Methods of identifying plant resistance proteins

EP4801941A1Pending Publication Date: 2026-09-09WAGENINGEN UNIVERSITEIT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024802339
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-10-31
Filing Date
2024-10-31
Publication Date
2026-09-09

AI Technical Summary

Technical Problem

Current methods for identifying plant resistance proteins that interact with pathogen effectors are limited by technical drawbacks such as generating spurious interactions and false positives, and are challenging for detecting weak and transient protein-protein interactions, especially with membrane-bound proteins.

Method used

The method involves creating a fusion protein with a pathogen's effector protein or its functional part fused to a proximity-dependent biotinylation enzyme (PDBE), which is then introduced into a resistant plant tissue. This allows for the biotinylation of interacting plant proteins, which are then captured and identified by mass spectrometry.

Benefits of technology

This approach effectively identifies plant proteins that interact with pathogen effectors, overcoming previous limitations by providing a more specific and sensitive method for detecting protein-protein interactions in vivo.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000037_0000
    Figure 00000037_0000
  • Figure 00000037_0001
    Figure 00000037_0001
  • Figure 00000038_0000
    Figure 00000038_0000
Patent Text Reader

Abstract

The invention relates to methods of identifying plant proteins that interact with an effector protein of a pathogen.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]P136151PC00 Title: Methods of identifying plant resistance proteins The invention relates to the identification of plant resistance proteins. More in particular, the invention relates to the identification of plant proteins that interact with an effector protein of a pathogen. INTRODUCTION Plants are constantly threatened by a wide range of pathogenic micro-organisms. Unlike vertebrates, plants lack mobile immune cells mediating adaptive immunity and fully rely on their innate immune system to perceive and subsequently eliminate microbial pathogens. The innate immune system of plants is broadly organised into two interconnected tiers, one at the level of the plasma membrane (PM) and one at the level of the cytoplasm. At the level of the PM, cell-surface receptors have the function to perceive extracellular immunogenic patterns (ExIPs), either directly or indirectly derived from pathogens, and these receptors represent the first layer of the plant innate immune system (van der Burgh and Joosten, 2019. Trends Plant Sci 24: 587-601). The perceived ExIPs can be structural components of the microbial pathogen, like so-called microbe-associated molecular patterns (MAMPs), and can also be modified components of the host, like host-derived damage-associated molecular patterns (DAMPs). In addition, secreted virulence factors of the pathogen, referred to as effectors, which are generally only produced in planta to suppress the initial immune response of the plant, can also act as ExIPs. These effectors are perceived by sensing the perturbation of host target proteins with the aim to suppress host immune responses. At the cytoplasmic level, nucleotide-binding leucine-rich repeat-containing immune receptors (NB-LRRs or NLRs) perceive effector proteins that are transferred to the cytoplasm of the host cells, again either directly or indirectly. Perception of pathogen effectors, either by cell-surface receptors or by cytoplasmic NLRs, triggers an immune response that is often associated with the hypersensitive response (HR), which is a form of programmed cell death (PCD) (van der Burgh and Joosten, 2019. Trends Plant Sci 24: 587–601). Cell-surface receptors are single-pass transmembrane proteins that possess an extracellular domain, in most cases consisting of leucine-rich repeats (LRRs), which mediate recognition of proteinaceous ExIPs. These immune receptors can be categorized into receptor-like kinases (RLKs) and receptor-like proteins (RLPs), according to either the presence or absence of an intracellular C-terminal kinase domain, respectively. As mentioned above, intracellular immunogenic patterns (InIPs) are perceived by a second set of immune receptors. These cytoplasmic immune receptors comprise proteins with a variable N-terminal domain, a conserved nucleotide-binding and oligomerization domain (NOD), and a C-terminal LRR domain. According to the composition of their N-terminal domain, these nucleotide-binding, LRR-containing proteins (NLRs) can be broadly categorized into three groups: Toll / INTERLEUKIN RECEPTOR-LIKE (IL1) resistance proteins (TIR)-type NLRs (TNLs), COILED-COIL (CC)-type NLRs (CC-NLRs or CNLs), and RESISTANCE TO POWDERY MILDEW 8 (RPW8)-type CNLs (CCR-NLRs or RNLs). From a functional point of view, NLRs can be divided into "sensor NLRs" that perceive InIPs and "helper NLRs" that act downstream of sensor NLRs. Frequently used methods for unbiased detection of interacting proteins in plants include yeast two-hybrid (Y2H) and split-ubiquitin screens, as well as affinity purification of the protein of interest, followed by mass spectrometry (MS) to identify co-purifying proteins (Meyer and Selbach, 2015. Front Genet 6: 1–7; Xing et al., 2016. Plant Physiol 171: 727–758). These techniques all face significant drawbacks that limit their applicability. The Y2H method is, for example, based on the ability of hybrid transcription factor domains to associate with, and activate the expression of, reporter genes in the nucleus of yeast cells. Hence, this technique requires the interaction partners to localize in the nucleus, which is a very different environment from that of immune receptor complexes that are localized at the PM of the plant cells. The split-ubiquitin yeast system represents an alternative method that is more suitable for the identification of proteins interacting with membrane-associated proteins (Johnsson and Varshavsky, 1994. Proc Natl Acad Sci USA 91: 10340–10344; Raquet et al., 2001. J Mol Biol 305: 927-938). This system is based on the co-expression of two split fragments of ubiquitin, which is a highly conserved eukaryotic protein involved in protein degradation (Glickman and Ciechanover, 2002. Physiol Rev 82: 373–428). Once reconstituted, ubiquitin-specific proteases cleave the ubiquitin from the reconstituted complex, allowing the release of a reporter transcription factor. This approach has been successfully implemented to identify interactions with membrane-associated proteins involved in plant immune responses (Aranda-Sicilia et al., 2015. J Plant Physiol 188: 44–48; Grefen et al., 2015. Nat Plants 1: 15108; Zhang et al., 2015. Plant Cell 27: 1697–1717; Wang et al., 2018. Gene 651: 49–56; Pan et al., 2019. Biochem Biophys Res Commun 518: 719–725). However, as is the case for Y2H, the split-ubiquitin system involves the screening of a cDNA library in yeast cells, making these methods prone to generate spurious interactions and false positives (Xing et al., 2016. Plant Physiol 171: 727–758; Fields and Song, 1989. Nature 340: 245–246). The identification of downstream signaling components activated upon recognition of a pathogen's effector, with the aim to further dissect the immune signaling pathway downstream of receptor-like proteins, has proven to be difficult because of technical limitations associated with detecting weak and transient protein-protein interactions, especially with membrane-bound proteins. Previous attempts using, for example, GFP-based affinity purification, followed by MS to identify co-purifying proteins, did not significantly detect any downstream signaling partner interacting with the kinase domain of SOBIR1 in N. benthamiana (van der Burgh, 2018. PhD thesis, Wageningen University). Possibly, as the protein-protein interactions to be detected are weak, interesting co-purifying proteins that interact with the bait are lost upon washing and resuspending of the affinity beads to which the bait protein is bound. There is thus a need for the development of methods and means that allow identification of plant molecules that interact with a pathogen's effector. BRIEF DESCRIPTION OF THE INVENTION Recently, enzyme-catalyzed proximity-dependent labelling (PL) has emerged as an alternative tool to study the composition of protein complexes. The PL technique involves the conversion of an inert substrate, most often biotin, into a short-lived reactive species that is covalently bound to proteins that are in the vicinity of the bait protein, which in the case of the use of biotin, is fused to a biotin-ligase that performs the labelling. This method allows to perform biotin labelling in living cells and bypasses the necessity to maintain the integrity of the interactions during processing of the sample (Mair and Bergmann, 2022. Plant Physiol 188: 756–768). The strength of the biotin-streptavidin interaction allows for the purification of the biotinylated proteins using streptavidin-coated beads. The coupling of this method with an MS analysis of the isolated proteins (PL-MS), is emerging as a very appropriate technique for identifying in vivo protein-protein interactions and determining the composition of large protein complexes (Mair and Bergmann, 2022. Plant Physiol 188: 756–768; Gingras et al., 2019. Curr Opin Chem Biol 48: 44–54; Arora et al., 2020. Plant Cell 32: 3388–3407). However, known PL techniques have several shortcomings, particularly when performed extracellularly. The present invention surprisingly overcomes these issues, including those encountered extracellularly. The invention provides a method of identifying plant proteins that interact with an effector protein or functional part thereof of a pathogen, the method comprising: a) providing a fusion protein comprising the effector protein, or functional part thereof, that is fused to a proximity-dependent biotinylation enzyme (PDBE); b) introducing the fusion protein into a tissue of a plant that is at least partially resistant to the pathogen, to thereby biotinylate a protein in proximity to the PDBE; c) capturing the biotinylated protein; and d) identifying the captured biotinylated protein. In methods of the invention, the fusion protein is transiently expressed in the plant tissue, preferably by Agrobacterium-mediated transient transformation. Said plant tissue preferably is or comprises leaf tissue. In methods of the invention, the fusion protein may be introduced into the apoplast of the plant, such as into an apoplastic fluid of the plant. In methods of the invention, the biotinylated protein(s) may be captured from apoplastic fluid (AF) that was isolated from the plant tissue. In methods of the invention, the plant tissue may be infiltrated with a solution comprising biotin or a derivative thereof, preferably further including adenosine triphosphate (ATP), preferably for a period of at most 2 hours, prior to the step of capturing the biotinylated protein. In methods of the invention, the PDBE comprises, or is, TurboID (TbID). In methods of the invention, the captured biotinylated protein is identified by mass spectrometry. In methods of the invention, the fusion protein is obtained from a second plant expressing the fusion protein, whereby the second plant preferably is of the same species as the plant into which the fusion protein is introduced. Said second plant preferably expresses the fusion protein in the apoplast, such as in its leaves. In methods of the invention, the fusion protein may be isolated from the second plant in the presence of a protease inhibitor such as phenylmethylsulfonyl fluoride (PMSF), and / or extracellular protease inhibitor (EPI1), for example, from Phytophthora infestans. In methods of the invention, the fusion protein may be transiently expressed in the second plant. In methods of the invention, the fusion protein is transiently expressed by Agrobacterium-mediated transient transformation. FIGURE LEGENDS Figure 1. The various bait-YFP-TbID fusion proteins successfully accumulate in planta. The various bait-YFP-TbID proteins were agroinfiltrated together with Cf-4-Myc, GUS-Myc or BAK1-Myc in leaves of N. benthamiana, with an OD600=0.5 per construct. Two days after agroinfiltration, leaves were harvested and subjected to a total protein extraction. The protein extracts were incubated with GFP-trap beads and the immuno- precipitate was analyzed by immunoblotting. The intensity of the Rubisco band in the different input samples (stain-free gel) shows equal loading. (A) Proper accumulation of YFP-TbID-tagged NbSOBIR1 and GUS takes place. The arrows in the upper panel at about 140 KDa indicate the GUS-YFP-TbID and NbSOBIR1-YFP-TbID bands, whereas the arrows at about 100 KDa point to the GFP-tagged versions of the bait proteins. The slower migration of the bands that are observed upon loading of the corresponding YFP-TbID-tagged bait proteins indicates that these actually represent the YFP-TbID-tagged versions. The arrows at about 150 KDa in the second panel from above point to Cf-4-Myc, whereas the arrows at about and 100 KDa indicate GUS-Myc in the immunoprecipitated samples. In the third and fourth panel from above, the grey arrows indicate GFP- and Myc-tagged GUS, as present in the total protein extract (input), respectively. (B) Proper accumulation of YFP-TbID-tagged SlBON1 and YFP-YFP-TbID. The arrows at about 150 KDa and about 100 KDa in the upper panel indicate SlBON1-YFP-TbID and SlBON1-GFP, respectively, and the presence of these bands evidences the stability of the YFP-TbID-tagged fusion proteins. The arrow pointing to the right in this panel and in the third panel from above indicates YFP-YFP-TbID, whereas the grey arrows in the second and fourth panel from above point to GUS-Myc. The arrows at about 120 KDa in the second panel from above indicate SlBAK1-Myc co-purifying with GFP- and YFP-TbID-tagged versions of SlBON1. Figure 2. Proximity-dependent labelling (PL) employing various YFP-TbID-tagged bait proteins in N. benthamiana. A series of YFP-TbID- and GFP-tagged fusion proteins were transiently expressed in leaves of N. benthamiana, together with SlBAK1-Myc. Agroinfiltrations were performed at an OD600 of 0.5 per fusion protein. (A) Evaluation of PL, including four hours of biotin treatment and infiltration with Avr4 protein where indicated. Two days after agroinfiltration, leaves were infiltrated with a solution containing biotin at 200μM (pH=8, 10 mM MES). Three hours later, the leaves were infiltrated with either a solution containing Avr4 (26 μM) or MQ, and harvested after one hour. Total protein extracts from the agroinfiltrated leaves were desalted to remove the free biotin, incubated with streptavidin-coated beads and analyzed by immunoblotting. In the upper panel, as well as in the third panel from above that represents the input, the arrows at about 140 KDa and 90 KDa indicate YFP-YFP-TbID and GUS-YFP-TbID, respectively, whereas the rectangles indicate the bands evidencing self-biotinylation of NbSOBIR1-YFP-TbID, with longer exposure times as indicated in the right-hand rectangles. In the second panel from above, the arrow at about 100 KDa indicates the position of SlBAK1-Myc, which has been biotinylated by the YFP-TbID-tagged fusion proteins, as it has been captured by the streptavidin-coated beads. (B) Evaluation of PL, with and without one hour of biotin treatment. Two days after agroinfiltration, leaves transiently expressing the various fusion proteins were infiltrated with a solution of biotin at 200μM where indicated (pH=8, 10 mM MES), and the leaves were harvested one hour later, after which protein accumulation and PL were analyzed by immunoblotting. In the upper panel, as well as in the third panel from above that represents the input, the arrows at about 140 and 90 KDa indicate YFP-YFP-TbID and GUS-YFP-TbID, respectively, whereas the rectangles indicate the presence of faint bands that suggest self-biotinylation of NbSOBIR1-YFP-TbID, SlBON1-YFP-TbID and GUS-YFP-TbID. The arrows at about 130 KDa in the second panel from above indicate the position of Sl-BAK1-Myc, which appears to have been biotinylated by the YFP-TbID-tagged versions of its known interactors, NbSOBIR1 and SlBON1. The grey arrows in this panel indicate SlBAK1-Myc which has been biotinylated by the negative control fusion proteins YFP-YFP-TbID and GUS-YFP-TbID. (C) Evaluation of PL using YFP-TbID-tagged versions of the negative control membrane protein LTI6b, and Cf-4. Two days after agroinfiltration, the leaves were infiltrated with a solution of biotin at 200μM (pH=8, 10 mM MES), and harvested after one hour. Desalted total protein extracts of the agroinfiltrated leaves were either incubated with GFP-trap beads or with streptavidin-coated beads and analyzed by immunoblotting. In the upper panel, the arrows at about 140 and 90 KDa indicate the position of GUS-YFP-TbID and YFP-YFP-TbID, whereas the blue arrows at about 70 and 30 KDa indicate LTI6b-YFP-TbID and LTI6b-GFP, respectively. The arrows in the 5 seconds exposure to the right point to Cf-4-YFP-TbID (left) and Cf-4-GFP (right), respectively. The arrows at about 140 KDa in the second panel from above evidence biotinylation of SlBAK1-Myc, as in these treatments the protein is captured by a streptavidin pull-down. Figure 3. YFP-TbID-tagged versions of NbSOBIR1 and Cf-4 are signaling competent. (A) NbSOBIR1-YFP-TbID and NbSOBIR1-GFP, together with Avr4 and Avr9, were transiently expressed by agroinfiltration in N. benthamiana:Cf-4 sobir1(-like) plants. The occurrence of an HR was evaluated at six days after agroinfiltration by red light imaging 235. An OD600 of 0.5 was employed for the expression of both fusion proteins, and an OD600 of 0.1 was used for both Avr4 and Avr9. (B) NbSOBIR1-YFP-TbID, NbSOBIR1-GFP and the negative control GUS-GFP were expressed by agroinfiltration in N. benthamiana:Cf-4 sobir1(-like) plants, after which the Avr4-triggered ROS was monitored two days later, by using a luminol-based assay in which Avr4 protein was added at a concentration of 0.1μM (N=12). Error bars show the standard error. (C) Cf-4-YFP-TbID and Cf-4-GFP, together with Avr4 and Avr9, were transiently expressed by agroinfiltration in N. benthamiana wildtype (WT) plants. The occurrence of an HR was monitored by red light imaging at six days after agroinfiltration. OD600=0.5 for GFP- and YFP-TbID-tagged Cf-4, and OD600=0.1 for Avr4 and Avr9. (D) Cf-4-YFP-TbID, Cf-4-GFP and the negative control GUS-GFP were expressed by agroinfiltration in N. benthamiana WT at an OD600 of 0.1. The Avr4-triggered ROS burst was monitored two days later, by using a luminol-based assay in which Avr4 protein was added at a concentration of 0.1μM (N=12). Error bars show the standard error. Figure 4. Proximity-dependent labelling (PL) of the cell-surface receptor Cf-4 by a YFP-TbID-tagged version of its matching secreted effector protein, Avr4. (A) Immunoblot of apoplastic fluid (AF) containing the Avr4-YFP-TbID fusion protein. Avr4-YFP-TbID was expressed by agroinfiltration in N. benthamiana, at an OD600 of 2. Three days later, AF was isolated from the leaves, and the proteins present in the AF were analyzed by immunoblotting. The upper arrow indicates the band that corresponds to the full-length fusion protein Avr4-YFP-TbID. The middle and lower arrows indicate bands that correspond to the predicted migration of the -YFP-TbID and -TbID elements, respectively. The possible identity of the 45KDa band is not clear. (B) Elicitor activity of the AF containing Avr4-YFP-TbID. The AF analyzed in (A) was also infiltrated in N. benthamiana:Cf-4 and in N. benthamiana wild-type plants, at six sites per leaf, after which the occurrence of an HR was assessed at two days after infiltration. (C) PL of Cf-4-Myc by Avr4-YFP-TbID. Avr4-YFP-TbID was transiently expressed together with either Cf-4-Myc or FLS2-Cf-4-Myc, in N. benthamiana, as indicated. For Avr4-YFP-TbID, the OD600 was 0.03, whereas for the other constructs an OD600 of 0.5 was used. At two days after agroinfiltration, the leaves were infiltrated with a solution containing biotin at 200μM (pH=8, 10 mM MES), and they were harvested after one hour. Total protein extracts were desalted, subsequently incubated with streptavidin-coated beads and the precipitate was analyzed by immunoblotting. Figure 5. Avr4-YFP-TbID (right) and XEG1-YFP-TbID (left) biotinylate their matching receptors in N. benthamiana. The identified proteins in PL-MS are shown by a Volcano Plot. Non-significantly enriched proteins are represented by the grey dots, while significantly enriched proteins are indicated by the black dots. Figure 6. Avr4-YFP-TbID (right) and Avr2-YFP-TbID (left) biotinylate their matching receptor Cf-4 and the protease RCR3, respectively, in tomato. Volcano Plot illustrating the identified proteins by PL-MS. Non-significantly enriched proteins are represented by the grey dots, while significantly enriched proteins are indicated by the black dots. Figure 7. Co-expression of the protease inhibitor EPI1 increases the Avr4-YFP-TurboID content in the apoplast. N. benthamiana plants were either co-agroinfiltrated with EPI1 or EPI1 empty vector, and with Avr4-YFP-TurboID. At 2 dpi apoplastic fluid was isolated and run on an SDS-PAGE gel. After western blotting, αTurboID antibodies were used to visualize the Avr4-YFP-TurboID fusion protein. Note that co-expression of EPI1 results in a higher accumulation of the recombinant Avr4-YFP-TbID fusion protein at 75 kDa. DETAILED DESCRIPTION OF THE INVENTION Definitions As are used herein, the singular forms "a", "an" and "the", are intended to include the plural forms as well. As is used herein, the term "or" includes any and all combinations of one or more of the associated listed items, unless the context clearly indicates otherwise (e.g., if an "either …or" construction is used). As are used herein, the terms "comprise" and "comprising", and conjugations thereof, are open language and specify the presence of stated features but do not preclude the presence or addition of one or more other features. It will be understood that when a particular step of a method is referred to as subsequent to another step, it can directly follow said other step, or one or more intermediate steps may be carried out before carrying out the particular step, unless specified otherwise. The term "plant", as used herein, refers to an organism of the kingdom Plantae, preferably a multicellular organism of said kingdom. Most plants perform photosynthesis, by means of which they obtain energy from sunlight. Plants are economically relevant, as parts of a plant may be used for human and / or animal consumption, such as seeds, fruits, and roots. Alternatively, ornamental plants are used for decorative purposes. Plants may also be used for the production of chemicals or materials, including fibers. The terms "resistant" and "resistance", as used herein, refer to the ability of a plant not to be negatively affected by a specific pathogen, and / or the ability to prevent or terminate an infection. Resistant plants may tolerate infection by a specific pathogen to a certain extent, thereby suffering none or only minimal damage. For example, a plant that is resistant to the fungus Fulvia fulva, formerly known as Cladosporium fulvum or Passalora fulva, causing a disease referred to as Tomato leaf mold, will not, or will only partially, or only temporally, be affected by F. fulva, in contrast to a plant that is susceptible to F. fulva. Symptoms in affected plants may include chlorosis, browning and necrosis of leaves and stem, wilting, withering, reduction of fruit size, and root decay. The term "pathogen", as used herein, refers to an infectious organism such as, for example, a fungus, an oomycete, a bacterium, a virus, a viroid, a virus-like organism, a phytoplasma, a protozoan, and a nematode that may cause a disease in a plant. The term pathogen includes reference to a fungus of the division Ascomycota, such as a fungus causing apple scab (Venturia inaequalis), Dutch elm disease (Ophiostoma ulmi), tomato leaf mold (Fulvia fulva), rice blast (Magnaporthe oryzae), black knot (Apiosporina morbosa), and powdery mildew, including powdery mildew of grape (Uncinula necator), powdery mildew of wheat, barley and other cereals (Blumeria graminis), powdery mildew of apples and pears (Podosphaera leucotricha), and powdery mildew of gourds and melons, such as Podosphaera xanthii and Erysiphe cichoracearum. Said pathogen may be a Cladosporium (Passalora) species, such as F. fulva, C. cladosporioides, C. herbarum and C. sphaerospermum. The term "infection", as used herein, refers to entrance of an organism such as a fungus, a bacterium, or a virus, into a plant. Optionally, said infecting organism causes or triggers a phenotypical change in the plant, such as a disease. The term "effector protein", as used herein, refers to one or more key virulence proteins of a pathogen that play a role in disease development in a susceptible plant and determines the virulence level of the pathogen. Effector proteins may activate immunity in disease-resistant plants after being recognized by specific immune receptors. Characterization of the interaction between an effector protein and its matching receptor in plants that are resistant to the pathogen is instrumental in understanding the molecular mechanism of resistance and implementing resistance in susceptible plants. The term "fused effector protein", also termed "fusion protein", as used herein, refers to an effector protein or functional part thereof that is fused to a proximity-dependent biotinylation enzyme (PDBE), such as a biotin ligase. Said PDBE may be located at the N-terminal part of the effector protein, preferably at the N-terminus, or at the C-terminal part of the fused effector protein, preferably at the C-terminus. Independent of the presence of a fused PDBE, a fused effector protein may additionally include one or more tags at its N-terminus and / or C--terminus. The term "tag", as is used herein, refers to a peptide sequence that may be included in a recombinant protein. The term includes reference to any tag known in the art, including a histidine tag, a c-myc domain, a hemagglutinin tag, a maltose-binding protein, a glutathione-S-transferase, a FLAG tag, a calmodulin-binding peptide, as presented in Esposito and Chatterjee, 2006 (Esposito and Chatterjee, 2006. Cur Opin Biotech 17, 353–358), or a fluorescent tag such as a green fluorescent protein (GFP) or a derivative thereof such as enhanced GFP, a yellow fluorescent protein (YFP), a blue fluorescent protein, a cyan fluorescent protein as, for example, described in Kremers et al., 2011 (Kremers et al., 2011. J Cell Sci 124: 157–160). When present, a tag is preferably located at an opposite end of a fused PDBE, or is subterminal to the fused PDBE. The term "gene", as used herein, refers to a region on the genome of an organism that encodes one or more expression products, such as proteins. On a genomic level, the term gene includes reference to all nucleic acid elements that enable expression of the one or more expression products, including promoter / enhancer sequences, coding sequences, intron sequences if present, terminator sequences, and 5' and 3' untranslated sequences. On a transcript level, the term gene includes reference to nucleic acid elements such as coding sequences and 5' and 3' untranslated sequences. The term "coding sequence", as used herein, refers to a DNA or RNA sequence that codes for a specific protein, or part thereof. The term "screening", as used herein, refers to the examination of a group of plants to identify one or more plants that have a certain characteristic, such as a particular phenotype, typically by means of an assay or a molecular test. Said characteristic includes, for example, the presence of resistance towards infection with a pathogen, such as F. fulva. The term "selecting", as used herein, refers to a process of identifying and isolating an individual plant from a group of plants, usually based on a certain characteristic such as phenotype of that individual plant, including the presence of a resistance to a certain pathogen or group of pathogens. Said individual plant preferably is identified in a screening process. Methods of introducing a fusion protein into a plant tissue The present invention relates to methods involving proximity-dependent biotinylation in order to identify plant resistance proteins that interact directly or indirectly with an effector protein of a pathogen. It is known that enzyme-catalyzed proximity labeling (PL) techniques cannot discriminate between whether there is actually a physical, and thereby probably a functional interaction between a bait and its prey proteins, or whether they are just in close proximity. Instead, PL provides a qualitative metric of the proximity between them. Beside this limitation, PL is a very useful approach for studying low-affinity and transient protein-protein interactions, as well as for the identification of the composition of protein complexes present at the plasma membrane (PM) (Samavarchi-Tehrani et al., 2020. Mol Cell Proteomics 19: 757-773; Mair and Bergmann, 2022. Plant Physiol 188: 756–768; Gingras et al., 2019. Curr Opin Chem Biol 48: 44–54). Extracellular plant cell-surface receptors mediating immune responses upon pathogen detection can be categorized as receptor-like kinases (RLKs) and receptor-like proteins (RLPs). RLKs are single-pass transmembrane proteins with an extracellular domain for danger perception and a cytoplasmic kinase domain for the initiation of downstream signaling. RLPs mediating immune responses lack any intracellular signaling domain and form bi-molecular receptor-like kinases by their constitutive interaction with the adaptor regulatory RLK termed SUPPRESSOR OF BIR1-1 (SOBIR1) (van der Burgh and Joosten, 2019. Trends Plant Sci 24: 587–601; Gust and Felix, 2014. Curr Opin Plant Biol 21: 104–111). The tomato Cf-4 protein is an example of such an RLP mediating immune responses. This RLP mediates resistance against strains of the leaf mold fungus F. fulva that secrete the matching effector protein Avr4, which is a chitin-binding lectin-like protein that protects fungal cell walls against hydrolysis by plant chitinases (Joosten et al., 1994. Nature 367: 384–386; van den Burg et al., 2006. Mol Plant-Microbe Interact 19: 1420–1430; de Wit, 2016. Annu Rev Phytopathol 54: 1–23). The assumed direct interaction of Avr4 with the extracellular leucine-rich repeat (LRR) domain of Cf-4 triggers the recruitment of the RLK BRI1-ASSOCIATED KINASE 1 (BAK1) (Postma et al., 2016. New Phytol 210: 627-642), after which a subsequent series of transphosphorylation events between the cytoplasmic kinase domains of SOBIR1 and BAK1 initiates an immune signaling cascade (van der Burgh et al., 2019. Mol Plant Pathol 20: 410–422). There is evidence suggesting that BAK1 recruitment is negatively regulated by its interaction with the RLK BAK1-INTERACTING RECEPTOR KINASE 1 (BIR1) (Gao et al., 2009. Cell Host Microbe 6: 34–44; Liu et al., 2009. New Phytol 212: 637–645). However, not much more is known regarding the interaction partners of RLP / SOBIR1 receptor complexes mediating immune responses in solanaceous plants. To identify such interaction partners, an effector protein of a pathogen, or a functional part thereof, a proximity-dependent biotinylation enzyme (PDBE) is fused to one or more cytoplasmic kinase domains of, for example, SOBIR1 and / or BAK1. Said PDBE may be a biotin ligase such as the Escherichia coli biotin ligase BirA, and variants thereof. In the presence of biotin and adenosine triphosphate (ATP), which are available in the cytoplasm, a biotin ligase such as BirA that is fused to a protein of interest results in the generation of a cloud of reactive and labile biotinylated AMP molecules (bioAMP) around the enzyme. Within this cloud, which is estimated to have a radius of 10 nm (Kim et al., 2014. Proc Natl Acad Sci USA 111: 2453–2461), the bioAMP reacts with lysine residues in proximal proteins, resulting in their covalent biotinylation. The search for further biotin ligases led to the development of several alternative enzymes (Mair and Bergmann, 2022. Plant Physiol 188: 756-768). Among these alternatives, a preferred enzyme is TurboID (TbID). TbID was engineered using yeast display-based directed evolution (Branon et al., 2018. Nat Biotechnol 36: 880-898; US patent application US2021 / 0214708). The TbID enzyme produces, in animal cells, as much biotinylated product within 10 min as a single amino acid mutant of BirA, termed BirA*, produces in 18 hours, thereby generating a biotinylation cloud with an estimated radius of at least 35nm (May et al., 2020. Cells 9: 1070). Since its development in 2018, TbID has been successfully used for PL-MS in various systems, including animals and plants (Arora et al., 2020. Plant Cell 32: 3388-3407; Branon et al., 2018. Nat Biotechnol 36: 880-898; Larochelle et al., 2019. J Cell Sci 132: jcs232249; Kim et al., 2019. bioRxiv 636324; Zhang et al., 2019. Nat Commun 10: 3252). The effector protein of a pathogen, or a functional part thereof, may be fused to a PDBE at either end of the protein or part thereof. The functional part of the effector protein is typically a mature part of the effector. It is appreciated what the mature part of the effector protein is to the skilled person. However, it is noted that the addition of epitope tags can affect the biological function of proteins. For instance, C-terminally tagged versions of BAK1 are impaired in their capacity to mediate immune responses (Ntoukakis et al., 2011. Plant Cell 23: 3871–3878; Hurst et al., 2018. Plant Physiol 177: 522–531). This phenomenon may limit the application of a tagged effector protein, also termed bait protein, for use in methods of the invention. Therefore, it should be tested whether an effector protein that is fused at the N-terminal end or C-terminal end is still able to induce the development of an immune response such as a hypersensitive response, which is a form of programmed cell death, and / or the production of reactive oxygen species (ROS), when transiently co-expressed in a susceptible plant with its matching resistance protein, or in a resistant plant containing the matching receptor. The fused effector protein may additionally be coupled to a tag to allow identification, subcellular localization, and optionally also isolation of the fused effector protein. Methods for employing these tags are known in the art and may be used for isolation and / or detection of said fused effector protein, for example, on a Western blot. Said fused effector protein may be introduced into a tissue of a plant that is at least partially resistant to the pathogen, to thereby biotinylate plant resistance-mediating proteins that are in proximity to the PDBE. In methods of the invention, said protein may be produced in a heterologous system such as a prokaryotic cell, or a fungus such as a filamentous fungus, or a yeast, such as Saccharomyces cerevisiae or Pichia pastoris, or a plant such as N. benthamiana. Production of the fused effector protein in a prokaryotic cell such as Escherichia coli, may be performed as described in Arbabi-Ghahroudi et al., 2005 (Arbabi-Ghahroudi et al., 2005. Cancer Metastasis Rev 24: 501–519). Production of the fused effector protein in bacteria, such as E. coli, can be performed by secretion of the fused effector protein into the periplasmic space, or by expression in the reducing cytosol. The latter may require refolding of the fusion protein (Arbabi-Ghahroudi et al., 2005. Cancer Metastasis Rev 24: 501–519). Following production of a fused effector protein in a heterologous expression system, the resulting protein may be purified. Methods for purification of a fused effector protein are known in the art and are generally based on chromatography, such as affinity chromatography and ion exchange chromatography, to remove contaminants. In addition to contaminants, it may also be necessary to remove undesirable derivatives of the product itself such as degradation products and aggregates. Suitable purification process steps are provided in Berthold and Walter, 1994 (Berthold and Walter, 1994. Biologicals 22: 135– 150). As an alternative, or in addition, a fused effector protein may be tagged with one or more specific tags to allow attachment of the protein to a bead or column that is specific to the tag and therefore be isolated from impurities. The purified protein is then exchanged from the affinity bead or column with a decoupling reagent. The method has been routinely applied for purifying recombinant protein. Conventional tags for proteins, such as a histidine tag, are used in combination with an affinity bead or column that specifically captures the tag (e.g., a Ni-NTA or Ni-IDA agarose column for a histidine tag) to isolate the protein from impurities. The protein is then exchanged from the bead or column using a decoupling reagent according to the specific tag (e.g., imidazole for a histidine tag). This method is more specific when compared with traditional purification methods. The resulting fused effector protein, which is preferably purified, is then introduced into a tissue of a plant that is at least partially resistant to the pathogen. Said plant tissue preferably is, or comprises, the intercellular space, termed apoplast. The apoplast is the space wherein microbe-associated molecular patterns (MAMPs) are secreted by pathogens, and is also the space where matching extracellular receptors triggering plant resistance are localized. Introduction of a fused effector protein into the apoplast will result in the biotinylation of plant defense proteins, or resistance proteins, including its matching receptor, in proximity to the PDBE. The methods of the invention further include capturing biotinylated proteins and identifying the captured biotinylated proteins by mass spectrometry (MS). As an alternative, said fused effector protein may be produced in a heterologous expression system, such as cultured plant cells, or a plant. Said plant should typically not possess a receptor recognizing said effector, so programmed cell death will not occur. Said plant preferably is a plant of the same species as the recipient plant that is able to recognize said effector. Said fused effector protein may be produced through stable transformation or by transient expression of a gene encoding said fused effector protein. Stably transformed transgenic plants in which expression vectors expressing the fused effector protein are inserted into the nuclear or chloroplast genome, can be used to produce said fused effector protein. Stable nuclear expression is the most commonly used method for genetically engineering plants, but chloroplast expression of transgenes can result in a higher yield of recombinant proteins (Cardi et al., 2010. Expert Rev Vaccines 9: 893–911). Known viral expression systems are based on, for example, recombinant tobacco mosaic virus, potato virus X, the geminivirus bean yellow dwarf virus, or cowpea mosaic virus, to produce recombinant proteins. Most stable transformation systems involve tissue culture to recover adult plants from regenerable explants. Constructs that express a fused effector protein can be delivered to the explant tissue culture by, for example, particle bombardment, Agrobacterium-mediated transformation, virus-mediated infection, electroporation, microinjection, aerosol beam injection, whiskers-mediated plant transformation, or Agrobacterium rhizogenes-mediated plant transformation. Subsequently, somatic embryos and / or friable embryogenic callus generated from transformed cells can be used to generate transgenic plants. As an alternative, somatic embryos and / or friable embryogenic callus may be transformed with a vector that expresses a fused effector protein and subsequently used to generate transgenic plants. A preferred system is provided by a transient expression, for example, by an Agrobacterium-mediated gene expression system, also termed agroinfiltration (Burnett and Burnett, 2020. Plants People Planet 2: 121–132). In the agroinfiltration method, a suspension of A. tumefaciens is introduced into plant leaves either by injection or vacuum infiltration, whereafter the bacteria transfer the expression cassette that expresses a fused effector protein into the nucleus of host plant cells. Generally, the expression of recombinant proteins via agroinfiltration is higher and more efficient than that obtained through traditional plant transformations. A fused effector protein that is expressed in a homologous expression system, such as a plant, preferably a plant of the same species as the recipient plant, may not need to be purified. For example, a fused secreted effector protein that is transiently or stably expressed in a plant, may be isolated from the apoplast, which is the intercellular space at the outside of the cells. The apoplastic fluid comprising the fused effector protein may be isolated from a plant, for example, a susceptible plant, using the method described by Joosten, 2012 (Isolation of Apoplastic Fluid from Leaf Tissue by the Vacuum Infiltration-Centrifugation Technique. In: Bolton, M., Thomma, B. (eds) Plant Fungal Pathogens. Methods in Molecular Biology, vol.835. Humana Press.), and transferred to the apoplast of a resistant plant to biotinylate proteins that are in the vicinity of the fused effector protein, followed by capturing biotinylated proteins and identifying the captured biotinylated proteins, preferably by MS. Said isolation of fused effector protein that is expressed in a homologous expression system, such as in the apoplastic space, may be performed in the presence of a protease inhibitor. Said protease inhibitor may include a small molecule and / or a protein-based protease inhibitor, such as aprotinin, bestatin, leupeptin, pepstatin A, alpha-1-antitrypsin, phenylmethylsulfonyl fluoride (PMSF), and / or an extracellular protease inhibitor, such as the extracellular protease inhibitor 1 (EPI1), for example, from Phytophthora infestans (UniProt D0MVC9). A preferred protease inhibitor is provided by PMSF and / or EPI1. As an alternative, a fused effector protein is introduced into a resistant plant by expressing the fused effector protein into a resistant plant. Typically, ATP and a biotin buffer are also introduced into the resistant plant. Said fusion protein preferably is introduced into a plant by transient expression, preferably by Agrobacterium-mediated transient transformation (agroinfiltration), resulting in localized high expression levels of the fusion protein. Typically, a promoter is also introduced into the plant, preferably the constitutive viral 35S promoter (CaMV 35S). Without being bound by theory, these high expression levels of the fusion protein may be a reason that at least part of the fusion protein can be recovered from the apoplastic fluid of the plant tissue, following agroinfiltration, before programmed cell death takes place as a result of recognition of the fused effector protein by the resistant plant. The fused effector protein is introduced into a tissue of a resistant plant for a sufficient time period to allow biotinylation of plant proteins that come into the vicinity of the fused effector protein, prior to isolating the plant tissue and capturing biotinylated plant proteins therein. Said sufficient time period may range from 10 minutes to 4 days. In case the fused effector protein is introduced as a protein into a tissue of a resistant plant, said period of time preferably is between 10 minutes and 6 hours, such as between 30 minutes and 4 hours, including 1 hour, 2 hours and 3 hours. In case the fused effector protein is introduced by transient expression through Agrobacterium of said protein into a tissue of a resistant plant, said period of time preferably is between 1 day and 4 days, such as between 36 hours and 72 hours, including 48 hours. Prior to capturing biotinylated plant proteins, the plant tissue may be infiltrated with a biotin solution to enhance the generation of biotinylated plant proteins. Typically, said biotin solution comprises biotin or a derivative thereof, preferably biotin, wherein typically the derivative is an analog, such as a structural or functional analog, preferably a functional analog that typically is capable of binding, for example, to avidin and / or streptavidin. Typically, the plant tissue is also infiltrated with a solution comprising ATP, preferably further comprising a cofactor, such as MgCl2. Said biotin solution may comprise biotin at a concentration of 10-1000 μM, such as 50-500 μM, including 100 μM, 200 μM, 300 μM and 400 μM. Said biotin solution may comprise ATP, for example, at a concentration of 0.1-5 mM, such as 0.3-3 mM, including 0.5-2 mM, 0.7-1.5 mM, and about 1 mM. Said biotin solution may comprise a cofactor, for example, at a concentration of 1-10 mM, such as 2-9 mM, including 3-8 mM, 4-7 mM, and about 5 mM. Said biotin solution may be provided in a buffered solution, for example, at pH 7-9, such as pH 7.5-8.5, preferably at pH=7.5 or pH=8.0. Said buffer preferably is a sulfonylethyl buffer, such as 2-(N-morpholino) ethanesulfonic acid (MES), N,N-bis-(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES) or N-cyclohexyl-2-aminoethanesulfonic acid (CHES). Said infiltration preferably is for a period of time of between 10 minutes and 4 hours, such as between 30 minutes and 2 hours, including 60 minutes and 90 minutes, before total protein extraction. Methods of capturing biotinylated proteins Following introduction of a fused effector protein into a resistant plant and, optionally, infiltration of a biotin solution and preferably ATP, the plant tissue is isolated before cell death has occurred due to the hypersensitive response (HR), to prepare protein extracts. The isolated plant tissue may be stowed prior to preparing the extracts, for example, by wrapping in aluminum foil, and storage in liquid nitrogen or at -80°C until further use. Frozen samples may be ground to a fine powder in liquid nitrogen, for example, by using a mortar and pestle. Pulverized samples may subsequently be transferred to pre-cooled tubes, preferably V-shape tubes, and resuspended in 2 mL / g of an extraction buffer. Said extraction buffer preferably comprises a salt, for example, 10-500 mM NaCl, such as 150 mM NaCl, 0.2-2% (v / v) of a nonionic, non-denaturing detergent such as Nonidet P40 or IGEPAL® CA-630 (Sigma-Aldrich), a protease inhibitor such as a Sigma protease inhibitor cocktail (1 tablet per 50 mL), buffered at a pH between 7.5 and 8.5, preferably at a pH of 8.0, with a buffer such as tris(hydroxymethyl)aminomethane. The samples are preferably kept on ice and may be agitated, such as being vortexed, during resuspending. Following resuspension, the samples may be centrifuged, for example, at 13,000 rpm for 30 minutes at 4°C in a Sigma 4-16K centrifuge, to remove insoluble material. Following resuspension and removal of insoluble material, the protein extracts may be desalted by a method known in the art, for example, using PD MiniTrap PD-10 desalting columns (GE Healthcare). Desalting is preferably performed at 4 °C, aimed at removing the remaining free biotin. The desalted protein extracts may subsequently be incubated with a high affinity binder to biotin to capture biotinylated proteins. Said high affinity binder includes de-glycosylated avidin (NeutrAvidin; ThermoFisher Scientific), streptavidin, and variants thereof. Said high affinity binder preferably is coupled to beads, preferably magnetic beads such as Dynabeads™. Following an incubation period, preferably between 10 minutes and 10 hours, the beads may be washed three times with extraction buffer and may be resuspended in extraction buffer. As an alternative, or in addition, the beads may be washed with an ammonium bicarbonate buffer, 50 mM, pH=8, and resuspended in this buffer. Method of identifying captured biotinylated proteins. While still on the beads, the disulfide bonds in the captured proteins may be reduced, for example, by adding 5 μL of dithiothreitol (150 mM) and incubating the samples at 45°C for 30 minutes. The sulfhydryl groups may subsequently be alkylated by adding 6 μL of acrylamide (200 mM) and incubating the samples for 10 minutes at room temperature. The peptides may subsequently be released from the beads by proteolytic digestion, for example, by tryptic digestion. For example, trypsin (0.5 μg / μL of trypsin in 1 mM HCl, pH 3) may be diluted 100 times in an ammonium bicarbonate buffer (50 mM, pH=8) and 100μL of the diluted trypsin solution may be added to each sample. The samples may then be incubated overnight at room temperature with mild agitation, after which they may be acidified to pH=3 using trifluoroacetic acid and cleaned-up using μColumns according to the method published by Wendrich and co-workers (Wendrich et al., 2017. Plant Hormones. In: Methods in Molecular Biology 1497: 147–158). Biotinylated proteins are typically subsequently identified by MS. A preferred method for identifying biotinylated proteins comprises ultra-high performance liquid chromatography (UHPLC), coupled to tandem mass spectrometry (LC-MS / MS) in positive electrospray ionization mode. The LC-MS / MS analysis may be performed, for example, by using a high end UHPLC chromatographic system coupled to a triple-quadrupole mass-spectrometer. For example, the peptides may be separated by reverse-phase nano-liquid chromatography using a Thermo nLC1000 column (ThermoFisher Scientific) and they may be measured using an Orbitrap Exploris 480 mass spectrometer (ThermoFisher Scientific). Resulting peptide spectra may be searched in Maxquant (Cox and Mann, 2008. Nat Biotechnol 26: 1367-1372), using the Andromeda search engine (Cox et al., 2011. J Proteome Res 10: 1794–1805) with label-free quantification (LFQ). The identified protein groups may then be analyzed using Perseus (Tyanova et al., 2016. Nat Methods 13: 731-740). The methods of the invention allow the identification of an unknown host cell-surface receptor of a particular secreted effector protein of a pathogen by PL-MS. The results presented herein surprisingly suggest that even unstable PDBE-tagged effector pro-proteins can biotinylate the corresponding receptor possibly already before being processed and degraded by proteases. This process may be facilitated by the short delivery route of the fusion protein, as effector proteins secreted by the host itself do not have to pass the cell wall to come into contact with their matching cell-surface receptors residing at the PM, thereby reducing the possibility of degradation of the fusion protein in the apoplast before biotinylation of the receptor can occur. The protocol proved to be useful to selectively biotinylate known components of the complex either at the cytoplasmic side or the apoplastic side of the PM. A validated series of TbID-fused bait proteins is generated that can be used to identify novel components of the Cf-4 / SOBIR1 complex by PL-MS. Additionally, it is shown to be possible to use PL-MS to identify an unknown cell-surface receptor of a particular secreted effector of a pathogen in plants resistant to that particular pathogen, typically in the case of biotin and ATP incubation. This could potentially speed up the process of the identification of economically relevant cell-surface receptors acting as resistance proteins in plants, and thereby revolutionize resistance breeding. Said TbID-fused bait proteins include the Avr4 gene of F. fulva, which codes for a pre-pro-protein of 135 amino acids (UniProt Q00363), including an N-terminal signal peptide for extracellular targeting (Joosten et al., 1994. Nature 367: 384-386)). Once secreted, the Avr4 pro-protein comprising 117 amino acids is processed at its N- and C-termini by apoplastic proteases into the mature and stable Avr4 elicitor of 86 amino acids (Joosten et al., 1997. Plant Cell 9: 367-379). Examples Example 1 Materials and Methods Plant material and growth conditions N. benthamiana and transgenic N. benthamiana stably expressing Cf-4 (N. bentamiana:Cf-4) were grown in climate chambers under 16 hr of light, at 24°C and 8 hr of darkness, at 22 °C and at an RH of 75%. Solanum lycopersicum cultivar Momeymaker-Cf-4 were grown under controlled greenhouse conditions under 16 hr of light, at 24°C and 8 hr of darkness, at 22 °C and at an RH of 60%. Vectors for agroinfiltrations The different bait-TbID fusion proteins were generated using a gateway-compatible 35S-YFP-TbID expression vector based on pEarleyGate101 (pEG101) (Kim et al., 2019. bioRxiv 636324). To generate C-terminally fused Avr4-YFP-TbID, the sequence encoding the primary translation product of 135 amino acids (UniProt Q00363) of the Avr4 gene was amplified from the pMOG800-Avr4 (SOL6783) plasmid. Avr2 and XEG1, which is an effector of F. fulva that inhibits extracellular proteases like Rcr3 and an effector of Phytophthora sojae for which N. benthamiana has an endogenous receptor, respectively, were amplified from the pMOG800-Avr2 plasmid and the cDNA of Phytophthora sojae, respectively. The signal peptides for extracellular targeting of Avr2 and XEG1 were predicted using the SignalP 6.0 server and exchanged with the NtPR1a signal peptide. The amplified effector genes were inserted into the destination vector using the ClonExpress MultiS One Step Cloning Kit. For constructing LTI6b-YFP-TbID (SOL9208), the sequence encoding LTI6b was amplified from pBIB-35S-LTI6b-eGFP 344, cloned into pENTR / D-Topo, and transferred into the destination vector using the Gateway® LR Clonase® II enzyme mix. The vectors GUS-YFP-TbID (SOL9203), NbSOBIR1-YFP-TbID (SOL9201), SlBON1-YFP-TbID (SOL9205), and Cf4-YFP-TBID were generated by LR reactions from the gateway entry vectors SOL2685, SOL4064, SOL8609, and SOL2520, respectively. The primers that were used are listed in Table 1. Agrobacterium-mediated transient transformation Agrobacterium-mediated transient transformations (agroinfiltrations) were performed as previously described (Van der Hoorn et al., 2000. Mol Plant-Microbe Interact 13: 439–446). For protein expression, the first fully expanded leaf of three to four weeks old N. benthamiana or the third and fourth compound leaves of 5 weeks old S. lycopersicum Moneymaker (MM) Cf-4 plants were infiltrated at the indicated OD600. For co-immunoprecipitation and streptavidin-pull downs, the N. benthamiana and S. lycopersicum leaves were harvested at two and three days after agroinfiltration, respectively. Bioassays for determining the Avr4-triggered HR and ROS burst The intensity of the HR in the leaf tissue of N. benthamiana was quantified by redlight imaging using a Chemidoc XRS system (Bio-Rad), following the procedure described by Landeo-Villanueva et al. (2021 Mol Plant Pathol 22:361-372) The fluorescence produced by the -eYFP tag that is present in the various fusion proteins that was generated was found to interfere with visualization of the HR. To prevent this, visualization of the strong necrotic responses shown in Figures 3A and 3C was performed at six days after agroinfiltration, once the signal from the -eYFP tag had faded away because of the transient nature of the protein expression (Curtis and Wolpert, 2004. Plant J 38: 244–259). In the case of the weak HR observed upon infiltration of AF containing Avr4-YFP-TbID in N. benthamiana:Cf-4, the images shown in Figure 4B were acquired upon excitation by a light source in the red visible spectrum (Red LED Module kit no. 1708283), and using the emission filter 695 / 55, thereby avoiding the fluorescence emitted by the -eYFP tag. Table 1. Nucleotide sequences of the primers that were used. Name SOL number Sequence LTI6b Fw JO20 caccATGAGTACAGCCACTTTCG LTI6b Rv JO21 CTTGGTGATGATATAAAGAGCG Avr4 Fw SO195 gagaggacacgctcgagatcATGCACTACACAACCC TC Avr4 Rv SO196 cccttgctcaccctaggcacATAGCCAGGATGTCCAA C pEG101 Fw JO28 GTGCCTAGGGTGAGCAAGGG pEG101 Rv JO29 GATCTCGAGCGTGTCCTCTCC NbSOBIR1 Fw JO4 TTCTTGAAGGTCATGTGCC YFP Rv JO6 CTCAGGTAGTGGTTGTCGG TurboID Rv JO8 GCAGATACAGGTCATTGGG GUS Fw JO9 GGTTATCTCTATGAACTGTGCG SlBON1 Fw JO11 CTGAAAGTGGAATTGTCGTTCC Eo_88 cccttgctcaccctaggcacACCGCAAAGACCAAAAC Avr2 Fw AGC Avr2 Rv Eo_100 gagaggacacgctcgagatcATGGGATTTGTTCTCTT TTCACAA NtPR1a Fw Eo_88 gagaggacacgctcgagatcATGGGATTTGTTCTCTT TTCACAA NtPR1a Rv Eo_89 cactggccgcagtagtctccACCTCCTGCACATCAAC AAATTT XEG1 Fw Eo_90 ttgttgatgtgcaggaggtGGAGACTACTGCGGCCA GTG XEG1 Rv Eo_91 cccttgctcaccctaggcacGTTGACCGCAGCCGAGA AC Co-immunoprecipitation assays and immunoblots Co-immunoprecipitations (co-IPs) were performed as described previously (Liebrand et al., 2013. Proc Natl Acad Sci USA 110: 10010–10015). The eGFP- or eYFP-tagged proteins were detected with αGFP-HRP antibodies (Miltenyi Biotec, 130-091-833), whereas Myc-tagged proteins were detected using αMyc antibodies (cMyc9E10, sc-40, Santa Cruz), with anti-Mouse-HRP (GE healthcare) as a secondary antibody. Presence of the TurboID element was detected by using anti-BirA antibodies (Agrisera, AS204440-ALP). Proximity-dependent labelling (PL) An adjusted protocol for the PL was used for the experiments of which the results are shown in Figures 2C and 4C. For these assays, agroinfiltrated leaves were infiltrated with a biotin solution (200 μM, pH=8, 10 mM MES), one hour before harvesting and stored in liquid nitrogen or at -80°C. Considering the low recombinant effector protein accumulation, the biotin solution was supplemented with 1mM of ATP and 5mM of MgCl2 to optimize the enzymatic activity of TurboID in the tomato apoplastic space. The samples were ground in liquid nitrogen using a mortar and pestle. The pulverized samples were then transferred to pre-cooled 50 mL V-shape tubes, weighed, and resuspended in 2mL / gram of extraction buffer (EB; pH=8.0, 150 mM NaCl, 1.0% [v / v] of branched octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL® CA-630; Sigma-Aldrich), 50 mM Tris and 1 tablet of protease inhibitor cocktail ((Sigma-Aldrich) per 50 mL). The samples were subsequently centrifuged at 13,000 rpm for 30 minutes at 4°C in a Sigma 4-16K Centrifuge. To prevent saturation of the streptavidin beads with the free biotin remaining in the samples, the centrifuged protein extracts were desalted at 4°C using MiniTrap PD-10 desalting columns (GE Healthcare), following the manufacturer's gravity protocol for removing salt. The desalted protein extracts were incubated with streptavidin beads to capture the biotinylated proteins. Subsequently, the biotinylated proteins were digested on the beads by treatment with trypsin and the resulting peptides were analyzed by nano-LC-MS / MS, using label-free relative quantitation. The relative enrichment level of biotinylated proteins was determined by Perseus. An aliquot of 45 μL of each desalted extract was collected as an input sample, mixed with 15 μL of 4x Laemmli loading buffer (4xLB; 200 mM Tris-HCl pH=6.8, 8% SDS, 40% glycerol, 400 mM DTT and 0.2% of Bromophenol blue), incubated at 95 °C for 5 minutes and kept at -20°C until further processing for western blotting. For each sample, 2 mL of desalted extracts were incubated for 1 hour at 4°C (at 10 rpm in an SB3 tube rotator, STUART) with 100μL of Dynabeads™ MyOne™ Streptavidin C1 (previously washed according to the manufacturers' protocol). After incubation, the beads were transferred into 4 fresh 2mL Eppendorf tubes using a magnetic separation rack, washed three times with 1mL of EB, and eventually resuspended in 30 μL of EB. To each sample 10μL of 4xLB was added, after which they were incubated at 95°C for 5 minutes and subsequently kept at -20°C until further processing for western blotting as described previously (Liebrand et al., 2013. Proc Natl Acad Sci USA 110: 10010-10015). For the PL assay of which the result is shown in Figure 2A, a longer biotin treatment was applied. Here, at two days after agroinfiltration, the leaves were infiltrated with the biotin solution and after three hours, the leaves were infiltrated with either MQ or a solution containing pure Avr4 protein (26 μM) and harvested after one hour. Isolation of apoplastic fluid from agroinfiltrated N. benthamiana leaves The isolation of apoplastic fluid was performed as described previously (Joosten, 2012. Methods Mol Biol 835: 603–610). The samples were kept at -20°C. RESULTS The various bait -YFP-TbID fusion proteins accumulate upon their transient expression in Nicotiana benthamiana To evaluate the use of TbID-based proximity-dependent labelling on dissecting the composition of RLP / SOBIR1-containing complexes in N. benthamiana, with the overall aim to identify novel interactors present in such complexes, a series of open reading frames (ORFs) were inserted into the gateway-compatible 35S-YFP-TbID vector (Kim et al., 2019. bioRxiv 636324). These ORFs encode known, as well as putative components of the Cf-4 / SOBIR1 complex, in addition to proteins to be used as negative controls. As a starting point, the accumulation of the various bait proteins fused to YFP-TbID and their association with known interactors was determined. For this purpose, C-terminally GFP- and YFP-TbID-tagged NbSOBIR1 or -GUS were transiently co-expressed in N. benthamiana with C-terminally Myc-tagged Cf-4 or -GUS. Two days after agroinfiltration, the proteins were extracted and immunoprecipitated using GFP-trap agarose beads. The isolated proteins were then subjected to immunoblotting with either anti-GFP or anti-Myc antibodies. The anti-GFP blot showed that the fusion proteins NbSOBIR1-YFP-TbID and GUS-YFP-TbID properly accumulate in the leaves of N. benthamiana plants, both represented by bands corresponding to about140KDa (Figure 1A, upper panel). When compared with their GFP-tagged versions, the absence of the TbID enzyme of approximately 37KDa in molecular weight was reflected by the faster migration of the corresponding bands (Figure 1A, upper panel). Immunoblotting of the isolated proteins with anti-Myc antibodies evidenced that the NbSOBIR1-YFP-TbID fusion protein, like its GFP-tagged version, constitutively interacts with the Cf-4-Myc fusion protein (Figure 1A, second panel from above). However, the anti-Myc antibodies also revealed strong signals from the GUS-Myc negative control co-purifying with NbSOBIR1-GFP and NbSOBIR1-YFP-TbID (Figure 1A, second panel from above), and from Cf-4-Myc co-purifying with GUS-GFP and GUS-YFP-TbID (Figure 1A, second panel from above). This shows a need for further optimization of the protocol, as GFP- and Myc-tagged GUS accumulate at high levels in the total protein extract (Figure 1A, third and fourth panel from above). The intense band representing Cf-4-Myc co-purifying with GUS-YFP-TbID, suggests a limitation for the use of this TbID-tagged fusion protein as a negative control for further PL experiments. The behavior of SlBON1-YFP-TbID, which is a tagged version of a putative component of RLP / SOBIR1 receptor complexes, and YFP-YFP-TbID, which is a fusion protein that may function as an alternative negative control, were subsequently evaluated. For this purpose, C-terminally GFP- and YFP-TbID-tagged SlBON1 or -GUS, as well as YFP-YFP-TbID, were transiently co-expressed in N. benthamiana with C-terminally Myc-tagged SlBAK1 or -GUS. Again, two days after agroinfiltration, total protein extracts from the agroinfiltrated leaves were subjected to immunoprecipitation using GFP-trap agarose beads, and immunoblotting with anti-GFP antibodies revealed the accumulation of SlBON1-YFP-TbID and SlBON1-GFP as bands corresponding to about 140KDa and about 100KDa, respectively (Figure 1B, upper panel). The YFP-YFP-TbID fusion protein accumulated at a high level and was visible as a band at about 95KDa after the pull-down with GFP beads and in the input (Figure 1B, upper and third panel from above). However, after the pull-down, the main band was accompanied by a high number of additional bands, suggesting aggregation and degradation of the YFP-YFP-TbID fusion protein. Immunoblotting with anti-Myc antibodies failed to reveal proper evidence for an interaction between SlBON1-GFP, or SlBON1-YFP-TbID, and SlBAK1-Myc. This was likely because of the high accumulation level of GUS-Myc, as evidenced by the strong bands at 110KDa in the immunoprecipitated samples and in the total protein extract (input) (Figure 1B, second and fourth panel from above). Bands at about 110KDa indicating SlBAK1-Myc co-purifying with SlBON1-GFP and with SlBON1-YFP-TbID, were only very faint in comparison with the bands corresponding to the negative control, GUS-Myc. Therefore, to visualize the band corresponding to SlBAK1-Myc, co-purifying with SlBON1-YFP-TbID, it was even necessary to expose the blot for a longer time (Figure 1B, second panel from above). Overall, these results show that the different bait-YFP-TbID fusion proteins do successfully accumulate upon their transient expression in N. benthamiana. However, the high level of the background signals from the negative controls, suggesting that the protein-protein interactions that we observe are not all specific, prevents the drawing of strong conclusions about a possible interference of the TbID enzyme with the protein-protein interactions in which the bait proteins are anticipated to be involved. The TbID element present in the various fusion proteins is enzymatically active in N. benthamiana To evaluate whether the YFP-TbID-tagged bait proteins can be used as a tool to identify interacting candidates of the Cf-4 / SOBIR1 receptor complex, it will be necessary to first test whether the TbID element is capable to biotinylate known interactors of the complex. The TbID enzyme produces a biotinylation cloud with a radius of at least about 35nm (May et al., 2020. Cells 9: 1070). Hence, besides the ability to self-biotinylate, the bait-YFP-TbID fusion proteins are expected to biotinylate proteins that are present in their vicinity. The biotinylation of Myc-tagged SlBAK1 by the NbSOBIR1-YFP-TbID fusion protein was tested first. Although BAK1 is specifically recruited to the Cf-4 / SlSOBIR1 complex upon Avr4 perception (Postma et al., 2016. New Phytol 21: 627–642; van der Burgh, 2018. Thesis. Wageningen University), BAK1 is expected to be in the proximity of our bait protein, SOBIR1, also in the pre-activation state. This was anticipated, as when transiently expressed in N. benthamiana, SlSOBIR1 co-purifies with SlBAK1, independently of the presence of Avr4 (Postma et al., 2016. New Phytol 210: 627–642). Therefore, the biotinylation assays were performed in a N. benthamiana line stably expressing the Cf-4 transgene (N. benthamiana:Cf-4), either in the presence or absence of Avr4. For this, YFP-YFP-TbID, GUS-YFP-TbID, NbSOBIR1-GFP, and NbSOBIR1-YFGP-TbID were all transiently expressed in N. benthamiana, together with SlBAK1-Myc. Two days after agroinfiltration, the leaves were infiltrated with a biotin solution at a concentration of 200μM. Three hours after the infiltration of biotin, the leaves were infiltrated again with either a solution containing Avr4 or MilliQ water (MQ) and harvested one hour later. Total protein extracts from the harvested leaves were desalted to remove the free biotin, after which the extracts were incubated with streptavidin coated magnetic beads to capture the biotinylated proteins, followed by immunoblotting of the captured proteins. When developing the blot with anti GFP antibodies, the YFP-YFP-TbID and GFP-YFP-TbID fusion proteins were visible as bands at about 95KDa and 140KDa, respectively (indicated in Figure 2A, upper panel). NbSOBIR1-YFP-TbID was visible as a faint band that needed a longer exposure time to become clearly visible (see the rectangles in Figure 2A, upper panel). Together with the absence of NbSOBIR1-GFP on the blot, this result shows that the different YFP-TbID-tagged bait proteins do self-biotinylate when expressed in N. benthamiana. When developing the blot with anti-Myc antibodies, bands at about 110KDa, corresponding with SlBAK1-Myc, revealed that all the YFP-TbID-tagged fusion proteins biotinylated SlBAK1-Myc (Figure 2A, second panel from above). Biotinylation of SlBAK1-Myc by NbSOBIR1-YFP-TbID was detected independently of the presence of Avr4. However, the procedure was found to be not specific enough, as SlBAK1-Myc was also biotinylated by the fusion proteins YFP-YFP-TbID and GUS-YFP-TbID, which were included as negative controls. In a second assay, the time between the infiltration of biotin and the harvesting of the leaves was reduced from four hours to one hour and included tests in which biotin was not infiltrated. This was all done to render the biotinylation process more specific. It was also decided not to infiltrate the Avr4 protein, and to reduce the amount of the suspension of streptavidin-coated beads that are used to recover the biotinylated proteins from the total protein extract by half (from 100 μL to 50 μL of suspension per sample). Furthermore, the tomato BON1 protein was included. Two days after agroinfiltration for transient expression of YFP-YFP-TbID, GUS-YFP-TbID, NbSOBIR1-GFP, NbSOBIR1-YFP-TbID, SlBON1-GFP and SlBON1-YFPTbID, together with SlBAK1-Myc in N. benthamiana, a biotin solution was infiltrated at 200 μM and the leaves were harvested after one hour. In addition, two samples include agroinfiltration of GUS and NbSOBIR1, both tagged with YFP-TbID and co-expressed with SlBAK1-Myc, but not treated afterwards with the biotin solution. Upon total protein extraction plus removal of free biotin, again a streptavidin pull-down and immunoblotting were performed. Developing of the blot with anti-GFP initially only detected the bands corresponding to YFP-YFP-TbID and GUS-YFP-TbID (Figure 2B, upper panel). Again, self-biotinylation of NbSOBIR1-YFP-TBID and SlBON1-YFP-TbID was detected as faint bands after a longer exposure time (Figure 2B, upper panel), suggesting low levels of self-biotinylation. Developing of the blot with anti-Myc antibodies revealed that SlBAK1-Myc was biotinylated by NbSOBIR1-YFP-TbID and by SlBON1-YFP-TbID (Figure 2B, second panel from above). The reduction of the time in between the infiltration of the biotin solution and the harvest of the plant material for total protein extraction, has successfully improved the specificity of the procedure, as among the treatments in which biotin was infiltrated prior to harvesting the plant material, co-expression of SlBAK1-Myc with YFP-YFP-TbID or GUS-YFP-TbID only resulted in faint bands (Figure 2B, second panel from above). These bands were very faint when compared with the bands resulting from the co-expression of SlBAK1-Myc with NbSOBIR1-YFP-TbID or with SlBON1-YFP-TbID, indicating that only in the latter case substantial biotinylation took place. Analysis of the samples that originated from leaf material that was not supplemented with biotin revealed that the different YFP-TbID-tagged bait proteins can sufficiently biotinylate proximal proteins by using only the endogenous biotin that is present in the leaves of N. benthamiana. Not infiltrating any additional biotin resulted in a more specific biotinylation process, as there was no band visible indicating biotinylation of SlBAK1-Myc by GUS-YFP-TbID (Figure 2B, second panel from above). This protocol was subsequently tested with two additional YFP-TbID-tagged bait proteins. One of the baits is based on LOW TEMPERATURE-INDUCED PROTEIN 6B (LTI6b), which is a small transmembrane protein that is commonly used as a PM-localized negative control (Arora et al., 2020. Plant Cell 32: 3388-3407; Kurup et al, 2005. Plant J 42: 444–453; Cutler et al., 2000. Proc Natl Acad Sci USA 97: 3718–3723; Ghareeb et al., 2016. Front Plant Sci 7: 1–15; Lee et al., 2020. Nat Commun 11: 1838), and another one is based on the tomato RLP Cf-4 that matches Avr4 (Joosten et al., 1994. Nature 367: 384–386; van den Burg et al., 2006. Mol Plant-Microbe Interact 19: 1420–1430; de Wit, 2016. Annu Rev Phytopathol 54: 1–23). After generating the expression constructs, the constructs GUS-YFP-TbID, YFP-YFP-TbID, LTI6b-YFP-TbID, LTi6b-GFP, Cf-4-YFP-TbID and Cf-4-GFP, were agroinfiltrated all in combination with SlBAK1-Myc, in N. benthamiana. Two days after agroinfiltration, the leaves were infiltrated with a biotin solution at 200 μM and harvested after one hour. Total protein extracts from the infiltrated leaves were first desalted to remove the free biotin, and then separated into two halves, of which one half was incubated with GFP-trap beads (for a GFP pull-down) and the other half was incubated with streptavidin-coated beads (for a streptavidin pull-down of the biotinylated proteins). Immunoblotting with anti-GFP antibodies of the GFP pull-downs evidenced the expression of the GUS-YFP-TbID and YFP-YFP-TbID bait proteins (arrows, Figure 2C, upper panel), whereas the LTI6b-YFP-TbID fusion protein was visible as a band corresponding to about 74KDa (Figure 2C, upper panel), and LTI6b-GFP was visible as a lower band corresponding to about 34KDa (Figure 2C, upper panel). The YFP-TbID- and GFP-tagged versions of Cf-4 needed a longer exposure time to become visible and appeared as bands corresponding to 190Kda (Figure 2C, upper panel) and to about 150KDa (Figure 2C, upper panel), respectively. These results show that also YFP-TbID-tagged LTI6b and the Cf-4 fusion proteins properly accumulate in leaves of N. benthamiana upon their transient expression. In order to reveal a possible interaction of the various transiently expressed proteins with SlBAK1-Myc and its resulting biotinylation, the fractions of the total protein extracts that were subjected to a streptavidin pull-down were analyzed by immunoblotting using anti-Myc antibodies. The results revealed that SlBAK1-Myc was biotinylated by Cf-4-YFP-TbID, and also by the negative control LTI6b-YFP-TbID, albeit to a much lower level (Figure 2C, second panel from above). In this experiment, biotinylation of SlBAK1-Myc by the negative controls GUS-YFP-TbID and YFP-YFP-TbID was not detected. These results show that the YFP-TbID-tagged bait proteins properly accumulate in N. benthamiana and in the case of Cf-4 specifically biotinylates proteins in its vicinity. The results also show that, even in the absence of Avr4 perception by Cf-4, SlBAK1-Myc localizes in the proximity of Cf-4-YFP-TbID when transiently co-expressed in N. benthamiana. All together, these results indicate that the various YFP-TbID-tagged fusion proteins that have been generated, can covalently attach biotin to other proteins that are present in their vicinity. Also, the results confirm previous reports indicating that a long labelling time after the infiltration of the biotin solution affects the specificity of the biotinylation process (Gingras et al., 2019. Curr Opin Chem Biol 48: 44–54; Kim et al., 2019. bioRxiv 636324). NbSOBIR1-YFP-TbID and Cf-4-YFP-TBID fusion proteins retain their biological function, as they mediate the Avr4-triggered hypersensitive response (HR) and reactive oxygen species (ROS) burst. It was subsequently investigated whether the NbSOBIR1-YFP-TbID and Cf-4-YFP-TbID fusion proteins are still immune signaling-competent. The capacity of NbSOBIR1-YFP-TbID to complement N. benthamiana:Cf-4 sobir1(-like) knock-out plants was evaluated. This is a N. benthamiana line that stably expresses the Cf-4 transgene, and in which SOBIR1 and its close paralog SOBIR1-like were knocked out by CRISPR / Cas technology (Huang et al., 2021. Plant Physiol 185: 290–294). NbSOBIR1-YFP-TbID and NbSOBIR1-GFP were transiently expressed by agroinfiltration, together with either Avr4 or Avr9, after which the leaf tissue was visualized by red light imaging (Landeo Villanueva et al., 2021. Mol Plant Pathol 22: 361–372) at six days after agroinfiltration. Clear evidence of a hypersensitive response (HR) was observed upon co-expression of each of the fusion proteins together with Avr4, but not with Avr9 or upon the expression of Avr4 alone (Figure 3A). The capacity of these fusion proteins to restore the Avr4-triggered production of reactive oxygen species (ROS) in the apoplast was also evaluated. This ROS burst is an early downstream response upon immune activation that is not strictly coupled with the development of an HR. For this purpose, NbSOBIR1-YFP-TbID, NbSOBIR1-GFP and the GUS-GFP negative control were transiently expressed in N. benthamiana:Cf-4 sobir1(-like) knock-out plants and the Avr4-triggered ROS burst was monitored two days after agroinfiltration, using a luminol-based assay. While the expression of both NbSOBIR1 fusion proteins restored the typical biphasic Avr4-triggered ROS burst, expression of GUS-GFP only caused a basal generation of ROS, likely because of priming of the tissue due to perception of the infiltrated Agrobacterium (Figure 3B). The capacity of the Cf-4-YFP-TbID fusion protein to activate immune responses upon recognition of Avr4 was subsequently evaluated. For this, Cf-4-GFP and Cf-4-YFP-TbID, together with either Avr4 or Avr9, were transiently expressed in leaves of N. benthamiana wild-type (WT) plants. The tissue was visualized by red-light imaging (Landeo Villanueva et al., 2021. Mol Plant Pathol 22: 361–372) at six days after agroinfiltration, and a clear HR was observed when Cf-4-GFP and Cf-4-YFP-TbID were expressed together with Avr4, but not when expressed with Avr9 or when Avr4 was expressed alone (Figure 3C). As for NbSOBIR1, the capacity of the Cf-4 fusion proteins to trigger a ROS burst upon perception of Avr4 was also monitored. For this, Cf-4-GFP, Cf-4-YFP-TbID and the negative control GUS-GFP were transiently expressed in N. benthamiana WT plants, and the capacity of the leaves to generate an Avr4-triggered ROS burst at two days after agroinfiltration was monitored. Expression of both Cf-4-GFP and Cf-4-YFP-TbID resulted in the production of the typical biphasic Avr4-triggered ROS burst, while the expression of GUS-GFP again resulted in a basal production of ROS, probably because of the perception of Agrobacterium (Figure 3D). Altogether, these results show that the NbSOBIR1-YFP-TBID and Cf-4-YFP-TbID fusion proteins are signaling-competent, in addition to being able to biotinylate their signaling partners when transiently expressed in N. benthamiana. Transient expression of secreted Avr4-YFP-TbID results in biotinylation of Cf-4-Myc in N. benthamiana It was subsequently evaluated whether proximity-dependent labelling can also be applied in the apoplast of the leaves of N. benthamiana. For this purpose, a YFP-TbID-bait fusion protein was generated, containing the primary translation product of the Avr4 gene of 135 amino acids. The resulting fusion protein contains the original fungal Avr4 signal peptide for extracellular targeting (Joosten et al., 1994. Nature 367: 384–386). To evaluate whether proper expression and secretion of the Avr4 fusion protein in the apoplast of N. benthamiana leaves takes place, apoplastic fluid (AF) was isolated of the leaves at three days after agroinfiltration of the Avr4-YFP-TbID construct. SDS-PAGE, followed by immunoblotting of the proteins present in the AF with anti-TbID antibodies confirmed proper secretion of the intact fusion protein into the apoplast, as a band at about 80KDa was present, indicating the accumulation of Avr4-YFP-TbID (Figure 4A). The presence of several bands representing faster migrating proteins that were also detected with the anti-TbID antibodies, suggested that there is degradation of the fusion protein taking place in the apoplast. These bands included one at about 70KDa, corresponding with the mass of the -YFP-TbID fragment (Figure 4A), and another band at about 36KDa that corresponds with the predicted mass of the TbID element itself (Figure 4A). This AF was infiltrated into N. benthamiana:Cf-4 and N. benthamiana wild-type plants. Two days after infiltration, the N. benthamiana:Cf-4 plants showed symptoms of chlorosis in the infiltrated areas, while the wild-type plants showed no response to the AF (upper panel, Figure 4B). Red-light imaging of the infiltrated leaves evidenced that the AF indeed triggers a cell death response in N. benthamiana:Cf-4 but not in N. benthamiana wild-type plants (lower panel, Figure 4B). It was then tested whether biotinylation of Cf-4-Myc takes place by the Avr4-YFP-TbID fusion protein, which would suggest that Cf-4 and Avr4 interact, either directly or indirectly. For this purpose, Avr4-YFP-TbID together with either Cf-4-Myc or FLS2-Cf-9-Myc were transiently co-expressed. FLS2-Cf-9-Myc is a chimeric protein resulting from fusing the extracellular LRR domain of FLS2 to the transmembrane and cytoplasmic portion of the RLP Cf-9. FLS2-Cf-9-Myc was used as a negative control for the specificity of the biotinylation process, as this protein also accumulates at the PM and interacts constitutively with SOBIR1 in N. benthamiana, but is not expected to interact with Avr4-YFP-TbID (Wu et al., 2019, Mol Plant Pathol 20: 751–764). Two days after agroinfiltration, the leaves were infiltrated with a solution containing 200 μM of biotin and they were harvested one hour later. Total protein extracts were desalted to remove the free biotin from the samples, subsequently incubated with streptavidin-coated beads, after which the precipitate was analyzed by immunoblotting. Development of the blot with anti-GFP antibodies showed a band at about 80KDa, corresponding to the Avr4-YFP-TbID fusion protein which was self-biotinylated. Development of blot with anti-Myc antibodies revealed that Cf-4-Myc was biotinylated by Avr4-YFP-TbID as it had been captured by the streptavidin-coated beads, whereas FLS2-Cf-9-Myc was not biotinylated by Avr4-YFP-TbID as a band representing the FLS2-Cf-9-Myc fusion protein was not visible (Figure 4C). All together, these results show that Avr4 appears to have either direct or indirect affinity for Cf-4, but not for FLS2, and that it is possible to specifically biotinylate plant cell-surface receptors in the apoplast using TbID-tagged versions of the matching secreted effector proteins. After confirmation of the expected interaction of Avr4-TbID with the Cf-4 receptor upon their transient co-expression in N. benthamiana, we aimed to determine whether Avr4-TbID and XEG1-TbID are able to biotinylate their matching endogenous receptors, being Cf-4 and RXEG1 (RLP), respectively, upon their transient expression in stably transformed N. benthamiana:Cf-4. As illustrated in Figure 5, both Avr4 and XEG1 (xyloglucanase) are biotinylated themselves, as they were present among the proteins captured with the streptavidin-coated beads, while Avr4 also biotinylates its corresponding receptor Cf-4, and XEG1 biotinylates its corresponding receptor RXEG1. Interestingly, XEG1 also biotinylates SOBIR1, a known interactor of RXEG1. Avr4-YFP-TbID also specifically biotinylates its endogenous receptor Cf-4 in S. lycopersicum cultivar MM-Cf-4 As shown in Figure 6, the Avr4-TbID fusion protein, when transiently expressed in MM-Cf-4 tomato leaves, significantly enriched its receptor Cf-4, as a result of Cf-4 biotinylation. Furthermore, Avr2-TbID and XEG1-TbID, that were included as negative controls, did not biotinylate Cf-4. Overall the results indicate that any effector-TbID fusion protein is in theory able to biotinylate its matching receptor in tomato. Moreover, Avr2-TbID biotinylates the secreted protease RCR3, which was earlier published to be required for recognition of Avr2 by Cf-2. In fact, Avr2 is a protease inhibitor that is secreted by F. fulva and it interacts with RCR3 to inhibit its activity. The Avr2 / RCR3 complex is subsequently "sensed" by Cf-2, which then mounts the immune response. These results show the ability of an effector-TbID fusion to specifically identify the corresponding endogenous immune receptor, and demonstrate that this should be possible for other unknown receptors in plants, using a known effector that is recognized by said plant. As mentioned, the apoplast is a harsh environment in which secreted proteases of the host plant degrade extracellular effectors of invading pathogens. The secreted effectors Avr9 and Avr4 of F. fulva are, for example, processed by extracellular proteases, whereas affinity tags are also easily removed as a result of extracellular protease activity. To test whether inhibition of extracellular proteases would increase recombinant effector protein accumulation, we transiently co-expressed the extracellular protease inhibitor 1 (EPI1) of the oomycete pathogen Phytophthora infestans with Avr4-YFP-TurboID and observed that the accumulation of this affinity-tagged protein significantly increased in the apoplast (Figure 7). EPI1 specifically inhibits subtilisin A, among major serine proteases, and inhibits and interacts with the pathogenesis-related P69B subtilisin-like serine protease of tomato in intercellular fluids.

Claims

Claims 1. A method of identifying plant proteins that interact with an effector protein or functional part thereof of a pathogen, the method comprising: a) providing a fusion protein comprising the effector protein, or functional part thereof, whereby the effector protein, or functional part thereof, is fused to a proximity-dependent biotinylation enzyme (PDBE); b) introducing the fusion protein into a tissue of a plant that is at least partially resistant to the pathogen, to thereby biotinylate a protein in proximity to the PDBE, wherein the fusion protein is introduced into the apoplast of the plant; c) capturing the biotinylated protein; and d) identifying the captured biotinylated protein.

2. The method of claim 1, wherein the fusion protein is transiently expressed in the plant tissue.

3. The method of claim 1 or 2, wherein the fusion protein is transiently expressed by Agrobacterium-mediated transient transformation.

4. The method of any one of claims 1-3, wherein the plant tissue is leaf tissue.

5. The method of any one of claims 1-3, wherein the plant tissue comprises leaf tissue.

6. The method of any one of claims 1-5, wherein the biotinylated protein is captured from apoplastic fluid (AF) that was isolated from the plant tissue.

7. The method of any one of claims 1-6, wherein the plant tissue is infiltrated with a solution comprising biotin or a derivative thereof, prior to the step of capturing the biotinylated protein.

8. The method of claim 7, wherein the plant tissue is infiltrated with the solution for a period of at most 2 hours.

9. The method of claim 7 or 8, wherein the plant tissue is further infiltrated with a solution comprising adenosine triphosphate (ATP), preferably further comprising a cofactor, such as MgCl2.

10. The method of any one of claims 1-9, wherein the PDBE comprises TurboID (TbID).

11. The method of any one of claims 1-10, wherein the captured biotinylated protein is identified by mass spectrometry.

12. The method of claim 1 or 5, wherein the fusion protein is obtained from a second plant expressing the fusion protein.

13. The method of claim 12, wherein the second plant is of the same species as the plant into which the fusion protein is introduced.

14. The method of claim 12 or 13, wherein the second plant expresses the fusion protein in the apoplast of the second plant.

15. The method of any one of claims 12-14, wherein the fusion protein is isolated from the second plant in the presence of a protease inhibitor.

16. The method of claim 15, wherein the protease inhibitor is phenylmethylsulfonyl fluoride (PMSF).

17. The method of any one of claims 12-16, wherein the fusion protein is isolated from the second plant in the presence of extracellular protease inhibitor 1 (EPI1), for example, from P. infestans.

18. The method of any one of claims 12-17, wherein the fusion protein is transiently expressed in the second plant.

19. The method of any one of claims 12-18, wherein the fusion protein is transiently expressed by Agrobacterium-mediated transient transformation.