Physiological function and homeostasis modulating compounds and use thereof

Abstract

Disclosed is a compound of formula (I), its hydrate, anhydrous or salt form thereof, wherein M, X and n are as disclosed herein. The compounds can be used modulating activity of aryl hydrocarbon receptor (AhR), and for treatment of diseases associated with modulating AhR activity. Also disclosed are pharmaceutical compositions containing the compound of formula (I), its hydrate, anhydrous or salt form thereof. (Formula I)

Description

PHYSIOLOGICAL FUNCTION AND HOMEOSTASIS MODULATINGCOMPOUNDS AND USE THEREOFCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application Nos. US 63 / 546372 and US 63 / 546365, both filed on October 30th, 2023. The content of the above-noted patent applications is hereby expressly incorporated by reference into the detailed description hereof.FIELD

[0002] The specification relates to compounds useful for modulating cellular physiological function and homeostasis and methods of use thereof.BACKGROUND

[0003] Regulation of physiological function and cellular homeostasis are essential for the normal development and activity of a number of human cells lines.

[0004] Originally studied for its involvement in mediating detoxification of xenobiotic compounds, the aryl hydrocarbon receptor (AhR) is now known to play an important function in normal cellular development and homeostasis. Regulation of AhR is central to major signaling systems and transcriptional programs critical to a variety of physiological functions (Kou Z, Dai W. Aryl hydrocarbon receptor: Its roles in physiology. Biochemical pharmacology. 2021 Mar 1 ;185:114428, incorporated herein by reference).

[0005] Activation of the aryl hydrocarbon receptor (AhR), and its downstream signal transduction, is known to occur with a wide number of exogenous and endogenous ligands via canonical and non-canonical pathways (Kou Z, Dai W. Aryl hydrocarbon receptor: Its roles in physiology. Biochemical pharmacology. 2021 Mar 1 ; 185:114428; Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annual review ofpharmacology and toxicology. 2003 Apr 1 ;43(1 ):309-34, incorporated herein by reference).

[0006] Retention of inactive AhR complexes with molecular chaperons, such as heat shock protein 90 (Hsp90), in the cytosol are typical of canonical pathways. Where upon activation, AhR undergoes a conformational change, releasing the receptor from the chaperone proteins and subsequent translation to the nucleus. Within the nucleus AhR heterodimerizes with aryl hydrocarbon receptor nuclear translocator protein (ARNT) then binds to xenobiotic responsive elements (XREs) of target genes, including cytochrome P450 superfamily enzyme Cyp1a1 , Cyp1a3, and Cyp1 b1 ; regulating their expression. The induction of CYP1A1 has therefore been used as a model system by which to define the mechanism by which AhR regulates gene expression (Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annual review of pharmacology and toxicology. 2003 Apr 1 ;43(1 ):309-34, incorporated herein by reference). Where binding of AhR to different intranuclear transcription factors may lead to non-canonical signaling pathways through binding of non-XRE deoxyribonucleic acid (DNA) elements.

[0007] Activation of the AhR pathway has been known to occur through a variety of ligands which are both synthetic in nature and those that are naturally occurring. The majority of compounds which activate AhR include planar, hydrophobic halogenated aromatic hydrocarbons (HAHs) and polycyclic aromatic hydrocarbons (PAHs) or related compounds thereof (Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annual review of pharmacology and toxicology. 2003 Apr 1 ;43(1 ):309-34, incorporated herein by reference). Exogenous ligands are known to be inclusive of tea flavonoids (epigallocatechin gallate), bacterial metabolic byproducts including indirubin, and coal tar high molecular weight aromatic hydrocarbons (Palermo CM, Westlake CA, Gasiewicz TA. Epigallocatechin gallate inhibits aryl hydrocarbon receptor gene transcription through an indirect mechanism involving binding to a 90 kDa heat shock protein. Biochemistry. 2005 Apr 5;44(13):5041-52; Adachi J, Mori Y, Matsui S, Takigami H, Fujino J, Kitagawa H, Miller CA, Kato T, Saeki K, Matsuda T. Indirubin and indigo are potent aryl hydrocarbon receptor ligands present in human urine. Journal of BiologicalChemistry. 2001 Aug 24;276(34):31475-8; Furue M, Tsuji G, Mitoma C, Nakahara T, Chiba T, Morino-Koga S, Uchi H. Gene regulation of filaggrin and other skin barrier proteins via aryl hydrocarbon receptor. Journal of dermatological science. 2015 Nov 1 ;80(2):83-8; Hahn ME. The aryl hydrocarbon receptor: a comparative perspective. Comparative Biochemistry and Physiology Part C: Pharmacology, Toxicology and Endocrinology. 1998 Nov 1 ; 121 (1 -3):23-53, all incorporated herein by reference). Endogenous ligands are known to be inclusive of kyneurine, lumichrome, lipoxin A4, bilirubin, kynurenic acid, and 6-formylindolo[3,2-b] carbazole (FICZ) (Mezrich JD, Fechner JH, Zhang X, Johnson BP, Burlingham WJ, Bradfield CA. An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. The Journal of Immunology. 2010 Sep 15;185(6):3190-8; Kou Z, Dai W. Aryl hydrocarbon receptor: Its roles in physiology. Biochemical pharmacology. 2021 Mar 1 ; 185:114428; Sinai CJ, Bend JR. Aryl hydrocarbon receptor-dependent induction of cyplal by bilirubin in mouse hepatoma hepa 1c1c7 cells. Molecular pharmacology. 1997 Oct 1 ;52(4):590-9; DiNatale BC, Murray IA, Schroeder JC, Flaveny CA, Lahoti TS, Laurenzana EM, Omiecinski CJ, Perdew GH. Kynurenic acid is a potent endogenous aryl hydrocarbon receptor ligand that synergistically induces interleukin- 6 in the presence of inflammatory signaling. Toxicological sciences. 2010 May 1 ; 115(1 ):89-97; Rannug A, Rannug U. The tryptophan derivative 6-formylindolo [3, 2- b] carbazole, FICZ, a dynamic mediator of endogenous aryl hydrocarbon receptor signaling, balances cell growth and differentiation. Critical reviews in toxicology. 2018 Aug 9;48(7):555-74, all incorporated herein by reference).

[0008] As a promiscuous receptor, a diverse population of ligands are able to activate the AhR pathway. The range of AhR ligands is known to elicit differentiated downstream pathways through activation of the AhR. This variable activation along with coactivation of other AhR independent pathways can lead to the detrimental effects seen in ligands like 2,3,7,8-tetrachlorodibenzodioxin TCDD or the beneficial effects of ligands found in naturally occurring and pharmaceutically derived ligands (Larigot L, Juricek L, Dairou J, Coumoul X. AhR signaling pathways and regulatory functions. Biochimie open. 2018 Dec 1 ;7: 1-9, incorporated herein by reference). The inherent role of AhR as a regulator of physiological function and homeostasis is impacted by a wide array of ligands where pathway interactors results in a complex system with downstream impacts that are dependent upon the ligand structure (Rothhammer V, Quintana FJ. The aryl hydrocarbonreceptor: an environmental sensor integrating immune responses in health and disease.Nature Reviews Immunology. 2019 Mar; 19(3): 184-97, incorporated herein by reference).

[0009] Although modulation of the AhR pathway has shown to have great potential in many therapeutic applications, exploration of novel AhR-activating compounds has been historically limited. This is in-part due to the observation that many exogenous ligands are known to elicit detrimental or undesired effects (Harmon AC, Hebert VY, Cormier SA, Subramanian B, Reed JR, Backes WL, Dugas TR. Particulate matter containing environmentally persistent free radicals induces AhR-dependent cytokine and reactive oxygen species production in human bronchial epithelial cells. PloS one. 2018 Oct 11 ;13(10):e0205412, incorporated herein by reference) through undesired production of reactive oxygen species. In these cases, AhR ligands activate CYP1A1 pathways without activation of the nuclear factor erythroid 2-related factor 2 (NRF2) pathway and subsequent upregulation of the downstream heme oxygenase 1 gene (HMOX-1), glutamate-cysteine ligase modifier subunit (GCLM), and NAD(P)H dehydrogenase [quinone] 1 (NQO1) to attenuate ROS production. Constructive therapeutic pathways invoking AhR are also known to upregulate FLG and LOR through OVOL-1 pathways.

[0010] There is a need in the art for one or more compounds that activate AhR. In addition, there is a need in the art for one or more compounds that activate AhR, which discretely modulate desired pathways to elicit favorable therapeutic outcomes. Further, there is a need in the art for a process of preparation of one or more compounds that activate AhR. Moreover, there is a need in the art for compositions containing one or more compounds that activate AhR.

[0011] The background herein is included solely to explain the context of the disclosure. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge as of the priority date.SUMMARY

[0012] In one aspect, the specification relates to a compound of formula (I):M— X n (l)

[0013] its hydrate, anhydrous or salt form thereof;

[0014] wherein M is Ag, and n is 1 , 2 or 3;

[0015] X is a bidentate ligand, and each X independently is: (i)

[0016] wherein

[0017] A1and A2each independently is CH, N, or SH;

[0018] each R1, R2or R3independently is –H, a C1-9substituent optionally having one or more heteroatoms, –OR4, –SR4, –N(R4)2, –C(=O)NR4, –NC(=O)R4, –C(=O)R4, – C(=O)OR4, or a halogen, or R1and R2together form a C5- or C6-membered ring optionally having one or more heteroatoms, the C5- or C6-membered ring optionally being mono or di- substituted with C1-3–alkyl, C1-3–alkoxy, phenyl, –N(R4)2, –C(O)R4, –COOR4, or a halogen; and wherein when both A1and A2are other than CH, R3is absent;

[0019] each R4independently is –H, or a C1-3substituent optionally having one or more heteroatoms;

[0020] D1and D2are each independently –H, –OH, –N(R5)2, –SH, –CO2R6or –C(=O)R7, wherein if one of D1or D2is –H, the other D1or D2is other than –H,

[0021] each R5independently is –H a C1-3 alkyl , or, or the two R5together form ,

[0022] R6is(-)(absent and is a negative charge), –H, or a C1-3alkyl;

[0023] R7is –H, –C1-C5–substituent or aryl, wherein the –C1-C5–substituent or aryl optionally has one or more heteroatoms;

[0024] R8is –H, –OH, a C1-3-alkyl substituent optionally having one or more heteroatoms, a –OC1-3-alkyl substituent optionally having one or more heteroatoms, or a halogen; and

[0025] R9is – H, or a C1-3 alkyl substituent optionally having one or more heteroatoms;

[0026] (ii)

[0027] wherein

[0028] A11and A12each independently is –CH or N;

[0029] R11and R12each independently is –H, a C1-3-substituent optionally having one or more heteroatoms, a –O–C1-3-substituent, or a halogen;

[0030] ------ is a single or a double bond, and only one of ------ in ------A14and ------ R14is a double bond;

[0031] when ------ between A13and R13is a single bond, A13is C–H or N, and R13is – H,

[0032] when ------ between A13and R13is a double bond, A13is C, and R13is CHy, wherein y is 1 or 2; and when y is 1, the CH is coupled to a substituted or unsubstituted aryl or heteroaryl;

[0033] when ------ of ------A14is a single bond, A14is NH or CH2,

[0034] when ------ of ------A14is a double bond, A14is N or CR15, wherein R15is – C(=O)– coupled to a substituted or unsubstituted heteroaryl;

[0035] when ------ of ------R14is a single bond, R14is –H, –COO(-), or –S(=O)R16, wherein R16is CHz optionally coupled to a substituted or unsubstituted aryl or heteroaryl, where z is 1, 2 or 3;

[0036] when ------ of ------R14is a double bond, R14is O or S; 0037] (iii)0038] wherein 0039] A21is N, and each of A22to A27independently is –CH or N; 0040] R21is –OR24or –SR25, wherein R24or R25is absent, –H, –C1-C3–alkyl or aryl; and 0041] R22and R23each independently is –H, a C1-3-substituent optionally having one or more heteroatoms, a halogen, or R22and R23together form a C5- or C6-membered aromatic ring, the C5- or C6-membered aromatic ring being optionally mono or di-substituted with C1-C3–alkyl, C1‐C3–alkoxy, –NR262, –C(O)R27, –COOR28, –CHO or halogen; 0042] wherein each of R26to R28is independently –H, –C1-C3–alkyl or aryl; 0043] or

[0044] (iv)

[0045] wherein

[0046] A31is a Group 16 to Group 17 element; and

[0047] each R31independently is absent, -H, -CO2H, -CO2-, -OC(=O)-C1-6-alkyl, - C(=O)NH2, -CO(CH2)1-6CHNH2CO2-, -CO(CH2)1-6CHNH2CO2H, -CONH2(CH2)1-6CH3, - CONH2(CH2)1-6CH3, =O, -O-, OH, -C3-6-alkyl ketone, -C3-6-alkoxy, NO3-, NO3H, NO2-, NO2H, NH2, -NH(CH2)1-6CH3, -N((CH2)1-6CH3)2, SH, S-alkyl, –C5-C10–substituent or aryl, wherein the – C5-C10–substituent or aryl optionally may have one or more heteroatoms; SO2-alkyl having 3-6 carbon atoms and optionally having one or more oxygen or nitrogen atoms, SO3H, SO3-, halogen, CN; and

[0048] p is 1 to 4; and

[0049] wherein represents a coordination bond of the ligand to Ag.

[0050] In a second aspect, the specification relates to a pharmaceutical composition comprising the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, disclosed herein, and a pharmaceutically acceptable excipient.

[0051] In a third aspect, the specification relates to a use of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as disclosed herein, for treatment of a disease associated with activation of aryl hydrocarbon receptor (AhR).

[0052] In a fourth aspect, the specification relates to a use of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as disclosed herein, for modulating aryl hydrocarbon receptor (AhR) activity.

[0053] In a fifth aspect, the specification relates to a method of medical treatment of a disease associated with activation of aryl hydrocarbon receptor (AhR) activity comprising administering to a subject in thereof, a pharmaceutically effective amount of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as disclosed herein.

[0054] In a sixth aspect, the specification relates to a method of modulating aryl hydrocarbon receptor (AhR) activity comprising providing the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as disclosed herein.

[0055] In a seventh aspect, the specification relates to a process for preparation of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, the process comprising:

[0056] reacting a silver salt or silver compound having a chelated ligand and one or more ligands in a solvent. BRIEF DESCRIPTION OF DRAWINGS

[0057] Reference will now be made, by way of example, to the accompanying drawings which show example embodiments of the present application, and by which the present application can be further understood from the following description with reference to the Figures. The present application includes drawings, wherein:

[0058] Figure 1 is a bar graph showing genetic expression of CYP1A1 in HaCaT human keratinocyte cells following a 6-hour exposure of either C5 (10 uM) versus media controlled (untreated) cells adherent at 30-50% confluency (fold change calculated versus time zero);

[0059] Figure 2 is a bar graph showing genetic expression of CYP1 B1 in HaCaT human keratinocyte cells following a 6-hour exposure of either C5 (10 uM) versus media controlled (untreated) cells adherent at 30-50% confluency (fold change calculated versus time zero);

[0060] Figure 3 is a bar graph showing genetic expression of KRT16, HMOX-1 , and GCLM in HaCaT human keratinocyte cells following a 6-hour exposure of either C5 (10 uM) versus media controlled (untreated) cells adherent;

[0061] Figure 4 is a bar graph showing the significant reduction in genetic expression of Thymic Stromal Lymphopoietin (TSLP) by Compound 4 in an inflammatory-predominant model of atopic dermatitis in mice (fold change calculated vs untreated MC903 + Vehicle control). TSLP is negatively regulated by AhR activation. Black dashed line is the uninduced, untreated sham control.

[0062] Figure 5 is a bar graph showing the significant reduction in ear thickness and swelling by Compound 4 in a barrier dysfunction-predominant model of atopic dermatitis in mice verses an untreated MC903 + Vehicle control.

[0063] Figure 6 is a bar graph showing the significant increase in genetic expression of filaggrin by Compound 4 in a barrier dysfunction-predominant model of atopic dermatitis in mice (fold change calculated vs untreated MC903 + Vehicle control). Black dashed line is the uninduced, untreated sham control.

[0064] Figure 7 is a line graph showing the % change in body weight of mice in the barrier dysfunction-predominant model showing a that Compound 4 treatment is well tolerated by mice, with little to. No effect on body weight.DESCRIPTION OF EXAMPLE EMBODIMENTS

[0065] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the typical materials and methods are described herein. In describing and claiming the present invention, the common terminology generally used is described herein below. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.

[0066] Many patent applications, patents, and publications are referred to herein to assist in understanding the aspects described. Each of these references are incorporated herein by reference in their entirety.

[0067] When introducing elements disclosed herein, the articles “a”, “an”, “the”, and “said” are intended to mean that there may be one or more of the elements.

[0068] The term "comprising" and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The foregoing also applies to words having similar meanings such as the terms, "including", "having" and their derivatives. It will be understood that any embodiments described as “comprising” certain components may also “consist of’ or “consist essentially of,” these components, wherein “consisting of’ has a closed-ended or restrictive meaning and “consisting essentially of’ means including the components specified but excluding other components except for materials present as impurities, unavoidable materials present as a result of processes used to provide the components, and components added for a purpose other than achieving the technical effects described herein. For example, a composition defined using the phrase “consisting essentially of’ encompasses any known acceptable additive, excipient, diluent, carrier, and the like, suitable for the composition described herein. Typically, a composition consisting essentially of a set of components will comprise less than 5% by weight, typically less than 3% by weight, more typically less than 1% by weight of non-specified components.

[0069] It will be understood that any component defined herein as being included may be explicitly excluded from the claimed invention by way of proviso or negative limitation, such as any specific compounds or method steps, whether implicitly or explicitly defined herein.

[0070] In addition, all ranges given herein include the end of the ranges and also any intermediate range points, whether explicitly stated or not.

[0071] Finally, terms of degree such as "substantially", "about" and "approximately" as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies.

[0072] The abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The word “or” is intended to include “and” unless the context clearly indicates otherwise.

[0073] The phrase “at least one of’ is understood to be one or more. The phrase “at least one of... and...” is understood to mean at least one of the elements listed or a combination thereof, if not explicitly listed. For example, “at least one of A, B, and C” is understood to mean A alone or B alone or C alone or a combination of A and B or a combination of A and C or a combination of B and C or a combination of A, B, and C.

[0074] The specification relates to a compound, its salt form, hydrate form or anhydrous form, which elicit activation of AhR pathways useful in treatment of a disease which may benefit from modulation of AhR pathways.

[0075] The specification includes sub-heading to assist the reader with understanding the specification. The disclosure under one sub-heading is not exclusive nor limited to the sub-heading, rather it should be taken and understood taking into consideration the entire disclosure of the specification.

[0076] The compound

[0077] In one aspect, the specification relates to compound of Formula (I):

[0078] its hydrate, anhydrous or salt form thereof;

[0079] wherein M is Ag, and n is 1 , 2 or 3;

[0080] X is a bidentate ligand, and each X independently is:

[0081] (i)

[0082] wherein

[0083] A1and A2each independently is CH, N, or SH;

[0084] each R1, R2or R3independently is –H, a C1-9substituent optionally having one or more heteroatoms, –OR4, –SR4, –N(R4)2, –C(=O)NR4, –NC(=O)R4, –C(=O)R4, – C(=O)OR4, or a halogen, or R1and R2together form a C5- or C6-membered ring optionally having one or more heteroatoms, the C5- or C6-membered ring optionally being mono or di- substituted with C1-3–alkyl, C1-3–alkoxy, phenyl, –N(R4)2, –C(O)R4, –COOR4, or a halogen; and wherein when both A1and A2are other than CH, R3is absent; 0085] each R4independently is –H, or a C1-3 substituent optionally having one or more heteroatoms; 0086] D1and D2are each independently –H, –OH, –N(R5)2, –SH, –CO2R6or –C(=O)R7, wherein if one of D1or D2is –H, the other D1or D2is other than –H, 0 or, or the two R5together form ,

[0088] R6is(-)(absent and is a negative charge), –H, or a C1-3 alkyl;

[0089] R7is –H, –C1-C5–substituent or aryl, wherein the –C1-C5–substituent or aryl optionally has one or more heteroatoms;

[0090] R8is –H, –OH, a C1-3-alkyl substituent optionally having one or more heteroatoms, a –OC1-3-alkyl substituent optionally having one or more heteroatoms, or a halogen; and

[0091] R9is – H, or a C1-3 alkyl substituent optionally having one or more heteroatoms;

[0092] (ii)

[0093] wherein

[0094] A11and A12each independently is –CH or N;

[0095] R11and R12each independently is –H, a C1-3-substituent optionally having one or more heteroatoms, a –O–C1-3-substituent, or a halogen;

[0096] ------ is a single or a double bond, and only one of ------ in ------A14and ------ R14is a double bond;

[0097] when ------ between A13and R13is a single bond, A13is C–H or N, and R13is – H,

[0098] when ------ between A13and R13is a double bond, A13is C, and R13is CHy, wherein y is 1 or 2; and when y is 1, the CH is coupled to a substituted or unsubstituted aryl or heteroaryl;

[0099] when ------ of ------A14is a single bond, A14is NH or CH2,

[0100] when ------ of ------A14is a double bond, A14is N or CR15, wherein R15is – C(=O)– coupled to a substituted or unsubstituted heteroaryl;

[0101] when ------ of ------R14is a single bond, R14is –H, –COO(-), or –S(=O)R16, wherein R16is CHz optionally coupled to a substituted or unsubstituted aryl or heteroaryl, where z is 1, 2 or 3;

[0102] when ------ of ------R14is a double bond, R14is O or S; - 13 -

[0103] (iii)

[0104] wherein

[0105] A21is N, and each of A22to A27independently is –CH or N;

[0106] R21is –OR24or –SR25, wherein R24or R25is absent, –H, –C1-C3–alkyl or aryl; and

[0107] R22and R23each independently is –H, a C1-3-substituent optionally having one or more heteroatoms, a halogen, or R22and R23together form a C5- or C6-membered aromatic ring, the C5- or C6-membered aromatic ring being optionally mono or di-substituted with C1-C3–alkyl, C1‐C3–alkoxy, –NR262, –C(O)R27, –COOR28, –CHO or halogen;

[0108] wherein each of R26to R28is independently –H, –C1-C3–alkyl or aryl;

[0009] (iv)

[0110] wherein

[0111] A31is a Group 16 to Group 17 element; and

[0112] each R31independently is absent, -H, -CO2H, -CO2-, -OC(=O)-C1-6-alkyl, - C(=O)NH2, -CO(CH2)1-6CHNH2CO2-, -CO(CH2)1-6CHNH2CO2H, -CONH2(CH2)1-6CH3, - CONH2(CH2)1-6CH3, =O, -O-, OH, -C3-6-alkyl ketone, -C3-6-alkoxy, NO3-, NO3H, NO2-, NO2H, NH2, -NH(CH2)1-6CH3, -N((CH2)1-6CH3)2, SH, S-alkyl, –C5-C10–substituent or aryl, whereinhe – C5-C10–substituent or aryl optionally may have one or more heteroatoms; SO2-alkyl having 3-6 carbon atoms and optionally having one or more oxygen or nitrogen atoms, SO3H, SO3-, halogen, CN; and

[0113] p is 1 to 4, and

[0114] wherein represents a coordination bond of the ligand to Ag.

[0115] The term, ‘hydrate’ as used herein is not particularly limited and should be known or understood to a person of skill in the art. A hydrate is a substance that contains water or its constituent elements. Hydrates can be considered as inorganic salts containing water molecules combined in a definite ratio as an integral part of the crystal that are either bound to a metal center or that have crystallized with the metal complex. Such hydrates are also said to contain water of crystallization or water of hydration.

[0116] The term, ‘anhydrous’ form as disclosed herein is not particularly limited and should be known or understood by a person of skill in the art. An anhydrous form of a substance refers to a compound that contains no water or substantially no water. In practice, it is very difficult to achieve perfect dryness as anhydrous compounds gradually absorb water from the atmosphere, requiring careful storage. In one embodiment, an anhydrous compound is where water is generally absent from the crystal lattice of the compound.

[0117] The term, ‘salt’ as disclosed herein is not particularly limited and should be known or understood by a person of skill in the art. The term includes acid or base addition salts, where an acid or a base is present or added to the compound to form its acid or base addition salt. In one embodiment, for example and without limitation, the compound of formula (I) is formed as a pharmaceutically acceptable salt.

[0118] A pharmaceutically acceptable salt form of the compound of formula (I) may also initially confer a desirable pharmacokinetic property on the active ingredient which were absent in the non-salt form and may even positively affect the pharmacodynamics of the active ingredient with respect to its therapeutic activity in the body.

[0119] Pharmaceutically acceptable salt of the compound of formula (I) refer to a salt that is pharmaceutically acceptable and that possesses the desired pharmacological activity of the parent compound. Non-limiting examples of such salts can include, without limitation, acid addition salts, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with organic acids such as glycolic acid, pyruvic acid, lactic acid, malonic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2- hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2- naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, salicylic acid, muconic acid, and the like; or basic addition salts formed with the conjugate bases of any of the inorganic acids listed above, wherein theconjugate bases comprise a cationic component selected from among Na+, K+, Mg+2, Ca+2, and quaternary ammonium. In one embodiment, for example and without limitation, where the compound of formula (I) has a positive charge, the counter-ion can be, for example and without limitation, HCO3; BF4; CO32; NO3; CIO4; SO42; F; Br, C3H3O2-, NH3, MnO4; NO2; BrO3; IO3-, Cr2O72; OH; CIO3; HCO2; and the like.

[0120] The metal (M) present in the compound of formula (I) is silver (Ag). Silver has an electron configuration of [Kr]4d105s1is a member of the group 11 of the periodic table. In the context of the specification, in the compound of formula (I), the oxidation state of silver is +2 or +3, and is present as Ag+2, or Ag+3, having an electronic configuration of [Kr]4d9or [Kr]4d8respectively. In the context of the specification, the geometry of the complexes may exist as square planar, distorted square planar, octahedral or distorted octahedra.

[0121] The term, “ligand” as used herein is not particularly limited and should be known or understood by a person of skill in the art. In coordination chemistry, a ligand is an ion or molecule (having a functional group) that binds to a central metal atom to form a coordination complex. This is typically achieved by the ligand donating a pair of electron (forming a dative bond) to the electronegative central M element. In other words, the bonding with the metal generally involves formal donation of one or more of the ligand's electron pairs, often through Lewis bases. The nature of metal-ligand bonding can range from covalent to ionic. Furthermore, the metal-ligand bond order typically can range from one to three, with higher bond orders also known to exist. Ligands are viewed as Lewis bases, although some cases are known to involve Lewis acidic "ligands".

[0122] The ligands as disclosed herein chelate with silver to form a silver complex. The silver complex can have 1 , 2 or 3 ligands that bind to silver. In addition, where 2 or 3 ligands bind to silver, the ligands can be the same or different. The silver complex formed can be present as a salt form. Furthermore, the silver complex can be in an anhydrous form or hydrate form. Moreover, when the silver complex is present in an anhydrous form or a hydrate form, it can also be present in a salt form of the hydrate or anhydrous form. In the hydrate form of the silver complex, water can bind to the silver metal in forming the complex.

[0123] In the one or more ligands present in the compound of formula (I), each of the one or more ligand is a bidentate ligand. The term, bidentate ligand, is not particularly limited and should be known or understood by a person of skill in the art. A bidentate ligand is a Lewis base that can donate two pairs (“bi”) of electrons to a metal atom. Bidentate ligands are often referred to as chelating ligands (“chelate” is derived from the Greek word for “claw”) because they can “grab” a metal atom in two places. It should be noted that the ligands disclosed herein can bind to silver from more than two sites. For instance, the ligandcan bind from three (tridentate ligand) or four (tetradentate) sites. In the context of the current specification, the ligands disclosed herein are at least a bidentate ligand. As such, the ligands contemplated herein can also be tridentate or tetradentate, and thereby have three or four atoms that bond to silver.

[0124] The position of the atom donating the lone pair of electrons to bind to the silver is not particularly limited. The binding can take place from a pair of electrons being donated from an atom present on the aromatic ring of the ligand, or from a moiety that is coupled to the aromatic ring, as disclosed herein. The bidentate ligands, as disclosed herein, can have the core structure of:

[0125] In one embodiment, for example and without limitation, one or more of the ligands present in the compound of formula (1) is ligand (i) (or ligand type (i)), as shown below:

[0126] wherein

[0127] A1and A2each independently is CH, N, or SH;

[0128] each R1, R2or R3independently is –H, a C1-9substituent optionally having one or more heteroatoms, –OR4, –SR4, –N(R4)2, –C(=O)NR4, –NC(=O)R4, –C(=O)R4, – C(=O)OR4, or a halogen, or R1and R2together form a C5- or C6-membered ring optionally having one or more heteroatoms, the C5- or C6-membered ring optionally being mono or di- substituted with C1-3–alkyl, C1-3–alkoxy, phenyl, –N(R4)2, –C(O)R4, –COOR4, or a halogen; and wherein when both A1and A2are other than CH, R3is absent;

[0129] each R4independently is –H, or a C1-3 substituent optionally having one or more heteroatoms;

[0130] D1and D2are each independently –H, –OH, –N(R5)2, –SH, –CO2R6or –C(=O)R7, wherein if one of D1or D2is –H, the other D1or D2is other than –H, [0 or, or the two R together form ,

[0132] R6is(-)(absent and is a negative charge), –H, or a C1-3 alkyl;

[0133] R7is –H, –C1-C5–substituent or aryl, wherein the –C1-C5–substituent or aryl optionally has one or more heteroatoms;

[0134] R8is –H, –OH, a C1-3-alkyl substituent optionally having one or more heteroatoms, a –OC1-3-alkyl substituent optionally having one or more heteroatoms, or a halogen; and

[0135] R9is – H, or a C1-3alkyl substituent optionally having one or more heteroatoms.

[0136] The binding of the bidentate ligands to the silver metal can take place from a number of different atoms on the ligand. For instance, when ligand (i) is present in the silvercomplex, the lone pair of electrons from the ligand can be donated by A1, A2, D1, D2, R1, R2or R3, or the structure represented by A1, A2, D1, D2, R1, R2or R3. As the ligand is a bidentate ligand, the two pairs of electrons donated to silver can come from any one or a combination of any two of A1, A2, D1, D2, R1, R2or R3. Alternatively, the two pairs of electrons can be donated by a single functional group, such as -COO( ), that can represent any one of A1, A2, D1, D2, R1, R2or R3. The position of the atoms donating the lone pairs of electrons in the ligand is also not particularly limited, so long as the ligand can chelate to silver. Similarly, when ligand (ii) is present in the silver complex of formula (I), the two lone pairs of electrons from the bidentate ligand can be donated by any one or two A11, A12, A13, A14, R11, R12, R13, or R14. Similarly, when ligand (iii) is present in the silver complex of formula (I), the two lone pairs of electrons from the bidentate ligand can be donated by any one or two A21, A22, A23, A24, A25, A26, A27, R21, R22, or R23.

[0137] The bidentate ligand present in the silver complex of formula (I) can be any one or combination of ligand (i), (ii) or (iii). As such, the silver complex of formula (I) can have only type of ligand, such ligand (i), (ii) or (iii). Alternatively, the silver complex of formula (I) can have any two types of the bidentate ligands, such as, ligands (i) and (ii), ligands (i) and (iii), or ligands (ii) and (iii). Moreover, the silver complex of formula (I) can have all types of ligands (i), (ii) and (iii), depending on the compound of formula (I) being formed.

[0138] The term, C1-9 substituent, and the like, as used herein is not particularly limited and should be known or understood by a person of skill in the art. The term relates to an organic substituent having from one to nine carbon atoms. The number of carbon atoms present in the substituent are noted in the subscript with C (denoting the carbon atom). As such, a C1-3 substituent refers to an organic substituent having from one to three carbon atoms, or a C1-5 substituent refers to an organic substituent having from one to five carbon atoms. An organic substituent, as used herein, is any chemical moiety containing carbon. As such, the C1-9 substituent can be, for example and without limitation, an alkyl, an alkenyl, an alkynyl, a cyclic structure, such as, for example and without limitation, a carbocyclic moiety, an aromatic moiety, a polycyclic moiety, or a combination thereof. Non-limiting examples of a C1-9 substituent can include methyl, ethyl, ethylenyl, ethynyl, propyl, propylenyl, propynyl, isopropyl, butyl, butenyl, butynyl, phenyl, benzyl, cyclohexanyl, ethylcyclohexyl, coumarin moiety, and others.

[0139] As disclosed herein, the C1-9 substituent can be optionally substituted having one or more heteroatoms, -OR4, -SR4, -N(R4)2, or a halogen. The presence of the noncarbon atom changes the class of organic compounds, but are considered to be included in the specification, so long as the total number of carbon atoms range from one to nine. Assuch, other organic classes, such as alcohols and ethers (represented by –OR4), thiols or thioethers (represented by –SR4), amines (represented by –NR4), amides (represented by – C(=O)NR4and –NC(=O)R4), aldehydes and ketones (represented by –C(=O)R4), carboxylic acid (or its anionic form) and esters (represented by –C(=O)OR4) are contemplated withinhe scope of the specification, so long as the substituent has a total of from one to nine carbon atoms, and do not prevent binding of the ligand with silver. Non-limiting examples of a C1-9substituent optionally having one or more heteroatoms contemplated within the specification include trifluoromethyl (–CF3), ethoxy (–OCH2CH3) , propanol (–CH2CH2OH), propanthiol (HSCH2CH2–), ethyl methylene suflide (CH3CH2SCH2–), pyridine, aniline, an acetic acid moiety (–CH2C(=O)OH), or bromine, to name a few.

[0140] The term, heteroatom, as used herein is not particularly limited and should be known or understood by a person of skill in the art. Heteroatoms refer to any atom otherhan carbon and hydrogen. In one embodiment, for example and without limitation, the heteroatom is one or more of nitrogen, oxygen, sulphur or a halogen.

[0141] The term, halogen, as used herein is not particularly limited and should be known or understood by a person of skill in the art. The halogens are elements that form group 17 of the periodic table. Halogen include fluorine, chlorine, bromine, or iodine.

[0142] In the type (i) ligand disclosed in the specification, the R1and R2can togetherorm a C5- or C6-membered ring, optionally substituted, as disclosed herein. The C5- or C6- membered ring are bonded to the aromatic core structure of ligand (i), and form a polycyclic ing structure. In addition, the C5- or C6-membered ring can be an aromatic ring, orsaturated or unsaturated ring. As such, structures, such as ,, , , or the like, are contemplated to be within the scope of the specification. Furthermore, the C5- or C6-membered ring optionally being mono or di-substituted with C1-3–alkyl, C1-3–alkoxy, phenyl, –N(R4)2, – C(O)R4, –COOR4, or a halogen.

[0143] In the ligand (i), when both A1and A2are other than CH, R3is absent. As such, R1, R2and R3can only be present when one or both A1and A2are CH. When both, A1and A2are, for example, N and / or SH, then R3is not present in the ligand (i).

[0144] In the ligand (i), when one of D1or D2is –H, the other D1or D2is other than – H. As such, both D1and D2cannot be –H in ligand (i). If one of D1is –H, then the other D2is a substituent other than –H. Furthermore, both D1and D2can be other than –H in ligand (i) disclosed herein. 00145] The term, alkyl, as used herein is not particularly limited and should be known r understood by a person of skill in the art. In organic chemistry, an alkyl group is an lkane missing one hydrogen. The term alkyl is intentionally unspecific to include many ossible substitutions. An acyclic alkyl has the general formula of −CnH2n+1. A cycloalkyl roup is derived from a cycloalkane by removal of a hydrogen atom from a ring and has the eneral formula −CnH2n−1. Typically an alkyl is a part of a larger molecule. The smallest alkyl roup is methyl, with the formula −CH3. The term, C1-3-alkyl as used herein refers to an alkyl roup having from one to three carbon atoms. Examples of a C1-3-alkyl include, methyl, thyl, propyl or isopropyl. 00146] The term, alkoxy, as used herein is not particularly limited and should be nown or understood by a person of skill in the art. Describe C1-3-alkoxy 00147] An alkoxy group is an alkyl group which is singularly bonded to oxygen, and an be denoted by the structure R−O, where R is an organic substituent. A C1-3-alkoxy efers to an alkoxy group having from one to three carbon atoms. Examples of a C1-3-alkoxynclude methoxy (CH3O–), ethoxy (CH3CH2O–), propyloxy (CH3CH2CH2O–), or iso-propyloxy (CH3)2CHO–). 00148] The term, aryl, as used herein is not particularly limited and should be known r understood by a person of skill in the art. An aryl is any compound, functional group or ubstituent derived from an aromatic ring, usually an aromatic hydrocarbon. An example ofn aryl group is phenyl (C6H5–), having the structure , where denotes the oint of bonding of the phenyl group to the remaining chemical structure. 00149] The term, heteroaryl, as used herein is not particularly limited and should be nown or understood by a person of skill in the art. A heteroaryl is an aryl having one or more heteroatoms. 00150] In the ligands disclosed herein, when a carboxylic acid or a phenolic group is resent on the ligand, the carboxylic acid or phenolic group can be in the protonated form (– COOH or –OH) or it can be in the deprotonated form (–COO(-)or –O(-)). When the term carboxylic acid or a phenolic structure is noted, both the protonated and deprotonated formsare contemplated within the context of the specification. Further, where a protonated form of carboxylic acid or phenolic group is denoted, the deprotonated form is also considered to be encompassed within it. As should be recognized by a person of skill in the art, the form the carboxylic acid or phenol group is present in depends upon the pH of the solution, and the protonated form can convert to the deprotonated form at lower pH’s, and vice versa.Further, depending on the conditions used, the amine group present on the chelate can be in a protonated form (-N(+)H) or the deprotonated form (-N:). Similar to the carboxylic acid and phenol group noted herein, in the context of the specification, when form of the amine (primary, secondary or tertiary amine) is disclosed, both the protonated form and deprotonated form are contemplated and considered encompassed within the scope of the specification.

[0151] Non-limiting examples of ligand (i) include

[0152] And where — (the arrow) represent a potential point of chelation of the bidentate ligand to Ag. As should be recognized by a person of skill in the art, there are multiple points of chelation of the ligand to the metal, as noted herein. The particular complex formed can depend on the reaction conditions. The particular point of chelation of the ligand to the silver can also be affected by kinetic, thermodynamic and steric factors. As such, where a ligand binds to the silver and forms a five or six membered ring, with an absence of adjacent bulky or sterically hindered moieties, is more likely to occur than when the chelation atoms are further apart in the ligand or adjacent to bulky or sterically hindered structures.

[0153] In some instances, a particular ligand can chelate with the silver from more than two locations, as noted herein. For example and without limitation, the ligand,, can chelate with silver from two different positions, as shown below, with chelation from the N and the O of the carboxylic acid moiety being more likely to occur.While the other possible chelation of the ligand is from the two oxygen atoms of the carboxylic acid group, and which is less likely to occur. Complexes formed from types of chelation are contemplated and considered encompassed within the specification.(chelation through N and O is more likely than)(chelation through the two oxygen atoms of carboxylic acid is possible, however, less likely to occur).

[0154] As noted herein, the chelation of the ligand can also occur from more than two atoms, thereby being, for example and without limitation, a tridentate ligand or a tetradentate ligand. In one embodiment, for example and without limitation, the ligand is a tetradentate ligand, with binding of the ligand taking place from four different atoms in the ligand, as shown below, with the •* — (the arrow) representing the point of chelation of the ligand to the metal.

[0155] In an embodiment, for example and without limitation, one or more of the ligands present in the compound of formula (1) is ligand (ii) (or ligand type (ii)), as shown below:

[0156] wherein

[0157] A11and A12each independently is -CH or N;

[0158] R11and R12each independently is -H, a Ci.3-substituent optionally having one or more heteroatoms, a -O-Ci.3-substituent, or a halogen;

[0159] z— is a single or a double bond, and only one of - in - A14and- R14is a double bond;

[0160] when - between A13and R13is a single bond, A13is C-H or N, and R13is -H,

[0161] when - between A13and R13is a double bond, A13is C, and R13is CHy, wherein y is 1 or 2; and when y is 1 , the CH is coupled to a substituted or unsubstituted aryl or heteroaryl;

[0162] when - of - A14is a single bond, A14is NH or CH2,

[0163] when - of - A14is a double bond, A14is N or CR15, wherein R15is -C(=O)- coupled to a substituted or unsubstituted heteroaryl;

[0164] whensingle bond, R14is -H, -COO( ), or -S(=0)R16, wherein R16is CHZoptionally coupled to a substituted or unsubstituted aryl or heteroaryl, where z is 1 , 2 or 3;

[0165] when - of - R14is a double bond, R14is O or S;

[0166] As disclosed herein, the feature “ - ” in the structure of ligand (ii) can be a single or a double bond. There are three different positions in ligand (ii), where the feature “zzzzzz” is present, one between A13and R13(denoted as A13- R13), a second instance can occur where ligand (ii) has the structural feature A14- C (where the C is the carbon of the five membered ring of ligand (ii)), and the third instance can occur where ligand (iii) has the structural feature C - R14(where the C is the carbon of the five membered ring of ligand(ii)). It should be recognized by a person of skill in the art that the C bonded to A13, A14andR14can only form a double bond between one of A14and R14, and not both, as it would result in a carbon atom having five bonds. Consequently, in ligand (ii), only one of “------” in ------ A14and ------R14in ligand (ii) is a double bond, and the other has to be a single bond. Hence, inigand (ii), when “------” between ------A14is a double bond, the “------” in ------R14is a single bond. Further, in ligand (ii), when “------” between ------R14is a double bond, the “------” in ---- --A14is a single bond.

[0167] In ligand (ii), as disclosed herein, when ------ between A13and R13is a single bond, A13is C–H or N, and R13is –H. Further, in ligand (ii), when ------ between A13and R13s a double bond, A13is C, and R13is CHy, wherein y is 1 or 2. As such, CHy can be –CH2 or –CH–, which is bonded to substituted or unsubstituted heteroaryl. Consequently, when y is 1, the CH is coupled to a substituted or unsubstituted aryl or heteroaryl. In one embodiment,or example and without limitation, the heteroaryl is not particularly limited and can have fromour to nine carbon atoms (i.e. C4-9-heteroaryl). In another embodiment, for example and without limitation, the heteroaryl can be substituted with one or more C1-3-substituent having one or more heteroatoms.

[0168] In an embodiment in accordance with the specification, when ------ of ------R14is a single bond, R14is –H, –COO(-), or –S(=O)R16, wherein R16is CHz optionally coupled to a substituted or unsubstituted aryl or heteroaryl, where z is 1, 2 or 3. As such, CHz can be –CH3, –CH2–, or –CH<, where the CH2 is bonded to another moiety and the CHs bonded to two other chemical moieties. Hence, when CHz is CH2 or CH, it is coupled to a substituted or unsubstituted aryl or heteroaryl. In one embodiment, for example and withoutimitation, the heteroaryl is not particularly limited and can have from four to nine carbon atoms (i.e. C4-9-heteroaryl). In another embodiment, for example and without limitation, the heteroaryl can be substituted with one or more C1-3-substituents having one or more heteroatoms.

[0169] Further, as disclosed herein, in an embodiment, for example and withoutimitation, in ligand (ii) when ------ of ------R14is a double bond, R14is O (oxygen) or S (sulphur).

[0170] Non-limiting examples of ligand (ii) include.

[0171] And where (the arrow) represent a potential point of chelation of the bidentate ligand to Ag. As should be recognized by a person of skill in the art, and as described herein with respect to the ligand (i), there are multiple points of chelation of theigand to the metal, as noted herein, and the description with respect to ligand (i) is also applicable to ligand (ii), disclosed herein. 00172] In an embodiment, for example and without limitation, one or more of theigands present in the compound of formula (1) is ligand (iii) (or ligand type (iii)), as shown below:(iii) 00173] wherein A21is N, and each of A22to A27independently is –CH or N. Further,n ligand (iii), R21is –OR24or –SR25, wherein R24or R25is absent, –H, –C1-C3–alkyl or aryl. When R24or R25is absent, there is a negative charge (anion formed) on O or S (represented as, O(-)or S(-)).

[0174] In ligand (iii), R22and R23each independently is –H, a C1-3-substituent optionally having one or more heteroatoms, a halogen, or R22and R23together form a C5- or C6-membered aromatic ring, the C5- or C6-membered aromatic ring being optionally mono or di-substituted with C1-C3–alkyl, C1‐C3–alkoxy, –NR262, –C(O)R27, –COOR28, –CHO or halogen, wherein each of R26to R28is independently –H, –C1-C3–alkyl or aryl.

[0175] A non-limiting example of ligand (iii) includes

[0176] And where (the arrow) represent a potential point of chelation of the bidentate ligand to Ag. As should be recognized by a person of skill in the art, and as described herein with respect to the ligands (i) and (ii), there are multiple points of chelation of the ligand to the metal, as noted herein, and the description with respect to ligand (i) and (ii) is also applicable to ligand (iii), disclosed herein.

[0177] In an embodiment, for example and without limitation, one or more of theigands present in the compound of formula (1) is ligand (iv) (or ligand type (iv)), as shown below:(iv)

[0178] wherein

[0179] A31is a Group 16 to Group 17 element; and

[0180] each R31

[0181] R31independently is -H, -CO2H, -CO2-, -OC(=O)-C1-6-alkyl, -C(=O)NH2, - CO(CH2)1-6CHNH2CO2-, -CO(CH2)1-6CHNH2CO2H, -CONH2(CH2)1-6CH3, -CONH2(CH2)1-6CH3, =O, -O-, OH, -C3-6-alkyl ketone, -C3-6-alkoxy, NO3-, NO3H, NO2-, NO2H, NH2, -NH(CH2)1-6CH3, -N((CH2)1-6CH3)2, SH, S-alkyl, –C5-C10–substituent or aryl, wherein the – C5-C10–substituentor aryl optionally may have one or more heteroatoms; SO2-alkyl having 3-6 carbon atoms and optionally having one or more oxygen or nitrogen atoms, SO3H, SO3-, halogen, CN; and

[0182] p is 1 to 4, and

[0183] wherein represents a coordination bond of the ligand to Ag. 00184] The phrase, Group 16 to Group 17 element, as used herein is not particularly limited and should be known or understood by a person of skill in the art. Group 16 is referred to as the chalcogens, or oxygen family. In one embodiment, for example and without limitation, the one or more elements of Group 16 present as A31n ligand (iv) is oxygen (O) or sulphur (S). Group 17 is also referred to as the halogen group. The halogens are a group in the periodic table containing six elements: fluorine (F), chlorine (Cl), bromine (Br), iodine (I), astatine (At), andennessine (Ts). In one embodiment, for example and without limitation, as disclosed above, A31is sulfur, selenium, tellurium, polonium, or iodine. In another embodiment, for example and without limitation, the one or more elements of Group 17 present in ligand tellurium (Te) or iodine (I). 00185] The terms, C1-12-alkyl, and C1-12-alkene, are not particularly limited and should be understood by a person of skill in the art. The subscript after carbon (C) denotes the possible number of carbon atoms present in the chemical moiety. In the case of C1-12, there can be from one to 12 carbon atoms present in the chemical moiety. The terms, alkyl and alkene are not particularly limited and should be known by a person of skill in the art. An alkyl group is an alkane missing one hydrogen. Theerm alkyl is intentionally unspecific to include many possible substitutions. An acyclic alkyl has the general formula of −CnH2n+1, where n denotes the number of carbon atoms. Non-limiting examples of alkyl include methyl (–CH3), ethyl (CH3– CH2–), propyl (CH3–(CH2)2–), or butyl (CH3–(CH2)3–). An alkene group is a hydrocarbon containing a carbon-carbon double bond. An alkenyl group is a hydrocarbon group formed when a hydrogen atom is removed from an alkene group. Alkenyl compounds are named by replacing the -e from the parent alkene's name with -yl. A non-limiting example of alkenyl is H2C=CH- (ethenyl or commonly known as vinyl). 00186] The term, alkyl ketone, as used herein refers to the general formula R–C(=O)–, where R is an alkyl substituent. In addition, alkyl ketone can also havethe general formula R–C(=O)–R’, where both R and R’ are alkyl substituents. When the alkyl ketone has the formula R–C(=O)–, A31is bonded to the carbon of R–C(=O)–. When the alkyl ketone has the formula R–C(=O)–R’, A31is bonded to R or R’. 00187] The terms, 2°-amino and 3°-amino, as disclosed herein are not articularly limited and should be understood by a person of skill in the art. A 2°- mino group refers to an amine having two organic substituents, and have theormula RR’-NH, where R and R’ are organic substituents. A 3°-amino group referso an amine having three organic substituents, and have the formula RR’R”-N, where R, R’ and R” are organic substituents. 00188] An imine is a functional group or organic substituent containing a arbon–nitrogen double bond. The nitrogen atom can be attached to a hydrogen or n organic group. The carbon atom has two additional single bonds. While an imine- lkyl has an alkyl group attached to imine moiety. 00189] An oxime is an organic substituent belonging to the imines, with the eneral formula RR’C=N−OH, where R is an organic side-chain and R' may be ydrogen, forming an aldoxime, or another organic group, forming a ketoxime. O- ubstituted oximes form a closely related family of compounds. 00190] A non-limiting example of ligand (iv) is metaperiodate (IO4(-)) or rthoperiodate (IO6(5-)) 00191] With respect to the silver complexes in their hydrate form, anhydrousorm, or salt thereof, in a first embodiment, for example and without limitation, the ompounds, their hydrate form, anhydrous form, or salt thereof, have a minimum olubility in aqueous media of 0.1 nM at 25 °C and 1 bar at neutral pH. In a second mbodiment, the compounds, their hydrate form, anhydrous form, or salt thereof, ave a minimum solubility in aqueous media of 0.1μM at 25 °C. 00192] With respect to the silver complexes in their hydrate form, anhydrousorm, or salt thereof, in a first embodiment, for example and without limitation, the ompounds, their hydrate form, anhydrous form, or salt thereof, have a minimum olubility in non-aqueous media, including DMSO, of 0.1 μM at 25 °C and 1 bar at eutral pH. In a second embodiment, the compounds, their hydrate form, anhydrousform, or salt thereof, have a minimum solubility in non-aqueous media, including DMSO, of 1.0 pM at 25 °C.

[0193] With respect to the silver complex compounds, their hydrate form, anhydrous form, or salt thereof, in a first embodiment, for example and without limitation, the formation constant (Kf) or stability constant, defined as the formation of a complex ion from its central ion (M) and attached ligands (L) via Kf=[MxLy] / [M]x[L]y determined at 25 °C and 1 bar at neutral pH, of the compound of Formula 1 , its hydrate form, anhydrous form, or salt thereof, ranges from Kf = 1 .0 x 105to Kf = 1.0 x 1035. In a second embodiment, for example and without limitation, the formation constant (Kf) of the compounds, their hydrate form, anhydrous form, or salt thereof, ranges from Kf = 1 .0 x 105to Kf = 1 .0 x 1025. In a third embodiment, for example and without limitation, the formation constant (Kf) of the compounds, their hydrate form, anhydrous form, or salt thereof, ranges from Kf = 1 .0 x 1010to Kf = 1.0 x 1025.

[0194] The structures disclosed herein above, permit secondary interactions encountered by the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, with atoms derived from solvents encountered by the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, during synthetic procedures, isolation procedures, formulation, and or therapeutic uses. These interactions may afford structures that include atoms and ligands derived encountered by the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, during synthesis, isolation, formulation and therapeutic uses. Such secondary interactions may result in a ligand displacement, thereby affording an opening or exchange, wherein the atoms and ligands encountered in the secondary interaction may insinuate themselves into the compounds, its hydrate form, anhydrous form, solvated form or salt thereof. Such structures are expressly contemplated in the present specification.

[0195] Compositions

[0196] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, disclosed herein as pharmaceutical formulations.

[0197] Pharmaceutical formulations of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, described herein may bemanufactured in a manner that is known including, but not limited to dissolution, granulation, emulsification, mixing, encapsulation, lyophilizing or combinations thereof.

[0198] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated into appropriate aqueous solutions for the purpose of injection, either subcutaneous or intravenous. Such compositions may include appropriate solutions including but not limited to physiologically compatible buffers. Such compositions may be formulated with the intention of delivery as a bolus injection or continuous infusion and may include excipients known in the art to enable suspension, stabilization, delivery, or dispersion.

[0199] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated with appropriate penetrants, known in the art, to afford transmucosal or transcutaneous administration. Such formulations may be inclusive of carriers including, but not limited to, liquids, gels, hydrogels, solids, slurries and may include suitable excipients known in the art to afford control over rheological and release properties.

[0200] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated into an aerosolized, spray, or nebulized format, with or without the use of a suitable propellant known in the art. Such formulations may be prepared in a solid, liquid or gel format through the inclusion of appropriate excipients known in the art. Such formulations may be utilized for delivery of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, and formulations described herein to dermal, hair, mucosal membranes, or inhaled.

[0201] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated into a reservoir such that the release or delivery of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, may proceed over the course of an extended period for long-acting formulations.

[0202] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated in combination with excipients or pharmaceutical compounds which may direct or target delivery to a discrete location within a biological system. Such formulations may employ use of liposomes, emulsions, self-assembled structures, polymeric compounds, sustained release materials, or combinations thereof.

[0203] The specification also provides embodiments of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, that may be formulated in combination with non-aqueous formulations. Such formulations may employ use of silica, silicones, cross-linked silicones and suitable excipients known in the art to contribute to rheological and delivery properties.

[0204] The compounds of the specification can be provided as salts with pharmaceutically compatible counterions such as sodium, potassium, calcium, ammonium or other non-toxic pharmaceutically acceptable salts known to those skilled in the art, or combinations thereof.

[0205] Pharmaceutical compositions of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, described in the present specification may be formulated and administered through a variety of means. Such administration may include systemic, localized, or topical including but not limited to oral, rectal, transmucosal, transcutaneous, intestinal, parenteral, intramuscular, subcutaneous, intramedullary, intrathecal, intravenous, intraventricular, intraperitoneal, intranasal, and intraocular. Therein the mode of administration may be tailored to the desired site and delivery scheme.

[0206] Pharmaceutical compositions of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, described in the present specification may be suitable wherein the active ingredients are contained and delivered in an effective amount to achieve a desired outcome and intended purpose. Such a therapeutically effective quantity can include an amount of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, described in the present specification which may treat, prevent, or ameliorate a disease or disorder in a subject. As used herein, the terms “treating,” “preventing,” and “ameliorating” refer to interventions performed with the intention of alleviating the symptoms associatedwith, preventing the development of, or altering the pathology of a disease, disorder or condition. Thus, in various embodiments, the terms may include the prevention (prophylaxis), moderation, reduction, or curing of a disease, disorder or condition at various stages. In various embodiments, therefore, those in need of therapy / treatment may include those already having the disease, disorder or condition and / or those prone to, or at risk of developing, the disease, disorder or condition and / or those in whom the disease, disorder or condition is to be prevented.

[0207] Pharmaceutical compositions of the compounds, their hydrate form, anhydrous form, solvated form or salt thereof, described in the present specification may be suitable for medical, dental, pharmaceutical, cosmeceutical, personal care, veterinary, agricultural, materials engineering, and over-the-counter fields. Such compositions may be used in the treatment and or therapy of subject inclusive of humans or other vertebrate wherein the composition provides either subjective relief of symptoms or an objectively identifiable improvement as noted by the clinician or other qualified observer.

[0208] The therapeutically effective does for any of the compounds, , their hydrate form, anhydrous form, solvated form or salt thereof, described in the present specification may initially be estimated by in-vitro cell culture assays as disclosed herein. However, it is understood to those skilled in the art, that the specific dose required for higher organisms including animals and humans, may be determined more accurately through in-vivo studies including determination of lethal dose (LDso) concentrations and effective dose concentrations (EDso) and the effective ratios thereof. It is also understood to those skilled in the art that the dosing regimen can more accurately through dose-finding studies in a clinical setting. It is also understood that the specific dose for any particular patient may be dependent upon a variety of factors including but not limited to age, sex, weight, height, health, time of administration, route of administration, drug pharmacokinetics and pharmacodynamics, drug interactions, the severity of the disease, and the recommendations and judgement of the prescribing physician.

[0209] In a one embodiment, compounds, their hydrate form, anhydrous form, solvated form or salt thereof, disclosed herein can have certain pharmacological properties including low toxicity, low carcinogenicity, desirable in-vitro and in-vivo half lives and reasonable efficacy.

[0210] Process for preparation

[0211] As disclosed herein, in a seventh aspect, the specification relates to a process for preparation of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, the process comprising:

[0212] reacting a silver salt or silver compound having a chelated ligand and one or more ligands in a solvent.

[0213] In one embodiment, for example and without limitation, the compound is prepared via an initial dissolution of the central M metal into an aqueous media following by the addition of a suitable oxidizing or reducing agent and acid or base to affect the desired orbital geometry prior to addition of the desired chelate to form the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof.

[0214] Conjugate acid and base or desired salts of the compounds may be prepared through appropriate adjudgment of the pH of the complex or ion exchange to obtain the desired salt.

[0215] In an embodiment, for example and without limitation, in accordance with the specification, the process involves reaction of a salt or chelate form of the central metal with a secondary chelate or mixed chelate system to form a desired chelate complex exhibiting various physiochemical properties, particularly stability and yield, rendering them suitable for industrial and commercial applications.

[0216] In another embodiment, for example and without limitation, the process involves dissolution of the central metal into a suitable solvent, pH, and temperature to support dissolution. The solvent may be selected from aqueous or organic media; inclusive but not limited to water, methanol, ethanol, dimethylformamide, dimethyl sulfoxide, toluene, or hexanes. The pH of the media may be adjusted by appropriate strong or weak acid or base to a pH of 2 to 14. In a more preferred embodiment, the pH of the media may be adjusted by a strong acid or base to a pH of 4 to 10. In some embodiments, the dissolution of the metal is conducted at a temperature ranging from about 0° C to about 100° C for about 0 minutes to about 90 minutes. In another embodiment, for example and without limitation, the dissolution of the metal is conducted at a temperature ranging from about 20° C to about 50° C for about 0minutes to 10 minutes. In another further embodiment, for example and without limitation, the concentration of the metal ranges from about 0.01 mM to about 2.0 M.

[0217] In a still embodiment, for example and without limitation, the process can involve dissolution of the ligand chelate or ligand chelates into a suitable solvent, pH, and temperature to support dissolution. The solvent may be selected from aqueous or organic media; inclusive but not limited to water, methanol, ethanol, dimethylformamide, dimethyl sulfoxide, toluene, or hexanes. The pH of the media may be adjusted by appropriate strong or weak acid or base to a pH of 2 to 14. In a more preferred embodiment, the pH of the media may be adjusted by a strong acid or base to a pH of 4 to 10. In another embodiment, for example and without limitation, the dissolution of the metal is conducted at a temperature ranging from about 0° C to about 100° C for about 0 minutes to about 90 minutes. In another further embodiment, for example and without limitation, the dissolution of the metal is conducted at a temperature ranging from about 20° C to about 50° C for about 0 minutes to 10 minutes. In a still embodiment, for example and without limitation, the concentration of the ligand chelate or ligand chelates ranges from about 0.01 mM to about 4.0 M.

[0218] In an embodiment, for example and without limitation, the ligand chelate solutions are added in series to the metal solution. In another embodiment, for example and without limitation, the mixed ligand chelate solution is added simultaneously to the metal solution. In a further embodiment, for example and without limitation, the ligand chelate, or ligand chelate systems are added directly to the metal solution. In a still embodiment, for example and without limitation, the metal is added directly to the ligand chelate solution or mixed ligand chelate solution.

[0219] In an embodiment, for example and without limitation, the pH of the reaction solution forming the metal chelate complex may be adjusted by appropriate strong or weak acid or base to a pH of 2 to 14. In another embodiment, for example and without limitation, the pH of the media may be adjusted by a strong acid or base to a pH of 4 to 10. In a further embodiment, for example and without limitation, the formation of the metal chelate complex may be conducted at a temperature ranging from about 0° C to about 100° C for about 0 minutes to about 48 hours. In another further embodiment, for example and without limitation, the formation of the metalchelate complex is conducted at a temperature ranging from about 20° C to about 90° C for about 0 minutes to 90 minutes.

[0220] In an embodiment, for example and without limitation, of the specification, the metal chelate complex may be isolated by filtration and optionally further purified. In another embodiment, for example and without limitation, of the specification, the metal chelate complex may be isolated by the reaction solution by formation of a conjugate acid or base and filtration and optionally further purified. In a further embodiment, for example and without limitation, of the specification, the metal chelate complex may be isolated from the reaction solution by the addition of a pharmaceutically suitable counterion to form a desired salt complex and isolated by filtration and optionally further purified.

[0221] In a still further embodiment, for example and without limitation, of the specification, further purification may proceed via recrystallization, sublimation, extraction, adsorption chromatography, column chromatography, high pressure liquid chromatography, or other methods known in the art.

[0222] Biological assay

[0223] Historical agonists of AhR have been quantified via nuclear translocation of AhR following ligand binding, resulting in the induction of cytochrome P450 and genetic expression of cyplal, exclusively and definitively downstream of AhR. However, more recent findings have identified that inducers of low cyplal expression are therapeutically advantageous and aligned with non-canonical pathways of AhR modulation.

[0224] The present invention describes compounds which induce the genetic expression of cyplal in human keratinocyte (HaCaT) cell or via Human HT29 colon adenocarcinoma or AhR reporter cells. As exemplified in the present invention, the chelates described herein have demonstrated significant induction of the expression of cyplal, a gene which is exclusively downstream of AhR promoter region and transcribed upon activation of AhR. Within in-vitro HaCaT models, the chelates described herein demonstrate induction of hmox-1 and gclm in parallel with cyplal and cyplbl as shown in Figure 1-3, aligned with therapeutically beneficial or non- canonical pathway induction. These results are translated within in-vivo models of inflammatory dermatological disease induced via calcipotriol or MC903 whereintreatment of chelate compounds described herein exhibit reductions in ear swelling, and TSLP signaling, while significantly increasing the genetic expression of filaggrin, a barrier function protein regulated by AhR (Jeong H, Shin JY, Kim MJ, Na J, Ju BG. Activation of aryl hydrocarbon receptor negatively regulates thymic stromal lymphopoietin gene expression via protein kinase Cb-p300-NF-KB pathway in keratinocytes under inflammatory conditions. Journal of Investigative Dermatology. 2019 May 1 ; 139(5): 1098-109.), all while having no significant effect on body weight as shown in Figure 4-7.EXAMPLES

[0225] The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific Examples. These Examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the constructs of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the typical aspects of the present invention and are not to be construed as limiting in any way in the remainder of the disclosure. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[0226] Example 1 : At room temperature, AgNOs (0.5mmol, 1 ml MilliQ-water) was dissolved with stirring. 2-Aminophenol (1 mmol, 5ml Mill-Q water) was dissolved with an addition of KOH (0.33mmol, 500ul Mill-Q water ) under heat (50-60C) and stirring. 6-Methoxy-2-[(4-methoxy-3,5-dimethyl-2-pyridinyl)methylsulfinyl]-1 H- benzimidazole (1 mmol, 10ml Mill-Q water) was dissolved with KOH (1 mmol, 1.5ml Milli-Q water). A solution of potassium persulfate was dissolved at 50-60C in milli-Q water, and 50ul (0.017mmol) was added to the stirring room temperature solution of AgNOs above. After 30 seconds 10ml of 6-methoxy-2-[(4-methoxy-3,5-dimethyl-2- pyridinyl)methylsulfinyl]-1 H-benzimidazole was added slowly over the course of 2 minutes resulting in a turbid brown solution. Immediately after the last addition of 6-methoxy-2-[(4-methoxy-3,5-dimethyl-2-pyridinyl)methylsulfinyl]-1 H-benzimidazole, 5ml of 2-Aminophenol was added slowly over 1 minute. Reaction continued to stir at room temperature for 10 minutes, resulting in a dark brown product. The Compound 1 product [Ag(2-aminophenol)( 6-methoxy-2-[(4-methoxy-3,5-dimethyl-2- pyridinyl)methylsulfinyl]-1 H-benzimidazole)] was isolated by vacuum filtration and characterized. FTIR: 3384 cm-1br, 2996 cm-1sh, 1616 cm-1s, 1565cm-1s, 1468 cm-1s, 1420 cm-1s; UV-Vis: Amax 310 nm, 423nm, 441 nm.

[0227] Example 2: At room temperature, AgNOs (1 mmol, 5ml MilliQ-water) was dissolved with stirring. 2-Aminophenol was dissolved in hexanes with molar excess of KOH (5ml Milli-Q water) and after drying a portion of the solid (2mmol) 2- aminophenol was added to the stirring room temperature solution of AgNOs above, followed by an additional 5ml of Milli-Q water. After 5 minutes of stirring at room temperature the reaction solution was a dark brown precipitate. After 25 minutes at room temperature without stirring the Compound 2 [Ag(2-aminophenol)2] product was isolated by vacuum filtration and characterized. FTIR: 3374 cm-1s, 3302 cm-1s, 1568 cm-1s, 1510 cm-1s, 1457 cm-1s; UV-Vis: Amax = 285 nm, 420 nm, 440 nm.

[0228] Example 3: At room temperature AgNOs (0.5mmol, 2.5ml MilliQ-water) was dissolved at room temperature. 2-Aminophenol was deprotonated in Hexanes with molar excess of KOH (5ml Milli-Q water) and after drying a portion of the solid (1 mmol) 2-aminophenol was dissolved in 10ml of Milli-Q water, lsoquinoline-1- carboxylic acid was dissolved at room temperature and added to the 10ml solution previously described while stirring at room temperature resulting in an amber coloured solution. AgNO3 (0.5mmol, 2.5ml Milli-Q water) was dissolved at room temperature with stirring and added to the reaction mixture with isoquinoline-1- carboxylic acid and 2-aminopenol resulting in a pale brown turbid solution. After 10 minutes the reaction solution was a dark brown and was neutralized over the course of 15 minutes with the addition of a total of 1.6mmol KOH (800ul Milli-Q water) and 0.4mmol HNO3 (200ul Milli-Q water). The Compound 3 [Ag(2-aminophenol) (isoquinoline-1 -carboxylate)] dark brown product was isolated by vacuum filtration. FTIR: 3374 cm-1s, 3302 cm-1s, 3100 cm-1m, 2750 cm-1m, 1593 cm-1s, 1510 cm-1s, 1458 cm-1s; 1380 cm-1m; UV-Vis: Amax = 280 nm, 420 nm, 440 nm.

[0229] Example 4: An aqueous solution of KOH (0.13 M) and KIO4 (0.43 M) was prepared by adding 0.75 g KOH and 10.0 g KIO4 to 100 ml of reverse osmosis(RO) water heated to 85 ^C stirring at 400 rpm. To this solution, argentic oxide (AgO) was added to a final concentration of 0.40 M. The turbid brown-black solution was maintained at 85 ^C while stirring for 3 hours during which time the solution decreased in turbidity with an increasing red color. Following 3 hours of heating, the solution was filtered hot through a fine glass frit filter. Upon cooling, orange red crystals of anhydrous Compound 4 [Ag(periodate)2K3] were isolated and recrystallized from hot water. Characterization via UV-Vis: λmax = 280 nm and 364 nm, ^ = 1.56 x 104cm-1M-1. XRD (^2^): 13.1, 13.8, 14.2, 16.4, 19.0, 21.1, 24.2, 25.3, 26.1, 26.3.

[0230] Example 5. At room temperature, AgNO3 (0.5mmol, 1ml MilliQ-water) was dissolved with stirring.2-Aminophenol (1 mmol, 5ml Mill-Q water) was dissolved with an addition of KOH (0.33mmol, 500ul Mill-Q water) under heat (50-60C) and stirring. Kynurenic Acid (1mmol, 10ml Mill-Q water) was dissolved with KOH (0.5mmol, 1ml Milli-Q water). A solution of potassium persulfate was dissolved at 50- 60C in milli-Q water, and 50ul (0.017mmol) was added to the stirring room temperature solution of AgNO3 above. After 30 seconds 5ml of 2-Aminophenol was added slowly over the course of 2 minutes resulting in an immediate dark precipitate and red-orange solution. Immediately after the last addition of 2-Aminophenol, 10ml of Kynurenic Acid was added slowly over the course of 1 minute resulting in a turbid brown solution. Reaction continued to stir at room temperature for 10 minutes, resulting in a dark brown product. The Compound 5 [Ag(2-aminophenol) (kynurenate)] product was isolated by vacuum filtration and recrystalized in hot water. FTIR: 3095 cm-1br, 1628 cm-1m, 1585 cm-1s, 1468 cm-1m, 1357 cm-1m; UV- Vis: λmax = 348nm, 418nm, 440 nm.

[0231] Example 6: Luciferase Assay

[0232] Human HT29 colon adenocarcinoma - AhR reporter cells (HT29- LuciaTM AhR Cells; InvivoGen; ht2l-ahr) were used to determine the EC50 of the described compounds. HT29-LuciaTM AhR Cells are engineering to express Lucia luciferase reporter gene with human Cyp1a1 gene transcription upon AhR activation. Briefly, cells were expanded using DMEM supplemented with 5% heat inactivated FBS, 1% Penicillin-Streptomycin, 2mM L-Glutamine, and 100µg / mL Normocin. After 2 passages, selective antibiotic, Zeocin, was added to media at 100µg / mL to selectfor stably transfected cells. Dose response and EC50 was evaluated by plating 56,000 cells / well into a 96 well plate in test media containing only DMEM + 5% heat inactivated FBS, 2mM L-Glutamine, and 1% Penicillin-Streptomycin. Compounds were solubilized in DMSO, and 1uL was added to each well for a final DMSO oncentration of 0.5%. Cells were incubated with compounds at 37˚C and 5% CO2or 24 hours. Following 24hr incubation, 20µL of cell supernatant was transferred to 96-well white opaque plate. A working stock of QUANTI-LucTM 4 Reagent was repared by adding 23.75mL of sterile H2O to the concentrated stock.45µL of QUANTI-LucTM 4 Reagent was added to each well containing cell supernatant. Theuminescence of each compound evaluated at 6.25 uM was immediately and eported fold change was determined where significant difference from baselinenduction was observed. C N CCCCC00233] Example 7: Efficacy In-Vitro 00234] Immortalized human keratinocyte (HaCaT) cells were seeded at .5x104cells / cm2in 2ml of complete DMEM (10% FBS, 1% Penicillin / Streptomycin) nd incubated at 37°C, with 5% CO2 for 18-24 hours prior to treatment. Samples were treated with 10 µM of the compound prepared in Example 4 described herein in omplete DMEM (10% FBS and 1% Penicillin / Streptomycin), made from diluting 000x a 10mM stock in water. Sonication was used to aid in dispersion and olubilization. Treated plates were incubated for 6 hours at 37 °C with 5% CO2. 00235] After 6 hours, genetic analysis was completed following aspiration ofhe culture media and addition of 400ul of TRIzol. The TRIzol with the remaining ells were homogenized using 1000ul pipette tip and incubated at room temperatureor 15 minutes. Following incubation, 80ul of chloroform was added to each sample,ollowed by a 2–3-minute incubation and 15 minutes centrifugation at 12,000xg at °C. The clear aqueous layer was removed and precipitated with room temperatureisopropanol at 4°C for 10 minutes, followed by 10 minutes centrifugation at 12,000xg at 4°C. Samples were washed twice with 70% Ethanol with 5 minutes centrifugation at 7,500xg at 4°C. RNA was air dried for 15 minutes than solubilized in H2O. RNA samples were converted to cDNA using the GB-Script™ III 1st Strand cDNA Synthesis Kit (+ gDNA wiper) (Cat# R312-01). For qPCR GB-Amp™ Sybr Green qPCR Mix (Cat#P2092), 5ng / reaction cDNA template and 1 uM primers: cypl bl (forward: 5’-GCCACTATCACTGACATCTTCGG-3’, reverse: 5’- CACGACCTGATCCAATTCTGCC-3’), cypl al (forward: 5’- GATTGAGCACTGTCAGGAGAAGC -3’, reverse: 5’- ATGAGGCTCCAGGAGATAGCAG -3’), krt16 (forward: 5’- CTACCTGAGGAAGAACCACGAG-3’, reverse: 5’- CTCGTACTGGTCACGCATCTCA-3’), homx-1 (forward: 5’- CCAGGCAGAGAATGCTGAGTTC-3’, reverse: 5’- AAGACTGGGCTCTCCTTGTTGC-3’), gclm (forward: 5’- TCTTGCCTCCTGCTGTGTGATG-3’, reverse: 5’- TTGGAAACTTGCTTCAGAAAGCAG -3’)and the housekeeping gene gapdh (forward: 5’- GTCTCCTCTGACTTCAACAGCG -3’, reverse: 5’- ACCACCCTGTTGCTGTAGCCAA -3’). The temperature profile was 95°C for 2 minutes and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Results shown in Figure 1-3.

[0236] Example 8: Efficacy In-Vivo

[0237] An atopic dermatitis like state was induced on the ears of female C57BL / 6 mice by topical application of MC903 (calcipotriol). In an inflammatory- predominant model, MC903 (1 nmol; in 100% ethanol) was topically applied daily, starting on Day 0, for 7 days. Three hours after MC903 administration, Compound 4 was topically applied daily in DMSO. Body weight were measured daily before dosing. On day 7, animals were sacrificed, and ear tissues were harvested. One half of the tissue was incubated in RNAIater overnight at -20°C for detection of TSLP and beta-actin with quantitative real-time PCR (qPCR).

[0238] In a barrier dysfunction-predominant model, MC903 was topically applied, starting on Day 0, on the ears of female C57BL / 6 mice for 5 days at a concentration of 2nmol (in 100% ethanol). After 5 days of induction, MC903 application transitioned to a maintenance dose of 1 nmol, every other day, withtopical Compound 4 application daily, 3hr after MC903 application. Ear thickness and body weight were measured daily before dosing. On day 12, mice were sacrificed, and ear tissues were harvested. One half of the tissue was incubated in RNAIater overnight at -20°C for detection of filaggrin (FLG) and GAPDH quantitative real-time PCR (qPCR).

[0239] The results of inhibition of genetic expression of TSLP in the inflammatory predominant model in the ear by Compound 4 are shown in Figure 4. The results of reduction in ear thickness and increase in filaggrin genetic expression in the barrier dysfunction model by Compound 4 are shown in Figure 5 and 6.

[0240] The results indicate that Compound 4 resulted in significant reductions in ear swelling, and TSLP signaling, while significantly increasing the genetic expression of filaggrin, a barrier function protein regulated by AhR, all while having no significant effect on body weight (Figure 7).

[0241] All publications, patents and patent applications cited above are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

[0242] Although preferred embodiments of the invention have been described herein in detail, it will be understood by those skilled in the art that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims.

Claims

WE CLAIM:

1. A compound of formula (I):M— X n (i) its hydrate, anhydrous or salt form thereof; wherein M is Ag, and n is 1 , 2 or 3;X is a bidentate ligand, and each X independently is:whereinA1and A2each independently is CH, N, or SH; each R1, R2or R3independently is -H, a C1-9 substituent optionally having one or more heteroatoms, -OR4, -SR4, -N(R4)2, -C(=O)NR4, -NC(=O)R4, -C(=O)R4, -C(=O)OR4, or a halogen, or R1and R2together form a Cs- or Cs-membered ring optionally having one or more heteroatoms, the Cs- or Cs-membered ring optionally being mono or disubstituted with C1-3- alkyl, Ci-3-alkoxy, phenyl, -N(R4)2, -C(O)R4, -COOR4, or a halogen; and wherein when both A1and A2are other than CH, R3is absent; each R4independently is -H, or a C1-3 substituent optionally having one or more heteroatoms;D1and D2are each independently -H, -OH, -N(R5)2, -SH, -CO2R6or -C(=O)R7, wherein if one of D1or D2is -H, the other D1or D2is other than -H,each R5independently is –H, a C1-3 alkyl, , or,R6is(-)(absent and is a negative charge), –H, or a C1-3 alkyl; R7is –H, –C1-C5–substituent or aryl, wherein the –C1-C5–substituent or aryl optionally as one or more heteroatoms; R8is –H, –OH, a C1-3-alkyl substituent optionally having one or more heteroatoms, a OC1-3-alkyl substituent optionally having one or more heteroatoms, or a halogen; and R9is – H, or a C1-3 alkyl substituent optionally having one or more heteroatoms;(ii) wherein A11and A12each independently is –CH or N; R11and R12each independently is –H, a C1-3-substituent optionally having one or more eteroatoms, a –O–C1-3-substituent, or a halogen; ----- is a single or a double bond, and only one of ------ in ------A14and ------R14is a ouble bond;when ------ between A13and R13is a single bond, A13is C–H or N, and R13is –H, when ------ between A13and R13is a double bond, A13is C, and R13is CHy, wherein y is 1 or 2; and when y is 1, the CH is coupled to a substituted or unsubstituted aryl or heteroaryl; when ------ of ------A14is a single bond, A14is NH or CH2, when ------ of ------A14is a double bond, A14is N or CR15, wherein R15is –C(=O)– oupled to a substituted or unsubstituted heteroaryl; when ------ of ------R14is a single bond, R14is –H, –COO(-), or –S(=O)R16, wherein R16s CHz optionally coupled to a substituted or unsubstituted aryl or heteroaryl, where zs 1, 2 or 3; when ------ of ------R14is a double bond, R14is O or S; (iiwherein A21is N, and each of A22to A27independently is –CH or N; R21is –OR24or –SR25, wherein R24or R25is absent, –H, –C1-C3–alkyl or aryl; and R22and R23each independently is –H, a C1-3-substituent optionally having one or more eteroatoms, a halogen, or R22and R23together form a C5- or C6-membered aromatic ng, the C5- or C6-membered aromatic ring being optionally mono or di-substituted with C1-C3–alkyl, C1‐C3–alkoxy, –NR262, –C(O)R27, –COOR28, –CHO or halogen; wherein each of R26to R28is independently –H, –C1-C3–alkyl or aryl; or(iv)wherein A31is a Group 16 to Group 17 element; and each R31independently is -H, -CO2H, -CO2-, -OC(=O)-C1-6-alkyl, -C(=O)NH2, - CO(CH2)1-6CHNH2CO2-, -CO(CH2)1-6CHNH2CO2H, -CONH2(CH2)1-6CH3, - CONH2(CH2)1-6CH3, =O, -O-, OH, -C3-6-alkyl ketone, -C3-6-alkoxy, NO3-, NO3H, NO2-, NO2H, NH2, -NH(CH2)1-6CH3, -N((CH2)1-6CH3)2, SH, S-alkyl, –C5-C10–substituent or aryl, wherein the – C5-C10–substituent or aryl optionally may have one or more heteroatoms; SO2-alkyl having 3-6 carbon atoms and optionally having one or more oxygen or nitrogen atoms, SO3H, SO3-, halogen, CN; and p is 1 to 4; and wherein represents a coordination bond of the ligand to Ag.

2. The compound, its hydrate, anhydrous or salt form thereof, as defined in claim 1, wherein at least one X is: ,, , ,represent a potential point of chelation of the bidentate ligand to Ag.

3. The compound, its hydrate, anhydrous or salt form thereof, as defined in claim 1 or 2, wherein at least one X is:wherein represent a potential point of chelation of the bidentate ligand to Ag.

4. The compound, its hydrate, anhydrous or salt form thereof, as defined in any one of claims 1 to 3, wherein at least one X is:wherein represent a potential point of chelation of the bidentate ligand to Ag.

5. The compound, its hydrate, anhydrous or salt form thereof, as defined in any one of claims 1 to 4, wherein the compound of formula (I) is:.

6. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 5 having a minimum solubility in aqueous media of 0.1 nM at 25 °C and 1 bar at neutral pH.

7. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 5 having a minimum solubility in aqueous media of 0.1 pM at 25 °C.

8. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 5 having a minimum solubility in nonaqueous media of 0.1 pM at 25 °C and 1 bar at neutral pH.

9. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 5 having a minimum solubility in nonaqueous media of 1 .0 pM at 25 °C.

10. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in claim 8 or 9, wherein the non-aqueous media is dimethyl sulfoxide (DMSO).

11. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 10 having a formation constant (Kf) ranging from 1 .0 x 105to 1.0 x 1035determined at 25 °C and 1 bar at neutral pH.

12. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 10 having a formation constant (Kf) ranging from 1 .0 x 105to 1.0 x 1025determined at 25 °C and 1 bar at neutral pH.

13. The compound of formula (I), its hydrate form, anhydrous form, or salt thereof, as defined in any one of claims 1 to 10 having a formation constant (Kf) ranging from 1 .0 x 1010to 1.0 x 1025determined at 25 °C and 1 bar at neutral pH.

14. A pharmaceutical composition comprising the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as defined in any one of claims 1 to 13, and a pharmaceutically acceptable excipient.

15. Use of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as defined in any one of claims 1 to 13, for treatment of a disease associated with activation of aryl hydrocarbon receptor (AhR).

16. Use of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as defined in any one of claims 1 to 13, for modulating aryl hydrocarbon receptor (AhR) activity.

17. A method of medical treatment of a disease associated with activation of aryl hydrocarbon receptor (AhR) activity comprising administering to a subject in thereof, a pharmaceutically effective amount of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as defined in any one of claims 1 to 13.

18. A method of modulating aryl hydrocarbon receptor (AhR) activity comprising providing the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, as defined in any one of claims 1 to 13.

19. A process for preparation of the compound of formula (I), its hydrate form, anhydrous form, solvated form or salt thereof, the process comprising: reacting a silver salt or silver compound having a chelated ligand and one or more ligands in a solvent.

Images