Auto-expression broth and uses thereof
Patent Information
- Application Number
- EP2024886688
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-30
- Filing Date
- 2024-10-29
- Publication Date
- 2026-09-09
AI Technical Summary
Existing protein production methods, particularly in the T7 expression system, face challenges in scalability and reproducible expression under standard conditions, especially for certain proteins of interest, leading to cytotoxicity and low yields.
The development of an auto-expression broth, referred to as Bosco Broth (BB), which maximizes protein production by using a nitrogen source, buffering composition, inorganic salt mixture, carbon sources including glucose, galactose, and glycerol, and a trace element solution, enabling auto-expression of recombinant proteins without the need for an inducer.
BB facilitates higher expression of recombinant proteins compared to conventional autoinduction protocols, achieving yields 3-10 times higher, and improves production across a broad range of expression systems and E. coli strains, reducing cellular stress and increasing protein production efficiency.
Smart Images

Figure US2024053341_08052025_PF_FP_ABST
Abstract
Description
AUTO-EXPRESSION BROTH AND USES THEREOFRELATED APPLICATION INFORMATION
[0001] This application claims priority to U.S. Application No. 63 / 546,333 filed on October 30, 2023, the contents of which are herein incorporated by reference.STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under NIGMS grant P30 GM140963. The government has certain rights in the invention.SEQUENCE LISTING STATEMENT
[0003] The content of the electronic sequence listing titled UMT_43857_601_SequenceListing.xml (Size: 2,055 bytes; and Date of Creation: October 29, 2024) is herein incorporated by reference in its entirety.TECHNICAL FIELD|0004] The present disclosure relates to the field of protein expression and fermentation technology. An auto-expression broth and process of using the broth for the efficient expression of recombinant proteins of interest in a bacterial host is described. The broth and process produce high yields of recombinant proteins in a wide variety of expression systems.BACKGROUND|0005] The global protein production market, currently valued at approximately 400 billion USD annually, attributes nearly a third of this revenue to protein production in Escherichia coli[M]. The T7 expression system, developed by William Studier in 1986, represents a cornerstone of E. coli-based protein production processes due to its simplicity and cost-effectiveness[2-4]. Despite extensive optimization of the T7 expression system over the years, challenges in scalability and reproducible expression under standard conditions persist, particularly for certain proteins of interest (POI)[4, 5].
[0006] Central to the T7 system is the coupling of the cellular machinery that governs the lac operon in E. coli to the expression of the T7 RNA polymerase. This system is regulated by two main mechanisms: carbon catabolite repression of the transcriptional master regulator cyclic adenosine monophosphate (cAMP) receptor protein (CRP)[6, 7]and transcriptional repression by the lac repressor, Lad
[0810] CRP bound to cAMP enhances transcription, while glucose reduces the CRP- cAMP levels resulting in transcriptional downregulation[6]. Concurrently, LacI binds to the operator site of the lac operon, blocking transcription by RNA polymerase[101. Thus, high levels of lac operon expression only occur when two conditions are met: glucose levels are low, allowing transcriptional activation by CRP-cAMP; and lactose / allolactose levels are high, binding to LacI and inducingconformational changes that disrupt LacI binding to the lac operator and permit transcription[6, 7]. In BL21(DE3) E. coli, the integrated lac operator site upstream of the T7 polymerase genetic locus mediates activation of T7 RNA polymerase gene in response to the appropriate inducers
[0810] . T7 polymerase, now expressed, recognizes the T7 promoter on the plasmid carrying the POI open reading frame
[0810] . Notably, the T7 promoter is not recognized by the endogenous bacterial RNA polymerase, ensuring exclusive expression of the target POI in response to the inducers.
[0007] The two most widely employed inducers for T7 expression system, IPTG (Isopropyl B-D-l- thiogalactopyranoside) and lactose utilized in auto-expression protocols, activate T7 RNA polymerase expression through lac operon regulatory elements. Some alternative T7 induction systems include those induced by arabinose, rhamnose, and tetracycline[5], or leaky expression induced by the contaminant lactose found in tryptone[4]. Induction by IPTG, which is a galactose derivative that mimics allolactose and binds to LacI, directly lowers the ability of the lac repressor to bind to the lac operon, promoting robust protein expression. This method, while effective, can introduce cellular stress due to overwhelming levels of POI expression leading to cytotoxicity[11, 12]. Auto-expression alleviates cytotoxicity by using native regulatory mechanisms exploiting the sequential utilization of glucose and alternative carbon sources like lactose or galactose. The production of POIs occurs as the cell naturally transitions from glucose to secondary carbon sources like lactose, which induces the lac operon[1 2, 4]. Auto-expression not only aligns with the cell's metabolic state but also reduces stress, as it avoids the abrupt changes induced by high levels of protein expression when IPTG is added acutely[2]. Given that auto-expression proves generally more effective and less stressful for the cells, particularly when expressing cytotoxic proteins[2, 4I, there is a need in the art for solutions to maximize protein production using auto-expression.SUMMARY|0008] Aspects of the present disclosure relate to compositions and methods related to an autoexpression broth used to produce high density bacterial overexpression cultures for recombinant protein production. In some aspects, the compositions and methods of the present disclosure maximize protein production using auto-expression. To address bottlenecks within the protein production workflow brought on by low yields of challenging proteins of interest (POIs), the present disclosure provides, in some aspects, an auto-expression broth (referred to herein as Bosco Broth (BB)). Surprisingly, the work described in the examples herein demonstrate that BB facilitates higher expression of POIs compared with conventional autoinduction protocols12 4]. The work described herein further unexpectedly demonstrates that BB improves production for a broad range of expression systems and E. coli strains, expanding upon the current T7 system by utilizing galactose rather than conventional lactose as an inducer for auto-expression.
[0009] BB-powered auto-expression can be used for diverse protein production processes relevant for academic research and the biotechnology industry. For example, the exemplary broth compositions described herein surprisingly and unexpectedly allow the user to improve protein production yields by 3-10 fold, dependent upon the protein being produced, over conventional protein expression broths using state of the art expression systems. The user is thus able to focus time and resources on research experiments and ultimately complete the research or biologic therapy production protocol faster. Furthermore, due to an increase in production on a volume weighted basis, the financial costs associated with necessary reagents used in bacterial protein overexpression are decreased. Significantly, the fold change in total production is 3-10 fold which can immediately allow the user to redirect resources towards other projects and / or research and development.
[0010] Thus, in one embodiment, disclosed herein is an auto-expression broth for a bacterial host cell protein expression system, comprising:
[0011] (a) a nitrogen source;
[0012] (b) a buffering composition in an amount effective to maintain a pH between 6.5 and 7.5;
[0013] (c) an inorganic salt mixture;
[0014] (d) a carbon source comprising glucose, galactose, glycerol in amounts sufficient to support bacterial growth without suppressing protein expression, wherein the amount of galactose present in the broth is from about 1.5 to about 3 times the amount of glucose present in the broth and wherein the amount of glycerol present in the broth is between 5 and 15 times the amount of glucose present in the broth; and
[0015] (e) a trace element solution comprising one or more trace elements in concentrations sufficient to support bacterial growth and protein production, wherein the broth enables autoexpression of one or more recombinant proteins of interest in a bacterial host expression system without the addition of an inducer.
[0016] In another embodiment, the auto-expression broth further comprises a source of a citric acid cycle intermediate selected from the group consisting of citrate, isocitrate, alpha-ketoglutarate, succinyl-CoA, succinate, fumarate, malate, oxaloacetate, and combinations thereof.
[0017] In still another embodiment, in the auto-expression broth:
[0018] (i) the citrate is selected from the group consisting of sodium citrate, potassium citrate, calcium citrate, and combinations thereof;
[0019] (ii) the isocitrate is sodium isocitrate;
[0020] (iii) the alpha-ketoglutarate is selected from the group consisting of sodium alpha- ketoglutarate, calcium alpha-ketoglutarate, and combinations thereof;
[0021] (iv) the succinate is selected from the group consisting of sodium succinate, potassium succinate, calcium succinate, and combinations thereof;
[0022] (v) the fumarate is selected from the group consisting of sodium fumarate, potassium fumarate, and combinations thereof;
[0023] (vi) the malate is selected from the group consisting of sodium malate, calcium malate, magnesium malate, and combinations thereof; and
[0024] (vii) the oxaloacetate is selected from the group consisting of sodium oxaloacetate, potassium oxaloacetate, and combinations thereof.
[0025] In yet another embodiment, the source of the citric acid cycle intermediate is sodium citrate.
[0026] In still yet another embodiment, the auto-expression broth comprises up to about 6 g / L sodium citrate.
[0027] In still yet another embodiment, the nitrogen source comprises:|0028] (i) tryptone;10029] (ii) yeast extract; or
[0030] (iii) both (i) and (ii).
[0031] In still yet another embodiment, the nitrogen source comprises:
[0032] (i) from about 6 to about 30, from 8 to about 28, from 10 to about 26, or from 12 to about 24 g / L trypone;
[0033] (ii) from about 12 to about 60, from about 16 to 56, from about 20 to about 52, or from about24 to about 48 g / L yeast extract; or
[0034] (iii) both (i) and (ii).
[0035] In still yet another embodiment, the buffering composition comprises:
[0036] (i) potassium dihydrogen phosphate;
[0037] (ii) disodium phosphate; or
[0038] (iii) both (i) and (ii).
[0039] In still yet another embodiment, the buffering composition comprises:
[0040] (i) from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about13.6 g / L of potassium dihydrogen phosphate;
[0041] (ii) from about 5 to about 16 g / L, from about 6 to about 15 g / L, or from about 7.1 to about14.2 g / L of disodium phosphate, or
[0042] (iii) both (i) and (ii).
[0043] In still yet another embodiment, the inorganic salt mixture comprises:
[0044] (i) ammonium chloride;|0045] (ii) disodium sulfate;
[0046] (iii) magnesium sulfate; or
[0047] (iv) any combination of (i), (ii), and (iii).10048] In still yet another embodiment, the broth comprises:
[0049] (i) from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride;
[0050] (ii) up to about 1 g / 10 / L disodium sulfate;|0051] (iii) up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate; or
[0052] (iv) any combination of (i), (ii) and (iii).
[0053] In still yet another embodiment, the carbon source comprises:
[0054] (i) from about 1 to about 6.5, about 1.5 to about 6, about 2.0 to about 5.5, or from about 2.5 to about 5 g / L of glucose;
[0055] (ii) from about 2 to about 13, from about 3 to about 12, from about 4 to about 11, or from about 5 to about 10 g / L of galactose; and
[0056] (iii) from about 10 to about 65, from about 15 to about 60, from about 20 to about 55, or from about 25 to about 50 g / L glycerol;
[0057] In still yet another embodiment, the trace element solution comprises:
[0058] (i) copper sulfate;
[0059] (ii) ferrous sulfate, or
[0060] (iii) both (i) and (ii).
[0061] In yet another embodiment, the trace element solution comprises:
[0062] (i) at least two sources of iron;
[0063] (ii) a source of calcium;
[0064] (iii) a source of manganese;
[0065] (iv) a source of zinc;|0066] (v) a source of cobalt;
[0067] (vi) at least two sources of copper;
[0068] (vii) a source of nickel;
[0069] (viii) at least two sources of molybdenum; or|0070] (ix) a source of boron; and
[0071] (x) a chelator; and
[0072] (xi) any combination of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or all of (i)-(x).
[0073] In still yet another embodiment, in the auto-expression broth:
[0074] (i) the at least two sources of iron comprise ferrous chloride and ferrous sulfate;10075] (ii) the source of calcium comprises calcium chloride;|0076] (iii) the source of manganese comprises manganese chloride;
[0077] (iv) the source of zinc comprises zinc sulfate;
[0078] (v) the source of cobalt comprises cobalt chloride;
[0079] (vi) the at least two sources of copper comprise copper chloride and copper sulfate;
[0080] (vii) the source of nickel comprises nickel chloride;
[0081] (viii) the at least two sources of molybdenum comprise sodium molybdate and ammonium heptamolybdate;
[0082] (ix) the source of boron comprises boric acid; or|0083] (x) the chelator comprises EDTA.]0084] In yet another embodiment, the trace element solution comprises:
[0085] (i) from about 0.05 to about 0.15 M ferrous chloride;
[0086] (ii) from about 0.01 to about 0.03 M calcium chloride;
[0087] (iii) from about 0.03 to about 0.04 M manganese chloride;
[0088] (iv) from about 0.077 to about 0.097 M zinc sulfate;
[0089] (v) from about 0.077 to about 0.097 M cobalt chloride;
[0090] (vi) from about 0.001 to about 0.003 M copper chloride;
[0091] (vii) from about 0.001 to about 0.003 M nickel chloride;
[0092] (viii) from about 0.001 to about 0.003 M sodium molybdate;
[0093] (ix) from about 0.0079 to about 0.0279 M ferrous sulfate;
[0094] (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate;|0095] (xi) from about 0.086 to about 0.286 M boric acid;
[0096] (xii) from about 0.01 to about 0.10 M EDTA; or
[0097] (xiii) from about 0.0052 to about 0.0072 M copper sulfate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).10098] In yet another embodiment, the trace element solution comprises:|0099] (i) from about 0.05 to about 0.15 M ferrous chloride hexahydrate;
[0100] (ii) from about 0.01 to about 0.03 M calcium chloride;
[0101] (iii) from about 0.03 to about 0.04 M manganese chloride tetrahydrate;|0102] (iv) from about 0.077 to about 0.097 M zinc sulfate heptahydrate;
[0103] (v) from about 0.077 to about 0.097 M cobalt chloride hexahdyrate;
[0104] (vi) from about 0.001 to about 0.003 M copper chloride dihydrate;
[0105] (vii) from about 0.001 to about 0.003 M nickel chloride hexahydrate;|0106] (viii) from about 0.001 to about 0.003 M sodium molybdate tetrahydrate;|0107] (ix) from about 0.0079 to about 0.0279 M ferrous sulfate heptahydrate;
[0108] (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate tetrahydrate;
[0109] (xi) from about 0.086 to about 0.286 M boric acid;
[0110] (xii) from about 0.01 to about 0.10 M EDTA; or
[0111] (xiii) from about 0.0052 to about 0.0072 M copper sulfate pentahydrate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).|0112] In yet another embodiment, the trace element solution comprises:10113] (i) about 0.1 M ferrous chloride hexahydrate;
[0114] (ii) about 0.02 M calcium chloride;
[0115] (iii) about 0.35 M manganese chloride tetrahydrate;|0116] (iv) about 0.087 M zinc sulfate heptahydrate;|0117] (v) about 0.087 M cobalt chloride hexahdyrate;
[0118] (vi) about 0.002 M copper chloride dihydrate;
[0119] (vii) about 0.002 M nickel chloride hexahydrate;
[0120] (viii) about 0.002 M sodium molybdate tetrahydrate;
[0121] (ix) about 0.0179 M ferrous sulfate heptahydrate;
[0122] (x) about 0.0009 M ammonium heptamolybdate tetrahydrate;
[0123] (xi) about 0.186 M boric acid;
[0124] (xii) about 0.05 M EDTA; and
[0125] (xiii) about 0.0062 M copper sulfate pentahydrate.
[0126] In yet another embodiment, the auto-expression system further comprises an auto-expression component comprising an engineered bacterial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the bacterial host cell.
[0127] In yet another embodiment, disclosed herein is an auto-expression system for producing one or more recombinant proteins of interest, the system comprising:
[0128] (a) the auto-expression broth described above;
[0129] (b) an auto-expression component comprising an engineered bacterial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the bacterial host cell; and
[0130] (c) an instrument for measuring expression of the one or more recombinant proteins of interest.BRIEF DESCRIPTION OF THE DRAWINGS
[0131] The patent or application file contains drawings executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.|0132] Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying Figures, which are not necessarily drawn to scale, and wherein:
[0133] FIG. 1A, FIG. IB, FIG. 1C, FIG. ID, and FIG. IE show improved eGFP production in BB. FIG. 1A shows OD600 (log scale) of BL21(DE3) E. coli cultures expressing eGFP in different media through time. FIG. IB shows eGFP fluorescence (ex. 485 nm, em. 516 nm) of bacterial cultures with respect to time for varying media. Samples are the same as in panel a. FIG. 1C shows yields of purified eGFP from varying media at 36 hrs. FIG. ID shows eGFP fluorescence intensity normalized per cell density (OD600) or culture volume. The values in FIG. 1 A, FIG. IB, and FIG. ID represent averages of 3 replicate cultures, error bars are SD. eGFP fluorescence per culture volume values in each media were compared by one-way Anova with Brown-Forsythe and Welch post-test to the values obtained in TB. Asterisks denote statistical significance, **** P<0.00001, * P<0.01. These experiments were performed once. FIG. IE shows SDS-PAGE of soluble (S) and insoluble (I) fractions of eGFP-expressing cultures in different media, as indicated above each gel. The Ifeft panel of FIG. IE shows total protein stain-free detection. The right panel of FIG. IE shows detection of eGFP by a Western blot with anti-His-tag antibodies.
[0134] FIG. 2A, FIG. 2B, FIG. 2C, FIG. 2D, and FIG. 2E show co-expression of Hu-Cytc and yeast heme lyase in BB vs 2xYT. FIG. 1 A shows a schematic representation of the dual expression system that produces a functional Hu-Cytc enzyme. FIG. IB shows pelleted BL21(DE3) E. coli expressing Hu-Cytc. FIG. 1C shows total protein gel of a representative Hu-Cytc purification. FIG. ID shows total protein yield comparison between successful 2xYT replicates and BB. Plotted values represent averages of 3 replicates per media, error bars are SD. Protein yields were compared by t-test asterisks denote statistical significance ** P<0.001. FIG. IE shows Michaelis-Menten plots for Hu- Cytc produced in 2xYT
[0021] and BB, in red and purple, respectively. Plotted are average values from three technical replicates, error bars are SD. The solid curves fit to the Michaelis-Menten equation, and Michaelis-Menten parameters for the peroxidase activity of Hu-Cytc holoenzyme produced in 2xYT
[0021] and BB.
[0135] FIG. 3A, FIG. 3B, FIG. 3C, FIG. 3D, and FIG. 3E show that an exemplary auto-expression broth of the present disclosure (BB) allows a higher percentage of dual-expressing cells. FIG. 3A shows a schematic for the dual expression construct expressing mStayGold and mTagBFP2 fluorescent proteins. FIG. 3B shows flow cytometry profiles of dual-expressing E. coli cells in indicated media. Cells were divided into four subpopulations: mStayGold + (QI), mTagBFP2 + (Q3),dual -positive (Q2) and non-fluorescent (Q4). Frequency of each subpopulation is indicated in the corresponding gate. Representative analysis of one replicate for each media. FIG. 3C shows the average fraction of dual positive cells for three independent biological replicates for each media. Error bars are SD. Cell fractions were compared by one-way Anova, followed by Tukey post-test, asterisks denote statistical significance ** P<0.001. FIG. 3D shows the mean in-cell fluorescence intensity comparison for each fluorescent protein between media. FIG. 3E shows mean in-cell fluorescence intensity comparison between mStayGold and mTagBFP2 in each media. Plotted values in d and e are averages of three independent replicates and error bars are SD; d and e analyze the same data and are plotted separately for clarity. Analysis was done with two-way Anova, followed by Sidak’ s post-test asterisks denote statistical significance, *** P<0.0001, ** P<0.001, *P<0.01.
[0136] FIG. 4A, FIG. 4B, and FIG. 4C shows eGFP production from both auto-induction and auto-expression media in BL21(DE3) and SHuffle T7 Express 3029 E. Coli. FIG. 4A shows a workflow for an eGFP in-colony fluorescence assay experiment. FIG. 4B shows eGFP in-colony fluorescence levels with respect to carbon source and strain using defined media. Plotted are average values from 12-16 replicates per culture condition, error bars are SD. Relative fluorescence intensities for each strain were compared by one-way Anova followed by Kruskal- Wallis post-test, asterisks denote statistical significance **** P<0.00001, *** P<0.0001, * P<0.01. FIG. 4C shows in-cell fluorescence of eGFP in BL21(DE3) and SHuffle T7 Express 3029 E. coli in BB liquid cultures. This experiment was performed once.
[0137] FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D, and FIG. 5E show the production of disulfide bondcontaining NMDA receptor agonist binding domains in BB. FIG. 5A shows a schematic representing disulfide bonds (solid lines connecting pink bars denoting C420-C454, C436-C455, C744-C798) for GluNl and GluN2A agonist binding domains (ABDs) as seen in previous structural alignment
[0034] . FIG. 5B shows a cartoon representation of GluN l / GluN2A ABD heterodimer with glutamate bound to GluN2A and 7-chlorokynurenic acid (7-CKA) bound to GluNl. FIG. 5C shows chemical structures of competitive GluNl antagonists, 5,7-dichlorokynurenic acid (DCKA) and 7-CKA. FIG. 5D shows a ribbon diagram of GluNl (purple) / GluN2A (green) ABD heterodimer in complex with 7-CKA and glutamate (PDB 9DA9) rotated to show ligand-binding pockets. The top of FIG. 5E shows schematics of GluN2A / GluNl ABD heterodimers bound to DCKA / glutamate (red and blue, left) or to 7- CKA / glutamate (grey and purple, right). The bottom of FIG. 5E shows an overlay of DCKA / glutamate bound GluN2A / GluNl ABD heterodimer (PDB: 4NF4) with 7-CKA / glutamate bound GluN2A / GluNl ABD heterodimer (PDB 9DA9). Insets: zoomed in agonist binding pockets with bound ligands (also overlaid).
[0138] FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG. 6E, FIG. 6F and FIG. 6G show the production of enzymatically active SpCas9 in BB. The top of FIG. 6A shows SpCas9-siriusGFP schematic. The bottom of FIG. 6A shows total protein gel stained with Coomassie brilliant blue (CBB, left) or in-gelfluorescence (IGF, right) of purified SpCas9-siriusGFP. FIG. 6B shows a workflow for the genome editing experiment targeting ebony locus in Drosophila melanogaster. FIG. 6C shows a somatic mosaic frequency based on all survived, SpCas9 injected Fo flies. FIG. 6D shows pigmentation of WT Canton-S males, double balanced male ebony flies, and a mosaic male Fo. FIG. 6E shows germline transmission rate of the Cas9-induced mutation in 12 crosses (see also FIG. 10E). 3 / 15 surviving injected flies did not produce any progeny. FIG. 6F shows pigmentation of WT or double balanced ebony mutant female flies, a representative Fi female from a control cross (no SpCas9 injection), and a representative phenotype of an Fi female fly inheriting SpCas9 edit. FIG. 6G shows the percentage of mutants in Fi offspring across the Fo crosses with germline transmission. Plotted is the average, black triangles represent Fi mutant percentages in each cross, error bars are SD.
[0139] FIG. 7 shows purified recombinant Hu-Ctyc. Lane 1, 2xYT produced and purified Hu- Cytc, Lanes 2-4, BB produced and purified Hu-Cytc from three replicate cultures.
[0140] FIG. 8 shows dual expression of fluorescent proteins in E. coli cultured in BB, LB, and TB. The two fluorescent channels were imaged in the same field of view with the same settings. Left to right: mTagBFP2 channel, the mStayGold channel, and merged images. Scale bar represents 10pm.
[0141] FIG. 9 A, FIG. 9B, FIG. 9C and FIG. 9D show flow cytometry profiles of all replicates ofE. coli expressing mStayGold / mTagBFP2 and cultured in BB, LB, TB, along with background control cultured in BB, but not expressing fluorescent proteins. Intact single cells were gated based on forward and side scattering (right plots), and assigned to mStayGold +, mTagBFP2 +, dual-positive and non-fluorescent subpopulations (left plots). Frequency of each subpopulation is indicated in the corresponding gate.|0142] FIG. 10A, FIG. 10B, FIG. 10C, FIG. 10D and FIG. 10E show Cas9. FIG. 10A shows SpCas9-siriusGFP ODeoo through time, and siriusGFP fluorescence intensity measurements through time monitoring for SpCas9-siriusGFP expression. Low-temperature (18°C) growth resulted in an extended time required for biomass accumulation and initiation of auto-expression. FIG. 10B shows a schematic of ebony locus depicting guide target sequence and ebony coding regions. crRNA is in bolded text. FIG. 10C shows a visualization of fundamental stages of embryogenesis as they relate to the microinjection protocol. Embryos were injected posteriorly 80-100 minutes after deposition, within the syncytial time window, following the beginning of germline development but prior to cellularization. Developing somatic nuclei are represented as blue circles; posteriorly developing germline is represented in red. FIG. 10D shows confocal image depicting a successful microinjection with spCas9-siriusGFP visualization pseudo-colored cyan and d’, an unsuccessful microinjection with no spCas9-siriusGFP visualization. Scale bars represent 50pm. FIG. 10E shows visual representation of potential phenotypes observed at a gross level and all potential genotypes that could result from crossing an injected WT female with one edited allele to a double balanced male. *sp, TM2 and TM6b adult balancer phenotypes are not visible at a gross level.DETAILED DESCRIPTION10143] Aspects of the present disclosure relate to an auto-expression broth and process of using the broth for the efficient expression of recombinant proteins of interest in a microbial host (e.g., a bacterial host). The broth and process produce high yields of recombinant proteins in a wide variety of expression systems. The disclosure also relates to auto-expression systems, methods and kits using the auto-expression broths of the present disclosure.
[0144] The examples disclosed herein report the development of an exemplary auto-expression broth (named BB) that facilitates recombinant protein production without the necessity to add an acute inducer, thus improving upon the classic IPTG induction protocols. The refinement of media formulations for protein production in E. coli represents a critical area for enhancing efficiency, particularly in the context of the widely used T7 expression system. This system, developed in 1986, is renowned for its cost-effectiveness and ease of use, but it faces challenges in producing some proteins under standard conditions[2-4]. The development of BB marks an advancement in this field and enables improved yields, especially for proteins that have been historically difficult to express. BB achieved superior target protein yields compared to established media including LB, TB, 2XYT, ZYM, and MAGICMEDIA™. This increased efficiency is crucial for both reducing operational costs and accelerating research and development in biotechnological applications[4].
[0145] An important feature facilitating protein production in BB is its capacity to support high bacterial culture density, while maintaining robust output of the target protein (FIG. 1). BB-expressed eGFP was predominantly found in the soluble fraction, while established auto-induction media appeared to produce copious amounts of insoluble eGFP (FIG. 1). Without wishing to be bound by theory, it is believed that this reflects more efficient folding of the POI when produced in BB compared to other high-density cultures. BB's effectiveness extends beyond simple expression systems to more complex co-expression processes. For instance, tests using Hu-Cytc and yeast heme lyase in a co-expression system with BB showed a 100% success rate of POI expression, a marked improvement over the 50-60% success rate observed with traditional media. This consistency is particularly advantageous for research where reliable high-yield production of proteins like human cytochrome c has been a persistent challenge. Based on the dual-fluorescence reporter expression analyzed by flow cytometry, the increase in effectiveness of dual expression in BB results from a higher fraction of cells that can engage in simultaneous production of two POIs (FIG. 3B and FIG. 3C).
[0146] Single-cell analysis of E. coli simultaneously expressing two fluorescent proteins by flow cytometry suggested that despite significant increases of the fluorescent protein expression per cell in BB compared to LB and TB, the driving force for higher production levels was the larger fraction of cells producing mStayGold and mTagBFP2 in BB (FIG. 3C, FIG. 3D and FIG. 3E). Notably, E. colicultured in TB produced a disproportionate amount of mTagBFP2 relative to mStayGold compared to the other two media, suggesting that co-production of multiple POIs is sensitive to medium composition. Overall, BB was the superior media for dual expression, and simultaneous production of two proteins was optimal when cells were cultured in BB.
[0147] Surmounting another protein production challenge, BB in conjunction with SHUFFLE T7 Express E. coli was found effective for expression of disulfide bonded proteins. Correct folding of BB-produced, heterodimerized GluN l / GluN2A NMDA receptor agonist binding domains via X-ray crystallography, and structural analysis was validated (FIG. 5). This holds significant promise in future drug discovery and structural biology endeavors. The compatibility of BB with strains like SHUFFLE T7 Express, which are essential for producing proteins with correct disulfide bonds, further enhances its utility. BB could enable further protein production optimizations for pharmaceutical applications, including therapeutic biologic targets, which often require complex native disulfide bonding patterns for functionality[1].
[0148] The examples disclosed herein demonstrate the expansion of the potential use of BB beyond the commonly utilized BL21(DE3) strain of E. coli and provide conclusive evidence that galactose is an effective inducer in the SHUFFLE T7 system independent of contaminant carbon sources found in non-defined media (FIG. 4). The use of defined M9 medium, which lacks contaminants such as lactose, addressed previous ambiguities caused by undefined media components and enabled a definitive assessment of galactose's role in activating T7 expression[4, 30, 43, 44]. The mechanism through which galactose drives T7 expression system is still unknown. However, the results described in the examples herein demonstrate that galactose can be the main inducer carbon source, and in the case of SHUFFLE T7 Express, functions as a robust auto-expression molecule.
[0149] Notably, an exemplary auto-expression broth containing galactose as the inducer (as used in BB) led to a more robust expression in SHUFFLE T7 than that induced by lactose. The genetic background of SHUFFLE T7 Express, which lacks the lacZ gene due to the integration of T7 RNA polymerase at this site, clarifies why lactose was less potent compared to galactose or IPTG. In the absence of P-galactosidase (LacZ), conversion of disaccharide lactose into glucose, galactose, and allolactose is expected to be ineffective[30, 45].|0150] CRISPR-Cas9 and the genome editing process that is enabled by this protein has revolutionized molecular biology and biotechnology
[0037] . Despite steady progress in genome editing approaches, it is still challenging to produce apo-SpCas9 protein for downstream genetic engineering experiments or gene therapies. Therefore, commercially available SpCas9 is expensive. The work described in the examples herein addresses obstacles in SpCas9 production by increasing the final yield of purified, apo-SpCas9 >8-fold (Table 3, line 3 vs line 5). Notably, these high yields are achieved without compromising the purity of the enzyme (over 95%). While >95% purity of SpCas9 is not required for most research laboratory genome editing projects, more demanding gene editingapplications in mammalian model systems, or in gene and cell therapies require high-purity SpCas9 to be both cost-effective and feasible
[0046] . Final FDA approval for producing and purifying SpCas9 is still a notable barrier. Moreover, the production and purification of SpCas9 to be used in a clinical trial is costly and tedious. Generally, FDA approved therapeutic processes are orders of magnitude more complex to execute, and far more expensive. Production improvements on the order of ~8x observed for BB-produced SpCas9 in this study, can immediately reduce the effort and costs necessary to generate enough product. As a result, this accelerates pre-clinical gene editing programs, ultimately expediting acquisition of key data necessary for clinical trials.
[0151] Using multi-step protocols to improve SpCas9 purity typically leads to significant losses of the protein; therefore, in our yield comparisons we focused on the studies reporting -90% enzyme purity (Table 3). Overall, the work described in the examples herein demonstrates that using the exemplary auto-expression broth BB for protein expression demonstrated higher apo-SpCas9 protein production coupled with optimal purity. Moreover, the BB-expressed SpCas9 shows activity when tested in Drosophila melanogaster, thus confirming higher yields of an active enzyme from BB (FIG. 6).
[0152] A recent report described an alternative expression and purification protocol for efficient production of SpCas9 in complex with sgRNA (Cas9 RNP)
[0047] . This system relies on expression of both the SpCas9 ORF and the sgRNA from a single plasmid. Isolation of Cas9 RNP, while more productive, limits the application of the resulting enzyme to a single genetic target. By contrast, apo- SpCas9 allows the user to take advantage of modularity, which is one of the most powerful attributes found within CRISPR-Cas9 genome editing technology. Apo-SpCas9 can be assembled with various specific sgRNAs or entire libraries to facilitate diverse gene editing applications or screening. By comparison, utilizing Cas9 RNP requires the full workflow of cloning, plasmid validation, expression, and purification for each unique sgRNA. This will likely not provide a long-term, cost-effective solution for scalable gene cell therapy production, and is less efficient in research laboratory settings where scientists could design, order, and usually receive a new sgRNA reagent within a few days of the order being placed.
[0153] It is known that many of the proteins produced in the global protein production market are therapeutic proteins (biologies). Biologies often contain disulfide bonds, effectively creating a challenge for scalable production in microbial processes. Auto-expression media from the past have not been able to be used in scalable production in microbial systems in the SHuffle T7 strain family, where disulfide bonded proteins are the target product. BB is compliant with all cGMP production standards and can make biologies in Escherichia coli strains that are designed for proper disulfide bond coordination simultaneously. This has previously not been realized in the biotechnology industry. Notably, previously developed, lactose-based, expression media do not work within theSHuffle T7 production family, and lactose-based systems are also outcompeted by BB even when genetic compatibility exists.|0154] Notably, lactose-based media do not provide a cost effective, or scalable cGMP production capability due the usage of lactose. Lactose is broadly a mammalian specific sugar, and large-scale production of lactose for process scale-ups would not be cost effective. This is because most lactose products are from animal sources which do not work in cGMP production for human consumption per the Food and Drug Administration (FDA) requirements. In comparison, galactose which is found in the auto-expression broth BB described herein, is capable of being used in an animal free environment when used in industry / cGMP production systems. Galactose can readily be sourced from non-animal locations. Galactose can do this while being more cost effective compared to IPTG at comparable same production scales.
[0155] Overall, the work described in the examples herein demonstrates that the exemplary autoexpression broth BB not only addresses longstanding challenges of protein production in E. coli but also sets a new benchmark for the field, offering a versatile, efficient solution that can significantly impact both academic research and industrial biotechnology.
[0156] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.1. Definitions
[0157] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0158] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.
[0159] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0160] As used herein, “auto-expression broth” refers to a growth medium that promotes the inducible or constitutive expression of recombinant proteins in a microbial host cell system without the need for external inducers or manual intervention. The auto-expression broths of the present disclosure are designed to optimize conditions for the automatic initiation of protein expression during microbial growth, typically by incorporating specific nutrient compositions, pH control, or metabolic regulators that trigger the expression of a protein of interest in response to the physiological state of the microorganism. An auto-expression broth of the present disclosure may include, but is not limited to, components such as carbon sources, nitrogen sources, buffers, salts, vitamins, amino acids, trace elements, and other supplements that support microbial growth and ensure optimal conditions for protein expression. The auto-expression broths of the present disclosure may also include components that influence gene expression pathways in bacteria, yeast, or other host organisms.
[0161] A “buffering composition” refers to any compound, mixture, or formulation that is capable of maintaining and stabilizing the pH of an auto-expression broth within a desired range during microbial growth and protein expression. The buffering composition resists significant changes in pH when acids or bases are introduced, thereby providing optimal conditions for the recombinant production of proteins in microbial host cells. Examples of buffering compositions include, but are not limited to, phosphate buffers (e.g., sodium phosphate or potassium phosphate), Tris (tris(hydroxymethyl)aminomethane), HEPES (4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid), MOPS (3-(N-morpholino)propanesulfonic acid), citrate buffers, acetate buffers, and bicarbonate buffers.
[0162] As used herein, "Cas protein" (CRISPR-associated protein) refers to a class of proteins associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immune system found in prokaryotes such as bacteria and archaea. Cas proteins function as enzymes that target and cleave foreign nucleic acids, such as those from viruses or plasmids, through the guidance of CRISPR-derived RNA. They are an essential part of the CRISPR system's role in defense against genetic invaders, and some Cas proteins have been harnessed as powerful tools for genome editing due to their ability to induce double-strand breaks in DNA at specific locations guided by RNA. Examples of Cas proteins include, without limitation, Cas3, Cas4, Cas6, Cas9, Cas 10, Cas 12a, Casl2b, Casl3, Casl3a, and Casl4.
[0163] As used herein, a "chelating agent" refers to any compound or molecule that can form complexes with metal ions by binding to them through multiple coordination sites, thereby stabilizing the metal ions in solution. The chelating agent helps to control the availability and solubility of essential metal ions, such as iron, magnesium, zinc, and other trace elements, preventing them from precipitating or becoming biologically inactive. Chelating agents ensure that these ions remain in a bioavailable form for microbial host cells to use during growth and protein expression. Examples ofchelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citrate, nitrilotriacetic acid (NTA), and diethylenetriaminepentaacetic acid (DTP A).|0164] As used herein, an "engineered microbial host cell" refers to a microbial cell (such as a bacterium, yeast, or other microorganism) that has been genetically modified or manipulated to introduce, remove, or alter one or more genes to enable or enhance the production of recombinant proteins in an auto-expression broth. These modifications can include the incorporation of foreign DNA, deletion or silencing of native genes, or modifications that optimize cellular processes such as protein expression, metabolic efficiency, or growth rate. Engineered microbial host cells are specifically tailored for industrial, research, or biotechnological applications to produce desired proteins of interest or metabolites. Examples of engineered microbial host cells include, but are not limited to bacterial host cells, such as Corynebacterium glutamicum, Escherichia coli, Bacillus subtilis, Pseudomonas fluorescens, engineered fungal host cells, such as Aspergillus niger, Trichoderma reesei, and engineered yeast host cells, such as Hansenula polymorpha, Kluyveromyces lactis, Saccharomyces cerevisiae, Pichia pastoris, and, with introduced or modified expression systems for the production of therapeutic proteins, enzymes, or other biologically significant compounds.
[0165] As used herein, an “inorganic salt mixture” refers to a combination of inorganic compounds that dissociate into ions when dissolved in water, contributing to the osmotic balance, pH stabilization, and provision of essential ions for metabolic processes. The composition of the inorganic salt mixture may vary depending on the requirements of the microorganism or protein expression system, but may include salts that supply cations such as sodium (Na+), potassium (K+), magnesium (Mg2+), and / or calcium (Ca2+), as well as anions like chloride (Cl"), sulfate (SO "), phosphate (PO? ), and / or bicarbonate (HCOs ).10166] An "instrument for measuring expression of one or more recombinant proteins of interest" refers to any device, apparatus, or system capable of detecting, quantifying, or characterizing the presence, concentration, or activity of recombinant proteins produced in an auto-expression broth system. This instrument may use physical, chemical, or biological methods to assess protein expression, including but not limited to, the measurement of protein concentration, activity levels, purity, folding, or post-translational modifications. Examples of such instruments include, but are not limited to, UV-visible spectrophotometers, fluorescence readers, ELISA (enzyme-linked immunosorbent assay) systems, mass spectrometers, Western blot systems, HPLC (high-performance liquid chromatography), SDS-PAGE (sodium dodecyl sulfate -polyacrylamide gel electrophoresis) setups, qPCR machines for measuring mRNA levels related to protein expression, and biosensors designed to detect specific recombinant proteins.
[0167] As used herein, “nitrogen source” refers to any compound or mixture of compounds that provides nitrogen in a bioavailable form capable of supporting the growth and metabolism of bacterialcells. Suitable nitrogen sources may include, but are not limited to, organic nitrogen compounds such as amino acids, peptides, and proteins, as well as inorganic nitrogen compounds such as ammonium salts, nitrates, or urea. These nitrogen sources can be incorporated into the auto-expression broth to ensure optimal bacterial growth conditions and efficient recombinant protein production.
[0168] As used herein, a “peptone” is a complex mixture of water-soluble peptides and amino acids obtained by the partial hydrolysis of proteins. This hydrolysis may be achieved through enzymatic, acidic, or alkaline processes, breaking down the protein into smaller fragments that are easier for microorganisms to assimilate. Peptones can be derived from various protein sources, including casein, meat, soy, gelatin, and fish.
[0169] As used herein, a "protein of interest" refers to any recombinant protein that is targeted for production, purification, or study using an auto-expression broth system. This protein can be naturally occurring or synthetically designed and is typically expressed in a microbial host cell following genetic modification or introduction of a heterologous gene. The protein of interest may serve various purposes, including therapeutic use, industrial applications, enzyme catalysis, or scientific research. Examples of proteins of interest include, but are not limited to, enzymes, antibodies, hormones, growth factors, structural proteins, and antigens.
[0170] As used herein, "recovering" in the context of a protein of interest, refers to the processes or methods used to isolate, purify, or collect the protein after it has been expressed in a host cell or produced in an auto-expression broth. Recovering may involve multiple steps aimed at obtaining the protein in a form suitable for downstream applications, which may include analysis, therapeutic use, or further bioprocessing. The process of recovering can include physical, chemical, or enzymatic methods, depending on the nature of the protein and the production system. Examples of recovering steps include, but are not limited to cell harvesting, cell lysis, centrifugation and filtration, chromatographic purification, precipitation or ultrafiltration, and final polishing.10171] As used herein, a “source of boron” refers to any compound or composition that supplies boron ions (B3+or B in complex forms) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as cell wall stability, membrane function, and signal transduction. Boron plays a role in various cellular processes, particularly in bacterial growth. Examples of boron sources include, but are not limited to, boric acid (H3BO3), sodium borate (Na? BA)?), and boron citrate.|0172] As used herein, a “source of calcium” refers to any compound or composition that supplies calcium ions (Ca2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions, such as stabilizing cell walls, signaling, enzymatic activity, or promoting overall microbial health. Calcium may also play a role in buffering, protein expression, or structural integrity of cells. Examples ofcalcium sources include, but are not limited to, calcium chloride (CaCh), calcium sulfate (CaSC ), calcium carbonate (CaCCh), calcium phosphate (Ca3(PO4)2), and calcium lactate.|0173] As used herein, a “source of cobalt” refers to any compound or composition that supplies cobalt ions (Co2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as vitamin B12 biosynthesis, enzyme cofactor activity, and metabolic regulation. Cobalt is essential for various enzymatic reactions and plays a key role in cellular metabolism. Examples of cobalt sources include, but are not limited to, cobalt chloride (C0CI2), cobalt sulfate (CoSCh), and cobalt nitrate (CO(NO3)2).
[0174] As used herein, a "source of a citric acid cycle intermediate" refers to any compound or composition that supplies one or more intermediates of the citric acid cycle (also known as the Krebs cycle or tricarboxylic acid (TCA) cycle) to an auto-expression broth of the present disclosure. The intermediates can be used to influence cellular metabolism, regulate gene expression, or support microbial growth and protein production in host organisms such as bacteria, yeast, etc. Citric acid cycle intermediates play a role in energy metabolism, biosynthesis, and cellular signaling, and they can act as metabolic regulators in gene expression pathways. Examples of citric acid cycle intermediates include, but are not limited to, citrate, isocitrate, a-ketoglutarate, succinate, fumarate, malate, and oxaloacetate. A source of a citric acid cycle intermediate may provide these compounds directly or may consist of precursors that are metabolized into these intermediates within the cell.|0175] As used herein, a “source of copper” refers to any compound or composition that supplies copper ions (Cu2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as oxidative stress response, iron transport, and electron transport chain activity. Copper is a vital cofactor for redox reactions and contributes to energy metabolism. Examples of copper sources include, but are not limited to, copper sulfate (CuSCE), copper chloride (CuCE), and copper acetate. |0176] As used herein, a “source of nickel” refers to any compound or composition that supplies nickel ions (Ni2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as enzyme activity (e.g., urease and hydrogenase) and metabolism of gases. Nickel is critical as a cofactor in specific enzymatic systems, particularly in bacteria and archaea. Examples of nickel sources include, but are not limited to, nickel sulfate (NiSCE), nickel chloride (NiCh), and nickel nitrate (Ni(NOs)2).
[0177] As used herein, a “source of iron” refers to any compound or composition that supplies iron ions (Fe2+or Fe3+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support essential cellular functions such as electron transport, oxygen transport, enzymatic catalysis, and DNA synthesis. Ironis critical for various metabolic pathways, including those involved in energy production and oxidative stress response, and it may also contribute to protein expression and the overall health and growth of microbial cells. Examples of iron sources include, but are not limited to, ferric chloride (FeCE), ferrous sulfate (FeSCh), ferric ammonium citrate, ferric nitrate (Fe(NO3)3), and iron dextran.
[0178] As used herein, a “source of manganese” refers to any compound or composition that supplies manganese ions (Mn2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as antioxidant defense, enzyme activation, and protein synthesis. Manganese is critical for various enzymatic reactions, including those involved in metabolism and detoxification of reactive oxygen species. Examples of manganese sources include, but are not limited to, manganese sulfate (MnSCh), manganese chloride (MnCE), and manganese acetate.
[0179] As used herein, a “source of molybdenum” refers to any compound or composition that supplies molybdenum ions (Mo6+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as nitrogen fixation, sulfur metabolism, and detoxification of aldehydes. Molybdenum is an essential cofactor for certain enzymes, particularly those involved in redox reactions. Examples of molybdenum sources include, but are not limited to, sodium molybdate (NasMoC ) and ammonium molybdate ((NH^MOTOM).
[0180] As used herein, a “source of zinc” refers to any compound or composition that supplies zinc ions (Zn2+) to an auto-expression broth of the disclosure that can be used for the recombinant production of proteins in microbial host cells, for example, to support cellular functions such as enzyme catalysis, protein folding, and gene expression regulation. Zinc is a key cofactor for many enzymes, including those involved in DNA replication and transcriptional regulation. Examples of zinc sources include, but are not limited to, zinc sulfate (ZnSCh), zinc chloride (ZnCE), and zinc acetate.|0181] As used herein, a "trace element solution" refers to a composition containing one or more essential micronutrients, typically in the form of metal ions or other inorganic compounds, required in small quantities to support the growth, metabolism, and recombinant protein production of microbial host cells in an auto-expression broth. These trace elements serve as cofactors for enzymes, stabilize cellular structures, and regulate various biochemical pathways critical for optimal cellular function. Examples of trace elements in such solutions include, but are not limited to, iron (Fe2+or Fe3+), manganese (Mn2+), zinc (Zn2+), copper (Cu2+), cobalt (Co2+), molybdenum (Mo), boron (B), and nickel (Ni2+). The solution may also contain appropriate salts or chelating agents to ensure the solubility and bioavailability of these trace elements.
[0182] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill inthe art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.2. Compositions
[0183] Aspects of the disclosure relate to compositions comprising an auto-expression broth and related methods for using the broth for producing recombinant proteins in a microbial host cell expression system.
[0184] In an aspect, the disclosure provides an auto-expression broth for a microbial host cell protein expression system, comprising: (a) a nitrogen source; (b) a buffering composition in an amount effective to maintain a pH between 6.5 and 7.5; (c) an inorganic salt mixture; (d) a carbon source comprising glucose, galactose, glycerol in amounts sufficient to support microbial cell growth without suppressing protein expression, wherein the amount of galactose present in the broth is from about 1.5 to about 3 times the amount of glucose present in the broth and wherein the amount of glycerol present in the broth is between 5 and 15 times the amount of glucose present in the broth; and (e) a trace element solution comprising one or more trace elements in concentrations sufficient to support microbial growth and protein production, wherein the broth enables auto-expression of one or more recombinant proteins of interest in a microbial host expression system without the addition of an inducer.
[0185] The auto-expression broth of the present disclosure can be used for auto-expression in any microbial host cell, for example, archaea, bacteria, and yeast host cells. In some embodiments, the microbial host cell is an archaeal host cell protein expression system. In other embodiments, the microbial host cell is a bacterial host cell protein expression system. In still other embodiments, the microbial host cell is a yeast host cell protein expression system.
[0186] The auto-expression broth compositions of the present disclosure can also include compounds or compositions that are capable of influencing gene expression pathways in bacteria, yeast, or other host organisms. For example, an auto-expression broth of the present disclosure may include a source of a citric acid cycle intermediate. Exemplary sources of citric acid cycle intermediates of use herein include, but are not limited to, citrate, isocitrate, alpha-ketoglutarate, succinyl-CoA, succinate, fumarate, malate, oxaloacetate, or compounds or compositions that produce citrate, isocitrate, alpha-ketoglutarate, succinyl-CoA, succinate, fumarate, malate, oxaloacetate in the auto-expression broth or when taken up by a microbial host cell expression system in the presence of the source of the citric acid cycle intermediate, and any combinations thereof.
[0187] In some aspects, the citrate is selected from the group consisting of sodium citrate, potassium citrate, calcium citrate, and combinations thereof. In some embodiments, the source of citrate is sodium citrate. In other embodiments, the source of citrate is potassium citrate. In yet other embodiments, the source of citrate is calcium citrate. In some instances, the source of citrate comprises at least two sources of citrate selected from the group consisting of sodium citrate, potassium citrate, and calcium citrate. In other instances, the source of citrate comprises at least three sources of citrate selected from the group consisting of sodium citrate, potassium citrate, and calcium citrate. In some aspects, the source of the citric acid cycle intermediate is sodium citrate.
[0188] In some aspects, the isocitrate is selected from the group consisting of sodium isocitrate, potassium isocitrate, calcium isocitrate, magnesium isocitrate, and combinations thereof. In some embodiments, the source of isocitrate is sodium citrate. In other embodiments, the source of isocitrate is potassium citrate. In yet other embodiments, the source of isocitrate is calcium citrate. In some instances, the source of isocitrate comprises at least two sources of isocitrate selected from the group consisting of sodium isocitrate, potassium isocitrate, and calcium isocitrate. In other instances, the source of isocitrate comprises at least three sources of isocitrate selected from the group consisting of sodium isocitrate, potassium isocitrate, and calcium isocitrate.
[0189] In some aspects, the alpha-ketoglutarate is selected from the group consisting of sodium alpha-ketoglutarate, calcium alpha-ketoglutarate, potassium alpha-ketoglutarate, and combinations thereof. In some embodiments, the source of alpha-ketoglutarate is sodium alpha-ketoglutarate. In other embodiments, the source of alpha-ketoglutarate is calcium alpha-ketoglutarate. In yet other embodiments, the source of alpha-ketoglutarate is potassium alpha-ketoglutarate. In some instances, the source of alpha-ketoglutarate comprises at least two sources of alpha-ketoglutarate selected from the group consisting of sodium alpha-ketoglutarate, calcium alpha-ketoglutarate, potassium alpha- ketoglutarate. In other instances, the source of alpha-ketoglutarate comprises at least three sources of alpha-ketoglutarate selected from the group consisting of sodium alpha-ketoglutarate, calcium alpha- ketoglutarate, and potassium alpha-ketoglutarate.
[0190] In some aspects, the succinate is selected from the group consisting of sodium succinate, potassium succinate, calcium succinate, and combinations thereof. In some embodiments, the source of succinate is sodium succinate. In other embodiments, the source of succinate is potassium succinate. In yet other embodiments, the source of succinate is calcium succinate. In some instances, the source of succinate comprises at least two sources of succinate selected from the group consisting of sodium succinate, potassium succinate, and calcium succinate. In other instances, the source of succinate comprises at least three sources of succinate selected from the group consisting of sodium succinate, potassium succinate, and calcium succinate.
[0191] In some aspects, the fumarate is selected from the group consisting of sodium fumarate, calcium fumarate, potassium fumarate, and combinations thereof. In some embodiments, the sourceof fumarate is sodium fumarate. In other embodiments, the source of fumarate is calcium fumarate. In yet other embodiments, the source of fumarate is potassium fumarate. In some instances, the source of fumarate comprises at least two sources of fumarate selected from the group consisting of sodium fumarate, calcium fumarate, and potassium fumarate. In other instances, the source of fumarate comprises at least three sources of fumarate selected from the group consisting of sodium fumarate, calcium fumarate, and potassium fumarate.
[0192] In some aspects, the malate is selected from the group consisting of sodium malate, calcium malate, magnesium malate, and combinations thereof. In some embodiments, the source of malate is sodium malate. In other embodiments, the source of malate is calcium malate. In yet other embodiments, the source of malate is magnesium malate. In some instances, the source of malate comprises at least two sources of malate selected from the group consisting of sodium malate, calcium malate, and magnesium malate. In other instances, the source of malate comprises at least three sources of malate selected from the group consisting of sodium malate, calcium malate, and magnesium malate.
[0193] In some aspects, the oxaloacetate is selected from the group consisting of sodium oxaloacetate, calcium oxaloacetate, potassium oxaloacetate, and combinations thereof. In some embodiments, the source of oxaloacetate is sodium oxaloacetate. In other embodiments, the source of oxaloacetate is calcium oxaloacetate. In yet other embodiments, the source of oxaloacetate is potassium oxaloacetate. In some instances, the source of oxaloacetate comprises at least two sources of oxaloacetate selected from the group consisting of sodium oxaloacetate, calcium oxaloacetate, and potassium oxaloacetate. In other instances, the source of oxaloacetate comprises at least three sources of oxaloacetate selected from the group consisting of sodium oxaloacetate, calcium oxaloacetate, and potassium oxaloacetate.|0194] Any suitable amount of a citric acid cycle intermediate can be used in the auto-expression broths of the present disclosure. Exemplary amounts of citric acid cycle intermediates present in the broths of the disclosure include up to about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of citrate. In some embodiments, the auto-expression broth comprises up to about 6 g / L sodium citrate. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of isocitrate. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of alpha-ketoglutarate. In some aspects, the auto-expression broth compriseabout 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of succinate. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of fumarate. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of malate. In some aspects, the auto-expression broth comprise about 0.5 g / L, about 1 g / L, about 1.5 g / L, about 2 g / L, about 2.5 g / L, about 3 g / L, about 3.5 g / L, about 4 g / L, about 4.5 g / L, about 5 g / L, about 5.5 g / L, or up to about 6 g / L of a source of oxaloacetate.
[0195] The auto-expression broth compositions of the disclosure are not limited to any particular nitrogen source. Exemplary nitrogen sources of use in the auto-expression broth compositions of the disclosure include, but are not limited to, organic nitrogen sources, such as amino acids, peptones, yeast extracts, and hydrolysates, or inorganic nitrogen sources, such as ammonium compounds, nitrate compounds, and urea.
[0196] Exemplary amino acids include, glutamine, glutamate, arginine, cysteine, lysine, histidine, valine, leucine, isoleucine, methionine, glycine, alanine, tryptophan, phenylalanine, and threonine.
[0197] Exemplary peptones suitable for use as a nitrogen source include, but are not limited to, casein peptone, fish peptone, gelatin peptone, meat peptone, soy peptone (e.g., PHYTONE) , tryptone, whey peptone, yeast extract peptone.
[0198] Exemplary yeast extracts include, but are not limited to, Bactoyeast extract powder, autolyzed yeast extract, and hydrolyzed yeast extract.
[0199] Exemplary inorganic nitrogen sources include, but are not limited to, ammonium chloride (NELCl), ammonium sulfate ((NEL^SCL), ammonium phosphate (NEL^PCL, diammonium phosphate (DAP, (NH4)2HPO4), (NH ammonium carbonate (NILO2CO3, ammonium nitrate (NH4NO3), ammonium acetate (CHsCOONEL), ammonium bicarbonate (NELHCOs), and ammonium hydroxide (NH4OH).
[0200] Exemplary nitrate compounds include, but are not limited to, sodium nitrate (NaNOs), potassium nitrate (KNOs), and calcium nitrate (Ca(NO3)2).
[0201] In some embodiments, the nitrogen source comprises tryptone. In some embodiments, the nitrogen source comprises yeast extract. In some embodiments, the nitrogen source comprises tryptone and yeast extract.|0202] The nitrogen source can be present in the auto-expression broth in any amount that supports the growth and metabolism of bacterial cells. In some embodiments, the nitrogen source comprises from about 6 to about 30, from 8 to about 28, from 10 to about 26, or from 12 to about 24 g / L tryptone. In other embodiments, the nitrogen source comprises from about 12 to about 60, fromabout 16 to 56, from about 20 to about 52, or from about 24 to about 48 g / L yeast extract. In still other embodiments, the nitrogen source comprises from about 6 to about 30, from 8 to about 28, from 10 to about 26, or from 12 to about 24 g / L tryptone and from about 12 to about 60, from about 16 to 56, from about 20 to about 52, or from about 24 to about 48 g / L yeast extract.
[0203] Any suitable buffering composition can be used in the auto-expression broths of the present disclosure. In some aspects, the buffering composition comprises a phosphate buffer composition. In some embodiments, the buffering composition comprises potassium dihydrogen phosphate. In other embodiments, the buffering composition comprises disodium phosphate. In yet other embodiments, the buffering composition comprises potassium dihydrogen phosphate and disodium phosphate. In other aspects, the buffering composition comprises a Tris buffer composition.
[0204] In yet other aspects, the buffering composition comprises a HEPES buffer composition. In still other aspects, the buffering composition comprises a MOPS buffer composition. In yet still other aspects, the buffer composition comprises a citrate buffer composition. In certain aspects, the buffer composition comprises an acetate buffer composition. In certain other aspects, the buffer composition comprises a bicarbonate buffer composition.
[0205] Any suitable amount of buffering composition can be used in the auto-expression broths of the disclosure. Exemplary amounts of buffering composition include, without limitation, about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a buffering composition described herein. In some aspects, the buffering composition comprises about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a phosphate buffering composition described herein. In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of potassium dihydrogen phosphate. In other embodiments, the buffering composition comprises from about 5 to about 16 g / L, from about 6 to about 15 g / L, or from about 7.1 to about 14.2 g / L of disodium phosphate. In yet other embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of potassium dihydrogen phosphate and from about 5 to about 16 g / L, from about 6 to about 15 g / L, or from about 7.1 to about 14.2 g / L of disodium phosphate.|0206] In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a Tris buffer composition. In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a HEPES buffer composition In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a MOPS buffer composition. In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a citrate buffer composition. In someembodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of an acetate buffer composition In some embodiments, the buffering composition comprises from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of a bicarbonate buffer composition.
[0207] Any suitable inorganic salt mixture can be used in the auto-expression broths of the present disclosure. In some aspects, the inorganic salt mixture comprises ammonium chloride. In other aspects, the inorganic salt mixture comprises disodium sulfate. In yet other aspects, the inorganic salt mixture comprises magnesium sulfate. In still other aspects, the inorganic salt mixture comprises ammonium chloride and disodium sulfate. In still yet other aspects, the inorganic salt mixture comprises ammonium chloride, disodium sulfate, and magnesium sulfate.
[0208] Any suitable amount of inorganic salts may be present in the inorganic salt mixture for use in an auto-expression broth of the disclosure. In some aspects, the auto-expression broth includes from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride. In other aspects, the auto-expression broth includes up to about 1 g / 10 / L disodium sulfate. In yet other aspects, the autoexpression broth includes up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate. In still other aspects, the auto-expression broth includes from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride and up to about 1 g / 10 / L disodium sulfate. In yet still other aspects, the auto-expression broth includes up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate and up to about 1 g / 10 / L disodium sulfate. In certain other aspects, the autoexpression broth includes from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride, up to about 1 g / 10 / L disodium sulfate, and up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate.
[0209] The auto-expression broths of the present disclosure utilize carbon sources that enable recombinant microbial host expression systems to produce high levels of a protein of interest in the absence of an external inducer. In some aspects, the carbon source of the auto-expression broth comprises glucose, galactose, and glycerol in amounts sufficient to support microbial cell growth without suppressing protein expression. In an aspect, the carbon source comprises an amount of galactose present in the broth from about 1.5 to about 3 times the amount of glucose present in the broth, and an amount of glycerol present in the broth between 5 and 15 times the amount of glucose present in the broth.
[0210] In some aspects, the amount of glucose present in the broth is about 1.0, about 1.5, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, or about 10.0 g / L of glucose. In some embodiments, the amount of glucose present in the broth is from about 1 to about 6.5, about 1.5 to about 6, about 2.0 to about 5.5, or from about 2.5 to about 5 g / L of glucose. In other embodiments, the amount of glucose present in the broth is no more than 1 g / L, no more than 2 g / L, no more than 3g / L, no more than 4 g / L, no more than 5 g / L, no more than 6 g / L, no more than 7 g / L, no more than 8 g / L, no more than 9 g / L, or about no more than 10 g / L.|0211] In some aspects, the amount of galactose present in the broth is about 1.2, about 1.3, about1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.5, about 4.0, about4.5, or about 5.0 time the amount of glucose present in the broth. In some embodiments, the amount of galactose present in the broth is from about 2 to about 13, from about 3 to about 12, from about 4 to about 11, or from about 5 to about 10 g / L of galactose. In other embodiments, the amount of galactose present in the broth is about 1.0, about 1.5, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, about 10.0, about 11.0, about 11.5, about 12.0, about 12.5, about 13.0, about13.5, about 14.0, about 14.5, about 15.0, about 15.5, about 16.0, about 16.5, about 17.0, about 17.5, about 18.0, about 18.5, about 19.0, about 19.5, or about 20.0 g / L.
[0212] In some aspects, the amount of glycerol present in the broth is about 3.0, about 3.5, about 4, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, about 10.0, about 10.5, about 11, about 11.5, about 12.0, about 12.5, about 13.0, about 13.5, about 14.0, about 14.5, about 15.0, about 15.5, about 16.0, about 17.0, about 17.5, about 18.0, about 18.5, about 19.0, or about 20.0 times the amount of glucose present in the broth. In some embodiments, the auto-expression broth comprises about 10 to about 65, from about 15 to about 60, from about 20 to about 55, or from about 25 to about 50 g / L glycerol. In other embodiments, the auto-expression broth comprises about 1.0, about 1.5, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, about 10.0, about 11.0, about 11.5, about 12.0, about 12.5, about 13.0, about13.5, about 14.0, about 14.5, about 15.0, about 15.5, about 16.0, about 16.5, about 17.0, about 17.5, about 18.0, about 18.5, about 19.0, about 19.5, about 20.0 g / L, about 21.0, about 21.5, about 22.0, about 22.5, about 23.0, about 23.5, about 24.0, about 24.5, about 25.0, about 25.5, about 26.0, about26.5, about 27.0, about 27.5, about 28.0, about 28.5, about 29.0, about 29.5, about 30.0, about 31.0, about 31.5, about 32.0, about 32.5, about 33.0, about 33.5, about 34.0, about 34.5, about 35.0, about35.5, about 36.0, about 36.5, about 37.0, about 37.5, about 38.0, about 38.5, about 39.0, about 39.5, about 40.0 g / L, about 11.0, about 11.5, about 12.0, about 12.5, about 13.0, about 13.5, about 14.0, about 14.5, about 15.0, about 15.5, about 16.0, about 16.5, about 17.0, about 17.5, about 18.0, about18.5, about 19.0, about 19.5, about 20.0 g / L, about 21.0, about 21.5, about 22.0, about 22.5, about 23.0, about 23.5, about 24.0, about 24.5, about 25.0, about 25.5, about 26.0, about 26.5, about 27.0, about 27.5, about 28.0, about 28.5, about 29.0, about 29.5, about 30.0, about 31.0, about 31.5, about 32.0, about 32.5, about 33.0, about 33.5, about 34.0, about 34.5, about 35.0, about 35.5, about 36.0, about 36.5, about 37.0, about 37.5, about 38.0, about 38.5, about 39.0, about 39.5, about 40.0 g / L, about 41.0, about 41.5, about 42.0, about 42.5, about 43.0, about 43.5, about 44.0, about 44.5, about45.0, about 45.5, about 46.0, about 46.5, about 47.0, about 47.5, about 48.0, about 48.5, about 49.0, about 49.5, about 50.0 g / L, about 51.0, about 51.5, about 52.0, about 52.5, about 53.0, about 53.5, about 54.0, about 54.5, about 55.0, about 55.5, about 56.0, about 56.5, about 57.0, about 57.5, about 58.0, about 58.5, about 59.0, about 59.5, about 60.0, about 61.0, about 61.5, about 62.0, about 62.5, about 63.0, about 63.5, about 64.0, about 64.5, about 65.0, about 65.5, about 66.0, about 66.5, about 67.0, about 67.5, about 68.0, about 68.5, about 69.0, about 69.5, about 70.0, about 71.0, about 71.5, about 72.0, about 72.5, about 73.0, about 73.5, about 74.0, about 74.5, or about 75.0 g / L.
[0213] The auto-expression broths of the present disclosure can include one or more trace elements in concentrations sufficient to support microbial growth and protein production. Any suitable trace element or combination of trace elements can be used.
[0214] In some aspects, the auto-expression broth comprises a source of copper. In some aspects, the auto-expression broth comprises at least two sources of copper. In some aspects, the autoexpression broth comprises at least three sources of copper. Examples of copper sources include, but are not limited to, copper sulfate (CuSCL), copper chloride (CuCE), and copper acetate. In some embodiments, the trace element solution comprises copper sulfate. In other embodiments, the trace element solution comprises copper sulfate and ferrous sulfate.
[0215] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of iron. Examples of iron sources include, but are not limited to, ferric chloride (FeCL), ferrous sulfate (FeSCL), ferric ammonium citrate, ferric nitrate (Fe(NO3)s), and iron dextran. In some embodiments, the trace element solution comprises ferrous sulfate.
[0216] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of calcium. Examples of calcium sources include, but are not limited to, calcium chloride (CaCE), calcium sulfate (CaSCh), calcium carbonate (CaCOs), calcium phosphate (Ca3(PO4)2), and calcium lactate. In some embodiments, the source of calcium comprises calcium chloride.
[0217] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of manganese. Examples of manganese sources include, but are not limited to, manganese sulfate (MnSCL), manganese chloride (MnClz), and manganese acetate. In some embodiments, the source of manganese comprises manganese chloride.|0218] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of zinc. Examples of zinc sources include, but are not limited to, zinc sulfate (ZnSCL), zinc chloride (ZnCE), and zinc acetate.
[0219] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of cobalt. Examples of cobalt sources include, but are not limited to, cobalt chloride (CoCb), cobalt sulfate (CoSCh), and cobalt nitrate (Co(NO3)2). In some embodiments, the source of cobalt comprises cobalt chloride.
[0220] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of nickel. Examples of nickel sources include, but are not limited to, nickel sulfate (NiSCh), nickel chloride (NiCE), and nickel nitrate (Ni(NOs)2). In some embodiments, the source of nickel comprises nickel chloride.|0221] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of molybdenum. Examples of molybdenum sources include, but are not limited to, sodium molybdate (Na2MoO4), ammonium molybdate ((NH^GMOTGM), and ammonium heptmolybdate. In some embodiments, the source of molybdenum comprises sodium molybdate. In other embodiments, the source of molybdenum comprises ammonium heptamolybdate. In still other embodiments, the at least two sources of molybdenum comprise sodium molybdate and ammonium heptamolybdate.
[0222] In some aspects, the trace element solution comprises at least one, at least two, or at least three sources of boron. Examples of boron sources include, but are not limited to, boric acid (H3BO3), sodium borate (NazEEO?), and boron citrate. In some embodiments, the source of boron comprises boric acid.
[0223] In some aspects, the trace element solution comprises a chelating agent. Examples of chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citrate, nitrilotriacetic acid (NTA), and diethylenetriaminepentaacetic acid (DTP A). In some embodiments, the chelating agent comprises EDTA.
[0224] In an embodiment, the trace element solution comprises any combination of at least two of(i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In another embodiment, the trace element solution comprises any combination of at least three of (i) at least two sources of iron;(ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In yet another embodiment, the trace element solution comprises any combination of at least four of (i) at least two sources of iron; (ii) a source of calcium;(iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In still another embodiment, the trace element solution comprises any combination of at least five of (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese;(iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In a further embodiment, the trace element solution comprises any combination of at least six of (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) asource of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In still a further embodiment, the trace element solution comprises any combination of at least seven of (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In a certain embodiment, the trace element solution comprises any combination of at least eight of (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In yet a further embodiment, the trace element solution comprises any combination of at least nine of (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel;(viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator. In one embodiment, the trace element solution comprises (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator.
[0225] The concentration of trace elements in the solution can vary. In some aspects, the trace element solution comprises from about 0.05 to about 0.15 M ferrous chloride. In some aspects, the trace element solution comprises from about 0.01 to about 0.03 M calcium chloride. In some aspects, the trace element solution comprises from about 0.03 to about 0.04 M manganese chloride. In some aspects, the trace element solution comprises from about 0.077 to about 0.097 M zinc sulfate. In some aspects, the trace element solution comprises from about 0.077 to about 0.097 M cobalt chloride. In some aspects, the trace element solution comprises from about 0.001 to about 0.003 M copper chloride. In some aspects, the trace element solution comprises from about 0.001 to about 0.003 M nickel chloride. In some aspects, the trace element solution comprises from about 0.001 to about 0.003 M sodium molybdate. In some aspects, the trace element solution comprises from about 0.0079 to about 0.0279 M ferrous sulfate. In some aspects, the trace element solution comprises from about 0.0005 to about 0.001 M ammonium heptamolybdate. In some aspects, the trace element solution comprises from about 0.086 to about 0.286 M boric acid. In some aspects, the trace element solution comprises from about 0.01 to about 0.10 M EDTA. In some aspects, the trace element solution comprises from about 0.0052 to about 0.0072 M copper sulfate.
[0226] In some aspects, the trace element solution comprises at least two of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0227] In some aspects, the trace element solution comprises at least three of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0228] In some aspects, the trace element solution comprises at least four of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0229] In some aspects, the trace element solution comprises at least five of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0230] In some aspects, the trace element solution comprises at least six of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0231] In some aspects, the trace element solution comprises at least seven of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0232] In some aspects, the trace element solution comprises at least eight of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0233] In some aspects, the trace element solution comprises at least nine of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0234] In some aspects, the trace element solution comprises at least 10 of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0235] In some aspects, the trace element solution comprises at least 11 of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0236] In some aspects, the trace element solution comprises at least 12 of: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0237] In some aspects, the trace element solution comprises: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride; (viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate.
[0238] In other aspects, the trace element solution comprises: (i) from about 0.05 to about 0.15 M ferrous chloride;(ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride;(viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).
[0239] In yet other aspects, the trace element solution comprises: (i) from about 0.05 to about 0.15 M ferrous chloride hexahydrate; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride tetrahydrate; (iv) from about 0.077 to about 0.097 M zinc sulfate heptahydrate; (v) from about 0.077 to about 0.097 M cobalt chloride hexahdyrate; (vi) from about 0.001 to about 0.003 M copper chloride dihydrate; (vii) from about 0.001 to about 0.003 M nickel chloride hexahydrate; (viii) from about 0.001 to about 0.003 M sodium molybdate tetrahydrate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate heptahydrate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate tetrahydrate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate pentahydrate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).
[0240] In some embodiments, the trace element solution comprises at least two of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0241] In some embodiments, the trace element solution comprises at least three of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0242] In some embodiments, the trace element solution comprises at least four of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloridehexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0243] In some embodiments, the trace element solution comprises at least five of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0244] In some embodiments, the trace element solution comprises at least six of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0245] In some embodiments, the trace element solution comprises at least seven of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.10246] In some embodiments, the trace element solution comprises at least eight of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0247] In some embodiments, the trace element solution comprises at least nine of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfateheptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.|0248] In some embodiments, the trace element solution comprises at least 10 of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0249] In some embodiments, the trace element solution comprises at least 11 of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0250] In some embodiments, the trace element solution comprises at least 12 of: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0251] In some embodiments, the trace element solution comprises: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; and (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.|0252] In some aspects, the auto-expression broth further comprises an auto-expression component comprising an engineered microbial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the microbial host cell.
[0253] In some embodiments, the auto-expression component comprises an engineered bacterial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the bacterial host cell. In some embodiments, the bacterial host cell comprises an engineered Corynebacterium glutamicum cell. In some embodiments, the bacterial host cell comprises an engineered Escherichia coli. In some embodiments, the engineered Escherichia coli host cell comprises a DH5alpha strain. In other embodiments, the engineered Escherichia coli host cell comprises a JM109 strain. In yet other embodiments, the engineered Escherichia coli host cell comprises a BL21 strain. In yet still other embodiments, the engineered Escherichia coli host cell comprises a BL21 (DE3) cell. In further embodiments, the engineered Escherichia coli host cell comprises a Lemo21(DE3) cell. In yet further embodiments, the engineered Escherichia coli host cell comprises a SHUFFLE® T7 cell. In still further embodiments, the engineered Escherichia coli host cell comprises a T7 Express Competent Cell. In other embodiments, the engineered bacterial host cell comprises an engineered Bacillus subtilis host cell. In other embodiments, the engineered bacterial host cell comprises an engineered Pseudomonas fluorescens host cell.
[0254] In some embodiments, the auto-expression component comprises an engineered fungal host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the fungal host cell. In some embodiments, the engineered fungal host cell comprises an engineered Aspergillus niger host cell. In other embodiments, the engineered fungal host cell comprises a Trichoderma reesei host cell.
[0255] In some embodiments, the auto-expression component comprises an engineered yeast host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the yeast host cell. In some embodiments, the engineered yeast host cell comprises an engineered Hansenula polymorpha cell. In other embodiments, the engineered yeast host cell comprises an engineered Kluyveromyces lactis cell. In other embodiments, the engineered yeast host cell comprises an engineered Saccharomyces cerevisiae cell. In other embodiments, the engineered yeast host cell comprises an engineered Pichia pastoris cell.
[0256] In some aspects, the present disclosure provides an auto-expression system for producing one or more recombinant proteins of interest, the system comprising: (a) an auto-expression broth of the present disclosure; (b) an auto-expression component comprising an engineered microbial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistentprotein expression throughout the growth phase of the microbial host cell; and (c) an instrument for measuring expression of the one or more recombinant proteins of interest.|0257] In some embodiments, the engineered microbial host cell of the system comprises an engineered bacterial host cell. In some embodiments, the bacterial host cell comprises an engineered Corynebacterium glutamicum cell. In some embodiments, the bacterial host cell comprises an engineered Escherichia coli. In some embodiments, the engineered Escherichia coli host cell comprises a DH5alpha strain. In other embodiments, the engineered Escherichia coli host cell comprises a JM109 strain. In yet other embodiments, the engineered Escherichia coli host cell comprises a BL21 strain. In yet still other embodiments, the engineered Escherichia coli host cell comprises a BL21 (DE3) cell. In further embodiments, the engineered Escherichia coli host cell comprises a Lemo21(DE3) cell. In yet further embodiments, the engineered Escherichia coli host cell comprises a SHUFFLE® T7 cell. In still further embodiments, the engineered Escherichia coli host cell comprises a T7 Express Competent Cell.
[0258] In other embodiments, the engineered bacterial host cell comprises an engineered Bacillus subtilis host cell. In other embodiments, the engineered bacterial host cell comprises an engineered Pseudomonas fluorescens host cell.
[0259] In other embodiments, the engineered microbial host cell of the system comprises an engineered fungal host cell. In some embodiments, the engineered fungal host cell comprises an engineered Aspergillus niger host cell. In other embodiments, the engineered fungal host cell comprises a Trichoderma reesei host cell.
[0260] In yet other embodiments, the engineered microbial host cell of the system comprises an engineered yeast host cell. In some embodiments, the engineered yeast host cell comprises an engineered Hansenula polymorpha cell. In other embodiments, the engineered yeast host cell comprises an engineered Kluyveromyces lactis cell. In other embodiments, the engineered yeast host cell comprises an engineered Saccharomyces cerevisiae cell. In other embodiments, the engineered yeast host cell comprises an engineered Pichia pastoris cell.|0261] The present disclosure contemplates production of any protein of interest using an autoexpression broth of the disclosure with an auto-expression system of the present disclosure. Exemplary proteins of interest include, without limitation, enzymes, antibodies, hormones, growth factors, structural proteins, and antigens. In some embodiments, the protein of interest is insulin. In some embodiments, the protein of interest is erythropoietin. In some embodiments, the protein of interest is human growth hormone. In some embodiments, the enzyme is a lipase. In some embodiments, the enzyme is an alpha-amylase. In some embodiments, the enzyme is a protease. In some embodiments, the protein of interest is green fluorescent protein (GFP). In some embodiments, the protein of interest is eGFP. In some embodiments, the protein of interest is a polymerase. Insome embodiments, the protein of interest is a luciferase. In some embodiments, the protein of interest is a Cas protein.3. Methods
[0262] In an aspect, the disclosure provides a method of producing a recombinant protein of interest, the method comprising: (a) culturing an auto-expression component in an auto-expression broth of the present disclosure under conditions suitable for the auto-expression of a recombinant protein of interest; and (b) recovering the recombinant protein of interest.4. Kits
[0263] The compositions can be used in a disclosed kit to implement the methods of the present disclosure.
[0264] In another aspect, the disclosure provides a kit comprising an auto-expression broth of the disclosure or one or more components thereof and instructions for using the auto-expression broth for the production of a recombinant protein of interest in an auto-expression system.
[0265] Instructions included in kits can be affixed to packaging material or can be included as a package insert. While the instructions are typically written or printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" can include the address of an internet site that provides the instructions.
[0266] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods of the present disclosure described herein are readily applicable and appreciable, and may be made using suitable equivalents without departing from the scope of the present disclosure or the aspects and embodiments disclosed herein. Having now described the present disclosure in detail, the same will be more clearly understood by reference to the following examples, which are merely intended only to illustrate some aspects and embodiments of the present disclosure, and should not be viewed as limiting to the scope of the disclosure. The disclosures of all journal references, U.S. patents, and publications referred to herein are hereby incorporated by reference in their entireties.MATERIALS AND METHODS
[0267] Molecular cloning
[0268] The DNA sequence harboring the 6x Histidine tag, the T7 peptide leader, a TEV proteolytic cleavage site, and eGFP (6xHis-T7Leader-TEV-eGFP) was isolated from ADDGENE construct (#54762). eGFP was cloned into a pET21a(+) vector (EMD MILLIPORE #69740) backboneby restriction enzyme digest followed by T4 DNA ligation. DNA sequence was confirmed via Sanger Sequencing (Eurofins).|0269] The DNA sequence harboring the 6x Histidine tag, the T7 peptide leader, an X-PRESS affinity tag, and mStayGold (6xHis-T7Leader-XpressTag-mStayGold) was amplified from ADDGENE construct (#212017). The DNA sequence harboring the 6x Histidine tag, the T7 peptide leader, a TEV proteolytic cleavage site, and mTagBFP2 was amplified from ADDGENE (#54572). The fragments were assembled via Gibson assembly into the pRSETB vector backbone (ADDGENE #212017)[28, 29DNA sequences were confirmed via Sanger Sequencing (Eurofins).
[0270] Table 1 - Exemplary auto-expression broth (BB) composition used for experiments described in the examples
[0271] eGFP induction and in-cell eGFP measurements|0272] In-cell eGFP fluorescence intensity measurements were conducted as previously described with minor changes
[0014] . eGFP expression construct was transformed into BL21(DE3) competent cells (NEW ENGLAND BIOLABS). An overnight starter culture was grown in LB at 37°C with 100 ug / mL carbenicillin. 50 mL production cultures in non-baffled disposable cell culture Fernbach flasks (CORNING 431143) were started in each media (LB, TB, MM, ZYM, BB) with 100 ug / mL carbenicillin by 1: 100 dilution of the starter culture and were grown at 30° C at 250 rpm. 1 mM IPTG was added to LB and TB media at 6 hours. For each biological replicate, and each respective time point across all five tested media, 1 mL of culture was collected and pelleted at 10,000g for 10 minutes. Media was decanted, and pellets were resuspended with 1 mL of 137 mM NaCl, 2.7 mM KC1, 10 mM Na2HPO4, and 1.8 mM KH2PO4 (lx PBS) each. Samples were diluted with lx PBS into range for accurate ODeoo measurements. Absorbance at ODeoo and eGFP fluorescence intensity (Ex485 / Em516) were then measured by adding 350 pL of diluted sample into a 96-well plate (Grenier 655180) and reading in a Synergy Hl plate reader (Agilent). Blank measurements were subtracted prior to correcting for dilution. 20 mL from all biological replicates, for each type of media were individually spun down at 4,000 rpm at the last time point, 36 hours (FIG. 1A). Media was decanted, and tubes were stored at -80°C until eGFP purification and solubility experiments were executed.|0273] eGFP Purification and Yield Quantification|0274] Cells from a single replicate each of the five E. coli eGFP liquid cultures (BB, LB, TB, MM and ZYM) were resuspended in lysis buffer: 1 mg mL1lysozyme (THERMO FISHER) and 1 mg mL1DNase I (THERMO FISHER) in lx PBS containing 5 mM imidazole. Cells were incubated for 20 minutes on a nutator, spun down at 17,000 g, 4°C for 10 minutes, and clarified proteincontaining lysate was collected. Five cycles were then carried out in which the remaining cell pellet was refrozen at -80 °C, thawed, resuspended in lysis buffer, spun down and the soluble fraction collected. All soluble fractions were pooled. The pooled lysates from each liquid culture were applied to individual gravity columns containing 10 mL Ni-NTA resin (CYTIVA) equilibrated in lx PBS. Clarified cell lysates were flown over each respective gravity column 5 total times at 3 mL min1. Gravity columns were then washed with lx PBS for >50 column volumes at 4°C. Protein elution during wash steps was monitored using Bradford reagent (Bio-Rad) until no detectable protein was eluted. eGFP was eluted off Ni-NTA resin with lx PBS containing 300 mM imidazole pH 7.4. Proteinelution from the Ni-NTA resin was monitored by Bradford reagent (Bio-Rad) throughout elution. eGFP samples were buffer exchanged into l PBS and concentrated by centrifuge ultrafiltration (Amicon Ultra-15, 10k MWCO, Millipore) to a final volume of 10 mL each. An aliquot from each sample was mixed 1 : 1 with Laemmli Sample Buffer (Bio-Rad), boiled for 5 minutes, and loaded into a 4-20% Mini-PROTEAN® TGX Stain-Free™ Gel (Bio-Rad). Stain-free chemistry incorporates a trihalo compound that covalently binds to tryptophan residues and allows the visualization of proteins following electrophoresis by making the proteins fluorescent when exposed to UV light
[0048] . The rest of the samples were flash frozen with liquid nitrogen for further analysis. The stain-free gel was imaged on a BIORADCHEMDOC™ MP imaging system and analyzed using ImageLab (v 5.1) software. Total intensities for all bands in each lane were quantified and the fraction of total protein corresponding to the eGFP band was determined. Freshly thawed remaining samples were used in a BCA assay
[0049] (THERMO FISHER) to measure the total protein concentration using a Synergy Hl plate reader (Agilent) to measure A562 of 350 jrL samples in wells of a clear 96- well plate (Greiner 655180). The percentage of eGFP signal measured above was applied to the total protein yields measured by the BCA assay. Final corrected eGFP yields were scaled up from mg / 20 mL to mg L1for all 5 media.|0275] Immunoblotting10276] To detect 6xHis-eGFP in the soluble and insoluble fractions, bacterial lysates either from the soluble fraction of clarified lysate, or from resolubilized insoluble fractions from the cell pellets (8M urea with buffer exchange back to lx PBS) were separated on a 4-20% SDS-PAGE gel (BioRad), and proteins were transferred to Immobilon-P PVDF membrane (EMD Millipore). After blocking in TBS / 0.1% Tween 20 / 5% non-fat dry milk, the blots were probed with mouse anti- 6xHistidine primary antibody (Sigma) followed by the secondary goat anti-mouse IgG2a labeled with HRP (Southern Biotech) diluted in blocking solution. Blots were developed using Luminata Crescendo Western HRP substrate (EMD Millipore) and recorded on ChemiDoc MP Imaging System (Bio-Rad).|0277] Human cytochrome c expression and purification
[0278] Human cytochrome c (Hu-Cytc) was expressed and purified as described previously
[0019] . The pBTR (Human Cytc) vector, a derivative of the pBTRl expression vector, with the yeast iso-1- Cytc gene replaced with a synthetic Hu-Cytc gene, was used for expression[17, 50, 511. This vector coexpresses yeast heme lyase, which covalently attaches heme to the Cys-Ser-Glu-Cys-His heme recognition sequence of Hu-Cytc in the cytoplasm of E. coli. Competent E. coli BL21(DE3) cells were transformed with the pBTR(Human Cytc) vector. The colonies were washed off the selection plate and grown in 1 L of BB for 24 to 36 hours at 37°C with 100 ug / mL carbenicillin. Cells were then pelleted and suspended in a lysis buffer containing 10 mM Tris pH 7.5, 500 mM NaCl, 2 mM PMSF, and a small quantity of DNase. Lysis was carried out via sonication with a Qsonica Q700sonicator. The lysate was cleared by centrifugation and then incubated overnight while stirring with 12% ammonium sulfate to precipitate impurities. Centrifugation separated out the precipitate, and the supernatant was dialyzed overnight twice at 4°C, both times in 3 L of buffer containing 12.5 mM sodium phosphate, pH 7.2, 1 mM disodium EDTA, and 2 mM P-mercaptoethanol (BME). The dialyzed protein solution was loaded onto a CM Sepharose column that had been equilibrated in 50 mM sodium phosphate buffer, pH 7.0, 1 mM EDTA, and 2 mM BME. The column was washed with 5 column volumes of this same buffer to remove any additional protein impurities, and the final protein was eluted with a linear gradient from 0-0.8 M NaCl in the same buffer. The eluate was concentrated and exchanged into a low salt buffer, 50 mM sodium phosphate, pH 7.0, by centrifuge ultrafiltration (Amicon Ultra-15, 3k MWCO, Millipore) before being flash frozen and stored at -80°C. On the day of the experiment, protein was thawed and further purified with an AKTA-prime plus chromatography system (GE HEALTHCARE LIFE SCIENCES) equipped with a HiTrap SP HP 5 mL cation exchange column and a gradient from 0-0.3 M NaCl in 50 mM sodium phosphate buffer, pH 7.0, over 30 minutes at a flow rate of 1 mL / min. The purified protein was concentrated via centrifuge ultrafiltration (AMICON Ultra- 15, 3k MWCO, MILLIPORE). Protein yields were calculated from the final purified, concentrated protein by UV-Vis Spectroscopy prior to peroxidase activity assays[521.
[0279] Peroxidase activity measurements
[0280] The peroxidase activity of human cytochrome c (Hu-Cytc) was measured via conversion of guaiacol to tetraguaiacol which strongly absorbs at 470 nm[19, 27]. Hu-Cytc was oxidized with potassium ferricyanide, Ka[Fe(CN)6], at room temperature for 7 to 10 minutes, and then the K3[Fe(CN)6] was separated from the protein using a G25 SEPHADEX desalting column (CYTIVA) equilibrated with 50 mM sodium phosphate buffer at pH 7.0. The buffer solution was degassed under argon for 30 to 45 minutes to inhibit non-enzymatic oxidation of guaiacol by dissolved CL- Solutions of 4 mM protein, 400 mM guaiacol, and 100 ± 4 mM hydrogen peroxide were made in the degassed buffer. The H2O2 concentration used was selected so that it was above the Michaelis constant, Km, of H2O2 for peroxidase activity which is about 37 mM for human Cytc[21-24, 27, 53]. Guaiacol and H2O2 concentrations were measured by absorbance using extinction coefficients, 0274= 2150 M 'cm1, and 6240= 41.5 M" 'em'1, respectively125-27( The protein solution, degassed buffer, and guaiacol solutions in different concentrations were mixed immediately prior to taking measurements. The protein / guaiacol solution was then automatically mixed in a 1: 1 ratio with the 100 mM peroxide solution using an APPLIED PHOTOPHYSICS SX20 stopped-flow spectrometer. Time-dependent changes were recorded at 470 nm (A470). Final protein concentration was 1 mM, and final H2O2 concentration was 50 mM. All data measurements were taken at 25 + 0.1 °C. Five traces were recorded per guaiacol concentration. A470 was plotted as a function of time for each trial, and the highest slope of the linear region was used to determine initial enzyme velocity, v. The slopes were averaged, then multiplied by 4 since oxidation of guaiacol removes 4 electrons, divided by final protein concentration andmultiplied by 26.6 the extinction coefficient for tetraguaiacol (3,3’-dimethoxy-4,4!- biphenoquinone)[19, 21, 53]. This gives v / [Cytc] values as a function of guaiacol concentration. The Michaelis-Menten equation was fit to the data using SigmaPlot v. 13 to extract the Michaelis constant, Km, as well as the catalytic rate constant, kcat-
[0281] Dual Expression of Fluorescent Proteins in E. coli
[0282] BL21(DE3) competent cells were transformed and cultivated with carbenicillin resistance
[0028] . Each flask for each replicate was inoculated with 1:100 starter culture from overnight cultivation (14 hours) for BB, TB, and LB media. 50 mL total cultures were used for each replicate and cells were grown at 37°C until reaching ODeoo 0.6 then, TB and LB cultures were induced with 0.1 mM IPTG, and all cultures were shaken at 25°C at 250 rpm for five days. Cells were harvested at 4000 rpm, media was decanted, and samples were flash frozen with liquid nitrogen, then stored at -80°C until flow cytometry experiments.
[0283] Flow Cytometry
[0284] Samples were analyzed with the Attune NxT (Life Technologies, Grand Island, NY, USA) flow cytometer. Forward and side scatter properties were displayed on a logarithmic scale with the forward scatter threshold set to 1000 for all samples analyzed. mStayGold green fluorescent protein was measured with the BL1 laser line, excitation at 488 nm with emission detection at 530 nm with a 30nm bandpass filter. mTagBFP2 was measured by the VL1 laser line excitation at 405 nm with emission detection at 440nm with a 50 nm bandpass filter. Thawed E. coli cells were resuspended in lx PBS supplemented with ImM MgSOi and 0.1 mM CaCL, and further diluted 1:50 in PBS. 100 mL of the cell suspension was analyzed at a flow rate of 25 mL / minute for each replicate. Data was analyzed using FlowJo V10.10 (BD Life Sciences, Franklin Lakes, NJ, USA). Cells of all replicates were gated for intact single cells based on the forward and side scatter (FIG. 9A, FIG. 9B, FIG. 9C and FIG. 9D) and universal gates for + mStayGold and ± mTagBFP2 were set based on the negative control cells cultured in BB, but not expressing fluorescent proteins (FIG. 9A, FIG. 9B, FIG. 9C and FIG. 9D).|0285] Imaging E. coli
[0286] Live-cell imaging of the bacterial cells was performed on a Zeiss LSM 880 laser scanning confocal microscope with a Plan- Apochromat 63x / 1.4 NA DIC M27 oil immersion objective. A 405nm laser was used to excite mTagBFP2 with fluorescence detected from 410-498nm. The excitation for mStayGold was a 488nm laser with fluorescence being detected from 498-598nm. All cultures were imaged using the same settings in ZenBlack 2.3. Maximum intensity projections were generated from z-stacks of E. coli in each respective medium using ZenBlue 3.6.
[0287] eGFP Expression Measurements Using M9 Agar Plates
[0288] All M9 minimal media combinations were prepared following the base recipe
[0020] . Each treatment was supplemented with glucose to a final concentration of 0.5% (w / v). Where appropriate,additional carbon sources (glycerol, glucose, lactose, and galactose) were also added to a final concentration of 1% (w / v); for the positive control, IPTG was supplemented to a final concentration of 0.1 mM. Plates meant for BL21(DE3) additionally contained carbenicillin at a final concentration of 100 pg mL-1, and plates meant for SHUFFLE® T7 contained carbenicillin and streptomycin at final concentrations of 100 pg mL1and 25 pg mL1, respectively. Starter cultures of SHUFFLE T7 and BL21(DE3) E. coli were prepared by inoculating eGFP transformants into 30 mL M9 medium (0.5% w / v glucose) containing the appropriate antibiotics described above. Flasks were incubated in rotary shakers set to 250 rpm at 30°C or 37°C for SHUFFLE® T7 Express or BL21(DE3) E. coli, respectively. The BL21(DE3) culture was grown for 24 h under these conditions, whereas SHUFFLE® T7 Express needed 72 h to achieve the same qualitative density. Following this initial growth, cell suspensions were plated in parallel on six M9 modifications with the appropriate antibiotic selection: M9 (0.5% w / v glucose), M9+glucose (1% w / v), M9+glycerol (1% w / v), M9+lactose (1% w / v), M9+galactose (1% w / v), and M9+IPTG (0.1 mM). For each plate, sixteen 10 pL aliquots of homogenous culture were dotted in a 4 x 4 grid and allowed to dry under a laminar flow hood. All plates were incubated at 30 °C and were imaged after 6 days (SHUFFLE T7 Express) or 8 days (BL21(DE3)) of culture using a BIORAD CHEMIDOC™ MP imaging system. To assess incolony eGFP fluorescence, images of each plate were captured using a 530 / 28 filter under UV illumination using the same exposure settings and image area. Images were analyzed using the companion IMAGELAB (v5.1) software, performing automatic background subtraction and quantifying integrated colony fluorescence intensity for each colony without normalization for colony size. Non-uniform or fused colonies were excluded from the analysis, resulting in 12-16 values per condition. Average fluorescence intensity was calculated for each condition.10289] Expression and Purification of NMDA Receptor ABDs
[0290] The GluN 1 and GluN2A agonist binding domains (ABDs) were purified using a similar protocol to previously described with several adjustments
[0054] . Briefly, the GluNl S1S2 ABD contains residues 394-544 and 663-800 from the full-length GluNl joined by a Gly-Thr dipeptide linker and the GluN2A ABD contains residues 402-539 and 661-802 from the full-length GluN2A joined by a Gly-Thr dipeptide linker as previously described[54, 55]. The GluNl ABD was fused with 6x-Histidine tag and thrombin proteolytic cleavage site (6xHis-Thrombin-GluNl ABD). The GluN2A ABD consisted of a fusion between 6xHis-small ubiquitin-like modifier and GluN2A ABD (6xHis-SUMO- GluN2A ABD). Each ABD protein was expressed using SHUFFLE® T7 Express E. coli in BB at 25°C or 20°C for 24 hours respectively. Each construct contained a 6xHis-tag at the amino-terminus and was captured by applying clarified cell lysate to a 5 mL HiTrap IMAC HP column (CYTIVA). Following loading of the GluN 1 and GluN2A ABDs onto the IMAC, proteins were eluted with a linear gradient of imidazole concentrations, and peak fractions containing proteins were pooled and digested with either thrombin protease or ubiquitin ligase protease-1 (ULP-1) to remove N-terminaL tag sequences and isolate GluNl or GluN2A ABD protein fragments respectively. Post-cleavage,GluNl / GluN2A ABD proteins were further applied to a 5 mL Hi-Trap SP column (CYTIVA) to remove major contaminants, and GluNl / GluN2A ABD protein fragments were further purified with Superdex 200 10 / 300 GL (CYTIVA) via size-exclusion chromatography in a buffer consisting of in 10 mM HEPES, 100 mM NaCl, 1 mM glycine, 1 mM L-glutamate, pH 7.0.
[0291] Crystallography for GluNl / GluN2A ABDs
[0292] Purified GluNIA and GluN2A ABD proteins were mixed at a 1: 1 ratio and incubated O / N at 4°C before the GluNl / N2A complex was subjected to another round of purification using a Superdex 200 10 / 300 GL size exclusion column (CYTIVA) in 10 mM HEPES-NaOH, 100 mM NaCl, 1 mM glycine, 1 mM L-glutamate, pH 7.0. Complexed proteins were concentrated to 4-7 mg / mL and used to set 1:1 drops against a reservoir consisting of 0.2 M ammonium acetate, pH 6.8 with 14-18% PEG 4000 using the hanging drop diffusion method. Following 48 h of crystal growth, two rounds of crystal soaking were conducted. In the first round of soaking, drops were soaked with reservoir solution including 100 pM glutamate, and 100 pM 7-Chlorokynurenic acid (7-CKA). After at least 24 hours of soaking, the drops were then soaked for a second time with reservoir solution including 100 pM glutamate, and 300 pM 7-CKA for a minimum of 24 hours prior to harvesting. Crystals were cryoprotected in reservoir solution containing 20% (v / v) glycerol and flash-frozen in a 100 K nitrogen gas stream. Diffraction data were collected at the Stanford Synchrotron Radiation Lightsource (SSRL- SMB) on the 12-2 beamline. Images were processed using autoPROC
[0056] . Initial phases were determined by molecular replacement in PHASER
[0057] using a published glycine / glutamate bound GluNl / 2A ABD structure (PDB ID 4NF4)
[0034] as search model. The initial models were fit into a 2mF0-DFcmap with COOT
[0058] and subjected to one cycle of rigid body refinement using procedures in the PHENIX program suite
[0059] . Subsequently, the model was refined by iterative model rebuilding in COOT and refinement with PHENIX. L-glutamate and the 7-CKA ligand were located in the structure using the mF0-DFcmap
[0060] . Data collection and refinement statistics are shown in Table 3. Coordinates and diffraction data have been submitted to the Protein Databank with ID 9DA9.
[0293] Table 2 - Crystallography data collection and refinement statistics. Statistics for the highest-resolution shell are shown in parentheses.
[0294] SpCas9 expression and purification
[0295] Recombinant nuclease was purified according to a previously published protocol with minor modifications
[0035] . Briefly, pET-28b-6xHis-MBP-TEV-Sp-Cas9-siriusGFP-3xNLS (ADDGENE #78312) was transformed in Rosetta (DE3) pLysS E. coli competent cells (Novagen), and single colonies were inoculated and grown overnight. 500mL BB cultures were inoculated by 1 :100 dilution of the starter cultures and grown at 18 °C while siriusGFP fluorescence was monitored through time (FIG. 10A). Bacterial pellets were then re-suspended in the lysis buffer (20 mM Tris [pH 8], 500 mM NaCl, 5 mM MgCh, and 5 mM imidazole) supplemented with lysozyme (0.5 mg / mL), incubated for20 min at 4°C while shaking and lysed by high-pressure cell disruption. After clarification by centrifugation (40,000 x g, 45 min, 4°C), the supernatants were flown over an IMAC 5mL HiTrap 3 times in total for initial affinity purification step. Following washes with 50 mL of PBS, SpCas9 was eluted with 400 mM imidazole step gradient, and dialyzed into 20 mM Tris [pH 8], 20 mM NaCl, 5 mM MgCf in the presence of TEV protease overnight at 4°C. The rest of the protocol adheres faithfully to
[0035] . According to protocol, two further steps of purification were performed: ionexchange (IEX) chromatography (HiTrap SP FF column, GE Healthcare) followed by size-exclusion chromatography (HiLoad 16 / 600 Superdex 200 PG, GE Healthcare) using an AKTA Pure 25 FPLC system (GE HEALTHCARE). After the final elution, fractions containing SpCas9 were pooled, concentrated using a centrifugal concentrator (100,000 MWCO) to reach at least 10 mg / mL, and stored in aliquots at -80°C until use. The expression and purification was performed 3 times, with the average yield of 8.5 mg / ml.
[0296] Preparation of SpCas9-sgRNA RNP for microinjection
[0297] For an injection preparation, 11.9 pg Cas9-siriusGFP in 25mM Tris, 300mM NaCl, 2 mM MgCL. and luM DTT was mixed with 2.36 pg sgRNA in TE buffer (1:1 molar ratio), and KC1 was added to a final concentration of 150mM in a final reaction volume of 10 pL. RNP assembly reaction was incubated while being centrifuged (17,000 RCF) for 30 minutes at 4°C. For all genome editing experiments, ribonucleoprotein complexes (RNPs) were formed between SpCas9 and sgRNA targeting coding exon 2 of the ebony (CG3331) locus.|0298] Full sgRNA sequence (IDT) with complementary crRNA underlined:
[0299] 5’CCACAAUUGUCGAUCGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3’ (SEQ ID NO: 1)|0300] Drosophila melanogaster microinjection
[0301] Wildtype Canton-S flies were maintained in 6 oz bottles (Flystuff #32-130) with 50mL standard fly food. Approximately 300 adults aged 2-5 days were transferred to embryo collection chambers (Flystuff #59-105) with 2% apple juice agar collection plates (35mm petri dish) topped with yeast paste for 30 minutes. Embryos were collected, washed with ddH2O, and arranged on a 18x18mm coverslip in olive oil. Sutter P-1000 horizontal micropipette puller and Sutter BV-10 Microelectrode Beveler were used to pull and bevel aluminosilicate glass capillary tubes (Sutter, #AF100-64-10), respectively. Pipettes were back loaded with injection mix. Syncytial stage embryos were injected in the posterior end (FIG. 10C) at 20°C with a trinocular microscope (ACCU-SCOPE EXI-310) and PM1000 Microinjector (MICRODATA INSTRUMENT Inc.) on manual setting, facilitated by an N2gas compressor and controlled by a hydraulic micromanipulator set up (Narishige #MM0-4, #MMN-1, #P-12, #GJ-8, #IP). Coverslip with injected embryos was then washed with 95%ethanol and quickly rehydrated with ddhhO. Coverslips were transferred to food vials (Flystuff, #32- 117) and incubated at 26±2°C, 65% humidity with a 12h light / dark cycle.|0302] Drosophila crosses and phenotypic characterization|0303] Individual injected surviving adults were crossed to 3 double balanced ebony flies (w[*]; CyO / sp; TM2, es / TM6b, e1) in 16x100mm glass isolation vials (THERMO FISHER #14-961-29) with 1.5mL standard fly food. Canton-S controls were isolated as pupae and subject to the same cross setup in biological triplicate. Cross vials were flipped daily for 10 days; incubated at 26±2°C, 65% humidity with a 12h light / dark cycle. Fi adults were screened for the ebony phenotype (c',' / "“' / / TM2, esor c',' / "',' / / TM6. e1; FIG. 10E).
[0304] Imaging fly embryos
[0305] Canton-S embryos were injected with Cas9-siriusGFP. Injected embryos were mounted on a glass slide (VWR #16005-106) in halocarbon 27 oil, overlaid with a coverslip sealed with nail polish and imaged using a Zeiss ESM 880 laser scanning confocal microscope with a Pin Apo 20x / 0.8 NA air objective. Excitation wavelength of 488nm was used to image with detection wavelength range of 493-530nm. Images were acquired using ZenBlack 2.3 software and pseudo colored turquoise in FIJI.
[0306] Imaging adult flies. Adults were imaged using a Sony a7R III camera mounted on anOlympus BH-2 microscope with Olympus 4xDPlan 0.10 160 / 0.17 objective and M2XNEX 2x Sony E-mount adapter. The specimens were lit bilaterally with Hera AKOD20 / CW 5-Watt LED Luminaire lamps. Flies were decapitated and mounted on glass slides (VWR #16005-106) with clear Gorilla Super Glue Gel. Images were stacked using manual fine-focus increments and combined in Helicon Focus 7.6.1 Pro using Method C with smoothing set to 2.EXAMPLES
[0307] The present disclosure has multiple aspects, illustrated by the non-limiting examples as described herein. Protein production using Escherichia coli is a cornerstone of modern biotechnology. The examples describe an exemplary auto-expression broth to maximize protein production. Each E. coli strain tested was capable of auto-expression in response to galactose, including strains in which the endogenous lacZ had been disrupted. This provides key evidence that galactose can regulate the lac operon independent of known lac operon-regulated metabolism. The enhanced capabilities of the exemplary auto-expression broth were documented across protein production systems including (1) increased yields for routinely expressed proteins (e.g. eGFP), (2) improved expression of human cytochrome c within a dual expression system, (3) robust auto-expression in lacZ-deficient strains producing proteins with challenging disulfide bonds, and (4) reproducible 8-fold increase in SpCas9 yields, at >95% purity. The exemplary auto-expression broth can streamline production and improve yields for routine as well as challenging proteins, accelerating recombinant protein production and creating new opportunities in biotechnology and structural biology.Example 1 - The exemplary auto-expression broth is the superior media for eGFP production |0308] It was hypothesized that auto-expression using a broth of the disclosure can be measured and monitored using eGFP fluorescence. Using fluorescence as a proxy for the expression of a GFP fusion protein, especially when utilizing auto-expression, can be a robust readout within E. coli cultures. Capturing GFP fluorescence throughout the expression process provides key insights regarding POI status in the following ways: (1) demonstration that the POI is being expressed, given that GFP is fluorescent and is capable of being visualized, (2) at minimum, the POI is present in the soluble fraction of the E. coli since GFP is not fluorescent if localized to inclusion bodies[13, 14]and (3) fluorescence readings as a function of protein expression can be measured in minutes, whereas expression monitoring by SDS-PAGE gel analysis following small scale sample lysis is time consuming and laborious
[1516] . However, it should be noted that a GFP protein could be proteolytically cleaved from a misfolded fusion protein, thus an analysis checking that the molecular weight corresponds to the full-length fusion protein is essential. If premature cleavage is realized, the released GFP will fluoresce resulting in false positive expression data. Thus, final yields of POI must be visualized using conventional methods.
[0309] To evaluate and compare the capacity of the exemplary auto-expression broth (BB) to produce proteins, it was tested in comparison to THERMOFISHER's MAGICMEDIA™ (MM), TERIFFIC BROTH (TB), LYSOGENY BROTH (LB), and STUDIER BROTH (ZYM). E. coli BL21(DE3) cells expressing 6xHis-eGFP from a pET2 la plasmid were monitored by ODeoo for biomass and by fluorescence emission (516 nm) for eGFP production in an orbital shaker culture
[0016] . The auto-expression broth of the present disclosure supported a similar bacterial optical density (OD(,oo) compared to TB, MM, and ZYM (FIG. 1 A). eGFP fluorescence intensity was monitored within BL21(DE3) E. coli without lysing the cells to measure eGFP accumulation over time. Intriguingly, despite similar ODsoo values, BB achieved significantly higher eGFP fluorescence (FIG. IB and FIG. ID).10310] To validate eGFP fluorescence signal as a robust metric of eGFP protein production, one replicate from each media recipe was lysed after 36 hours, soluble eGFP was purified from each culture in parallel using affinity chromatography, and the amount of eGFP in each sample was quantified with correction for protein purity. Total yields of eGFP display the same approximate 3x difference observed during the in-cell fluorescence measurements (FIG. IB and FIG. 1C). It was concluded that in-cell fluorescence measurements accurately report key protein production values without significant fluorescent artifacts. Further normalization of eGFP fluorescence intensity relative to ODaoo and total culture volume revealed that the enhanced eGFP expression capability in BB was a function of higher cell-specific yield per OD unit (FIG. ID). Notably, LB was able to producesignificantly more eGFP per OD&oo compared to TB, MM, or ZYM. However, total protein yield from BB outcompetes LB as BB supports a higher density of E. coli (FIG. IB and FIG. 1C).|0311] It was further hypothesized that the increased yield of eGFP in BB or LB compared to ZYM, TB, and MM resulted from improved solubility of the recombinantly expressed protein
[0013] . To test this hypothesis, eGFP distribution between the soluble and insoluble fractions in each culture condition was compared. Distinct distribution of eGFP between the soluble and insoluble fractions in each media both by a total protein gel staining was observed, as well as by a western blot against the 6xHis-eGFP (FIG. IE). These qualitive observations supported the hypothesis predicting that BB would alleviate protein solubility shortcomings of other media. It was concluded that BB can produce more eGFP compared to other popular media, in-cell fluorescence can be used to monitor and maximize protein production in auto-expression processes, and that higher folding efficiency in BB contributes to higher target protein yields.Example 2 - The auto-expression broth of the present disclosure (BB) increases efficiency of a dual expression system10312] BB’s performance in a challenging co-expression scenario was next investigated, where the target protein needs to be produced along with an essential accessory factor. Human cytochrome c (Hu-Cytc) was chosen, which requires simultaneous production of yeast heme lyase encoded by the same plasmid as the Hu-Cytc
[0017] , as a co-expression model. Heme lyase is required to covalently attach a heme group onto apo-Cytc, ultimately producing a functional holo Cytc117-191(FIG. 2A). Heme lyase and Hu-Cytc are expressed from a bicistronic open reading frame
[0017] . Historically, either TB or 2xYT have been used to express Hu-Cytc[17, 191where 2xYT is a nutrient dense medium with similar ingredients as TB only different by the ratio of tryptone and yeast extract, the presence of NaCl, and the absence of glycerol
[0020] . However, 30% to 40% of the cultures grown in either TB or 2xYT fail to express Hu-Cytc despite being grown simultaneously in the same orbital shaker with other successful cultures. By contrast, when expressed in BB, 12 of 12 cultures displayed a vibrant pink color indicative of proper heme group assembly required for Hu-Cytc function, demonstrating consistent expression in every BB culture (FIG. 2B). There was not an appreciable difference between the pellets with respect to color among different replicates cultured in parallel. Hu-Cytc protein purification from three of the representative replicate 1 L cultures confirmed production of the same molecular weight and purity protein as the standard induction (FIG. 2C and FIG. 7). When compared to successfully grown 2xYT cultures following the standard expression protocol, BB produced approximately three times as much Hu-Cytc (15 mg / L versus 5 mg / L) (FIG. 2D).
[0313] To confirm that proteins expressed in BB were active, functional enzymes, we measured peroxidase activity of the purified Hu-Cytc protein by monitoring the production of tetraguaiacol from guaiacol in the presence of H2O2[19, 21-271and compared the kinetic data to previously reported valuesfor protein expressed in 2xYT
[0019] . Michaelis-Menten plots were generated with respect to guaiacol concentration to determine the kcatand Kmparameters (FIG. 2E). Overall, the plots were similar, and the feat values obtained from the fits were the same within the margin of error (two-tailed t-test P>0.05) (FIG. 2E). The Kmvalues were not strongly affected by the change in production media (FIG. 2E). Following confirmation of enzymatic activity, we conclude that in this dual expression system, BB reliably produced active, functional enzyme yielding enzymatic parameters consistent with previously reported data
[0019] .Example 3 - The auto-expression broth of the present disclosure (BB) maintains a higher number of cells producing target proteins in a dual expression system
[0314] BB might outperform other media in dual-expression systems by several mechanisms, including maintaining a higher number of protein-producing cells in the culture, achieving higher protein output per cell, or allowing efficient simultaneous expression of two proteins rather than skewing production to a single dominant protein. To understand which potential scenario best describes BB’s enhanced Hu-Cytc expression, flow cytometry was used and a fluorescent dual expression system consisting of mStayGold green fluorescent protein and mTagBFP2 blue fluorescent protein. These two fluorophores were expressed from a bi-cistronic open reading frame construct (FIG. 3 A)[28, 29], which can allow for a similar level of biosynthesis, with a subtle production bias favoring the ORF that is transcribed first within the system. It was allowed for possible lower cell positivity counts as well as POI expression levels by using the high quantum yields intrinsic to mStayGold and mTagBFP2. This provided the exemplary autho-expression system with a broad dynamic range for fluorescence detection[28, 29]. Flow cytometry provided the capability to determine the fraction of bacteria expressing fluorescent proteins, the level of protein produced per cell per medium, and the relative amounts of mStayGold and mTagBFP2 found in dual fluorescent cells. LB and TB were chosen as the two media comparisons because TB is similar in its base composition to BB, and LB historically supports high fluorescent protein expression. As a result, LB has been used to produce an array of fluorescent proteins (FIG. ID)
[0028] .
[0315] The published growth conditions for mStayGold
[0028] were followed and analyzed cells 5 days post induction (BB) or IPTG inoculation (LB and TB) by flow cytometry. All samples were gated for intact cells (FIG. 9A, FIG. 9B, FIG. 9C and FIG. 9D, and the percentage of cells producing blue-green, dual-fluorescent signal was established using uniform gating for all cultures based on a non-fluorescent control culture (FIG. 9A, FIG. 9B, FIG. 9C and FIG. 9D). BB produced 10-fold more dual fluorescent cells compared with LB and TB (FIG. 3B and FIG. 3C). Additionally, the mean fluorescence intensity for each fluorophore in the dual-positive cells was similar among the three media, with a minor increase in BB (FIG. 3D). The comparison of mTagBFP2 and mStayGold fluorescence intensities suggested that TB produced a biased amount of mTagBFP2 in comparison tomStayGold, which was unique among the tested media and confirmed by microscopy (FIG. 3E and FIG. 8). It was concluded that BB supports a larger population of cells that simultaneously produce two target proteins in dual-expression systems. The percentage of dual-fluorescent cells in BB was superior compared to LB and TB. Notably, BB cells that displayed dual blue-green, fluorescent signal also correlated with higher mean fluorescence intensities, thus achieving similar or better protein output per cell (FIG. 3E. Additionally, dual expression in TB and perhaps other media may become biased towards one of the two proteins of interest, ultimately preventing production of the desired product, especially if the desired product requires the presence of a chaperone protein for complete maturation. Overall, the increased effectiveness of BB for dual-expression applications results from a combination of a greater number of cells engaged in protein production and an unbiased expression of both POIs.Example 4 - The exemplary auto-expression broth of the present disclosure (BB) produces natively folded disulfide-rich proteins using galactose as the inducer
[0316] BB relies on galactose to induce the T7 system, although galactose is not the canonical inducer of the lac operon. Previous literature has described galactose as a capable inducer in some E. coll genetic backgrounds such as BL21(DE3)[2, 41. To test BB’s auto-expression capability in E. coll strains beyond the canonically used BL21(DE3) strain and its derivatives, we used BB to support expression by SHUFFLE T7 Express E. coli, which have been engineered to facilitate production of correctly disulfide-bonded POIs in the cytoplasm
[0030] . During SHUFFLE Express engineering, T7 RNA polymerase was integrated into lacZ, disrupting bacterial ability to convert lactose to allolactose
[0030] . Before attempting production of challenging disulfide protein targets, we first tested the ability of various carbon sources including galactose to induce expression in SHUFFLE T7 Express using a minimal medium (M9) as a base in agar plates. Each M9 variant contained one additional carbon source (FIG. 4A). Base M9, glycerol supplemented, and glucose supplemented M9 plates served as negative controls as glucose and glycerol do not induce the T7 expression system[2, 41.
[0317] eGFP fluorescence was used as a readout for POI production in all experiments, allowing on-plate expression measurements. Robust eGFP expression was observed on plates containing lactose, galactose, and IPTG for BL21(DE3) (FIG. 4B). For plates containing glycerol, excess glucose, or the M9 / base glucose negative control, there was little fluorescence intensity detected per colony; furthermore, excess glucose downregulated eGFP expression compared to M9 / base glucose presumably through catabolite repression (FIG. 4B). As expected, significant eGFP expression was observed in SHUFFLE T7 Express in response to IPTG (FIG. 4B). However, eGFP production in the lactose plates was considerably reduced compared to IPTG, likely due to disruption of lacZ (FIG. 4B). Intriguingly, galactose was as efficient as IPTG in inducing eGFP expression in the SHUFFLE Express strain (FIG. 4B). It was concluded that galactose can induce the T7 expression systemthrough an alternative, non-characterized mechanism. The above-mentioned induction mechanism is hereafter referred to as auto-expression.|0318] Having established that the SHUFFLE T7 Express E. coli strain is capable of autoexpression in response to galactose on minimal media, whether SHUFFLE T7 Express would support auto-expression when cultured in BB was tested. eGFP was used for tracking expression, and observed robust eGFP expression, on par with a positive control BL21(DE3) (FIG. 4C). It was concluded that SHUFFLE T7 Express is capable of auto-expression in response to galactose in both minimal media as well as BB.
[0319] Following confirmation that BB can be used for auto-expression in the SHUFFLE T7 express strain, this system was used to produce isolated agonist binding domains (ABD) from GluNl and GluN2A subunits within N-methyl-D-aspartate (NMD A) receptors[31, 32]. NMDA receptors have received considerable attention as targets for therapeutic agents in neurological and psychiatric disorders
[0033] , and we chose GluNl and GluN2A ABDs as their production represents a significant bottleneck in studies of the structural and pharmacological properties of NMDA receptors. The GluNl and GluN2A ABDs contain three disulfide bonds each, necessitating the usage of E. coli strains such as SHUFFLE T7 Express for proper folding (FIG. 5A)
[3132] . In a functional NMDA receptor, two GluN 1 subunits assemble with two GluN2A subunits to form a heterotetrametric receptor, while recombinantly expressed isolated ABDs form GluNl -GluN2A heterodimers (FIG. 5B)[32, 34].
[0320] To test whether the proteins produced in BB achieve correct folding and disulfide bonding, the two ABDs were purified separately and crystallized the GluNl / GluN2A ABD-heterodimer complex. The crystal structure of the GluN2A-GluN 1 ABD heterodimer in complex with the competitive GluNl antagonist 7-chlorokynurenic acid (7-CKA) and the GluN2A agonist glutamate was solved at a 2.05 A resolution (FIG. 5C and FIG. 5D). This structure displays proper disulfide pairing for each NMDA receptor ABD and corroborates previously reported GluN2A-GluN 1 ABD heterodimer structures (FIG. 5D). This was further supported by aligning the backbone atoms of this structure with the 5,7-dichlorokynurenic acid (DCKA)Zglutamate-bound GluN2A-GluNl ABD- heterodimer structure (PDB ID 4NF4)
[0034] (FIG. 5C). This alignment gave an RMSD of 0.185 angstrom, and aligns each ligand, 7-CKA and glutamate, with DCKA and glutamate (FIG. 5E). It was concluded that SHUFFLE T7 Express E. coli can be used in conjunction with BB to promote future structural and biochemical research with disulfide bond-containing proteins.Example 5 - BB increases production of recombinant SpCas9
[0321] Having established that BB improves protein production for a broad range of systems, the focus shifted to utilizing BB coupled with GFP fluorescence as a readout for production of Streptococcus pyogenes CRISPR-associated DNA endonuclease Cas9 (SpCas9)[35’371. To visualize production of SpCas9, a SpCas9-siriusGFP fusion protein was used (FIG. 6A)
[0035] . SpCas9-siriusGFPwas expressed in BB and observed robust accumulation of siriusGFP through time (FIG. 10 A, FIG. 10B, FIG. 10C, FIG. 10D and FIG. 10E). Following apo-SpCas9 purification as per the published protocol
[0035] , an 8-fold increase in >95% pure apo-SpCas9 was achieved (FIG. 6A) in direct comparison to previously published yields per liter (Table 3, line 3 vs 5). Importantly, this production improvement was relative to apoSpCas9 protein yields of comparable purity >95% due to the necessity for high purity of SpCas9 for challenging genetic engineering applications (i.e. CAR-T cell therapy). It was concluded that BB coupled with fluorescence as an in-cell expression readout can be used to produce significantly more, and highly pure (>95%) apo-SpCas9 utilizing conventional purification strategies.
[0322] Table 3 below shows a comparison of purified apo-Cas9 yields per liter of culture. Among numerous Cas9 purification reports, those listed in the table were selected based on approaching -90% apo-SpCas9 purity.
[0323] Table 3
[0324] * Purity level not suitable for gene therapy applications or high-cost model organism engineering due to inherent editing failure risks associated with contaminants.|0325]APublication reports only a single replicate.|0326] Example 6 -The exemplary auth-expression broth of the present disclosure (BB)- produced SpCas9 is catalytically active in vivo|0327] The activity of BB-expressed SpCas9-siriusGFP by targeting the ebony gene in Drosophila melanogaster was validated. The ebony gene is responsible for body pigmentation and is a widely- used co-CRISPR marker
[0042] . Ribonucleoprotein complexes (RNPs) were formed with a single guide RNA (sgRNA) sequence targeting the second coding exon in the ebony gene (FIG. 6B and FIG. 10B)
[0042] . Syncytial blastoderm embryos of Canton S flies were microinjected with SpCas9 / sgRNA complexes targeting the posterior of the embryos to increase the chance of heritable edits in the germ cells (FIG. 6B and FIG. 10C). Following microinjection, a subset of embryos was tested for GFP fluorescence, which indicated successful microinjection (FIG. 10D). Remaining embryos were allowed to develop, grown to adulthood, and individually crossed to double balancer ebony flies (w*;CyO / sp; TM2, es / TM6b, e1), to test for germline transmission of any generated mutations (FIG. 10E). Activity of SpCas9 was assessed by body pigmentation phenotypes within the Foand Fi progeny (FIG. 6C and FIG. 6D). A somatic mosaic phenotype was observed in ~7% of all injected, surviving Fo animals (FIG. 6C and FIG. 6D). Furthermore, 40% of surviving Fo were able to transmit the edit in crosses (FIG. 6E). Among the Fi progeny in 5 crosses with germline transmission of the edit, a consistent percentage of mutants were observed (~30%, FIG. 6F and FIG. 6G). From these data it was concluded that production of >95% pure SpCas9 can be improved 8-fold using BB. Moreover, it was demonstrated that the increased protein yields from BB did not compromise protein activity, as BB- produced SpCas9 was readily capable of catalyzing programmable endonuclease activity in vivo.
[0328] It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations upon the scope of the disclosure, which is defined solely by the appended claims and their equivalents.
[0329] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including without limitation those relating to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations, or methods of use of the disclosure, may be made without departing from the spirit and scope thereof.
[0330] For reasons of completeness, various aspects of the disclosure are set out in the following numbered clauses:
[0331] Clause 1. An auto-expression broth for a microbial host cell protein expression system, comprising: (a) a nitrogen source; (b) a buffering composition in an amount effective to maintain a pH between 6.5 and 7.5; (c) an inorganic salt mixture; (d) a carbon source comprising glucose, galactose, glycerol in amounts sufficient to support bacterial growth without suppressing protein expression, wherein the amount of galactose present in the broth is from about 1.5 to about 3 times the amount of glucose present in the broth and wherein the amount of glycerol present in the broth is between 5 and 15 times the amount of glucose present in the broth; and (e) a trace element solution comprising one or more trace elements in concentrations sufficient to support microbial growth and protein production, wherein the broth enables auto-expression of one or more recombinant proteins of interest in a microbial host expression system without the addition of an inducer.
[0332] Clause 2. The auto-expression broth of clause 1, further comprising a source of a citric acid cycle intermediate selected from the group consisting of citrate, isocitrate, alpha-ketoglutarate, succinyl-CoA, succinate, fumarate, malate, oxaloacetate, and combinations thereof.
[0333] Clause 3. The auto-expression broth of clause 2, wherein: (i) the citrate is selected from the group consisting of sodium citrate, potassium citrate, calcium citrate, and combinations thereof; (ii) the isocitrate is sodium isocitrate; (iii) the alpha-ketoglutarate is selected from the group consisting of sodium alpha-ketoglutarate, calcium alpha-ketoglutarate, and combinations thereof; (iv) the succinate is selected from the group consisting of sodium succinate, potassium succinate, calcium succinate,and combinations thereof; (v) the fumarate is selected from the group consisting of sodium fumarate, potassium fumarate, and combinations thereof; (vi) the malate is selected from the group consisting of sodium malate, calcium malate, magnesium malate, and combinations thereof; and (vii) the oxaloacetate is selected from the group consisting of sodium oxaloacetate, potassium oxaloacetate, and combinations thereof.
[0334] Clause 4. The auto-expression broth of clause 3, wherein the source of the citric acid cycle intermediate is sodium citrate.
[0335] Clause 5. The auto-expression broth of clause 4, wherein the auto-expression broth comprises up to about 6 g / L sodium citrate.
[0336] Clause 6. The auto-expression broth of clause 1, wherein the nitrogen source comprises: (i) tryptone; (ii) yeast extract; or (iii) both (i) and (ii).
[0337] Clause 7. The auto-expression broth of clause 2, wherein the nitrogen source comprises:
[0338] (i) from about 6 to about 30, from 8 to about 28, from 10 to about 26, or from 12 to about24 g / L trypone; (ii) from about 12 to about 60, from about 16 to 56, from about 20 to about 52, or from about 24 to about 48 g / L yeast extract; or (iii) both (i) and (ii).
[0339] Clause 8. The auto-expression broth of clause 1, wherein the buffering composition comprises: (i) potassium dihydrogen phosphate; (ii) disodium phosphate; or (iii) both (i) and (ii).
[0340] Clause 9. The auto-expression broth of clause 8, wherein the buffering composition comprises: (i) from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about 13.6 g / L of potassium dihydrogen phosphate; (ii) from about 5 to about 16 g / L, from about 6 to about 15 g / L, or from about 7.1 to about 14.2 g / L of disodium phosphate, or (iii) both (i) and (ii).
[0341] Clause 10. The auto-expression broth of clause 1, wherein the inorganic salt mixture comprises: (i) ammonium chloride; (ii) disodium sulfate; (iii) magnesium sulfate; or (iv) any combination of (i), (ii), and (iii).
[0342] Clause 11. The auto-expression broth of clause 10, wherein the broth comprises: (i) from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride; (ii) up to about 1 g / 10 / L disodium sulfate; (iii) up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate; or (iv) any combination of (i), (ii) and (iii).
[0343] Clause 12. The auto-expression broth of clause 1, wherein the carbon source comprises: (i) from about 1 to about 6.5, about 1.5 to about 6, about 2.0 to about 5.5, or from about 2.5 to about 5 g / L of glucose; (ii) from about 2 to about 13, from about 3 to about 12, from about 4 to about 11, or from about 5 to about 10 g / L of galactose; and (iii) from about 10 to about 65, from about 15 to about 60, from about 20 to about 55, or from about 25 to about 50 g / L glycerol;
[0344] Clause 13. The auto-expression broth of clause 1, wherein the trace element solution comprises: (i) copper sulfate; (ii) ferrous sulfate, or (iii) both (i) and (ii).
[0345] Clause 14. The auto-expression broth of clause 1, wherein the trace element solution comprises: (i) at least two sources of iron; (ii) a source of calcium; (iii) a source of manganese; (iv) a source of zinc; (v) a source of cobalt; (vi) at least two sources of copper; (vii) a source of nickel; (viii) at least two sources of molybdenum; or (ix) a source of boron; and (x) a chelator; and (xi) any combination of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or all of (i)-(x).
[0346] Clause 15. The auto-expression broth of clause 14, wherein: (i) the at least two sources of iron comprise ferrous chloride and ferrous sulfate; (ii) the source of calcium comprises calcium chloride; (iii) the source of manganese comprises manganese chloride; (iv) the source of zinc comprises zinc sulfate; (v) the source of cobalt comprises cobalt chloride; (vi) the at least two sources of copper comprise copper chloride and copper sulfate; (vii) the source of nickel comprises nickel chloride; (viii) the at least two sources of molybdenum comprise sodium molybdate and ammonium heptamolybdate; (ix) the source of boron comprises boric acid; or (x) the chelator comprises EDTA.
[0347] Clause 16. The auto-expression broth of clause 15, wherein the trace element solution comprises: (i) from about 0.05 to about 0.15 M ferrous chloride; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride; (iv) from about 0.077 to about 0.097 M zinc sulfate; (v) from about 0.077 to about 0.097 M cobalt chloride; (vi) from about 0.001 to about 0.003 M copper chloride; (vii) from about 0.001 to about 0.003 M nickel chloride;(viii) from about 0.001 to about 0.003 M sodium molybdate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).|0348] Clause 17. The auto-expression broth of clause 15, wherein the trace element solution comprises: (i) from about 0.05 to about 0.15 M ferrous chloride hexahydrate; (ii) from about 0.01 to about 0.03 M calcium chloride; (iii) from about 0.03 to about 0.04 M manganese chloride tetrahydrate; (iv) from about 0.077 to about 0.097 M zinc sulfate heptahydrate; (v) from about 0.077 to about 0.097 M cobalt chloride hexahdyrate; (vi) from about 0.001 to about 0.003 M copper chloride dihydrate; (vii) from about 0.001 to about 0.003 M nickel chloride hexahydrate; (viii) from about 0.001 to about 0.003 M sodium molybdate tetrahydrate; (ix) from about 0.0079 to about 0.0279 M ferrous sulfate heptahydrate; (x) from about 0.0005 to about 0.001 M ammonium heptamolybdate tetrahydrate; (xi) from about 0.086 to about 0.286 M boric acid; (xii) from about 0.01 to about 0.10 M EDTA; or (xiii) from about 0.0052 to about 0.0072 M copper sulfate pentahydrate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, atleast five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).|0349] Clause 18. The auto-expression broth of clause 17, wherein the trace element solution comprises: (i) about 0.1 M ferrous chloride hexahydrate; (ii) about 0.02 M calcium chloride; (iii) about 0.35 M manganese chloride tetrahydrate; (iv) about 0.087 M zinc sulfate heptahydrate; (v) about 0.087 M cobalt chloride hexahdyrate; (vi) about 0.002 M copper chloride dihydrate; (vii) about 0.002 M nickel chloride hexahydrate; (viii) about 0.002 M sodium molybdate tetrahydrate; (ix) about 0.0179 M ferrous sulfate heptahydrate; (x) about 0.0009 M ammonium heptamolybdate tetrahydrate; (xi) about 0.186 M boric acid; (xii) about 0.05 M EDTA; and (xiii) about 0.0062 M copper sulfate pentahydrate.
[0350] Clause 19. The auto-expression broth of any one of clauses 1-18, wherein the trace element solution comprises a first mixture of trace elements and a second mixture of trace elements, wherein the second mixture of trace elements is present in the broth at a concentration that is about 500, about 1000, about 1500 fold, or about 2000 fold less than the concentration of the first mixture of trace elements in the broth.
[0351] Clause 20. The auto-expression broth of clause 19, wherein: (i) the first mixture of trace elements comprises iron, calcium, manganese, zinc, cobalt, nickel, or sodium, and any combination thereof; and (ii) the second mixture of trace elements comprises zinc, manganese, cobalt, copper, or iron, and any combination thereof.
[0352] Clause 21. The auto-expression broth of clause 19, wherein: (i) the first mixture of trace elements comprises ferrous chloride, calcium chloride, manganese chloride, zinc sulfate, cobalt chloride, copper chloride, nickel chloride, sodium molybdate; and (ii) the second mixture of trace elements comprises EDTA disodium salt, zinc sulfate, manganese chloride, cobalt chloride, copper sulfate, ammonium heptamolybdate, or iron sulfate.
[0353] Clause 22. The auto-expression broth of clause 19, wherein: (i) the first mixture of trace elements comprises magnesium chloride tetrahydrate, zinc sulfate heptahydrate, cobalt chloride hexahydrate, copper chloride dihydrate, nickel chloride hexahydrate, or sodium molybdate pentahydrate, and any combination thereof; and (ii) the second mixture of trace elements comprises EDTA disodium salt, zinc sulfate heptahydrate, manganese chloride tetrahydrate, cobalt chloride hexahydrate, copper sulfate pentahydrate, ammonium heptamolybdate tetrahydrate, or iron sulfate heptahydrate, and any combination thereof.
[0354] Clause 23. The auto-expression broth of any one of clauses 1-22, further comprising an auto-expression component comprising an engineered microbial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the microbial host cell.
[0355] Clause 24. An auto-expression system for producing one or more recombinant proteins of interest, the system comprising: (a) the auto-expression broth of any one of clauses 1-23; (b) an autoexpression component comprising an engineered microbial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the microbial host cell; and (c) an instrument for measuring expression of the one or more recombinant proteins of interest.
[0356] Clause 25. A method of producing a recombinant protein of interest, the method comprising: (a) culturing an auto-expression component in an auto-expression broth of any one of clauses 1-23 under conditions suitable for the auto-expression of a recombinant protein of interest; and (b) recovering the recombinant protein of interest.
[0357] Clause 26. A kit comprising an auto-expression broth of any one of clauses 1-23 or one or more components thereof and instructions for using the auto-expression broth for the production of a recombinant protein of interest in an auto-expression system.
[0358] Clause 27. The auto-expression broth of any one of clauses 1-22, the auto-expression component of clause 23, the method of clause 25, or the kit of clause 26, wherein the microbial host cell is selected from the group consisting of an engineered bacterial host cell, an engineered fungal host cell, and an engineered yeast host cell.
[0359] Clause 28. The auto-expression broth, auto-expression component, method and kit of clause 27, wherein the engineered bacterial host cell an engineered bacterial host cell selected from the group consisting of a Corynebacterium glutamicum cell, an Escherichia coli cell, Bacillus subtilis cell, and a Pseudomonas fluorescens cell.
[0360] Clause 29. The auto-expression broth, auto-expression component, method and kit of clause 28, wherein the engineered Escherichia coli host cell comprises an engineered strain selected from the group consisting of a DH Sulpha strain, a JM109 strain, a BL21 strain, a BL21 (DE3) strain, a Lemo21(DE3) strain, a SHUFFLE® T7 strain, and a T7 Express Competent Cell strain.
[0361] Clause 30. The auto-expression broth, auto-expression component, method and kit of clause 27, wherein the engineered microbial host cell comprises an engineered fungal host cell.]0362] Clause 31. The auto-expression broth, auto-expression component, method and kit of clause 30, wherein the engineered fungal host cell comprises an engineered Aspergillus niger host cell or Trichoderma reesei host cell.|0363] Clause 32. The auto-expression broth, auto-expression component, method and kit of clause 27, wherein the engineered microbial host cell comprises an engineered yeast host cell.
[0364] Clause 33. The auto-expression broth, auto-expression component, method and kit of clause 32, wherein the engineered yeast host cell comprises an engineered Hansenula polymorpha strain, Kluyveromyces lactis, Saccharomyces cerevisiae or Pichia pastoris strain.
[0365] Clause 34. The auto-expression broth of any one of clauses 1-33, the auto-expression component of any one of clauses 23-33, the method of any one of clauses 25-33, or the kit of any one of clauses 26-33, wherein proteins of interest is selected from the group consisting of enzymes, antibodies, hormones, growth factors, structural proteins, and antigens.References Goeddel, D., Expression in Escherichia coli of chemically synthesized genes for human insulin. PNAS, 1979. 76(1). Studier, W., Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. Journal of Molecular Biology, 1985. 189(1): p. 113-130. Zulkifly, N.A.H., Optimisation of recombinant TNFa production in Escherichia coli using GFP fusions and flow cytometry. Frontiers in Bioengineering and Biotechnology, 2023. 11. Studier, W., Protein production by auto-induction in high-density shaking cultures. Protein Expression and Purification, 2005. 41(1): p. 207-234. Du, F., Regulating the T7 RNA polymerase expression in E. coli BL21 (DE3) to provide more host options for recombinant protein production. Microbial Cell Factories, 2021. 189. Kolb, A., TRANSCRIPTIONAL REGULATION BY cAMP AND ITS RECEPTOR PROTEIN. Annual REview of Biochemistry, 1993. 62: p. 749-797. Busby, S., Transcription activation by catabolite activator protein ( CAP). Journal of Molecular Biology, 1999. 293(2): p. 199-213. Kataoka, K., IPTG-independent autoinduction of extracellular matrix proteins using recombinant E. coli as the expression host. Polymer Journal, 2021. 53: p. 385-391. Xu, J., Galactose can be an inducer for production of therapeutic proteins by auto-induction using E. coli BL21 strains. Protein Expression and Purification, 2012. 83(1): p. 30-36. Beckwith, J., Regulation of the Lac Operon: Recent studies on the regulation of lactose metabolism in Escherichia coli support the operon model. Science, 1967. 156: p. 597-604. Hoffman, F., Stress Induced by Recombinant Protein Production in Escherichia coli. Advances in Biochemical Engineering, 2004. 89. Wagner, S., Consequences of Membrane Protein Overexpression in Escherichia coli. Molecular & Cellular Proteomics, 2007. Waldo, G.S., Rapid protein-folding assay using green fluorescent protein. Nature Biotechnology, 1999. 17: p. 691-695. Schilling, P.J., Improved designs for pET expression plasmids increase protein production yield in Escherichia coli. Communications Biology, 2020. Santillan, M., Quantitative approaches to the study of bistability in the lac operon of Escherichia coli. J. R. Soc. Interface, 2008: p. S29-39. Valbuena M., F., A photostable monomeric superfolder green fluorescent protein. Traffic: The moving front of cell biology, 2020. 21(8). Olteanu, A., Stability and apoptotic activity of recombinant human cytochrome c. Biochemical and Biophysical Research Communications, 2003. 312: p. 733-740. Rumbley, J.R., Recombinant equine cytochrome c in Escherichia coli: high-level expression, characterization, and folding and assembly mutants. Biochemistry, 2002. 41(47). Nold, S.M., Effect of a K72A Mutation on the Structure, Stability, Dynamics, and Peroxidase Activity of Human Cytochrome c. Biochemistry, 2017. 56(26): p. 3358-3368. Sambrook, J., Molecular Cloning: A Laboratory Manual (2nd ed.). Vol. 3. 1989, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Diederix, R.E.M., Peroxidase Activity as a Tool for Studying the Folding of c-Type Cytochromes. Biochemistry, 2002. 41(43): p. 13067-13077. Diederix, R.E.M., Kinetic stability of the peroxidase activitity ofunfoled cytochrome c: heme degradation and catalyst inactivation by hydrogen peroxide. Inorganic Chemistry, 2003. 42: p. 7249-7257. Radi, R., Cytochrome c-catalyzed oxidation of organic molecules by hydrogen peroxide. Archives of Biochemistry and Biophysics, 1991. 288(1): p. 112-117. Samsri, S., Influence of cysteine-directed mutations at the Q-loops on peroxidase activity of human cytochrome c. Archives of Biochemistry and Biophysics, 2021. 709. Noble, R., The Reaction of Ferrous Horseradish Peroxidase with Hydrogen Peroxide. The Journal of Biological Chemistry, 1969. 245(9): p. 2409-2413. Nelson, D.P., Enthalpy of decomposition of hydrogen peroxide by catalase at 25° C (with molar extinction coefficients ofH202 solutions in the UV). Analytical Chemistry, 1972. 49(2): p. 474- 478.Doerge, D.R., Identification of the colored guaiacol oxidation product produced by peroxidases. Analytical Biochemistry, 1997. 250(1): p. 10-17. Ando, R., StayGold variants for molecular fusion and membrane-targeting applications. Nature Methods, 2024. 21: p. 648-656. Subach, O.M., An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. PLoS One, 2011. 6(12). Lobstein, J., SHujfle, a novel Escherichia coli protein expression strain capable of correctly folding disulfide bonded proteins in its cytoplasm. Microbial Cell Factories, 2012. 11(56). Lind, G.E., Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits. PNAS, 2017. 114(33). Furukawa, H., Subunit arrangement and function in NMDA receptors. Nature Biotechnologies, 2005. 438: p. 185-192. Hansen, K., Structure, Function, and Pharmacology of Glutamate Receptor Ion Channels. Pharmacological Reviews, 2021. 73: p. 298-487. Jespersen, A., Structural insights into competitive antagonism in NMDA receptors. Neuron, 2014. 81(2): p. 366-378. Fleitas, A.L., A Robust Expression and Purification Method for Production ofSp Cas9-GFP- MBP Fusion Protein for In Vitro Applications. Methods and Protocols, 2022. 5(3): p. 44. Burger, A., Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development, 2016. 143'(11). Jinek, M., A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science, 2012. 337(6096): p. 816-821. D’Astolfo, D., Efficient intracellular delivery of native proteins. Cell, 2015. 161(3): p. 674-690. Martin-Martin, I., Optimization of sand fly embryo microinjection for gene editing by CRISPR / Cas9. PLoS Neglected Tropical Diseases, 2018. 12(9). Rajagopalan, N., A Two-Step Method for Obtaining Highly Pure Cas9 Nuclease for Genome Editing, Biophysical, and Structural Studies. Methods and Protocols, 2018. 1(17). Dilworth, D., Purification of Recombinant Cas9. Open Lab Notebooks, 2018. Kane, N.S., Efficient Screening of CRISPR / Cas9-Induced Events in Drosophila Using a Co- CRISPR Strategy. G3 Genes Genomes Genetics, 2017. 7: p. 87-93. Pinto, C., The Selective Advantage of the lac Operon for Escherichia coli Is Conditional on Diet and Microbiota Composition. Frontiers in Microbiology, 2021. 12. Fethi-Roudsari, M., Auto-induction for high level production of biologically active reteplase in Escherichia coli. Protein Expression and Purification, 2018. 151: p. 18-22. Hall, B.G., Transgalactosylation activity ofebg beta- galactosidase synthesizes allolactose from lactose. Journal ofBacteriology, 1982. 150(1): p. 132-140. Bloomer, H., CRISPR / Cas9 ribonucleoprotein-mediated genome and epigenome editing in mammalian cells. Advanced Drug Delivery Reviews, 2022. 181. Qiao, J., Co-expression of Cas9 and single-guided RNAs in Escherichia coli streamlines production ofCas9 ribonucleoproteins. Communications Biology, 2019. Taylor, S., The design of a quantitative western blot experiment. BioMed Reseasrch International, 2014. Smith, P.K., Measurement of protein using bicinchoninic acid. Analytical Biochemistry, 1985. 150(1): p. 76-85. Pollock, W.B.R., Bacterial Expression of a Mitochondrial Cytochrome c. Trimethylation of Lys72 in Yeast iso-l-Cytochrome c and the Alkaline Conformational Transition. Biochemistry, 1998. Mauk, A.G., Spectroscopic Properties of a Mitochondrial Cytochrome c with a Single Thioether Bond to the Heme Prosthetic Group. Biochemistry, 2002. Margoloash, E., Spectrum of horse-heart cytochrome c. The Biochemical Journal, 1959. 71(3): p. 570-572. Diederix, R.E.M., The peroxidase activity of cytochrome c-550 from Paracoccus versutus. European Journal of Biochemistry, 2001. Yi, F., Structural Basis for Negative Allosteric Modulation of GluN2 A- Containing NMDA Receptors. Neuron, 2016. 91(6): p. 1316-1329.Furukawa, H., Mechanisms of activation, inhibition and specificity: crystal structures of the NMDA receptor NR1 ligand-binding core. The EMBO Journal, 2003. 22: p. 2873-2885. Vonrhein, C., Data processing and analysis with the autoPROC toolbox. ActaChrystallography Biological Crystallography, 2011. 67: p. 293-302. McCoy, A.J., Phaser crystallographic software. Journal of Applied Crystallography, 2007. 40: p. 658-674. Emsley, P., Features and development of Coot. ActaChrystallography Structural Biology, 2010. 66: p. 486-501. Liebschner, D., Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. ActaChrystallography Structural Biology, 2019. 75: p. 861- 877. Read, R.J., Improved Fourier coefficients for maps using phases from partial structures with errors. ActaChrystallography Biological Crystallography, 1986. 42(3): p. 140-149.
Claims
CLAIMSWhat is claimed is:
1. An auto-expression broth for a bacterial host cell protein expression system, comprising:(a) a nitrogen source;(b) a buffering composition in an amount effective to maintain a pH between 6.5 and 7.5;(c) an inorganic salt mixture;(d) a carbon source comprising glucose, galactose, glycerol in amounts sufficient to support bacterial growth without suppressing protein expression, wherein the amount of galactose present in the broth is from about 1.5 to about 3 times the amount of glucose present in the broth and wherein the amount of glycerol present in the broth is between 5 and 15 times the amount of glucose present in the broth; and(e) a trace element solution comprising one or more trace elements in concentrations sufficient to support bacterial growth and protein production, wherein the broth enables autoexpression of one or more recombinant proteins of interest in a bacterial host expression system without the addition of an inducer.
2. The auto-expression broth of claim 1, further comprising a source of a citric acid cycle intermediate selected from the group consisting of citrate, isocitrate, alpha-ketoglutarate, succinyl-CoA, succinate, fumarate, malate, oxaloacetate, and combinations thereof.
3. The auto-expression broth of claim 2, wherein:(i) the citrate is selected from the group consisting of sodium citrate, potassium citrate, calcium citrate, and combinations thereof;(ii) the isocitrate is sodium isocitrate;(iii) the alpha-ketoglutarate is selected from the group consisting of sodium alpha- ketoglutarate, calcium alpha-ketoglutarate, and combinations thereof;(iv) the succinate is selected from the group consisting of sodium succinate, potassium succinate, calcium succinate, and combinations thereof;(v) the fumarate is selected from the group consisting of sodium fumarate, potassium fumarate, and combinations thereof;(vi) the malate is selected from the group consisting of sodium malate, calcium malate, magnesium malate, and combinations thereof; and(vii) the oxaloacetate is selected from the group consisting of sodium oxaloacetate, potassium oxaloacetate, and combinations thereof.
4. The auto-expression broth of claim 3, wherein the source of the citric acid cycle intermediate is sodium citrate.
5. The auto-expression broth of claim 4, wherein the auto-expression broth comprises up to about 6 g / L sodium citrate.
6. The auto-expression broth of claim 1, wherein the nitrogen source comprises:(i) tryptone;(ii) yeast extract; or(iii) both (i) and (ii).
7. The auto-expression broth of claim 2, wherein the nitrogen source comprises:(i) from about 6 to about 30, from 8 to about 28, from 10 to about 26, or from 12 to about 24 g / L trypone;(ii) from about 12 to about 60, from about 16 to 56, from about 20 to about 52, or from about24 to about 48 g / L yeast extract; or(iii) both (i) and (ii).
8. The auto-expression broth of claim 1, wherein the buffering composition comprises:(i) potassium dihydrogen phosphate;(ii) disodium phosphate; or(iii) both (i) and (ii).
9. The auto-expression broth of claim 8, wherein the buffering composition comprises:(i) from about 5 to about 15 g / L, from about 6 to about 14 g / L, or from about 6.8 to about13.6 g / L of potassium dihydrogen phosphate;(ii) from about 5 to about 16 g / L, from about 6 to about 15 g / L, or from about 7.1 to about14.2 g / L of disodium phosphate, or(iii) both (i) and (ii).
10. The auto-expression broth of claim 1, wherein the inorganic salt mixture comprises:(i) ammonium chloride;(ii) disodium sulfate;(iii) magnesium sulfate; or(iv) any combination of (i), (ii), and (iii).
11. The auto-expression broth of claim 10, wherein the broth comprises:(i) from about 1 to about 5 g / L or from about 2 to about 4 g / L ammonium chloride;(ii) up to about 1 g / 10 / L disodium sulfate;(iii) up to about 1, about 0.75, about 0.50, or about 0.25 g / L magnesium sulfate; or(iv) any combination of (i), (ii) and (iii).
12. The auto-expression broth of claim 1, wherein the carbon source comprises:(i) from about 1 to about 6.5, about 1.5 to about 6, about 2.0 to about 5.5, or from about 2.5 to about 5 g / L of glucose;(ii) from about 2 to about 13, from about 3 to about 12, from about 4 to about 11, or from about 5 to about 10 g / L of galactose: and(iii) from about 10 to about 65, from about 15 to about 60, from about 20 to about 55, or from about 25 to about 50 g / L glycerol;13. The auto-expression broth of claim 1, wherein the trace element solution comprises:(i) copper sulfate;(ii) ferrous sulfate, or(iii) both (i) and (ii).
14. The auto-expression broth of claim 1, wherein the trace element solution comprises:(i) at least two sources of iron;(ii) a source of calcium;(iii) a source of manganese;(iv) a source of zinc;(v) a source of cobalt;(vi) at least two sources of copper;(vii) a source of nickel;(viii) at least two sources of molybdenum; or(ix) a source of boron; and(x) a chelator; and(xi) any combination of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or all of (i)-(x).
15. The auto-expression broth of claim 14, wherein:(i) the at least two sources of iron comprise ferrous chloride and ferrous sulfate;(ii) the source of calcium comprises calcium chloride;(iii) the source of manganese comprises manganese chloride;(iv) the source of zinc comprises zinc sulfate;(v) the source of cobalt comprises cobalt chloride;(vi) the at least two sources of copper comprise copper chloride and copper sulfate;(vii) the source of nickel comprises nickel chloride;(viii) the at least two sources of molybdenum comprise sodium molybdate and ammonium heptamolybdate;(ix) the source of boron comprises boric acid; or(x) the chelator comprises EDTA.
16. The auto-expression broth of claim 15, wherein the trace element solution comprises:(i) from about 0.05 to about 0.15 M ferrous chloride;(ii) from about 0.01 to about 0.03 M calcium chloride;(iii) from about 0.03 to about 0.04 M manganese chloride;(iv) from about 0.077 to about 0.097 M zinc sulfate;(v) from about 0.077 to about 0.097 M cobalt chloride;(vi) from about 0.001 to about 0.003 M copper chloride;(vii) from about 0.001 to about 0.003 M nickel chloride;(viii) from about 0.001 to about 0.003 M sodium molybdate;(ix) from about 0.0079 to about 0.0279 M ferrous sulfate;(x) from about 0.0005 to about 0.001 M ammonium heptamolybdate;(xi) from about 0.086 to about 0.286 M boric acid;(xii) from about 0.01 to about 0.10 M EDTA; or(xiii) from about 0.0052 to about 0.0072 M copper sulfate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii), (iii), (iv), (v),(vi), (vii), (viii), (x), (xi), and (xii).
17. The auto-expression broth of claim 15, wherein the trace element solution comprises:(i) from about 0.05 to about 0.15 M ferrous chloride hexahydrate;(ii) from about 0.01 to about 0.03 M calcium chloride;(iii) from about 0.03 to about 0.04 M manganese chloride tetrahydrate;(iv) from about 0.077 to about 0.097 M zinc sulfate heptahydrate;(v) from about 0.077 to about 0.097 M cobalt chloride hexahdyrate;(vi) from about 0.001 to about 0.003 M copper chloride dihydrate;(vii) from about 0.001 to about 0.003 M nickel chloride hexahydrate;(viii) from about 0.001 to about 0.003 M sodium molybdate tetrahydrate;(ix) from about 0.0079 to about 0.0279 M ferrous sulfate heptahydrate;(x) from about 0.0005 to about 0.001 M ammonium heptamolybdate tetrahydrate;(xi) from about 0.086 to about 0.286 M boric acid;(xii) from about 0.01 to about 0.10 M EDTA; or(xiii) from about 0.0052 to about 0.0072 M copper sulfate pentahydrate, wherein the trace element solution comprises (ix) or (xiii) and at least one, at least two, at least three, at least four, at least five, at least six, at least seven at least eight, at least nine, at least 10, at least 11, or all of (i), (ii),(iii), (iv), (v), (vi), (vii), (viii), (x), (xi), and (xii).
18. The auto-expression broth of claim 17, wherein the trace element solution comprises:(i) about 0.1 M ferrous chloride hexahydrate;(ii) about 0.02 M calcium chloride;(iii) about 0.35 M manganese chloride tetrahydrate;(iv) about 0.087 M zinc sulfate heptahydrate;(v) about 0.087 M cobalt chloride hexahdyrate;(vi) about 0.002 M copper chloride dihydrate;(vii) about 0.002 M nickel chloride hexahydrate;(viii) about 0.002 M sodium molybdate tetrahydrate;(ix) about 0.0179 M ferrous sulfate heptahydrate;(x) about 0.0009 M ammonium heptamolybdate tetrahydrate;(xi) about 0.186 M boric acid;(xii) about 0.05 M EDTA; and(xiii) about 0.0062 M copper sulfate pentahydrate.
19. The auto-expression broth of claim 1, further comprising an auto-expression component comprising an engineered bacterial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the bacterial host cell.
20. An auto-expression system for producing one or more recombinant proteins of interest, the system comprising:(a) the auto-expression broth of claim 1;(b) an auto-expression component comprising an engineered bacterial host cell or genetic construct designed to express one or more recombinant proteins of interest continuously without the need for an exogenous inducer, wherein the broth promotes consistent protein expression throughout the growth phase of the bacterial host cell; and(c) an instrument for measuring expression of the one or more recombinant proteins of interest.