% reduction to about a 80% reduction, about a 5% reduction to about a 70% reduction, about a 5% reduction to about a 60% reduction, about a 5% reduction to about a 50% reduction, about a 5% reduction to about a 45% reduction, about a 5% reduction to about a 40% reduction, about a 5% reduction to about a 35% reduction, about a 5% reduction to about a 30% reduction, about a 5% reduction to about a 25% reduction, about a 5% reduction to about a 20% reduction, about a 5% reduction to about a 15% reduction, about a 5% reduction to about a 10% reduction, about a 10% reduction to about a 99% reduction, about a 10% reduction to about a 90% reduction, about a 10% reduction to about a 80% reduction, about a 10% reduction to about a 70% reduction, about a 10% reduction to about a 60% reduction, about a 10% reduction to about a 50% reduction, about a 10% reduction to about a 45% reduction, about a 10% reduction to about a 40% reduction, about a 10% reduction to about a 35% reduction, about a 10% reduction to about a 30% reduction, about a 10% reduction to about a 25% reduction, about a 10% reduction to about a 20% reduction, about a 10% reduction to about a 15% reduction, about a 15% reduction to about a 99% reduction, about a 15% reduction to about a 90% reduction, about a 15% reduction to about a 80% reduction, about a 15% reduction to about a 70% reduction, about a 15% reduction to about a 60% reduction, about a 15% reduction to about a 50% reduction, about a 15% reduction to about a 45% reduction, about a 15% reduction to about a 40% reduction, about a 15% reduction to about a 35% reduction, about a 15% reduction to about a 30% reduction, about a 15% reduction to about a 25% reduction, about a 15% reduction to about a 20% reduction, about a 20% reduction to about a 99% reduction, about a 20% reduction to about a 90% reduction, about a 20% reduction to about a 80% reduction, about a 20% reduction to about a 70% reduction, about a 20% reduction to about a 60% reduction, about a 20% reduction to about a 50% reduction, about a 20% reduction to about a 45%reduction, about a 20% reduction to about a 40% reduction, about a 20% reduction to about a 35% reduction, about a 20% reduction to about a 30% reduction, about a 20% reduction to about a 25% reduction, about a 25% reduction to about a 99% reduction, about a 25% reduction to about a 90% reduction, about a 25% reduction to about a 80% reduction, about a 25% reduction to about a 70% reduction, about a 25% reduction to about a 60% reduction, about a 25% reduction to about a 50% reduction, about a 25% reduction to about a 45% reduction, about a 25% reduction to about a 40% reduction, about a 25% reduction to about a 35% reduction, about a 25% reduction to about a 30% reduction, about a 30% reduction to about a 99% reduction, about a 30% reduction to about a 90% reduction, about a 30% reduction to about a 80% reduction, about a 30% reduction to about a 70% reduction, about a 30% reduction to about a 60% reduction, about a 30% reduction to about a 50% reduction, about a 30% reduction to about a 45% reduction, about a 30% reduction to about a 40% reduction, about a 30% reduction to about a 35% reduction, about a 35% reduction to about a 99% reduction, about a 35% reduction to about a 90% reduction, about a 35% reduction to about a 80% reduction, about a 35% reduction to about a 70% reduction, about a 35% reduction to about a 60% reduction, about a 35% reduction to about a 50% reduction, about a 35% reduction to about a 45% reduction, about a 35% reduction to about a 40% reduction, about a 40% reduction to about a 99% reduction, about a 40% reduction to about a 90% reduction, about a 40% reduction to about a 80% reduction, about a 40% reduction to about a 70% reduction, about a 40% reduction to about a 60% reduction, about a 40% reduction to about a 50% reduction, about a 40% reduction to about a 45% reduction, about a 45% reduction to about a 99% reduction, about a 45% reduction to about a 90% reduction, about a 45% reduction to about a 80% reduction, about a 45% reduction to about a 70% reduction, about a 45% reduction to about a 60% reduction, about a 45% reduction to about a 50% reduction, about a 50% reduction to about a 99% reduction, about a 50% reduction to about a 90% reduction, about a 50% reduction to about a 80% reduction, about a 50% reduction to about a 70% reduction, about a 50% reduction to about a 60% reduction, about a 60% reduction to about a 99% reduction, about a 60% reduction to about a 90% reduction, about a 60% reduction to about a 80% reduction, about a 60% reduction to about a 70% reduction, about a 70% reduction to about a 99% reduction, about a 70% reduction to about a 90% reduction, about a 70% reduction to about a 80% reduction, about a 80% reduction to about a 99% reduction, about a 80% reduction to about a 90% reduction, or about a 90% reduction to about a 99% reduction) in the number of B cells in a tissue of the subject e.g., in peripheral blood) having the autoimmune disease, e.g., as compared to the levels in the subject prior totreatment or the levels in a similar subject not treated or receiving a different treatment. In some embodiments, after deep measured depletion of B cells in a tissue of a subject (e.g., in peripheral blood), B cell counts may increase and substantially recover to normal levels, e.g., as compared to levels in the subject prior to treatment or the levels in a similar subject not treated or receiving a different treatment or any other suitable control. In some embodiments, B cell counts will substantially recover to normal levels after about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. In some embodiment, recovered B cells will show a sustained naive phenotype profile, indicating the potential for an immune reset and a long-term functional cure of the subject. In some embodiments, the amount of one or more auto- antibodies (e.g., autoantibodies associated with the autoimmune disease) produced by the recovered B cells and measured in serum is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% relative to the amount of the auto-antibodies prior to the provided treatment. Without wishing to be bound by theory, it is contemplated that the B cell depletion caused by the CAR T cells may lead to an immune reset, e.g., as evidenced by the durable absence of symptoms of the disease even in the presence of reconstituted B cell numbers.
[0232] In some embodiments, administration of methods and compositions described herein result in a reduction e.g., at least a 1% reduction, at least a 5% reduction, at least a 10% reduction, at least a 15% reduction, at least a 20% reduction, at least a 25% reduction, at least a 30% reduction, at least a 35% reduction, at least a 40% reduction, at least a 45% reduction, at least a 50% reduction, at least a 55% reduction, at least a 60% reduction, at least a 65% reduction, at least a 70% reduction, at least a 75% reduction, at least a 80% reduction, at least a 85% reduction, at least a 90% reduction, at least a 95% reduction, or at least a 99% reduction, or about a 1% reduction to about a 99% reduction (or any of the subranges of this range described herein) in the level of auto-antibodies in the subject having the autoimmune disease, e.g., as compared to the levels in the subject prior to treatment or the levels in a similar subject not treated or receiving a different treatment.Autoimmune encephalitis (AE)
[0233] Provided herein are methods and compositions for reducing the number of B cells in a subject having autoimmune encephalitis (AE). In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject having AE, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the present disclosure provides methods and compositionsfor reducing pathogenic autoantibodies associated with AE (e.g., anti-NMDAR autoantibodies, anti- AMP AR autoantibodies, anti-GABAR (e.g., GABAAR or GABABR) autoantibodies, anti-LGIl autoantibodies, anti-CASPR2 autoantibodies, anti-GAD autoantibodies, anti-GlyR autoantibodies, anti-DPPX autoantibodies, anti-IgLON5 autoantibodies, anti-mGluRl autoantibodies, anti-mGluR5 autoantibodies, anti-diacylglycerol lipase alpha (DAGLA) autoantibodies, etc.). Also provided herein are methods of treating a subject having AE, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject. In some embodiments, the AE is anti-NMDAR encephalitis. In some embodiments, the AE is anti-AMPAR encephalitis. In some embodiments, the AE is anti- GABAR encephalitis. In some embodiments, the AE is anti-LGIl encephalitis. In some embodiments, the AE is anti-CASPR2 encephalitis. In some embodiments, the AE is anti- GAD encephalitis. In some embodiments, the AE is anti-GlyR encephalitis. In some embodiments, the AE is anti-DPPX encephalitis. In some embodiments, the AE is associated with anti-IgLON5 antibodies. In some embodiments, the AE is anti-mGluRl encephalitis. In some embodiments, the AE is anti-mGluR5 encephalitis. In some embodiments, the AE is anti-DAGLA encephalitis.
[0234] In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for AE that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with plasmapheresis. In some embodiments, a subject receiving a presently provided treatment has previously been treated with plasma exchange. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a B cell targeting therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti- CD19 antibody therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD20 antibody therapy (e.g., an obinutuzumab therapy (e.g., Gazyva), an ocrelizumab therapy (e.g., Ocrevus), an ofatumumab therapy (e.g., Kesimpta), a rituximab therapy (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD38 antibody (e.g., daratumumab, isatuximab, etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with bortezomib.Sjogren ’s Syndrome
[0235] Provided herein are methods and compositions for reducing the number of B cells in a subject having Sjogren’s syndrome. In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue (e.g. salivary glands or cervical lymph nodes) in a subject having Sjogren’s syndrome, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the present disclosure provides methods and compositions for reducing pathogenic autoantibodies associated with Sjorgren’s syndrome. Also provided herein are methods of treating a subject having Sjogren’s syndrome, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anli- CD19 CAR T cell) to the subject.
[0236] In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for Sjogren’ s syndrome that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with plasmapheresis. In some embodiments, a subject receiving a presently provided treatment has previously been treated with plasma exchange. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a B cell targeting therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti- CD20 antibody therapy (e.g., an obinutuzumab therapy (e.g., Gazyva), an ocrelizumab therapy (e.g., Ocrevus), an ofatumumab therapy (e.g., Kesimpta), a rituximab therapy (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD38 antibody (e.g., daratumumab, isatuximab, etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CTLA4 antibody.Kidney Transplantation
[0237] Provided herein are methods and compositions for reducing the number of B cells in a subject that has received or will receive a kidney transplant. In some embodiments, provided herein are methods and compositions for reducing or eliminating allo-antibodies in a subject prior to kidney transplantation. In some embodiments, the allo-antibodies to be reduced or substantially eliminated include anti-HLA antibodies that bind the donor’s HLA serotype. This approach is also known as desensitization. It is understood that anti-HLAantibodies may arise in a subject by various means, including post-pregnancy, post-blood transfusion, etc. Without wishing to be bound by theory, it is understood that eradication of allo- antibodies (such as anti-HLA antibodies) in a sensitized subject (e.g., a subject that is positive for anti-HLA antibodies that bind the donor’ s HLA serotype) mitigates acute rejection of a transplanted kidney thereby enabling successful transplantation in the subject. In some embodiments, provided herein are methods for reducing or eliminating allo- antibodies (e.g., anti-HLA antibodies) in a sensitized subject, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the allo- antibodies to be reduced or substantially eliminated include antibodies that bind the donor’s kidney, which may mediate acute or chronic humoral immune rejection of a transplanted kidney in a subject. In some embodiments, provided herein are methods and compositions for treatment of acute or chronic humoral (antibody-mediated) immune rejection of a transplanted kidney in a subject, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the present disclosure provides a method of reducing the number of B cells in the transplanted kidney in a subject that has received the kidney transplantation, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. The engineered T cell can be administered prior to or after the kidney transplantation. In some embodiments, the present disclosure provides methods and compositions for reducing antibodies associated with kidney transplant rejection. Also provided herein are methods of treating a subject that has received or will receive a kidney transplant, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject.
[0238] In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for kidney transplantation (e.g., a treatment to reduce B cells, to desensitize the subject receiving the transplant, etc.) that was ineffective and / or caused one or more adverse side effects.IgG4-Related Disease
[0239] Provided herein are methods and compositions for reducing the number of B cells in a subject having an IgG4-related disease. In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject having an IgG4-related disease, the method comprisingadministering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the present disclosure provides methods and compositions for reducing pathogenic autoantibodies associated with IgG4-related disease (e.g., anti-MuSK autoantibodies, anti-IgLON5 autoantibodies, anti-LGIl autoantibodies, anti-Contactin 1 autoantibodies, anti-Neurofascin autoantibodies, anti-DPPX autoantibodies, anti-CASPR2 autoantibodies, etc.). Also provided herein are methods of treating a subject having an IgG4- related disease, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject. In some embodiments, the IgG4-related disease is IgG4-related sialadenitis. In some embodiments, the IgG4-related disease is IgG4-related ophthalmic disease. In some embodiments, the IgG4-related disease is IgG4-related pharyngitis. In some embodiments, the IgG4-related disease is IgG4-related thyroid disease. In some embodiments, the IgG4-related disease is IgG4-related hypophysitis. In some embodiments, the IgG4-related disease is IgG4-related pachymeningitis. In some embodiments, the IgG4- related disease is IgG4-related leptomeningitis. In some embodiments, the IgG4-related disease is IgG4-related pancreatitis. In some embodiments, the IgG4-related disease is IgG4- related lung disease. In some embodiments, the IgG4-related disease is IgG4-related pleuritis. In some embodiments, the IgG4-related disease is IgG4-related hepatopathy. In some embodiments, the IgG4-related disease is IgG4-related sclerosing cholangitis. In some embodiments, the IgG4-related disease is IgG4-related cholecystitis. In some embodiments, the IgG4-related disease is IgG4-related aortitis. In some embodiments, the IgG4-related disease is IgG4-related periaortitis. In some embodiments, the IgG4-related disease is IgG4- related periarteritis. In some embodiments, the IgG4-related disease is IgG4-related pericarditis. In some embodiments, the IgG4-related disease is IgG4-related mediastinitis. In some embodiments, the IgG4-related disease is IgG4-related retroperitoneal fibrosis. In some embodiments, the IgG4-related disease is IgG4-related mesenteritis. In some embodiments, the IgG4-related disease is IgG4-related mastitis. In some embodiments, the IgG4-related disease is IgG4-related kidney disease. In some embodiments, the IgG4-related disease is IgG4-related prostatitis. In some embodiments, the IgG4-related disease is IgG4-related perivasal fibrosis. In some embodiments, the IgG4-related disease is IgG4-related paratesticular pseudotumor. In some embodiments, the IgG4-related disease is IgG4-related epididymo-orchitis. In some embodiments, the IgG4-related disease is IgG4-related lymphadenopathy. In some embodiments, the IgG4-related disease is IgG4-related skin disease. In some embodiments, the IgG4-related disease is IgG4-related perineural disease.
[0240] In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for IgG4-related disease that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with plasmapheresis. In some embodiments, a subject receiving a presently provided treatment has previously been treated with plasma exchange. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a B cell targeting therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD20 antibody therapy (e.g., an obinutuzumab therapy (e.g., Gazyva), an ocrelizumab therapy (e.g., Ocrevus), an ofatumumab therapy (e.g., Kesimpta), a rituximab therapy (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD38 antibody (e.g., daratumumab, isatuximab, etc.)..
[0241] In some embodiments, a subject receiving a presently provided treatment has previously received a standard of care or approved treatment for IgG4-related disease (e.g., any common treatment described herein, e.g., those discussed above), and the standard of care or approved treatment dose is reduced (e.g., by tapering) or terminated (e.g., by washing out) before T cells are obtained from the subject for making engineered T cells (e.g., via any method described herein). In some embodiments, a standard of care or approved treatment dose is reduced or terminated at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks before T cells are obtained from the subject for making engineered T cells (e.g., by apheresis). In some embodiments, a standard of care or approved treatment dose is reduced at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks prior to a subject receiving a provided treatment. In some embodiments, a standard of care or approved treatment dose is reduced at least 6 weeks prior to a subject receiving a provided treatment. In some embodiments, a subject continues to receive a standard of care or approved treatment (e.g., at a standard dose, at a reduced dose, and / or keeping only a limited number of individual therapeutic components from the original SOC treatment) while also receiving the presently provided treatment. In some embodiments, a subject does not continue to receive a standard of care or approved treatment while receiving the presently provided treatment. In some embodiments, a subject continues to receive a corticosteroid (e.g., a glucocorticoid, such as prednisone) at a reduced dose while also receiving the presently provided treatment.AN CA- Associated Vasculitis
[0242] Provided herein are methods and compositions for reducing the number of B cells in a subject having ANCA-associated vasculitis. In some embodiments, a subject having ANCA-associated vasculitis is identified as having granulomatosis with polyangiitis (GPA) or microscopic polyangiitis (MPA) according to the 2022 ACR / EULAR Classification Criteria. In some embodiments, a subject having ANCA-associated vasculitis is positive for serum PR3-ANCA or MPO-ANCA. In some embodiments, a subject having ANCA- associated vasculitis has either (A) or (B): (A) a Birmingham Vasculitis Activity Score as a disease-specific activity index for Wegener's granulomatosis (BVAS / WG) of >3 within prior 60 days (not including the BVAS / WG items of "fever" or "purpura") and either: (i) failure to achieve sustained remission with glucocorticoids and either cyclophosphamide or rituximab given for at least 4 months; or (ii) intolerance or contraindication to alternative treatments; OR (B) refractory disease defined as: (i) a history of repeated (>2) relapses of ANCA- associated vasculitis despite treatment with immunosuppressive agents; or (ii) requiring prolonged and / or repeated courses of unacceptable doses of glucocorticoids to maintain adequate control.
[0243] In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject having ANCA-associated vasculitis, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. In some embodiments, the present disclosure provides methods and compositions for reducing pathogenic autoantibodies associated with ANCA-associated vasculitis. Also provided herein are methods of treating a subject having ANCA-associated vasculitis, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject.
[0244] In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment for ANCA-associated vasculitis that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with plasmapheresis. In some embodiments, a subject receiving a presently provided treatment has previously been treated with plasma exchange. In some embodiments, a subject receiving a presently provided treatment has previously been treated with a B cell targeting therapy. In some embodiments, a subject receiving a presently provided treatment haspreviously been treated with an anti-CD20 antibody therapy (e.g., an obinutuzumab therapy (e.g., Gazyva), an ocrelizumab therapy (e.g., Ocrevus), an ofatumumab therapy (e.g., Kesimpta), a rituximab therapy (e.g., Rituxan, Ruxience, Truxima, Riabni), etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an anti-CD38 antibody (e.g., daratumumab, isatuximab, etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with cyclophosphamide..Chronic Inflammatory Demyelinating Polyradiculoneuropathy
[0245] The present disclosure also provides methods and compositions that can be used to treat a subject identified as having chronic inflammatory demyelinating polyradiculoneuropathy (CIDP). CIDP is an autoimmune disease of the peripheral nerves and nerve roots. It is the most common chronic autoimmune neuropathy in humans and is estimated to affect up to 1 in 10,000 individuals. Although multiple subtypes and variants of chronic inflammatory neuropathies with diverse corresponding acronyms have been described, CIDP remains the most common form. CIDP is characterized by symmetric loss of motor and sensory function, and diagnostic tests demonstrate electrophysiological and histological evidence of demyelination. Additional pathologic features include interstitial edema, “onion bulb” formation, which is indicative of repeated demyelination and remyelination episodes, and endoneurial inflammatory cell infiltrates composed of monocytes and lymphocytes.
[0246] For most patients, the clinical course of CIDP progresses slowly; however, one- third of patients can present with relapsing-remitting disease, which by some definitions progresses or relapses for more than eight weeks. This time-course distinguishes CIDP from acute inflammatory demyelinating polyneuropathies and other subtypes of Guillain-Barre syndrome, which are monophasic and usually peak within three to four weeks; although, their clinical course is also very heterogeneous. Current therapeutic options for treating CIDP, including glucocorticoids, intravenous immunoglobulin, and plasmapheresis, have limited efficacy, with many patients experiencing a relapsing period despite receiving treatment.
[0247] The CIDP to treat with the present method can be positive for one or more autoantibodies. Auto- antibodies associated with CIDP include but are not limited to antibodies that bind neurofascin-155 (NF155), neurofascin-140 (NF-140), neurofascin-186 (NF-186), and contactin-associated protein 1 (CASPR1). In some embodiments, the CIDP is anti- neurofascin-155 (anti-NF155) positive (i.e., the subject tests positive for anti-NF155antibodies). In some embodiments, the CIDP is anti-NF155 negative (z.e., the subject tests negative for anti-NF155 antibodies). In some embodiments, the CIDP is anti-neurofascin-140 (anti-NF- 140) positive. In some embodiments, the CIDP is anti-NF140 negative. In some embodiments, the CIDP is anti-neurofascin-186 (anti-NF-186) positive. In some embodiments, the CIDP is anti-NF186 negative. In some embodiments, the CIDP is anti- contactin-associated protein 1 (anti-CASPRl) positive. In some embodiments, the CIDP is anti-CASPRl negative. In some embodiments, a subject may be anti-NF155, anti-NF140, anti-NF186, and / or anti-CASPRl negative, but positive for one or more other autoantibodies. In some embodiments, a subject with CIDP is seronegative for antibodies known to be associated with CIDP. In some embodiments, the subject tests positive for anti-NF155, anti- NF140, anti-NF186, and / or anti-CASPRl antibodies. In some embodiments, the subject tests negative for anti-NF155, anti-NF140, anti-NF186, and / or anti-CASPRl antibodies.
[0248] The present disclosure provides, among other things, methods and compositions for reducing the number of B cells in a tissue in a subject having CIDP. The present disclosure also provides engineered T cells (e.g., T cells engineered to express any CAR described herein) and method of making engineered T cells for use in treating CIDP.
[0249] The present disclosure appreciates that B cells express a wide array of cell surface molecules during their differentiation and proliferation, e.g., CD 19. CD 19 is widely expressed on B cells during all phases of B cell development from pro-B cells to plasmablasts. The present disclosure further appreciates, that because of the ubiquity of CD19 on B cells, CD19 can function as a therapeutic target for certain provided methods and compositions (e.g., methods and compositions for treating CIDP). Accordingly, in some embodiments, provided herein are methods and compositions for reducing the number of B cells in a subject (e.g., in a tissue of a subject) via targeting of CD19. In some embodiments, the present disclosure provides for methods and compositions for treating a subject having CIDP via targeting of CD19. In some embodiments, the present disclosure provides for engineered T cells that target CD 19. In some embodiments, the present disclosure provides for engineered nucleic acids that express one or more polypeptides that target CD19. In many embodiments of the present disclosure a CAR that binds to CD 19 is used to target cells that express CD19 (e.g., B cells).
[0250] Provided herein are methods and compositions for reducing the number of B cells in a subject having chronic inflammatory demyelinating polyradiculoneuropathy (CIDP). In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject havingCIDP, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. Also provided herein are methods of treating a subject having CIDP, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject.
[0251] In some embodiments, a subject receiving a provided treatment (e.g., any engineered nucleic acid, engineered T cell, or CAR provided herein) has previously been treated with a lymphodepletion agent (e.g., cyclophosphamide and / or fludarabine). In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment (e.g., any standard of care or approved treatment described herein) for CIDP that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with a corticosteroid (e.g., a glucocorticoid). In some embodiments, a subject receiving a presently provided treatment has previously been treated with non-steroidal immunosuppressants. In some embodiments, a subject receiving a presently provided treatment has previously been treated with intravenous immunoglobulin therapy. In some embodiments, as subject receiving a presently provided treatment has previously been treated with plasmapheresis.Neuromyelitis Optica Spectrum Disorder
[0252] The present disclosure further provides methods and compositions that can be used to treat a subject identified as having a neuromyelitis optica spectrum disorder (NMOSD) (e.g., neuromyelitis optica (NMO)). In some embodiments, an NMOSD is NMO. NMOSD is an autoimmune inflammatory demyelinating disorder of the central nervous system (CNS). NMOSD mainly affects the optic nerve and spinal cord and its lesions also involve the brain stem and cerebrum in most cases by repeated brain attacks, manifesting as optic neuritis, myelitis, and certain brain and brainstem syndromes. NMOSD is a severely disabling disorder leading to devastating sequelae, such as permanent blindness or paralysis or even death. Simultaneously, NMOSD patients are complicated with severe persistent neuropathic pain, and about half of the patients had severe pain, which seriously affected the quality of life of patients.
[0253] The NMOSD to treat with the present method can be positive for one or more auto-antibodies. Auto- antibodies associated with NMOSD include but are not limited to antibodies that bind aquaporin-4 (AQP4) and myelin oligodendrocyte glycoprotein (MOG).In some embodiments, the NMOSD is anti-aquaporin-4 (anti-AQP4) positive (i.e., the subject tests positive for anti-AQP4 antibodies). In some embodiments, the NMOSD is anti-AQP4 negative (i.e., the subject tests negative for anti-AQP4 antibodies). In some embodiments, the NMOSD is anti-myelin oligodendrocyte glycoprotein (anti-MOG) positive. In some embodiments, the NMOSD is anti-MOG negative. In some embodiments, a subject with NMOSD is positive for one or more non-anti-AQP4 antibodies that are associated with the disease (e.g., anti-MOG antibodies, etc.). In some embodiments, a subject may be anti-AQP4 negative but positive for one or more other autoantibodies (e.g., anti-MOG antibodies, etc.). In some embodiments, a subject with NMOSD is seronegative for antibodies known to be associated with NMOSD. In some embodiments, the subject tests positive for anti-AQP4 and / or anti-MOG antibodies. In some embodiments, the subject tests negative for anti-AQP4 and / or anti-MOG antibodies.
[0254] The present disclosure provides, among other things, methods and compositions for reducing the number of B cells in a tissue in a subject having NMOSD. The present disclosure also provides engineered T cells (e.g., T cells engineered to express any CAR described herein) and method of making engineered T cells for use in treating NMOSD.
[0255] The present disclosure appreciates that B cells express a wide array of cell surface molecules during their differentiation and proliferation, e.g., CD 19. CD 19 is widely expressed on B cells during all phases of B cell development from pro-B cells to plasmablasts. The present disclosure further appreciates, that because of the ubiquity of CD19 on B cells, CD19 can function as a therapeutic target for certain provided methods and compositions (e.g., methods and compositions for treating NMOSD). Accordingly, in some embodiments, provided herein are methods and compositions for reducing the number of B cells in a subject (e.g., in a tissue of a subject) via targeting of CD19. In some embodiments, the present disclosure provides for methods and compositions for treating a subject having NMOSD via targeting of CD 19. In some embodiments, the present disclosure provides for engineered T cells that target CD 19. In some embodiments, the present disclosure provides for engineered nucleic acids that express one or more polypeptides that target CD19. In many embodiments of the present disclosure a CAR that binds to CD 19 is used to target cells that express CD19 (e.g., B cells).
[0256] Provided herein are methods and compositions for reducing the number of B cells in a subject having neuromyelitis optica spectrum disorder (NMOSD). In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject having NMOSD, themethod comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. Also provided herein are methods of treating a subject having NMOSD, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject.
[0257] In some embodiments, a subject receiving a provided treatment (e.g., any engineered nucleic acid, engineered T cell, or CAR provided herein) has previously been treated with a lymphodepletion agent (e.g., cyclophosphamide and / or fludarabine). In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment (e.g., any standard of care or approved treatment described herein) for NMOSD that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with a B-cell depleting antibody (e.g., rituximab, inebilizumab, etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with a corticosteroid (e.g., a glucocorticoid). In some embodiments, a subject receiving a presently provided treatment has previously been treated with non-steroidal immunosuppressants. In some embodiments, a subject receiving a presently provided treatment has previously been treated with intravenous immunoglobulin therapy. In some embodiments, a subject receiving a presently provided treatment has previously been treated with complement inhibitor (e.g., eculizumab, ravalizumab, zilucoplan, etc.).Idiopathic Inflammatory Myopathy
[0258] The present disclosure further provides methods and compositions that can be used to treat a subject identified as having idiopathic inflammatory myopathy (IIM), such as antisynthetase syndrome (ASyS), dermatomyositis (DM), immune-mediated necrotizing myopathy (IMNM), or polymyositis (PM). The immune-mediated necrotizing myopathy can be an anti-HMGCoR-myopathy or an anti-SRP myopathy. In some embodiments, the IIM is identified based on the 2017 EULAR / ACR classification criteria for probable or definite IIM. In some embodiments, the subject with IIM is identified to have a disease severity and minimal core set measurement criteria of MMT-8 score <136 / 150, with at least 2 other abnormal core set measures (CSMs) from the following: (i) patient global visual analogue scale (VAS) >3 on a 1-10 scale; (ii) physician's global VAS >3 on a 1-10 scale; (iii) global extramuscular activity score >2 cm; (iv) elevation of at least one of the muscle enzymes (CK, AST, ALT, aldolase, LDH) >1.5 times upper limit of normal; and / or (v) HAQ-DI >0.25. Insome embodiments, the subject with IIM is identified to have active disease per at least one of the following: (i) creatine kinase >4xULN; (ii) active rashes of dermatomyositis such that CDASI-activity >6; (iii) evidence on MRI of active myositis within last 6 months; (iv) evidence on EMG of active myositis within last 6 months; and / or (v) muscle biopsy evidence of active myositis within last 6 months. In some embodiments, the subject with IIM is positive for at least one of the following myositis-specific autoantibodies (except for patients with DM who need not have a positive test for a myositis-specific autoantibody), presented as myositis-specific antibody: target antigen: anti-Jo-1 : Histidyl-tRNA synthetase; anti-EJ: Glycyl-tRNA synthetase; anti-PL-7: Threonyl-tRNA synthetase; anti-OJ: Isoleucyl-tRNA synthetase; anti-PL-12: Alanyl-tRNA synthetase; anti-Mi-2: Nucleosome remodeling deacetylase complex; anti-TIFl gamma: Transcription intermediary factor 1; anti-MDA5: Melanoma differentiation associated protein 5; anti-SAE: Small ubiquitin-like modifier activating enzyme; anti-NXP2: Nuclear matrix protein 2; anti-SRP: Signal recognition particle; and / or anti-HMGCR: 3hydroxy-3methylglutaryl CoA reductase. In some embodiments, the IIM is positive for at least one myositis-specific antibody, myositis- associated antibody, or anti-nuclear antibody, e.g., detected at screening or prior to screening for the treatment provided herein. In some embodiments, the IIM disease activity has severe muscle and / or skin involvement. In some embodiments, the subject has an active myositis- associated rash. In some embodiments, the IIM is diagnosed by examining a muscle biopsy. In some embodiments, the subject has an elevated creatine kinase level more than 3-fold higher than the upper limit of normal creatine kinase level. In some embodiments, the subject has progressive Interstitial Lung Disease (ILD) on high-resolution computed tomography (HRCT). In some embodiments, the subject has an inadequate response to glucocorticoids and at least 2 of the following treatments used for at least 3 months: azathioprine, methotrexate, cyclosporin A, tacrolimus, MMF, cyclophosphamide, leflunomide, IVIG, and rituximab. In some embodiments, the subject having IIM has refractory IIM. In some embodiments, the subject having IIM disease has previous failure, or intolerance, to glucocorticoids and at least two non-glucocorticoids immunosuppressive therapies. In some embodiments, a subject having IIM has, before receiving a provided therapy, undergone at least 12 weeks of a standard of care or approved therapy that has been ineffective, and / or experienced an intolerance or adverse reaction necessitating discontinuation of the standard of care or approved therapy.
[0259] ASyS is an autoimmune disease characterized by autoantibodies against one of many aminoacyl transfer RNA (tRNA) synthetases with clinical features that may includeinterstitial lung disease (ILD), non-erosive arthritis, myositis, Raynaud’s phenomenon, unexplained fever and / or mechanic’s hands. ASyS is an idiopathic inflammatory myopathy, with a higher prevalence of ILD compared to dermatomyositis and polymyositis (other idiopathic inflammatory myopathies with which it shares many features). The ILD in ASyS patients is often severe and rapidly progressive, causing much of the increased morbidity and mortality associated with anti-synthetase syndrome as compared to the other idiopathic inflammatory myopathies. Patients with ASyS have a higher incidence of pulmonary involvement and symptoms considered to be more characteristic of other connective tissue diseases, such as Raynaud’s phenomenon or gastroesophageal reflux. Patients with ASyS may have corticosteroid-resistant myositis or ILD, frequently requiring additional immunosuppressive medications.
[0260] Immunosuppressive agents are commonly used to treat the pulmonary and / or muscle manifestations of ASyS. Corticosteroids have long been first-line in the treatment idiopathic inflammatory myopathies, though when corticosteroids are used as monotherapy in ASyS, there is frequent lung disease recurrence with corticosteroid tapering. Additional immunosuppressive agents are added for refractory muscle and / or lung disease and as corticosteroid-sparing agents. Frequently used adjunctive agents include azathioprine, my cophenolate mofetil, tacrolimus, rituximab, and cyclophosphamide. Nevertheless, such standard treatments have limited therapeutic effect and often results in side effects.
[0261] The ASyS to treat with the present method can be positive for one or more autoantibodies. Auto-antibodies associated with ASyS include but are not limited to antibodies that bind histidyl tRNA synthetase, Jo-1, PL-7, PL-12, PL-EJ, PL-OJ, PL-KS, PL-Zo, and PL-Ha. In some embodiments, the ASyS is anti-histidyl tRNA synthetase positive (i.e., the subject tests positive for anti-histidyl tRNA synthetase antibodies). In some embodiments, the ASyS is anti-Jo-1 positive i.e., the subject tests positive for anti-Jo-1 antibodies). In some embodiments, the ASyS is anti-Jo-1 negative (i.e., the subject tests negative for anti-Jo-1 antibodies). In some embodiments, the ASyS is anti-PL-7 positive. In some embodiments, the ASyS is anti-PL-7 negative. In some embodiments, the ASyS is anti-PL-12 positive. In some embodiments, the ASyS is anti-PL-12 negative. In some embodiments, the ASyS is anti-PL- EJ positive. In some embodiments, the ASyS is anti-PL-EJ negative. In some embodiments, the ASyS is anti-PL-OJ positive. In some embodiments, the ASyS is anti-PL-OJ negative. In some embodiments, the ASyS is anti-PL-KS positive. In some embodiments, the ASyS is anti-PL-KS negative. In some embodiments, the ASyS is anti-PL-Zo positive. In some embodiments, the ASyS is anti-PL-Zo negative. In some embodiments, the ASyS is anti-PL-Ha positive. In some embodiments, the ASyS is anti-PL-Ha negative. In some embodiments, a subject may be anti-Jo-1, anti-PL-7, anti-PL-12, anti-PL-EJ, anti-PL-OJ, anti-PL-KS, anti- PL-Zo, and / or anti-PL-Ha negative, but positive for one or more other autoantibodies. In some embodiments, a subject with ASyS is seronegative for antibodies known to be associated with ASyS. In some embodiments, the subject tests positive for anti-Jo-1, anti-PL- 7, anti-PL-12, anti-PL-EJ, anti-PL-OJ, anti-PL-KS, anti-PL-Zo, and / or anti-PL-Ha antibodies. In some embodiments, the subject tests negative for anti-Jo-1, anti-PL-7, anti-PL-12, anti-PL- EJ, anti-PL-OJ, anti-PL-KS, anti-PL-Zo, and / or anti-PL-Ha antibodies.
[0262] The present disclosure provides, among other things, methods and compositions for reducing the number of B cells in a tissue in a subject having ASyS. The present disclosure also provides engineered T cells (e.g., T cells engineered to express any CAR described herein) and method of making engineered T cells for use in treating ASyS.
[0263] The present disclosure appreciates that B cells express a wide array of cell surface molecules during their differentiation and proliferation, e.g., CD19. CD19 is widely expressed on B cells during all phases of B cell development from pro-B cells to plasmablasts.. The present disclosure further appreciates, that because of the ubiquity of CD 19 on B cells, CD 19 can function as a therapeutic target for certain provided methods and compositions (e.g., methods and compositions for treating ASyS). Accordingly, in some embodiments, provided herein are methods and compositions for reducing the number of B cells in a subject (e.g., in a tissue of a subject) via targeting of CD19. In some embodiments, the present disclosure provides for methods and compositions for treating a subject having ASyS via targeting of CD 19. In some embodiments, the present disclosure provides for engineered T cells that target CD 19. In some embodiments, the present disclosure provides for engineered nucleic acids that express one or more polypeptides that target CD19. In many embodiments of the present disclosure a CAR that binds to CD19 is used to target cells that express CD19 (e.g., B cells).
[0264] Provided herein are methods and compositions for reducing the number of B cells in a subject having antisynthetase syndrome (ASyS). In some embodiments, the present disclosure provides a method of reducing the number of B cells producing autoantibodies that mediate autoimmunity in a tissue in a subject having ASyS, the method comprising administering a therapeutically effective amount of any engineered T cell described herein to the subject. Also provided herein are methods of treating a subject having ASyS, the method comprising administering a therapeutically effective amount of an engineered T cell (e.g., any engineered T cell described herein, e.g., an anti-CD19 CAR T cell) to the subject.
[0265] In some embodiments, a subject receiving a provided treatment (e.g., any engineered nucleic acid, engineered T cell, or CAR provided herein) has previously been treated with a lymphodepletion agent (e.g., cyclophosphamide and / or fludarabine). In some embodiments, a subject receiving a provided treatment has previously received a standard of care or approved treatment e.g., any standard of care or approved treatment described herein) for ASyS that was ineffective and / or caused one or more adverse side effects. For example, in some embodiments, a subject receiving a presently provided treatment has previously been treated with a B-cell depleting antibody (e.g., rituximab). In some embodiments, a subject receiving a presently provided treatment has previously been treated with an immunosuppressive drug (e.g., azathioprine, mycophenolate mofetil (MMF), etc.). In some embodiments, a subject receiving a presently provided treatment has previously been treated with a corticosteroid (e.g., a glucocorticoid). In some embodiments, a subject receiving a presently provided treatment has previously been treated with non-steroidal immunosuppressants. In some embodiments, a subject receiving a presently provided treatment has previously been treated with intravenous immunoglobulin therapy.Kits
[0266] Also provided herein are kits that include any of the compositions described herein. For example, a kit can include one or more of any of the nucleic acid constructs described herein. In other examples, a kit can include any of engineered T cell described herein or one or more doses of a composition including any engineered T cell described herein. In some embodiments, a kit can include instructions for performing any of the methods described herein.
[0267] Technologies of the present disclosure will be further described in the following examples, which do not limit the scope of the disclosure described in the claims.EXAMPLES
[0268] The following examples are put forth to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their invention.Example 1. Preparation of Engineered T Cells Comprising a Lentivirus Vector Encoding Hul9-CD828Z
[0269] This example describes a method of producing a fully human autologous antiCD 19 chimeric antigen receptor (CAR) T cell therapy called KYV-101.
[0270] A Hul9-CD828Z may be prepared as described in U.S. Patent No. 10,287,350. Briefly, fully human anti-CD19 CARs were generated by utilizing sequences of the fully human 47G4 monoclonal antibody (described in U.S. Patent Application Publication No. 2010 / 0104509). The 47G4 antibody was generated by vaccinating mice of the KM strain, which carry a human kappa light chain transgene and a human heavy chain transchromosome. The sequences of the 47G4 antibody light chain and heavy chain variable regions were obtained from U.S. Patent Application Publication No. 2010 / 0104509. A 47G4 scFv was designed comprising the following elements from 5' to 3': a CD8 signal sequence, the 47 G4 antibody light chain variable region, a linker sequence (encoding a peptide comprising the amino acid sequence GSTSGSGKPGSGEGSTKG (SEQ ID NO: 9)) (see Cooper et al., Blood, 101(4): 1637-1644 (2003)), and the 47G4 antibody heavy chain variable region. A DNA sequence encoding a CAR was then designed comprising the following components from 5' to 3’: the 47G4 scFv described above, part of the extracellular region and all of the transmembrane region of the human CD8 molecule, and the cytoplasmic (or intracellular) portions of the human CD28 molecule and the human CD3 zeta, molecule. This CAR was designated 47G4-CD828Z (SEQ ID NO: 13), and the sequence was synthesized by Invitrogen (Carlsbad, Calif.).
[0271] Expression of a Hul9-CD828Z polypeptide in a cell can be performed using any suitable method. In these experiments, T cells (CD4+ T cells, CD8+ T cells, or an cell mixture enriched for CD4+ and CD8+ T cells) are transduced with a lentivirus where the lentiviral vector includes a nucleic acid sequence encoding Hul9-CD828Z polypeptide. The lentiviral vector includes an MSCV promoter among other regulatory factors (see, e.g., FIG. 1). Lentivirus is produced in HEK293 cells according to standard protocols. A KL-hl98a28z lentiviral vector system may be used to transduce T cells. KL-hl98a28z is a self-inactivating (SIN) vesicular stomatitis virus (VSV)-G pseudotyped 3rd generation lentiviral vector expressing human anti-CD19 chimeric antigen receptor (CAR). The lentiviral vector KL- hl98a28z is manufactured using a HEK 293T cell line transiently transfected with a state-of- the-art four-plasmid system. The envelope protein encoding plasmid (pLTG1292) expresses a heterologous spike protein, the VSV-G protein, under control of the cytomegalovirus (CMV) promoter. The VSV-G envelope protein provides broad cell tropism for transduction of a wide variety of mammalian cell types. KL-hl98a28z encodes the CAR construct Hul9-CD828Z, and can be used to manufacture CAR T cells for treating patients with B cell- associated diseases.
[0272] Engineered T cells can be produced from blood cells using various known methods, e.g., as described in Ghassemi et al., (2018) Cancer Immunol. Res. 6(9) and Mackensen et al., (2022) Nat. Med. 28:2124-32. In one example, white blood cells are collected from a patient by apheresis. The cells are enriched for CD4+ and CD8+ T cells and are then activated with CD3 and CD28 agonistic agents, e.g., TransAct™, a polymeric nanomatrix coated. Following activation, the cells are transduced with lentiviral vector KL- hl98a28z vector encoding Hul9-CD828Z and expanded in culture. The cells are then harvested and assessed for viability, Hul9-CD828Z expression, T cell phenotype, and potency (e.g., cytotoxicity and cytokine release).
[0273] In one example of preparing engineered T cells, autologous CD4+ and CD8+ T cells were enriched from multiple sclerosis (MS) patients. KYV-101 was generated by transducing T cells with a lentiviral vector encoding the Hul9-CD828Z polypeptide. KYV- 101 functional potency, such as cytokine release and cytotoxicity, was assessed in vitro in cocultures with patient-derived CD19+ B cells, and CD19+ or CD19- control cells. Expansion and functional potency of CAR-T cells from a clinical cohort of KYV-101 treated patients were assessed.
[0274] In the in vitro assays, T cells from MS patients transduced with the lenti virus exhibited greater dose-dependent cytotoxicity and IFN-gamma production when co-cultured with CD19+ cells than untransduced T cells. Negligible responses were observed following co-culture with CD19- control cells. It was observed that KYV-101 manufactured from MS (n=2) patients displayed CD19-specific functional activity. The CAR-T cells expanded by 32.5-61 fold on Day 8, prior to harvest, indicating successful expansion of the cells for therapeutic use.Example 2. Use of KYV-101 to Treat Multiple Sclerosis
[0275] This example describes a phase 2 clinical study to assess the safety, tolerability, and clinical activity of KYV-101 (a fully human anti-CD19 CAR T-cell therapy) in adult subjects with refractory primary progressive multiple sclerosis (PPMS) and secondary progressive multiple sclerosis (SPMS). The refractory patients have continued to progress despite treatment.
[0276] MS is an autoimmune and neurodegenerative disease in which lymphocytes at first attack the myelin sheaths within the central nervous system (CNS), accompanied or laterfollowed by axonal damage. The onset of the disease is primarily in young adults, with women affected 2-fold more frequently than men. MS is estimated to affect greater than 2.8 million individuals worldwide, including more than 1,000,000 individuals in the United States (US).
[0277] The clinical course of MS is variable, and several clinical subtypes have been described. The most prevalent phenotype at diagnosis is relapsing -remitting MS (RRMS; representing -85% of cases of MS), in which patients experience recurrent relapses and remissions of neurological symptoms. Non-relapsing SPMS typically develops following an initial relapsing course, which has evolved to increasing loss of neurologic function and neurologic decline independent of relapses. PPMS is characterized by progressive disability accumulation from the onset without subsequent superimposed relapses. As described in this protocol, the proposed study patient population will include PPMS and SPMS and includes active disease based on the mechanism of action described below and the potential for benefit.
[0278] There are presently 3 Food and Drug Administration (FDA)-approved monoclonal CD20+ antibody therapies for MS: ocrelizumab, ofatumumab, and ublituximab. Rituximab, a CD20+ monoclonal antibody, has also been used off-label for the treatment of MS. All FDA- approved monoclonal antibodies for treatment of MS have an indication for relapsing forms of MS. These drugs target the CD20 glycoprotein molecule expressed on pre-B-cells, mature and memory B-cells, and some plasmablasts. However, the CD20+ glycoprotein is not expressed on plasma cells. One of these molecules (ocrelizumab) has been FDA-approved for PPMS to slow accumulation of disability but has not been shown to halt neurologic progression and there remains a need for additional treatments for PPMS. None of these treatments have been approved for non-active worsening SPMS, or for non-worsening PPMS. Active SPMS can be treated with siponimod or mitoxantrone, which is rarely used due to significant cardiac toxicity and the lifetime risk of secondary leukemia. Of these, mitoxantrone is exposure dependent and thus limits the ability to continue dosing. Siponimod can be initiated following irnmunogenetic testing of the cytochrome P450 (CYP)2C9 metabolic status and has shown some efficacy on myelin maintenance and reduction of cerebral atrophy in SPMS. Thus, there remains a need for effective treatments for SPMS.
[0279] More than 20 disease modifying therapies (DMTs) have also been approved by the Food and Drug Administration (FDA) in the US for the treatment of relapsing forms of MS, including clinically isolated syndrome, RRMS, and active SPMS. One treatment (ocrelizumab) is FDA-approved for PPMS, though efficacy in the pivotal ORATORIO trialappeared driven by the experience of those patients with evidence of active relapsing disease, either clinically or based on magnetic resonance imaging (MRI) evidence of interval T2 hyperintense expanding or gadolinium enhancing lesions. There is no FDA-approved treatment for non-relapsing SPMS or for refractory PPMS; hence, there remains a significant unmet medical need in these populations.
[0280] B -cells play a central and multifunctional role in the immunopathogenesis of MS. B-cells present antigen to T-cells in stimulating a pro-inflammatory immune cascade, secrete pathogenic cytokines, moderate T-cell and myeloid cell functions, form structural B-cell meningeal follicles within the human central nervous system, and produce pathogenic antibodies upon evolution to plasma cells.
[0281] KYV-101 consists of autologous CD4+ and CD8+ enriched and expanded T-cells genetically engineered to express a chimeric antigen receptor that targets CD 19, an antigen expressed on the surface of both normal and autoreactive B-cells in patients with autoimmune diseases. CD19-targeted CAR T-cells harness the ability of cytotoxic T-cells to directly and specifically lyse target cells, leading to effective depletion of B-cells in the circulation and in lymphoid and potentially non-lymphoid tissues. The CAR expressed by the KYV-101 cells is Hul9-CD828Z, see, e.g., Example 1.
[0282] Prior to this study, 1 patient with relapsing remitting RRMS was treated with KYV-101 at a dose of IxlO8CAR T- cells under compassionate use practice. The patient showed a favorable safety profile to KYV-101 administration to date (data available to 30 days post-dose; data not shown), with episodes of Grade 1 cytokine release syndrome (CRS) reported on the day of dosing and Days 3 and 6 post-dose; CRS episodes were associated with fever and resolved with routine standard-of-care management (acetaminophen, tocilizumab, and dexamethasone). The MS patient did not experience immune effector cell- associated neurotoxicity syndrome (ICANS). No meaningful data were available to inform on efficacy in the patient with MS.
[0283] The above-mentioned evidence of bioactivity of CD19-targeting CAR T-cells in animal models and patients with autoimmune disease, the unmet medical need in progressive forms of MS, and the anticipated manageable risks of KYV-101, support proceeding with the investigation of KYV-101 in treatment refractory PPMS or primary or secondary progressive SPMS.Patient Selection
[0284] Representative Inclusion Criteria1. Subject must be 18 to 60 years of age (inclusive).2. Subject must have a history of diagnosis of PPMS or SPMS meeting the criteria below: a. Diagnosed according to the 2017 McDonald criteria; and / or b. EDSS of 3.0 to 5.5 at screening.3. History of treatment with anti-CD20 mAb with continuing evidence of worsening physical disability over a period of >6 months with documented evidence of clinical disability progression within the 2 years prior to inclusion, as below. Patients with active SPMS should also have shown inadequate response or intolerance to another DMT (e.g., sphingosine- 1 -phosphate (SIP) receptor modulator), subject to availability. a) progression of EDSS during the past 2 years of at least 1 point sustained if the baselineEDSS is less than or equal to 5.5 points, or b) increase of timed 25-foot walk (TW25) by at least 20% in the last 2 years sustained for at least 6 months, or c) documented change in neurological examination (inclusive of mental status, cranial nerves, motor, sensory, or gait domains) despite at least 1 year prior treatment for progressive forms of MS (anti-CD20 mAh).Dosage and Administration
[0285] KYV-101 is a cell suspension formulated in a chemically defined freezing medium (50% Plasma-Lyte A™ containing 2% human serum albumin [for a final human serum albumin concentration of 1%] + 50% CryoStorlO containing dimethyl sulfoxide (DMSO) to a final concentration of 5%). The finished product is filled in a freezing bag and stored at <-150°C in the vapor phase of liquid nitrogen. Lymphodepletion (LD) chemotherapy consisting of cyclophosphamide (CYC) 300 mg / m2and fludarabine (FLU) 30 mg / m2is administered intravenously (IV) daily for 3 days, 5 to 7 days prior to administration of KYV-101. KYV-101 is then administered intravenously as a single infusion.
[0286] The primary objective of the study is to evaluate the efficacy of KYV-101. The primary endpoint is Confirmed Disability Progression (CDP), defined as an increase in the Expanded Disability Status Scale (EDSS) of at least 1.0 point if the baseline EDSS is less than or equal to 5.5 points, or an increase of >0.5 points if the baseline EDSS is >5.5 points, from baseline, where the increase is sustained on subsequent visits for at least 12 weeks. An absence of confirmed disease progression over a duration of time (e.g., 12 weeks, 3 months, 4months, 6 months, 1 year, 2 years, or longer) indicates efficacy of KYV-101. It will be understood that follow-up periods (e.g., the duration of time disease progression is monitored) will be a function of the amount of time necessary to assess clinically defined progressive events.
[0287] Secondary objectives of the study include (1) characterization of safety and tolerability of KYV-101 ; (2) further evaluation of the efficacy of KYV-101 ; (3) characterization of pharmacokinetics (PK) and pharmacodynamics (PD) of KYV-101; and (4) evaluation of humoral immunogenicity of KYV-101. Safety and tolerability of KYV-101 can be assessed by incidence and severity of adverse events (AEs), adverse events of special interests (AESIs) and serious adverse events (SAEs). Efficacy of KYV-101 can be further evaluated by: (a) Composite Confirmed Disability Progression (CCDP) defined as disability progression measured by EDSS (increase >1 if the baseline EDSS is less than or equal to 5.5 points, or an increase of >0.5 point, if the baseline EDSS is >5.5 points), or 20% Timed 25- Foot Walk (T25FW) increase, or >20% 9-Hole Peg Test (9HPT) increase, confirmed after >12 weeks; (b) impact on clinical disability as defined by the number of days from randomization to the primary outcome; (c) disability as measured by EDSS change from pretreatment baseline to end of study; (d) annualized relapse rate (ARR) in patients with active SPMS (relapse in the past 2 years or active lesions on MRI); (e) comparison of end-of- study brain MRI compared to baseline scan in T2 burden of demyelinating disease, baseline to end of study, including whole brain volume and grey matter volume changes from treatment baseline to end of study; and / or (f) for the CSF consenting subset, comparison of interval changes in unmatched intrathecal oligoclonal bands treatment from baseline to end of study. PK and PD of KYV-101 can be assessed by CAR-positive T cell counts, CAR transgene levels, B cell counts over time, and systemic cytokine concentrations. Humoral immunogenicity of KYV-101 can be assessed by the presence of anti-KYV-101 antibodies. The secondary endpoints are assessed over a duration of time e.g., 12 weeks, 3 months, 4 months, 6 months, 1 year, 2 years, or longer).
[0288] Prior to initiating the Phase 2 trial, the safety and tolerability of KYV-101 are assessed in an open-label, single-arm, safety run-in period at two escalating dose levels: 0.33xl08and IxlO8CAR+T-cells. This phase aims to gather additional safety information in refractory MS patients.
[0289] Upon successful review of cohort safety and available PK, PD, and efficacy data, there will be a determination of the recommended Phase 2 dose level. As such, the currentlystated Phase 2 dose level of IxlO8CAR T-cells may be replaced with a dose to be determined after the dose escalation safety run-in period of the study.
[0290] In the Phase 2 study, subjects will be randomized to receive KYV-101 (active) or to continuing anti-CD20 mAb (e.g., ocrelizumab) (control) with follow-up to continue until the desired number of confirmed progression events are observed. Subjects randomized to receive anti-CD20 mAb may continue to receive their regularly scheduled anti-CD20 mAb doses. However, subjects randomized to receive anti-CD20 mAb will be allowed to cross over to KYV-101 as escape treatment upon confirmed disease progression. Subjects will be stratified for balance across arms based on PPMS or SPMS. Progression is defined as an increase in the EDSS of at least 1.0 point if the baseline EDSS is less than or equal to 5.5 points, or an increase of >0.5 point, if the baseline EDSS is >5.5 points, from baseline (at the time of randomization), where sustained on subsequent visits for at least 12 weeks.Example 3. Treatment of Multiple Sclerosis Using KYV-101
[0291] This example describes treatment of five patients with progressive multiple sclerosis with KYV-101 (a fully human anti-CD19 CAR T-cell therapy). Additional information related to the studies described in this example, including further detail on Patients 1 and 2, can be found in Fischbach et al., Med 5, 550-558, the contents of which are incorporated by reference in their entirety for all purposes.
[0292] Each patient received a single dose of IxlO8KYV-101 CART-cells following lymphodepletion with fludarabine (30 mg / m2 on days -5, -4, and -3) and cyclophosphamide (300 mg / m2 on days -5, -4, and -3). The KYV-101 construct was as described herein in Example 1, including a CD19 binding domain, a CD8a hinge and transmembrane domain, a CD28 co-stimulatory domain, and a CD3z activation domain.Results
[0293] Patient 1 was a 47-year-old female with a 23 -year history of MS. Patient 1 was initially diagnosed with RRMS based on left-sided leg paresis and disseminated lesions in cerebral and spinal magnetic resonance imaging (c / s MRI). Due to progressive neurological deterioration, B cell-depleting therapy with ocrelizumab was initiated prior to treatment with KYV-101 CAR-T therapy, and continued until 3 months before CAR-T cell infusion. Despite receiving symptomatic treatment with fampridine to address walking disability, disease progressed with further walking distance reduction over time (FIG. 2, panel A). At presentation, c / s MRI showed >50 MS-typical lesions with accentuation in the cervical spinal cord.
[0294] Following CD 19 CAR-T cell infusion, Patient 1 developed a recurring rise in body temperature (cytokine release syndrome [CRS] grade 1 according to American Society for Transplantation and Cellular Therapy consensus), which began a few hours after infusion (FIG. 2, panel B and FIG. 3, panel A). Two sequential doses of tocilizumab and two doses of dexamethasone (10 mg) were consequently administered to prevent higher grade CRS, which conveys increased risk for immune effector cell-associated neurotoxicity syndrome (ICANS). On day 5, Patient 1 presented with facial and neck swelling and received a third dose of tocilizumab and another single dexamethasone dose, which transitioned to 10 mg every 6 h at day 6 due to another rise in body temperature. Symptoms rapidly subsided thereafter, enabling dexamethasone taper over the following 8 days. Overall, no ICANS occurred (FIG.2, panel B). Additionally, Patient 1 developed a transient increase in transaminases (grade 2, according to Common Terminology Criteria for Adverse Events [CTCAE] v.5) (FIG. 3, panel B). Lymphocyte counts confirmed lymphocyte suppression prior to CAR-T cell therapy (FIG.3, panel C).
[0295] Concurrent with the reported fever episodes, Patient 1 presented with isolated transient worsening of pre-existing spastic paresis of the left side. This was interpreted as Uhthoff’s phenomenon, a temporally worsening of MS-related symptoms due to elevated body temperature. As a result, the expanded disability status scale (EDSS) score transiently increased to 6.0 before returning to baseline (4.5) by day 29 and remaining stable (FIG. 2, panel B). At subsequent clinical follow-ups to day 100, no sign of treatment-related toxicity was observed. On day 64, one new T2 lesion without contrast enhancement was detected at the thoracic spinal cord (FIG. 4, panel B), which remained unchanged at day 100 on a subsequent MRI. Self-reported walking distance increased from 400 m at baseline to 700 m at day 100 post-CAR-T cell infusion (EDSS 4.0). Other neurological assessments including timed 25-ft walk, 9-hole peg test, and 6-min walking distance matched pre-infusion values.
[0296] Patient 2 was a 36-year-old male patient that was diagnosed with PPMS after a 2- year history of worsening gait due to lower limb paraparesis with disseminated lesions in c / s MRI. Ocrelizumab was administered and continued until 4 months prior to CAR-T cell infusion (FIG. 2, panel C). At baseline, spastic paraparesis had progressed, limiting the patient’s walking distance to 10 m with the assistance of a walker, and c / s MRI revealed >20 disseminated lesions. After CAR-T cell infusion and until the last follow-up (day 28), Patient 2 showed no signs of CRS or ICANS (FIG. 2, panel D and FIG. 3, panel D). Repeat c / s MRI on day 14 was unchanged from baseline. A transient increase of transaminases (CTCAE grade 3) was observed (FIG. 3, panel E), which improved with ursodeoxycholic acidtreatment. No other adverse events occurred. No new neurological symptoms were observed, and EDSS remained stable throughout observation. Lymphocyte counts confirmed sufficient lymphocyte suppression, similar to what was observed for Patient 1 (FIG. 3, panel F).
[0297] Patient 3 was a 29-year-old patient that was diagnosed with RRMS about 1 year prior to receiving KYV-101 treatment. Patient 3 had previously received methyl-prednisolone (1000 mg / d) and ofatumumab (20 mg) treatments. Patient 3 had an EDSS at baseline of 2. After receiving KYV-101, Patient 3 showed CRS grade 1 and no signs of ICANS.
[0298] Patient 4 was a 27-year-old patient that was diagnosed with RRMS about 5 years prior to receiving KYV-101 treatment. Patient 4 had previously received glatiramer acetate (20mg / d), ofatumumab (20 mg / 4wk), and natalizumab (300 mg / 4wk) treatments. Patient 4 had an EDSS at baseline of 3.5. After receiving KYV-101, Patient 4 showed CRS grade 1 and no signs of ICANS.
[0299] Patient 5 was a 36-year-old patient that was diagnosed with PPMS about 5 years prior to receiving KYV-101 treatment. Patient 5 had previously received ocrelizumab (600 mg) treatment. Patient 5 had an EDSS at baseline of 7. After receiving KYV-101, Patient 5 showed no signs of CRS or ICANS.CAR-T cell expansion
[0300] In Patient 1, peak expansion of CAR-T cells (Cmax) was observed on days 6 and 7 post-infusion (>214 CAR-T cells / mL; FIG. 5, panel A). CAR-T cells remained detectable in the peripheral blood on day 100, with 1.3 cells / mL. In Patient 2, modest expansion of circulating CAR-T cells was observed (>5 / mL at days 17 and 20; FIG. 5, panel B). In both Patient 1 and Patient 2, CAR-T cell presence and target-driven expansion in the CSF relative to peripheral blood was demonstrated by day 14. Consistent with peripheral expansion, this effect was more pronounced in Patient 1 (>64-fold) than in Patient 2 (>27-fold) (FIGs. 5, panels C-F).
[0301] CAR-T cell measurements for presence in blood and CSF for Patients 1-5 is shown in FIG. 6. Change in oligoclonal bands (OCBs) for Patients 1-5 is also shown in FIG. 6. Only Patient 5 showed lack of expansion of CAR-T cells.Target cell effects
[0302] Both Patient 1 and Patient 2 received the same B cell-depleting therapy (ocrelizumab) until 3-4 months prior to CAR-T cell infusion. Nevertheless, circulating B cells were detectable at baseline in the peripheral blood of Patient 1 (FIG. 5, panel G) but not Patient 2 (FIG. 5, panel H). This residual B cell population of Patient 1 was depleted by day 2 post- infusion and has not reconstituted as of day 100. Furthermore, reduced serumimmunoglobulin G was observed in both patients at day 14 post-infusion (FIGs. 5, panels I and J).
[0303] In Patient 1, the number of OCBs decreased from 13 to 6 on day 14, sustained through day 64 (FIG. 5, panel K). Concurrent quantitative evaluation of intrathecal immunoglobulins demonstrated a notable decline at day 64 (FIG. 5, panel I). In Patient 2, no changes in the number of OCBs nor intrathecal immunoglobulin levels were observed on day 14 (FIGs. 5, panels J and L).
[0304] The number of OCBs also decreased in Patients 3 and 4 after receiving CAR-T therapy (FIG. 6).Discussion
[0305] Preventing disease progression remains one of the most difficult challenges in MS therapy. Provided herewith is report on the successful use of CD19 CAR-T cells in patients with MS demonstrating early safety, kinetics, and target cell effects.
[0306] CAR-driven expansion of pathogenic T cells could theoretically lead to severe worsening of MS symptoms and ICANS, which would be expected to occur during the expansion phase of the CAR-T cells. However, surprisingly CAR-T cell related neurological toxicity was not observed, which is especially notable given the substantial expansion of CAR-T cells in the CSF of the patients. This finding is particularly noteworthy since CAR-T cell expansion in the CSF has only been reported concurrently with clinical presentation of ICANS in patients with lymphoma. Similar to reported experiences in other autoimmune diseases, we observed only low-grade CRS (grade 1 ). The observed neck and facial swelling could be interpreted as a local manifestation of CRS, as described in a prior reports in patients with hematological malignancy.
[0307] In summary, we report the first cases of CD 19 CAR-T cell administration in progressive MS with an acceptable safety profile. CAR-T cell enrichment in the CSF was observed without clinical signs of early neurotoxicity. Additionally, our cases showed a possible effect of CD19-directed CAR-T cells on their target cells in the presence of a higher expansion in the CSF as mirrored in a reduction of OCB count in several patients. This further underlines the benefit of CAR-T cell therapy in penetrating immune compartments, which have not been accessible to systemic application of B cell-depleting monoclonal antibodies.
[0308] These findings empower the potential of CAR-T cell therapy for patients with advanced MS that are refractory to conventional antibody-mediated B cell depletion. Systematic studies will be needed to further assess short- and long-term safety profiles andtherapeutic effects with regard to suppression of disease activity. CD19-directed CAR-T cells could not only suppress inflammatory relapses, similar to anti-CD20 antibodies, but at the same time purge the CNS of residing B cells that likely contribute to progression independent of relapses.OTHER EMBODIMENTS
[0309] It is to be understood that while the provided technologies have been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.SEQUENCE APPENDIXSEQ ID NO: 1 Hul9-CD828Z Heavy Chain CDR1 (Kabat)SYAISSEQ ID NO: 2 Hul9-CD828Z Heavy Chain CDR2 (Kabat)GIIPIFGTTNYAQQFQGSEQ ID NO: 3 Hul9-CD828Z Heavy Chain CDR3 (Kabat, Chothia)EAVAADWLDPSEQ ID NO: 4 HuI9-CD828Z Light Chain CDR1 (Kabat, Chothia)RASQSVSSSYLASEQ ID NO: 5 Hul9-CD828Z Light Chain CDR2 (Kabat, Chothia)GASSRATSEQ ID NO: 6 Hul9-CD828Z Light Chain CDR3 (Kabat, Chothia)QQYGSSRFTSEQ ID NO: 7 Hul9-CD828Z Heavy Chain Variable RegionQVQLVQSGAEVKKPGSSVKVSCKDSGGTFSSYAISWVRQAPGQGLEWMGGIIPIFGTTNYAQQFQGRVTITADESTSTAYMELSSLRSEDTAVYYCAREAVAADWLDPWGQGTLVTVSSSEQ ID NO: 8 Hul9-CD828Z Light Chain Variable RegionEIVLTQSPGTLSLSPGERATLSCRASQSVSSSYLAWYQQKPGQAPRLLIYGASSRATGIPDRFSGSGSGTDFTLTISRLEPEDFAVYYCQQYGSSRFTFGPGTKVDIKSEQ ID NO: 9 Hul9-CD828Z Peptide LinkerGSTSGSGKPGSGEGSTKGSEQ ID NO: 10 Full-length Hul9-CD828Z Chimeric Antigen Receptor without signal peptideEIVLTQSPGTLSLSPGERATLSCRASQSVSSSYLAWYQQKPGQAPRLLIYGASSRATGIPDRFSGSGSGTDFTLTISRLEPEDFAVYYCQQYGSSRFTFGPGTKVDIKGSTSGSGKPGSGEGSTKGQVQLVQSGAEVKKPGSSVKVSCKDSGGTFSSYAISWVRQAPGQGLEWMGGIIPIFGTTNYAQQFQGRVTITADESTSTAYMELSSLRSEDTAVYYCAREAVAADWLDPWGQGTLVTVSSFVPVFLPAKPTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDIYIWAPLAGTCGVLLLSLVITLYCNHRNRSKRSRLLHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRSEQ ID NO: 11 CD8a transmembrane domain (shorter version)IYIWAPLAGTCGVLLLSLVITSEQ ID NO: 12 CD28 transmembrane domainFWVLVVVGGVLACYSLLVTVAFIIFWVSEQ ID NO: 13 Full-length Hul9-CD828Z Chimeric Antigen Receptor - amino acid sequenceMALPVTALLLPLALLLHAARPEIVLTQSPGTLSLSPGERATLSCRASQSVSSSYLAWYQQKPGQAPRLLIYGASSRATGIPDRFSGSGSGTDFTLTISRLEPEDFAVYYCQQYGSSRFTFGPGTKVDIKGSTSGSGKPGSGEGSTKGQVQLVQSGAEVKKPGSSVKVSCKDSGGTFSSYAISWVRQAPGQGLEWMGGIIPIFGTTNYAQQFQGRVTITADESTSTAYMELSSLRSEDTAVYYCAREAVAADWLDPWGQGTLVTVSSFVPVFLPAKPTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDIYIWAPLAGTCGVLLLSLVITLYCNHRNRSKRSRLLHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRSEQ ID NO: 14 Full-length Hul9-CD828Z Chimeric Antigen Receptor - nucleic acid sequenceATGGCCCTGCCTGTGACAGCTCTGCTGCTGCCCCTGGCCCTGCTGCTGCATGCCGCCAGACCTGAGATCGTGCTGACCCAGTCTCCCGGCACCCTGTCTCTCAGCCCAGG AGAGAGAGCCACCCTGAGCTGCAGAGCCAGCCAGAGCGTGTCCAGCAGCTACCTGGCCTGGTATCAGCAGAAGCCCGGACAGGCCCCCAGACTGCTGATCTACGGCGCCAGCTCTAGAGCCACCGGCATCCCCGACAGATTCAGCGGCAGCGGCAGTGGCAC CGACTTCACCCTGACCATCAGCAGACTGGAACCCGAGGACTTCGCCGTGTACTACTGCCAGCAGTACGGCAGCAGCCGGTTCACCTTCGGCCCTGGCACCAAGGTGGACATCAAGGGCAGCACCTCCGGCAGCGGCAAGCCTGGCTCTGGCGAGGGCTCTACCAAGGGCCAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCCGGCTCTAGCGTGAAGGTGTCCTGCAAGGACAGCGGCGGCACCTTCAGCAGCTACGCCATC AGCTGGGTGCGCCAGGCCCCAGGACAGGGGCTGGAATGGATGGGCGGCATCATCCCCATCTTCGGCACCACCAACTACGCCCAGCAGTTCCAGGGCAGAGTGACCATC ACCGCCGACGAGAGCACCAGCACCGCCTACATGGAACTGAGCAGCCTGCGGAGCGAGGACACAGCCGTGTATTACTGTGCCCGCGAGGCCGTGGCCGCCGACTGGCTGGATCCTTGGGGACAGGGCACCCTGGTGACAGTGTCCAGCTTCGTGCCCGTGTTCCTGCCCGCCAAGCCTACCACCACCCCTGCCCCTAGACCTCCCACCCCAGCCCCAACAATCGCCAGCCAGCCTCTGTCCCTGCGGCCCGAAGCCTGTAGACCTGCTGCCGGCGGAGCCGTGCACACCAGAGGCCTGGACTTCGCCTGCGATATCTACATCTGGGCCCCTCTGGCCGGCACCTGTGGCGTGCTGCTGCTGAGCCTGGTGATCACCCTGTACTGCAACCACCGGAACAGAAGCAAGCGGAGCCGGCTGCTGCACAGCGACTACATGAACATGACCCCAAGACGGCCTGGCCCCACCCGGAAGCACTACCAGCCTTACGCCCCTCCCAGAGACTTCGCCGCCTACCGGTCCAGAGTGAAGTTCAGCAGATCCGCCGACGCCCCTGCCTACCAGCAGGGACAGAACCAGCTGTACAACGAGCTGAACCTGG GCAGACGGGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCCGAGATGGGCGGAAAGCCCAGACGGAAGAACCCCCAGGAAGGCCTGTATAACGAACT GCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGAGGCGCGGCAAGGGCCACGATGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCAGATGASEQ ID NO: 15 ...
Claims
WHAT IS CLAIMED IS:
1. A method of treating multiple sclerosis, the method comprising administering to a subject in need thereof a therapeutically effective amount of T cells that comprises a vector comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises, from N-terminus to C-terminus:(a) an antigen-binding fragment of an anti-CD19 antibody;(b) a transmembrane domain; and(c) an intracellular T cell signaling domain from human CD3^.
2. A method of reducing the number of B cells that express CD19 in a tissue in a subject having multiple sclerosis, the method comprising administering to the subject a therapeutically effective amount of T cells that comprises a vector comprising a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises, from N-terminus to C-terminus:(a) an antigen-binding fragment of an anti-CD19 antibody;(b) a transmembrane domain; and(c) an intracellular T cell signaling domain from human CD3^.
3. The method of claim 2, wherein the tissue is brain.
4. The method of claim 2, wherein the tissue is spinal cord.
5. The method of any one of claims 1-4, wherein the anti-CD19 antibody is a human antibody.
6. The method of any one of claims 1 -5, wherein the antigen-binding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 25, 26, and 3, respectively, and the light chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively.
7. The method of any one of claims 1-5, wherein the antigen-binding fragment of the anti-CD19 antibody comprises a heavy chain variable domain and a light chain variable domain, the heavy chain variable domain comprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 1, 2, and 3, respectively, and the light chain variable domaincomprising CDR1, CDR2, and CDR3 amino acid sequences of SEQ ID NOs: 4, 5, and 6, respectively.
8. The method of claim 6 or 7, wherein the heavy chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 7, and the light chain variable domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 8.
9. The method of claim 8, wherein the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 8.
10. The method of claim 9, wherein the antigen-binding fragment of the anti-CD19 antibody comprises the amino acid sequence of SEQ ID NO: 17.
11. The method of any one of claims 1-10, wherein the transmembrane domain is from human CD8.
12. The method of any one of claims 1-11, wherein the transmembrane domain comprises an amino acid sequence at least 90% identical to SEQ ID NO: 11.
13. The method of claim 12, wherein the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 11.
14. The method of any one of claims 1-13, wherein the intracellular T cell signaling domain from human CD3^ comprises an amino acid sequence at least 90% identical to SEQ ID NO: 23.
15. The method of claim 14, wherein the intracellular T cell signaling domain from human CD3^ comprises the amino acid sequence of SEQ ID NO: 23.
16. The method of any one of claims 1-15, wherein the CAR further comprises an intracellular T cell signaling domain from human CD28.
17. The method of claim 16, wherein the intracellular T cell signaling domain from human CD28 comprises the amino acid sequence of SEQ ID NO: 21.
18. The method of any one of claims 1-15, wherein the CAR does not comprise an intracellular T cell signaling domain from 4- IBB.
19. The method of any one of claims 1-18, wherein the CAR comprises an amino acid sequence of SEQ ID NO: 10 or 13.
20. The method of any one of claims 1-19, wherein the vector is a lentivirus vector.
21. The method of any one of claims 1-20, wherein the vector further comprises a murine stem cell virus (MSCV) U3 promoter operably linked to the nucleic acid.
22. The method of any one of claims 1-21, wherein at least 10% of the T cells express the CAR.
23. The method of any one of claims 1-22, wherein the T cells comprise at least 10% of CD8+cytotoxic T cells.
24. The method of any one of claims 1-23, wherein the T cells comprise at least 10% of CD4+helper T cells.
25. The method of any one of claims 1-24, wherein the multiple sclerosis is relapsingremitting multiple sclerosis (RRMS), secondary progressive multiple sclerosis (SPMS), or primary progressive multiple sclerosis (PPMS).
26. The method of claim 25, wherein the multiple sclerosis is PPMS.
27. The method of claim 25, wherein the multiple sclerosis is SPMS.
28. The method of claim 25, wherein the multiple sclerosis is RRMS.
29. The method of any one of claims 1-28, wherein the subject exhibits progression independent of relapse activity.
30. The method of any one of claims 1 -29, wherein the treatment is administered as a first-line therapy.
31. The method of any one of claims 1-29, wherein the multiple sclerosis is refractory to a disease-modifying therapy.
32. The method of claim 31 , wherein the disease- modifying therapy comprises an anti- CD20 antibody.
33. The method of any one of claims 1-24, wherein the multiple sclerosis is PPMS or SPMS refractory to an anti-CD20 antibody.
34. The method of claim 33, wherein the PPMS or SPMS is diagnosed according to the 2017 McDonald criteria.
35. The method of claim 33 or 34, wherein the subject has an expanded disability status scale (EDSS) of 3.0 to 5.5.
36. The method of any one of claims 33-35, wherein the subject has continuing evidence of worsening physical disability over a period of 6 months or longer, with documented evidence of clinical disability progression.
37. The method of claim 36, wherein the subject has a baseline EDSS less than or equal to 5.5, and a sustained increase of EDSS by at least 1 point.
38. The method of claim 36, wherein the subject has a baseline EDSS greater than 5.5, and a sustained increase of EDSS by at least 0.5 point.
39. The method of claim 36, wherein the subject has an increase of timed 25-foot walk (TW25) by at least 20% in the last 2 years sustained for at least 6 months.
40. The method of claim 36, wherein the subject has a documented change in neurological examination despite at least 1 year of prior treatment with the anti-CD20 antibody.
41. The method of claim 40, wherein the documented change in neurological examination comprises a change in mental status, cranial nerves, motor, sensory, or gait domains.
42. The method of any one of claims 36-41, wherein the subject has active SPMS and further has inadequate response or intolerance to an additional disease-modifying therapy.
43. The method of claim 42, wherein the additional disease-modifying therapy comprises a sphingosine- 1 -phosphate receptor modulator.
44. The method of any one of claims 1-43, wherein the therapeutically effective dose is in a range of about 5xl07to IxlO8of the T cells.
45. The method of any one of claims 1-44, wherein the therapeutically effective dose is about IxlO8of the T cells.
46. The method of any one of claims 1-43, wherein the therapeutically effective dose is about 0.33xl08of the T cells.
47. The method of any one of claims 1-46, wherein the T cells are administered by intravenous infusion.
48. The method of any one of claims 1-46, wherein the T cells are administered by intrathecal infusion.
49. The method of any one of claims 1-48, wherein the subject receives a single dose of the T cells.
50. The method of any one of claims 1 -49, wherein the subject has received a lymphodepletion treatment.
51. The method of any one of claims 1 -49, wherein the subject has not received a lymphodepletion treatment.