Methods for preventing unwanted cells arising during differentiation of human pluripotent stem cells

EP4802053A1Pending Publication Date: 2026-09-09ASPECT BIOSYST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024795210
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-10-31
Filing Date
2024-10-28
Publication Date
2026-09-09

AI Technical Summary

Technical Problem

The differentiation of human pluripotent stem cells (hPSCs) into specific cell types, such as definitive endoderm (DE) or pancreatic endocrine cells, is hindered by the presence of unwanted residual hPSCs and off-target mesodermal cell populations, which pose safety risks and contaminate the cell therapy product.

Method used

Inactivating or reducing the expression of specific genes required for the formation of mesodermal cell populations during the differentiation of hPSCs into DE, using a combination of genetic engineering techniques and optimized culture conditions with WNT signaling activators.

Benefits of technology

This approach significantly reduces the formation of mesodermal off-target cells and residual hPSCs, resulting in a more homogeneous and safe cell therapy product, such as pancreatic endocrine cells, suitable for treating diabetes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000024_0001
    Figure IMGF000024_0001
  • Figure IMGF000052_0001
    Figure IMGF000052_0001
Patent Text Reader

Abstract

The present invention relates generally to stem cells, particularly to methods for preventing unwanted cells i.e. off-target cell populations such as stromal cells, non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium. Other type of off target cell populations are mesodermal cell population and / or residual human pluripotent stem cells arising during in vitro differentiation of human pluripotent stem cells into definitive endoderm. The mesodermal cell population formation is inhibited by inactivating in the human pluripotent stem cells one or more genes required for the formation of said cell population. The residual human pluripotent stem cells are eliminated or reduced by culturing the human pluripotent stem cells wherein one or more genes required for the formation of the mesodermal cell population has been inactivated in a medium comprising WNT signalling agonist. The present invention also relates to homogenous cell population of definitive endoderm obtained from such methods.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS FOR PREVENTING UNWANTED CELLS ARISING DURING

[0002] DIFFERENTIATION OF HUMAN PLURIPOTENT STEM CELLS

[0003] TECHNICAL FIELD

[0004] The present invention generally relates to the field of stem cells. Particularly, it relates to a method for preventing specific type of unwanted cells arising during the differentiation of human pluripotent stem cells (hPSCs) into definitive endoderm (DE) or neurons or non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium.

[0005] INCORPORATION-BY-REFERENCE OF THE SEQUENCE LISTING

[0006] SEQUENCE LISTING

[0007] The present application is filed with a Sequence Listing in electronic form. The entire contents of the sequence listing are hereby incorporated by reference.

[0008] BACKGROUND

[0009] Human Pluripotent Stem Cells (hPSCs) can replicate indefinitely while retaining the capacity to differentiate into all cell types of the human body. One such cell type is pancreatic endocrine cells (PEC) including insulin producing beta cells. Step wise in vitro differentiation of hPSCs is carried out to obtain an inexhaustible source of PEC that is being explored as a transplantable stem cell therapy product for treatment of diabetes.

[0010] However, the major impediment in using PEC or other cell types differentiated from hPSCs as a cell therapy product is the potential safety risk due to contamination with unwanted cells. One type of unwanted cells is residual (undifferentiated) hPSCs that can remain due to inefficient differentiation. Another type of unwanted cells is off-target cell population(s) arising from one or more of distinct germ layers: ectoderm, mesoderm and endoderm during the early stage of hPSCs differentiation. One such off-target cell population that arises in all germ layers: Cells of ventral midbrain neural lineage (ectoderm), cardiomyocytes (mesoderm) and pancreatic islet lineage (endoderm) from in vitro differentiation protocols and contributes to the heterogenous mixture are cell types of a stromal or fibroblastic identity. Stromal cells are found to be a frequent component of heterogenous hPSCs derived differentiation protocols and considered an undesirable cell type. Other type of off-target cell populations are non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium.

[0011] Another off-target cell population is mesodermal cell population that arises during hPSCs differentiation into PEC. The first step is the induction of an intermediate cell population termed primitive streak (PS) that can subsequently bifurcate into desirable definitive endoderm (DE) or unwanted mesodermal off target cell populations.

[0012] Several attempts have been made to reduce the mesodermal off-target cell populations such as by reduction of mesodermal-derived lineages through enrichment by cell sorting or pharmacological inhibition.

[0013] Cuesta-Gomez et al (Cell reports 40, August 23, 2022) discloses most recent approaches to enrich endocrine populations and remove off-target cells.

[0014] However, controlling lineage-specific differentiation, particularly during the initial endoderm and mesoderm bifurcation remains a challenge, particularly when scaling up the differentiation protocol.

[0015] Due to inefficient differentiation of hPSCs incomplete induction of DE can occur, resulting in unwanted residual hPSCs. Contamination of PEC with residual hPSCs can lead to teratoma formation upon transplantation of PEC into a subject. Some strategies have been dedicated towards detection and elimination of residual hPSCs in stem cell derived products intended for clinical use.

[0016] Aghazadeh et al (Stem Cell Reports, Vol.17, 964-978, April 12, 2022) discloses that GP2-enriched pancreatic progenitors give rise to functional insulin producing cells in vivo and eliminate the risk of teratoma formation.

[0017] However, there remains a need for more efficient strategies and approaches to prevent residual hPSCs and / or the formation of mesodermal off-target cell populations during in vitro differentiation of hPSCs into DE that can be subsequently differentiated to obtain PEC or during in vitro differentiation of hPSCs into differentiated cells, such as neurons or non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium. There also remains a need for a cell therapy product that is devoid of or has a substantially reduced number of off-target cells such as mesodermal cells and / or residual hPSCs. Such cell therapy product can among other diseases be used for the treatment of diabetes.

[0018] SUMMARY

[0019] The present invention relates to in vitro methods for inhibiting or reducing the unwanted cells arising during the differentiation of hPSCs into DE or differentiation of hPSCs into neurons or non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium. In one aspect, the present invention provides a method for inhibiting or reducing the formation of a mesodermal cell population during in vitro differentiation of hPSCs into DE comprising inactivating or reducing the expression one or more genes in the hPSCs, wherein said one or more genes are required for the formation of the mesodermal cell population.

[0020] In another aspect, the present invention provides a method for inhibiting or reducing the formation of a mesodermal cell population during in vitro differentiation of hPSCs into DE comprising inactivating or reducing the expression of one or more genes in the hPSCs, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0021] In one aspect, the present invention provides a method for differentiating hPSCs into DE comprising a step of culturing the hPSCs in a cell culture medium, wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in the hPSCs.

[0022] In another aspect, the present invention provides a method for differentiating hPSCs into DE comprising a step of culturing the hPSCs in a cell culture medium, wherein one or more genes required for the formation of the mesodermal cell population selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEF1 has been inactivated in the hPSCs.

[0023] In one aspect, the present invention provides a method for differentiating hPSCs into DE comprising a step of culturing the hPSCs in a cell culture medium comprising a WNT signalling activator, wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in the hPSCs.

[0024] In another aspect, the present invention provides a method for differentiating hPSCs into DE comprising a step of culturing the hPSCs in a cell culture medium comprising a WNT signalling activator wherein one or more genes required for the formation of the mesodermal cell population selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEF1 has been inactivated in the hPSCs.

[0025] In one aspect the present invention provides genetically engineered cell(s) or a cell population thereof, wherein the cell(s) comprises or consists of one of more of MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEF1 genes that have been inactivated or have a reduced expression.

[0026] In another aspect, the present invention provides genetically engineered cell(s) or a cell population thereof, wherein the cell(s) are genetically modified to prevent formation of mesodermal cells during the differentiation of human pluripotent stem cells into definitive endoderm, pancreatic endoderm or pancreatic endocrine cells, wherein the genetically engineered cell comprises or consists of one of more of MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEF1 genes that have been inactivated or have a reduced expression.

[0027] In another aspect, the present invention provides an in vitro cell population of the genetically engineered cells according to previous aspects or definitive endoderm derived from human pluripotent stem cells wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in said human pluripotent stem cells, wherein said one or more gene is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0028] In further aspect, the present invention provides a cell population of the genetically engineered cells or DE derived from hPSCs wherein said cell population comprises less than 1% or 2% of mesodermal cells and / or less than 0.05% of hPSCs. This means that in the population of cells which results from the differentiation of hPSCs into DE, less than 1% of the cells comprised in said cell population are mesodermal cells, or less than 2% of the cells comprised in said cell population are mesodermal cells, and / or less than 0.05% of the cells comprised in said cell population are residual hPSCs.

[0029] In one aspect, the present invention provides a cell composition comprising a cell culture medium and the genetically engineered cells or DE cell population derived from hPSCs wherein one or more genes required for the formation of mesodermal cell population has been inactivated, for further differentiation or differentiated into PEC or insulin producing cells, for use as a medicament in the treatment of diabetes, by administering or grafting or transplanting the PEC or the insulin producing cells or tissue or organ derived from the PEC or the insulin producing cells into a subject.

[0030] The present invention may also solve further problems that will be apparent from the disclosure of the exemplary embodiments.

[0031] BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 A shows a schematic overview of hPSCs differentiation towards the three germ layers: ectoderm (EC), mesoderm (ME) and DE. The three germ layers are generated through two nested lineage bifurcations. First hPSCs bifurcate into ectoderm or primitive streak (PS) and the PS subsequently bifurcates into DE or ME. In the context of hPSCs differentiation, incomplete differentiation can occur, resulting in lingering residual hPSCs (illustrated by dashed lines).

[0033] Figure 1 B shows a schematic paradigm for differentiation of hPSCs into DE. Differentiation of hPSCs into PS is induced by activation of the Wnt signalling pathway by activator of the pathway (here illustrated by example of CHIR99021). Insufficient activation i.e. low CHIR99021 concentration results in contamination due to residual hPSCs remaining after differentiation into DE. High Wnt signalling pathway activation i.e. high CHIR99021 concentration results in mesodermal contamination.

[0034] Figure 2A shows a schematic overview of differentiation protocol of hPSCs into DE. hPSCs are treated with varying concentrations of Wnt signalling activator (illustrated by example of CHIR99021) for 24h to induce PS and subsequently with Activin A for 72h.

[0035] Figure 2B shows a set of flow cytometry dot plots of hPSCs differentiated to DE04 according to protocol outlined in figure 2A. hPSCs were treated with CHIR99021 concentrations ranging from 2.5uM to 6uM for the first 24h of the differentiation and subsequently with a constant concentration of Activin A for 72h before analysing the cells. Cells are stained for FOXA2, SOX17 and OCT3 / 4. Co-expression of SOX17 and FOXA2 marks DE. Expression of OCT3 / 4 marks residual hPSCs. Residual hPSCs or undifferentiated cells (OCT3 / 4+) are observed at the DE04 stage when applying low CHIR99021 concentrations (2.5-3.5uM). Increasing CHIR99021 concentrations (4-6uM) reduces the residual undifferentiated cells at DE04 but also leads to the increased formation of mesoderm off-target cells (SOX17+ / FOXA2- and SOX17- / FOXA2-). Optimal CHIR99021 concentration in this specific experiment appears to be between 3.5 and 4uM. However, the presence of undifferentiated cells and mesoderm off-target cells are still observed at these CHIR99021 concentrations.

[0036] Figure 3A shows t-distributed stochastic neighbor embedding (t-SNE) plots of the expression levels of the housekeeping-gene ACTB and the pan-endocrine cell genes NKX2-2 and SYP in single cells. Endocrine cells are demarcated with dashed lines. Cells outside the dashed lines are non-endocrine cells.

[0037] Figure 3B shows expression levels of canonical mesenchyme / stromal cell genes VIM, COL1A1 , COL3A1 , LUM, PDGFRA, PDGFRB in scRNA-seq data set. Cells coexpressing these markers are highlighted with solid lined circle. The presence of a stromal cell off-target population at the DP stages indicates the occurrence of a mesodermal contamination during differentiation of hPSCs into DE.

[0038] Figure 4A shows graft analysis of transplanted PEC under the mouse kidney capsule for ~16 week. Grafts were stained for DAPI to visualize all cells, SYP, a marker of endocrine cells and human KU80, a marker of human cells. The presence of SYP- / KU80+ indicates the presence of non-endocrine off-target populations in the graft.

[0039] Figure 4B shows graft analysis of transplanted PEC under the mouse kidney capsule for 12 weeks. Grafts were stained for DAPI to visualize all cells, VIM, a marker of mesenchymal / stromal-like cells and CK19 (KRT19), a marker of epithelial duct-like cells. The presence of a significant proportion of mesenchymal / stromal-like cells indicates unwanted cell growth of the mesodermal off-target cell populations in vivo.

[0040] Figure 5A shows a Uniform Manifold Approximation and Projection (UMAP) plot of a scRNA-seq time series of hPSCs differentiation into DE conducted as outlined in figure 2A. UMAP contains data from three repeats of the same differentiation protocol (diff. #1 , diff.#2 and diff. #3) with cells collected for analysis every 24h. hPSCs and PS are marked by dashed circles. Bifurcation is observed at primitive streak (PS) =DE01 approximately 24h after start of differentiation of hPSCs. However, the downstream effect of the bifurcation is more clearly observed 48h after start of differentiation of hPSCs i.e. at DE02(+), with cells either differentiating towards DE (endoderm) or mesoderm, marked by arrows.

[0041] Figure 5B shows a UMAP plot of combined samples from the three repeats of the same differentiation protocol (diff. #1 , diff.#2 and diff. #3), focusing on the DE / Mesoderm bifurcation stage (stage DE02 and DE03). Markers for DE (FOXA2, SOX17 and EPCAM) and mesoderm (HAND1 , NCAM1 and GYPB) are shown in the UMAP plots. Figure 5C shows a UMAP of samples from two of the three repeats of the same differentiation protocol (diff. #1 and diff. #3), focusing on the DE / Mesoderm bifurcation stage (stage DE02 and DE03). Markers for DE (FOXA2, SOX17 and EPCAM) and mesoderm (HAND1 , NCAM1 and GYPB) are shown in UMAP plots. Majority of mesoderm cells originated from diff. # 1 and diff. #3.

[0042] Figure 5D shows a UMAP of samples from one of the three repeats of the same differentiation protocol (diff. #2), focusing on the DE / Mesoderm bifurcation stage (stage DE02 and DE03). Markers for DE (FOXA2, SOX17 and EPCAM) and mesoderm (HAND1 , NCAM1 and GYPB) are shown in UMAP plots. Limited mesoderm cells were observed in this sample.

[0043] Figure 6A shows a schematic overview of the initial differentiation towards the three germ layers; ectoderm (EC), mesoderm (ME) and DE as shown in figure 1A. Inhibition of mesoderm formation by inactivating in hPSCs one or more genes required for the formation of the mesoderm (lineage restriction) efficiently promotes the differentiation towards DE.

[0044] Figure 6B shows (Top panel) In standard condition, a narrow range of CHIR99021 concentration exists where too low CHIR99021 concentration results in incomplete differentiation resulting in residual hPSCs contamination and too high CHIR99021 concentration results in mesoderm contamination.

[0045] (Bottom panel) Inhibition of mesoderm formation through lineage restriction results in use of CHIR99021 over a broad range for efficient DE induction without residual hPSCs.

[0046] Figure 7A shows a set of UMAP plots (Top panel) FOXA2 expression and (Bottom panel) MESP1 expression, in a scRNA-seq time series of hPSCs to DE differentiation (as outlined in figure 2A, analysis as shown in figure 5A). It is expected that the mesoderm / endoderm bifurcation observed at DE02 / DE03 (see figure 5) is already determined at the DE01 (PS) stage. DE01 (PS, 24h time point) samples are shown, with UMAP plots for all three repeats of the same differentiation protocol diff. #1 , diff.#2 and diff. #3 (Left panel), UMAP plots from the two repeats of the same differentiation protocol (diff. #1 and diff. #3) with mesoderm contamination observed at DE02-DE03 (Middle panel) and UMAP plots containing the sample from the one repeat of the same differentiation protocol (diff. #2) with limited mesoderm contamination observed at DE02- DE03 (Right panel). FOXA2 is pre-defined as an on-target gene for further DE differentiation, MESP1 is pre-defined as an off-target gene. The analysis illustrates the presence of more and higher expression of MESP1 in the two differentiations with mesoderm contamination and vice versa for FOXA2. Figure 7B shows DE01 (PS) on- and off-target module scores. Three genes were pre-defined as on-target genes (FOXA2, LEFTY1 , GDF3) and three pre-defined as off- target genes (HES7, MESP1 , TBX6) for further DE differentiation. The pre-defined genes were used to calculate on- and off-target module scores. DE01 cells with unique on-target module scores (lower right part of plot, 578 cells), with unique off-target module scores (upper left part of plot, 638 cells) and undefined (middle part of the plot, 2271 cells) were extracted.

[0047] Figure 7C shows a volcano plot of differentially expressed genes in DE01 on- target (right side) vs. off-target cells (left side). Selected genes are highlighted with names.

[0048] Figure 8 shows a flow cytometry analysis of the pluripotency markers SOX2 and OCT3 / 4 (POU5F1) in the two MESP1 / MESP2 hPSCs double Knock-out (KO) clones (EST008.B1 , EST008.B2) as well as three control hPSCs clones (Ctrl. 1 , 2 and 3), all derived from the same parental hPSCs line. The analysis demonstrates high and comparable expression of SOX2 and OCT3 / 4 indicating that all five hPSCs clones retain expression of key pluripotency transcription factors after genetic engineering.

[0049] Figure 9 shows a schematic outline of differentiation of MESP1 / MESP2 double Knock-out (KO) clones (EST008.B1 , EST008.B2) and control clones (Ctrl. 1 , 2 and 3). Undifferentiated hPSCs were seeded as single cells (UD00) in small-scale bioreactors to form undifferentiated hPSCs aggregates for 72h (DE00). hPSCs aggregates were distributed into 6-well low attachment plates and treated with 4, 5 or 6pM CHIR99021 for 24h, followed by treatment with a constant concentration of Activin A for 72h. DE (at DE04) cells were analyzed by flow cytometry for markers of DE as well as hPSCs and mesoderm.

[0050] Figure 10 shows DE (at DE04) cells obtained according to experimental outline in figure 9 analyzed by flow cytometry for the undifferentiated hPSCs markers OCT3 / 4 and SOX2. (Top panel) dot plots show samples treated with 4pM CHIR99021 for the first 24h of the differentiation. (Middle panel) dot plots show samples treated with 5pM CHIR99021 for the first 24h of the differentiation. (Bottom panel) dot plots show samples treated with 6pM CHIR99021 for the first 24h of the differentiation.

[0051] Figure 11 shows a summary graph of flow cytometry results shown in figure 10. Samples (Ctrl clone and two MESP1 / 2 KO lines) when treated with increasing concentrations of CHIR99021 result in a decrease of percentage of residual hPSCs (SOX2+, OCT3 / 4+ cells) observed at DE04. Figure 12 shows a flow cytometry analysis of hPSCs differentiated to DE (at DE04) according to experimental outline in figure 9. (Top panel) dot plots show samples treated with 4pM CHIR99021 for the first 24h of the differentiation. (Middle panel) dot plots show samples treated with 5pM CHIR99021 for the first 24h of the differentiation. (Bottom panel) dot plots show samples treated with 6pM CHIR99021 for the first 24h of the differentiation. DE (at DE04) cells were analysed for the DE markers FOXA2 and SOX17.

[0052] Figure 13 shows a summary graph of flow cytometry results shown in figure 12. Increasing concentrations of CHIR99021 results in a decrease in percentage of DE cells (at DE04) in the three Ctrl, clones but not the two MESP1 / 2 KO lines (EST008 B1 , EST008 B2).

[0053] Figure 14 shows a flow cytometry analysis of hPSCs differentiated into DE (at DE04) according to experimental outline in figure 9. DE (at DE04) cells were analysed for the DE marker SOX17 and the mesoderm / endothelial marker VE-CADHERIN (VE-CAD).

[0054] Figure 15 shows a summary graph of DE (DE04) samples across the three different CHIR99021 concentrations analysed by flow cytometry for the mesodermal marker VE-CAD and SOX17 expression as shown in figure 14. Increasing concentrations of CHIR99021 results in an increase in VE-CAD+ cells in the three Ctrl, clones but not the two MESP1 / 2 KO lines (EST008 B1 , EST008 B2).

[0055] Figure 16A shows a schematic outline of differentiation experiment of MESP1 / MESP2 KO clones (EST008.B1 , EST008.B2) and control clones (Ctrl. 1 , 2 and 3) in small scale bioreactors. Undifferentiated hPSCs were seeded as single cells (UD00) in small-scale bioreactors to form undifferentiated hPSCs aggregates for 72h (DE00). hPSCs aggregates from MESP1 / MESP2 KO clones (EST008.B1 , EST008.B2) were pooled 1 :1 in a small-scale bioreactor and control clones (Ctrl. 1 , 2 and 3) were pooled 1 :1 :1 in a small-scale bioreactor. hPSCs aggregates were treated with 5pM CHIR99021 for 24h, followed by treatment with a constant concentration of Activin A for 72h. DE (at DE04) cells were analyzed by flow cytometry for markers of DE and hPSCs.

[0056] Figure 16B shows a flow cytometry analysis of hPSCs differentiated to DE (at DE04) cells according to experimental outline in figure 16 A. (Dot plots show samples analyzed for FOXA2 and SOX17 both in MESP1 / MESP2 KO clone pool and Ctrl pool. The DE differentiation efficiency was higher in the MESP1 / MESP2 KO clone pool compared to the Ctrl, pool (99.2% vs. 95.2% SOX17+ / FOXA2+ cells, respectively). A higher presence of mesoderm contaminant (SOX17+ / FOXA2- and SOX17- / FOXA2-) was observed in the Ctrl, pool compared to the MESP1 / MESP2 KO clone pool. Figure 17A is a schematic outline of the differentiation of hPSCs towards first DE, then pancreatic endoderm and finally towards endocrine cells including beta cells. Genes listed below the cell stages in the schematic are used as markers for the different cell populations by flow cytometry analysis. Cells co-expressing ISL1 and NKX6-1 are considered hPSCs-derived beta cells. Both MESP1 / 2 KO and Ctrl. hPSCs lines were differentiated according to schematic in small-scale bioreactor formats.

[0057] Figure 17B shows SOX17 and FOXA2 flow cytometry analysis of MESP1 / 2 and Ctrl hPSCs differentiated towards DE. Dot plot is representative example, and graph summarizes the percentage of cells co-expressing SOX17 and FOXA2 at the DE stage, n = 4 for MESP1 / 2 hPSCs lines and n =5 for Ctrl. hPSCs lines. *P < 0.05. The significant lower percentage of DE in the Ctrl. hPSCs lines compared to the MESP1 / 2 KO lines is a consequence of varying levels of mesoderm contamination occurring only in the control lines.

[0058] Figure 17C shows PDX1 and NKX6-1 flow cytometry analysis of MESP1 / 2 and Ctrl. hPSCs differentiated towards pancreatic endoderm. Dot plots is representative example and the graph summarizes the percentage of cells co-expressing PDX1 and NKX6-1 at the pancreatic endoderm stage, n = 4 for MESP1 / 2 hPSCs lines and n =5 for Ctrl. hPSCs lines. No statistically significant difference between the two groups.

[0059] Figure 17D shows ISL1 and NKX6-1 flow cytometry analysis of MESP1 / 2 and Ctrl. hPSCs differentiated towards beta cell stage. Dot plot is representative example, and the graph summarizes the percentage of cells co-expressing ISL1 and NKX6-1 at the beta cell stage, n = 4 for MESP1 / 2 hPSCs lines and n =5 for Ctrl. hPSCs lines. No statistically significant difference between the two groups. Together the results show that both MESP1 / 2 KO and Ctrl. hPSCs can be differentiated efficiently towards the pancreatic lineage and beta cells.

[0060] Figure 18A shows FOXA2 and VE-CADHERIN (VE-CAD) flow cytometry analysis of MESP1 / 2 and Ctrl. hPSCs differentiated four days into the pancreatic endoderm (PE) stage. Dot plots are shown as representative examples for MESP1 / 2 and Ctrl. hPSCs differentiations. VE-CAD is primarily expressed on mesoderm-derived cells. FOXA2- positive cells are of endoderm origin.

[0061] Figure 18B shows a graph summarizing the percentage of FOXA2 cells expressing VE-CAD, n = 2. Flow cytometry analysis demonstrates that knock-out of MESP1 / 2 eliminates the presence of mesoderm-derived cells during the differentiation towards the pancreatic lineage. Figure 19A shows a Uniform Manifold Approximation and Projection (UMAP) plot of the scRNA-seq data from Ctrl, and MESP1 / 2 KO clones differentiated to the pancreatic endocrine cell stage. Eight unique cell populations (clusters) are identified and annotated according to the gene expression signature. Cluster 1 contains hPSCs-derived beta cells expressing INS, ISL1 and NKX6-1.

[0062] Figure 19B shows expression levels of select genes for Beta cells (INS, ISL1), Alpha cells (ARX, GCG), Delta cells (SST, HHEX) and Enterochromaffin cells (TPH1 , LMX1A) in individual UMAPs.

[0063] Figure 19C shows expression of select genes for mesoderm-derived off-target cells shown in individual UMAPs (cluster 8 marked with dashed circle).

[0064] Figure 20 shows scRNA-seq analysis UMAP of individual Ctrl, and MESP1 / 2 KO clones hESC lines differentiated to pancreatic endocrine cells. All endocrine subpopulations, including beta cells (cluster 1) are present in both Ctrl, and MESP1 / 2 KO clones, supporting that the ability to generate beta cells is not affected by the knockout of MESP1 / 2. Noteworthy, mesoderm-derived off-target cells (cluster s, marked by dashed circle) are only identified in the two Ctrl. hPSCs lines whereas no mesoderm-derived off- target cells were detected in the MESP1 / 2 KO sample. Thus, prevention of mesoderm during differentiation to DE results in the absence of mesoderm-derived off-target lineages upon further differentiation towards the pancreatic endocrine lineage, including beta cells.

[0065] Figure 21 shows flow cytometry analysis of the pluripotency markers SOX2 and OCT3 / 4 (POU5F1) in the two TBXT hPSCs Knock-out (KO) clones (TBXT_7_36_KO, TBXT_10_22 KO) as well as two control hPSCs clones (Ctrl. 1 and 3), all derived from the same parental hPSCs line. The analysis demonstrates high and comparable expression of SOX2 and OCT3 / 4 indicating that all four hPSCs clones retain pluripotency after genetic engineering.

[0066] Figure 22 shows data evaluating the knockout of TBXT on a protein level. hPSCs were treated with 4uM CHIR for 24h to induce differentiation to the primitive streak stage (PS), where TBXT is expressed. Both Ctrl, and TBXT KO clones were differentiated and harvested for flow cytometry analysis of TBXT expression. Histogram of a Ctrl, and TBXT KO hPSCs line differentiated to the PS stage. Solid line shows Ctrl, clone and dotted line shows TBXT KO clone. The Ctrl, clone shows much higher expression of TBXT compared to the TBXT KO clone that has a reduced expression of TBXT, thus validating the knockout of TBXT on protein level. Figure 23A is a schematic outlining the differentiation of hPSCs towards first DE, then pancreatic endoderm and finally towards endocrine cells incl. Beta cells. Genes listed below the schematic are used as markers for the different cell populations by flow cytometry analysis. Cells co-expressing ISL1 and NKX6-1 are considered hPSCs-derived beta cells. Both TBXT KO and Ctrl. hPSCs lines were differentiated according to schematic in small-scale bioreactor formats.

[0067] Figure 23B shows SOX17 and FOXA2 flow cytometry analysis of TBXT and Ctrl. hPSCs differentiated towards DE. Dot plot is representative example, and the graph summarizes the percentage of cells co-expressing SOX17 and FOXA2 at the DE stage, n = 2 for both TBXT hPSCs lines and Ctrl. hPSCs lines. A lower percentage of DE in the Ctrl. hPSCs lines compared to the TBXT KO lines is a likely consequence of increased levels of mesoderm contamination occuring only in the control lines.

[0068] Figure 23C shows PDX1 and NKX6-1 flow cytometry analysis of TBXT and Ctrl. hPSCs differentiated towards pancreatic endoderm. Dot plot is representative example and the graph summarizes the percentage of cells co-expressing PDX1 and NKX6-1 at the pancreatic endoderm stage, n = 2 for both TBXT hPSCs lines and Ctrl. hPSCs lines.

[0069] Figure 23D shows ISL1 and NKX6-1 flow cytometry analysis of TBXT and Ctrl. hPSCs differentiated towards beta cell stage. Dot plot is representative example, and the graph summarizes the percentage of cells co-expressing ISL1 and NKX6-1 at the beta cell stage, n = 2 for both TBXT hPSCs lines and Ctrl. hPSCs lines. The results demonstrate that both TBXT KO and Ctrl. hPSCs can be differentiated efficiently towards the pancreatic lineage and beta cells.

[0070] Figure 24A shows FOXA2 and VE-CADHERIN (VE-CAD) flow cytometry analysis of TBXT and Ctrl. hPSCs differentiated four days into the pancreatic endoderm stage. Dot plots are shown as representative examples for TBXT and Ctrl. hPSCs differentiations. VE-CAD is primarily expressed on mesoderm-derived cells. FOXA2 positive cells are considered of endoderm origin.

[0071] Figure 24B shows the graph summarizing the percentage of FOXA2 cells expressing VE-CAD, n = 2. Flow cytometry analysis demonstrates that knock-out of TBXT reduces the presence of mesoderm-derived cells during the differentiation towards the pancreatic lineage.

[0072] Figure 25A is a schematic outlining the differentiation of hPSCs towards DE. Cells were differentiated for the first 24h either in the presence of Wnt signalling agonist, either 4pM CHIR or 1 pM of CP21 R7. DE was then differentiated for four days towards pancreatic endoderm. Both MESP1 / 2 KO and Ctrl. hPSCs lines were differentiated according to schematic in small-scale bioreactor formats. Cells co-expressing FOXA2 and SOX17 at the DE stage are regarded as DE. Cells expressing FOXA2 and PDX1 at the PE stage are regarded as pancreatic endoderm. At both DE and PE, cells expressing only SOX17 (SOX17+, FOXA2-) are regarded as an off-target population derived from mesoderm.

[0073] Figure 25B shows SOX17 and FOXA2 flow cytometry analysis of MESP1 / 2 and Ctrl. hPSCs differentiated towards DE. The efficiency of differentiation towards DE is much higher for the MESP1 / 2 KO hPSCs line compared to the Ctrl. hPSCs line, independent of whether CHIR or CP21 R27 was used to induce differentiation. A much higher level of mesoderm contamination is observed in the Ctrl. hPSCs line.

[0074] Figure 25C shows SOX17 and FOXA2 flow cytometry analysis of MESP1 / 2 and Ctrl. hPSCs differentiated towards DE (as in B) and further towards pancreatic endoderm. The efficiency of differentiation towards PE is much higher for the MESP1 / 2 KO hPSCs line compared to the Ctrl. hPSCs line, independent of whether CHIR or CP21 R27 is used. A much higher level of mesoderm contamination is observed in the Ctrl. hPSCs line, also independent of whether CHIR or CP21 R27 was used to induce differentiation. Together, these results show, that independent of Wnt signalling agonist used for inducing differentiation of hPSCs, the knock-out of MESP1 and MESP2 prevents formation of mesoderm off-targets during differentiation towards DE and downstream lineages thereof.

[0075] Figure 26A is schematic outlining the differentiation of hPSCs towards first DE (DE). Cells were differentiated for the first 24h either in the presence of 4pM or using an alternative Wnt signalling agonist (1 pM of CP21 R7). DE was then differentiated for four days towards pancreatic endoderm. Both MESP1 / 2 KO and Ctrl. hPSCs lines were differentiated according to schematic in small-scale bioreactor formats.

[0076] Figure 26B shows cells expressing FOXA2 (FOXA2+, VE-CAD-) at the PE stage are regarded as pancreatic endoderm, whereas cells expressing VE-CAD (FOXA2-, VE- CAD+) are regarded as an off-target population derived from mesoderm. A much higher level of mesoderm contamination (FOXA2-, VE-CAD+) is observed in the Ctrl. hPSCs line, also independent of whether CHIR or CP21 R27 was used to induce differentiation. Together, these results show, that independent of Wnt signalling agonist used for inducing differentiation of hPSCs, the knock-out of MESP1 and MESP2 prevents formation of mesoderm off-targets during differentiation towards DE and downstream lineages thereof. DETAILED DESCRIPTION

[0077] Differentiation of hPSCs towards DE comprises an intermediate step of PS formation. This is a bifurcating step where PS can differentiate either into desired DE or into unwanted mesoderm that is an off-target cell population (see figure 1A). The fate of differentiation into DE or mesoderm is dependent on the Wnt signalling pathway activation, which can be accomplished by a WNT signalling activator. However, efficient differentiation of hPSCs towards DE is challenging. This is because on one hand, too low WNT activation results in incomplete induction of DE i.e. not all the hPSCs differentiate into DE resulting in the presence of unwanted / contaminating residual (undifferentiated) hPSCs. On the other hand, too high WNT activation results in patterning of the PS towards mesoderm rather than DE thus resulting in formation of unwanted / contaminating off target mesodermal cell populations (see figure 1B). The off target mesodermal cell population persists during the downstream differentiation process up to the PEC stage. This is evident by the presence of off target mesodermal-derived cell populations in Drug Substance (DS)ZDrug Product (DP) (see figures 3 and 4).

[0078] The residual hPSCs and / or off target mesodermal cell populations pose a significant safety risk through unwanted cell growth observed in vivo upon transplantation of PEC obtained by further differentiation of DE comprising the residual hPSCs and / or off target mesodermal cell populations.

[0079] The present inventors have demonstrated that the presence or absence of off target mesodermal cell populations or extent of mesodermal contamination varies from one repeat to another for the same differentiation protocol when used for differentiating hPSCs into DE (see figures 5C and 5D; and figure 7A). Thus, variation amongst repeats of the same differentiation protocol presents a significant issue with regards to unwanted cells produced during the differentiation of hPSCs into DE.

[0080] This further emphasizes on the need for robust, reliable, reproducible, and efficient methods for inhibiting the formation of these mesodermal cell populations and / or eliminating or reducing the residual hPSCs. These methods could then be either used alone or in combination with differentiation protocols that have been optimized with a focus on elimination of unwanted cells arising during differentiation of hPSCs into DE.

[0081] The present inventors have found efficient methods for inducing DE from hPSCs by inhibiting the formation of off-target mesodermal cell population and / or by eliminating or reducing the residual hPSCs during the differentiation of hPSCs into DE.

[0082] The present invention provides a method for inhibiting formation of off target mesodermal cell population during differentiation of hPSCs into DE by inactivating in the hPSCs i.e. prior to differentiation, one or more genes required for the formation of the off- target cell population(s).

[0083] Advantageously, the present invention also provides an efficient method for differentiation of the hPSCs, where one or more genes required for the formation of mesodermal cell population(s) have been inactivated, into DE such that there are no or reduced number of residual hPSCs and / or mesodermal cells. This efficient differentiation process where most or all the hPSCs are differentiated into DE results in a homogenous and pure DE cell population that can be further differentiated in a stepwise manner to obtain PEC for use as an improved cell therapy product for the treatment of type 1 diabetes, that is safer for patients.

[0084] The present invention relates to a method for inhibiting the expression of one or more genes in a population of DE cells comprising the steps of: a) obtaining hPSCs, b) inactivating in the hPSCs the one or more genes required for the formation of an off-target cell population, c) differentiating the hPSCs into DE cells by treating the hPSCs in a culture medium.

[0085] The present inventors have also found that once the formation of the mesodermal cell population is inhibited during the differentiation of hPSCs into DE through inactivation of genes essential to formation of mesodermal cell population, the number of residual hPSCs can be eliminated by increasing the concentration range in which WNT signalling activator can promote induction of DE.

[0086] Unless otherwise stated, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. The practice of the present invention employs, unless otherwise indicated, conventional methods of chemistry, biochemistry, biophysics, molecular biology, cell biology, genetics, immunology, and pharmacology, known to those skilled in the art.

[0087] It is noted that all headings and sub-headings are used herein for convenience only and should not be construed as limiting the invention in any way.

[0088] The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. Definitions

[0089] General definitions

[0090] As used herein, “a” or “an” or “the” can mean one or more than one. Unless otherwise indicated in the specification, terms presented in singular form also include the plural situation.

[0091] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”). Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.

[0092] Allele

[0093] The term “allele” as used herein means a variant of a given gene. For example, MESP1_allele1 and MESP1_allele2 are variants, also called alleles or isotypes, of the MESP1 gene.

[0094] Stem cells

[0095] As used herein, the term “stem cell” refers to an undifferentiated cell having proliferative capacity (particularly self-renewal competence) but maintaining differentiation potency. The term “stem cell” includes categories such as pluripotent stem cell, multipotent stem cell, and the like according to their differentiation potentiality.

[0096] As used herein, the term “pluripotent stem cell” (PSC)” refers to a stem cell capable of being cultured in vitro and having a potency to differentiate into any cell lineage belonging to the three germ layers (ectoderm, mesoderm, endoderm) and / or extraembryonic tissue (pluripotency). Examples of the pluripotent stem cell (PSC) include embryonic stem cell (ESC), EG cell (embryonic germ cell), induced pluripotent stem cell (iPSC) and the like.

[0097] In one embodiment, the cells of the method of the present invention are pluripotent stem cells.

[0098] In one embodiment, the DE cell population of the present invention is obtained from pluripotent stem cells.

[0099] As used herein, "hPSCs" (hPSCs) refers to hPSCs that can be derived from any source and that are capable, under appropriate conditions, of producing human progeny of different cell types that are derivatives ofany one of the three germ layers (endoderm, mesoderm, and ectoderm) which can further differentiate into various human cell types. In one embodiment, the cells of the method of the present invention are hPSCs.

[0100] In one embodiment, the DE cell population of the present invention is obtained from hPSCs.

[0101] In one embodiment, the hPSCs cells of the method of the present invention are SOX2+ / OCT3 / 4+ double positive. OCT3 / 4 refers to gene identified by ENSG00000204531.

[0102] As used herein, the term “induced pluripotent stem cell” (also known as iPS cells or iPSCs) means a type of pluripotent stem cell that can be generated directly from cells that are not PSCs and have a nucleus. By the introduction of products of specific sets of pluripotency-associated genes non-pluripotent cells can be converted into pluripotent stem cells.

[0103] In one embodiment, the cells of the method of the present invention are induced pluripotent stem cells.

[0104] In one embodiment, the DE cell population of the present invention is obtained from induced pluripotent stem cells.

[0105] As used herein, the term “embryonic stem cell” means a pluripotent stem cell derived from parthenotes as described in e.g. WO 2003 / 046141. Preferably, the methods and products of the present invention are based on human PSCs, i.e. stem cells derived from either human induced pluripotent stem cells or human embryonic stem cells, including parthenotes.

[0106] As used herein, the term “multipotent stem cell” means a stem cell having a potency to differentiate into plural types of tissues or cells, though not all kinds and is typically restricted to one germ layer.

[0107] As used herein, the term “artificial” in reference to cells may comprise material naturally occurring in nature but modified to a construct not naturally occurring. This includes human stem cells, which are differentiated into non-naturally occurring cells mimicking the cells of the human body.

[0108] As used herein, the term “undifferentiated” pluripotent stem cell or human pluripotent stem cell or induced pluripotent stem cell means that such cell has not differentiated into another cell type.

[0109] Method

[0110] As used herein, the term “method” refers to a process comprising or consisting of one or more or a series of steps performed to obtain the desired outcome or product. Throughout this application the terms “method” and “protocol”, when referring to processes for differentiating cells, may be used interchangeably.

[0111] As used herein, the term “step” in relation to methods as described herein is to be understood as a stage, where something is undertaken and / or an action is performed. It will be understood by one of ordinary skill in the art when the step(s) to be performed is a first step or an intermediate step occurring between one or more steps or a final step and / or the steps undertaking are concurrent and / or successive and / or continuous.

[0112] As used herein, the term “day” and similarly day in vitro (DIV), in reference to the protocols, refers to a specific time for carrying out certain steps during the differentiation procedure. It will be understood by one of ordinary skill in the art when the day is expressed alternatively in hours.

[0113] In general, and unless otherwise stated, “day 0” refers to the initiation of the protocol, this be by for example but not limited to plating the cells or transferring the cells to an incubator or contacting the cells in their current cell culture medium with a compound prior to transfer of the cells. Typically, the initiation of the protocol will be by transferring the cells, such as e.g. undifferentiated stem cells, DE cells, pancreatic endoderm cell, pancreatic endocrine progenitor (EP) cells or pancreatic endocrine (PEC) cells to a different cell culture medium and / or container such as, but not limited to, by plating or incubating, and / or with the first contacting of the cells with a compound or compounds that affects the undifferentiated stem cells in such a way that a differentiation process is initiated.

[0114] When referring to “day X”, such as day 1 , day 2 etc., it is relative to the initiation of the protocol at day 0. One of ordinary skill in the art will recognize that unless otherwise specified the exact time of the day for carrying out the step may vary. Accordingly, “day X” is meant to encompass a time span such as of + / -10 hours, + / -8 hours, + / -6 hours, +1-4 hours, + / -2 hours, or + / -1 hours. One of ordinary skill in the art will understand that the days can be used in combination with the cell stage for e.g. DE02 means DE at day 2, DE04 means DE at day 4 etc.

[0115] As used herein, the phrase “from at about day X to at about day Y” refers to a day at which an event starts from. The phrase provides an interval of days on which the event may start from. For example, if “cells are contacted with a differentiating factor from at about day 3 to at about day 5” then this is to be construed as encompassing all the options: “the cells are contacted with a differentiating factor from about day 3”, “the cells are contacted with a differentiating factor from about day 4”, and “the cells are contacted with a differentiating factor from about day 5”. Accordingly, this phrase should not be construed as the event only occurring in the interval from day 3 to day 5. This applies mutatis mutandis to the phrase “to at about day X to at about day Y”.

[0116] Culturing stem cells

[0117] As used herein, the term “culturing” refers to a continuous procedure, which is employed throughout the method to maintain the viability of the cells at their various stages. After the cells of interest have been isolated from, for example but not limited to, living tissue or embryo, they are subsequently maintained under carefully controlled conditions. These conditions vary for each cell type, but generally consist of a suitable vessel with a substrate and / or medium that supplies the essential nutrients (amino acids, carbohydrates, vitamins, minerals), growth factors, hormones, and gases (CO2, O2), and regulates the physio-chemical environment (pH buffer, osmotic pressure, temperature).

[0118] As used herein, the term “cell culture medium” refers to a liquid or gel designed to support the growth of cells. Cell culture media generally comprise an appropriate source of energy and compounds which regulate the cell cycle. Cell culture media for PSC, ESC, iPSC, DE, insulin secreting cells etc. are well defined in the art [Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells - PubMed (nih.gov)]

[0119] As used herein, the term “incubator” refers to any suitable incubator that may support a cell culture. Non-limiting examples include culture dish, petri dish and plate (microtiter plate, microplate, deep well plate etc. of 6 well, 24 well, 48 well, 96 well, 384 well, 9600 well and the like), flask, chamber slide, tube, Cell Factory, roller bottle, spinner flask, hollow fiber, microcarrier, or bead.

[0120] As used herein, the term “providing or obtaining stem cells” when referred to in a protocol means obtaining a batch of cells by methods such as described above and optionally transferring the cells into a different environment such as by seeding onto a new substrate. One of ordinary skill in the art will readily recognize that stem cells are fragile to such transfer and the procedure requires diligence and that maintaining the stem cells in the origin cell culture medium may facilitate a more sustainable transfer of the cells before replacing a cell culture medium with another cell culture medium more suitable for a further differentiation process.

[0121] As used herein the term “inactivating of gene” means the process of disrupting the function of a specific gene by way of knock out by genetic engineering or knock down that is transient, via siRNA or similar technology. As used herein, the term “treating” refers to applying cell medium containing factors (growth factors and / or small molecule agonists / antagonists) to the hPSCs, where the” treatment” leads to a response from the hPSCs, in this context the response being ’’differentiation”.

[0122] Differentiating stem cells

[0123] As used herein, the term “expressing or expression” in relation to a gene or protein refers to the presence of an RNA molecule, which can be detected using assays such as reverse transcription quantitative polymerase chain reaction (RT-qPCR), RNA sequencing and the like, and / or a protein, which can be detected for example using antibody-based assays such as flow cytometry, immunocytochemistry / immunofluorescence, and the like. Depending on the sensitivity and specificity of the assay, a gene or protein may be considered expressed when a minimum of one molecule is detected such as in RNA sequencing, or the limit of detection above background / noise levels may be defined in relation to control samples such as in flow cytometry.

[0124] As used herein, the term “marker” refers to a naturally occurring identifiable expression made by a cell, which can be correlated with certain properties of the cell. In a preferred embodiment the marker is a genetic or proteomic expression, which can be detected and correlated with the identity of the cell. The markers may be referred to by gene. This can readily be translated into the expression of the corresponding mRNA and proteins.

[0125] As used herein, the term “negative” or when used in reference to any marker such as a surface protein or transcription factor disclosed herein refers to the marker not being expressed in a cell or a population of cells, while the term “weak” or “low” refers to the marker being expressed at a reduced level in a cell as compared to the mean expression of the marker in a population of cells or as compared to a reference sample.

[0126] As used herein, the term “reduced expression” in reference to a gene refers to a decrease in the amount or level of RNA transcript (e.g., mRNA) of the gene, a decrease in the amount or level of protein encoded by the gene, and / or a decrease in the amount or level of activity of the gene in a cell or a population of cells, when compared to an appropriate reference (e.g., a reference cell or population of cells).

[0127] As used herein, the term “double negative” refers to two markers not being expressed in a cell or a population of cells.

[0128] As used herein, the term “positive” or “+“ when used in reference to any marker such as a surface protein or transcription factor disclosed herein refers to the marker being expressed in a cell or a population of cells, while the term “high” or “strong” refers to the marker being expressed at an increased level in a cell as compared to the mean expression of the marker in a population of cells or as compared to a reference sample.

[0129] As used herein, the term “double positive” refers to two markers being expressed in a cell or a population of cells.

[0130] As used herein, the term "differentiation" or “differentiate” or “differentiating” refers broadly to the process wherein cells progress from an undifferentiated state or a state different from the intended differentiated state to a specific differentiated state, e.g. from an immature state to a less immature state or from an immature state to a mature state, which may occur continuously as the method is performed. Changes in cell interaction and maturation occur as cells lose markers of undifferentiated cells or gain markers of differentiated cells. Loss or gain of a single marker can indicate that a cell has “fully differentiated" or “terminally differentiated”. “Terminally differentiated” cells are the final stage of a developmental lineage and cannot further differentiate. hPSCs are differentiated towards pancreatic endocrine (PEC) cells in a stepwise manner through distinct stages. These stages include DE, pancreatic endoderm (PE), endocrine progenitor (EP) and finally to pancreatic islet cells (also denoted PEC) (Madsen et al. - Nat Biotechnol. - 2006 Dec, 24(12):1481-3).

[0131] The term "differentiation factor" refers to a compound added to stem cells to enhance their differentiation into mature cells. In one embodiment, differentiation factor is added to pluripotent stem cell to enhance their differentiation into DE cell.

[0132] Exemplary differentiation factors include hepatocyte growth factor, keratinocyte growth factor, exendin-4, basic fibroblast growth factor, insulin-like growth factor-1 , epidermal growth factor platelet-derived growth factor, and glucagon-like peptide 1. In aspects of the invention, differentiation of the cells comprises culturing the cells in a medium comprising one or more differentiation factors.

[0133] In one embodiment, differentiation of the cells comprises culturing the cells in a medium comprising one or more differentiation factors.

[0134] As used herein, the term “for further differentiation” or “capable of further differentiation” refers to the ability of a differentiated cell to progress from a differentiated state to a more mature state either directly or in a stepwise manner e.g. DE “for further differentiation” into insulin producing cells means that the DE cells are capable of differentiating into insulin producing cells when subjected to a suitable differentiation protocol. In some embodiments, the DE obtainable by the methods of the present invention are further differentiated into pancreatic endocrine cells.

[0135] As used herein, the term “residual hPSCs” refers to the “undifferentiated” pluripotent stem cell or hPSCs or iPSC that has not differentiated into another cell type and remain in the cell culture medium even after the cells have been subjected to a suitable differentiation protocol.

[0136] As used herein, by the term “contacting” in reference to culturing or differentiating cells is meant exposing the cells to e.g. a specific compound by placing the specific compound in a location that will allow it to touch the cell in order to produce "contacted" cells. The contacting may be accomplished using any suitable means. A non-limiting example of contacting is by adding the compound to a cell culture medium of the cells. The contacting of the cells is assumed to occur as long as the cells and specific compound are in proximity, e.g. the compound is present in a suitable concentration in the cell culture medium.

[0137] As used herein, the term “inhibiting”, or “inhibition” refers to a reduction or suppression or down-regulation of a process such as a signaling pathway which can promote cell differentiation or formation of a cell population. Inhibition can be partial inhibition or complete inhibition.

[0138] As used herein, the term "inhibitor" refers to a compound that reduces or suppresses or down-regulates a process, such as a signaling pathway which can promote cell differentiation or formation of a cell population.

[0139] As used herein, the term “activation” refers to induction or stimulation or upregulation of a process, such as a signaling pathway which can promote cell differentiation or formation of a cell population.

[0140] As used herein, the term “activator” refers to a compound that induces or stimulates or up-regulates a process, such as a signaling pathway which can promote cell differentiation or formation of a cell population.

[0141] As used herein, “WNT signalling activator” or “WNT agonist” refers to the WNT ligand protein of the signalling pathways or any component of the signalling transduction pathways besides the ligand protein, (e.g. the receptors, transducers, signalling mediators).

[0142] Non limiting examples of WNT signalling activator include CHIR99021 or CP21 R7 or WNT3a or BIO or other family member of the WNT signalling pathway.

[0143] In one embodiment, WNT signalling activator is CHIR99021

[0144] In one embodiment, the present invention relates to a method of differentiating hPSCs into DE cells comprising the step of culturing said hPSCs in a cell culture medium comprising a WNT signalling agonist.

[0145] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration in the range 0.5-25 pM in the culture medium.

[0146] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration of at least 1 pM.

[0147] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration in the range 2-8 pM.

[0148] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration in the range of 3-6 pM.

[0149] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration of at least 4 pM.

[0150] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration of at least 5 pM.

[0151] In one embodiment, the method of the present invention comprises a WNT signalling activator in a concentration of at least 6 pM. Inhibitors of glycogen synthase kinase 3

[0152] CHIR is a glycogen synthase kinase 3 (Gsk3b) inhibitor and a known component of a defined tissue culture medium to maintain mouse embryonic stem cells in the pluripotent state (Ying et al Nature 453, 519-523). Gsk3b has multiple targets but is mainly known to regulate degradation and / or nuclear transfer of beta-catenin. The role of stabilized beta-catenin in PS formation from human embryonic stem cells (hESC) has been described using other glycogen synthase kinase 3 (Gsk3b) inhibitors such as BIO. However, CHIR is the most selective Gsk3b-inhibitor reported to date.

[0153] As used herein, “CHIR” or “CHIR99021”, is a patented commercially available glycogen synthase kinase 3 (Gsk3b) inhibitor covered in patent US6417185 and described by Goff, D. A., et al. (2002).

[0154] In one embodiment the WNT signalling activator is CHIR99021 .

[0155] In one embodiment, the present invention relates to a method of differentiating hPSCs into DE cells comprising the step of culturing the hPSCs in a cell culture medium comprising CHIR99021.

[0156] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration in the range 0.5-25 pM.

[0157] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration in the range 2-8 pM.

[0158] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration in the range of 3-6 pM pM.

[0159] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration of at least 4 pM.

[0160] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration of at least 5 pM.

[0161] In one embodiment, the method of the present invention comprises CHIR99021 in a concentration of at least 6 pM.

[0162] As used herein, when describing the steps of a protocol the cells may be referred to as “cells”, “differentiating cells” or in some cases PSCs or “PSC-derived cells”. A skilled person will recognize that during a protocol for differentiating PSCs into specialized cells, the cells at some point lose their pluripotency. Accordingly, when referring the “cells” or “PSCs” or hPSCs” in a step of e.g. contacting the cells with a compound is meant the cells which initially were pluripotent stem cells. As used herein, the term “in vitro" means that the cells are provided and maintained outside of the human or animal body, such as in a vessel like a flask, multiwell or petri dish. It follows that the cells are cultured in a cell culturing medium.

[0163] As used herein, the term “on-target cell population” is a desired cell lineage obtained by cell differentiation specifically directed towards said cell lineage. For example, when definitive endoderm cells are the desired cells and these are obtained by directed differentiation of human pluripotent stem definitive endoderm is referred to as “on-target cell population.

[0164] In one embodiment, definitive endoderm is the on-target cell population.

[0165] In one embodiment, pancreatic endocrine cell population is the on-target cell population.

[0166] As used herein, the term “off-target cell population” refers to a cell population of undesired cells that may be of same type or a mixture of different type of cells or cell lineages. Mesodermal or ectodermal or endothelial cell populations are “off-target cell populations” as they are undesired cell populations when obtained during the differentiation of hPSCs towards DE.

[0167] As used herein, the term “mesodermal cell population” or “mesodermal derived cell populations” or “cell population of mesodermal origin” or “mesodermal subtypes” refers to a cell population that is characterized by expression markers including but not limited to markers HAND1, NCAM1, GYPB and / or CDH5 (VE-CAD).

[0168] In a preferred embodiment, off target cell population is a mesodermal cell population.

[0169] In one embodiment, off target cell population of mesodermal cells is endothelial cells.

[0170] Primitive streak (PS)

[0171] As used herein, the term “primitive streak” refers to a transient structure occurring during early human development. It is a region of the epiblast in which precursor cells of the mesoderm and the definitive endoderm ingress during gastrulation when they undergo an epithelial to mesenchymal transition. Definitive Endoderm (DE)

[0172] As used herein, the term “DE”, “DE cells”, or “DE” refers to cells characterized by expression of the marker FOXA2. Optionally, further markers of DE are one or more of the following SOX17. DE cells are important for development of e.g., pancreatic cells.

[0173] "SOX17" (SRY-box 17) as used herein is a member of the SOX (SRY-related HMGbox) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. It refers to gene identified by ENSG00000164736.

[0174] In one embodiment, the DE cells of the method of the present invention are SOX17+ positive.

[0175] "FOXA2" (forkhead box A2) as used herein is a member of the forkhead class of DNA-binding proteins. It refers to the gene identified by ENSG00000125798.

[0176] In one embodiment, the DE cells of the method of the present invention are SOX17+ / FOXA2+ double positive.

[0177] In one embodiment, the DE is obtained by culturing the hPSCs in culture medium comprising a WNT signalling agonist.

[0178] DE cell population can be obtained by one or more known protocols. In the following, references are given to already known protocols for the differentiation of hPSCs into DE:

[0179] DE is commonly derived by treating hPSCs with transforming growth factor p and WNT / p-Catenin agonists (D'Amour et al. - Nat Biotechnol. - 2005 Dec; 23(12): 1534-41 , 2006, 2008; Rezania et al. - Diabetes - 2011 Jan;60(1):239-47, Kubo et al. - Development - 2004 Apr; 131 (7): 1651 -62, Rezania et al. - Nat Biotechnol. - 2014 Nov;32(11):1121-33 Funa et al. - Cell Stem Cell. - 2015 Jun 4;16(6):639-52).

[0180] In one embodiment, DE cell population according to the present invention is obtainable by the protocol described in WO2012 / 175633 (which is incorporated herein by reference in its entirety).

[0181] In a preferred embodiment, DE cell population according to the present invention is obtainable by the protocol described in example 4.

[0182] In one embodiment, the present invention relates to in vitro DE cell population obtainable by the methods of the present invention. In one embodiment, the present invention provides a DE cell population comprising elevated endoderm gene expression and significantly reduced mesoderm gene expression.

[0183] In one embodiment, the present invention provides a DE cell with increased coexpression of SOX17+ / FOXA2+, i.e., with increased expression of SOX17+ / FOXA2+ double positive cells.

[0184] In one embodiment, the present invention provides a DE cell population with no or decreased / reduced expression of VE-Cadherin+ cells.

[0185] In one embodiment, the present invention provides a DE cell population with no or decreased co-expression of HAND1, NCAM1 and GYPB.

[0186] In one embodiment, the present invention provides a DE cell population wherein less than 2% or less than 1% of the cell population are mesodermal cells.

[0187] In one embodiment, the present invention provides a DE cell population obtainable by the methods of the present invention with no or fewer SOX2+ / OCT3 / 4+ double positive cells.

[0188] In one embodiment, the present invention provides a DE cell population obtainable by the methods of the present invention, wherein said population comprises less 2% or less than 1% or less than 0.05% residual hPSCs.

[0189] In one embodiment, the present invention provides a DE cell population wherein less than 2% of the cell population are mesodermal cells and less than 0.05% residual hPSCs.

[0190] In one embodiment, the present invention provides a DE cell population wherein less than 1% of the cell population are mesodermal cells and less than 0.05% residual hPSCs.

[0191] Pancreatic Endoderm (PE)

[0192] As used herein, the term “pancreatic endoderm”, “pancreatic endoderm cells”, “pancreatic progenitors" or “PE” refers to cells characterized by expressing the markers PDX1 and NKX6.1.

[0193] "PDX1" as used herein, refers to a homeodomain transcription factor implicated in pancreas development. PDX1 refers to the gene identified by Ensembl identifier ENSG00000139515. "NKX6.1" as used herein is a member of the NKX transcription factor family. NKX6.1 refers to the gene identified by Ensembl identifier ENSG00000163623.

[0194] In one embodiment, DE cell population obtainable by the methods of the present invention are further differentiated into pancreatic endoderm by one or more known protocols.

[0195] In the following, references are given to already known protocols for the differentiation of DE into pancreatic endoderm: DE is further specified into PDX1 + NKX6.1+ PE population in vitro. Fibroblast growth factor, retinoic acid, sonic hedgehog, epidermal growth factor and bone morphogenic protein signalling pathways have all been implicated in pancreas development and manipulation of these pathways at distinct stages of the differentiation promote highly enriched populations of PE (:D'Amour et al. - Nat Biotechnol. - 2006 Nov;24(11):1392-401 , Kroon et al. - Nat Biotechnol. - 2008 Apr;26(4):443-52, Nostro et al. - Development - 2011 Mar;138(5):861-71 , Rezania et al. - Diabetes - 2012 Aug;61 (8):2016-29, Mfopou et al. - Gastroenterology - 2010 Jun;138(7):2233-45, Ameri et al. - Stem cells - 2010 Jan;28(1):45-56, Russ et al. - EMBO J. - 2015 Jul 2;34(13):1759-72). Additional pathways including protein kinase C, Nicotinamide, WNT, Rho associated kinase and TGF|3 have also been identified to participate in the specification of hPSCs towards the pancreatic lineage (Chen et al.- Nat Chem Biol. - 2009 Apr;5(4):258-65, Rezania et al.- Diabetes - 2012 Aug;61 (8):2016-29, Rezania et al. - Stem Cell - 2013 Nov;31 (11):2432-42, Nostro et al. - Stem Cell Reports - 2015 Apr 14;4(4):591-604, Sharon et al. - Cell Rep. - 2019 May 21 ;27(8):2281-2291 ,e5, Toyoda et al. - Stem Cell Rep. - 2017 Aug 8;9(2):419-428).

[0196] Non-limiting examples of PE inducing protocols is described in WO2014 / 033322, which is incorporated herein by reference in its entirety.

[0197] Pancreatic Endocrine Progenitor (EP) cells

[0198] As used herein, the term “pancreatic endocrine progenitors” or “endocrine progenitor cells” or “EP” refers to cells characterized by expressing NEUROG3, and optionally one or more of, NeuroD and NKX2.2, hallmarks for EP cells committed to an endocrine cell fate.

[0199] "NEUROG3" as used herein, is a member of the neurogenin family of basic loop- helix-loop transcription factors. NEUROG3 refers to the gene identified by Ensembl identifier ENSG00000122859.

[0200] "NKX2.2" and "NKX6.1" as used herein are members of the NKX transcription factor family. NKX2-2 refers to the gene identified by ENSG00000125820. "NeuroD" as used herein is a member of the NeuroD family of basic helix-loop- helix (bHLH) transcription factors. NeuroD refers to the gene identified by Ensembl identifier ENSG00000162992.

[0201] In one embodiment, DE cell population obtainable by the methods of the present invention are further differentiated into pancreatic endocrine progenitors by one or more known protocols.

[0202] In the following, references are given to already known protocols for the differentiation of pancreatic endoderm into pancreatic endocrine progenitors. Pancreatic endocrine specification from PE is dependent on the expression of the transcription factor NEUROG3 (McGrath et al. - Diabetes - 2015 Jul;64(7):2497-505, Zhang et al. - Dev. Cell - 2019 Aug 5;50(3):367-380.e7.). Several approaches have been explored to induce EP as well as PEC from PE. Culturing PE on air-liquid interface culture resulted in upregulation of NEUROG3 5 transcript, as well as the pancreatic hormones insulin (INS) and glucagon (GCG), compared with cells cultured in planar culture Rezania et al. - Nat Biotechnol. - 2014 Nov;32(11):1121-33). Expression of a NEUROG3 transgene in PE was shown to induce endocrine differentiation (Zhu et al. - Cell Stem Cell. - 2016 Jun 2;18(6):755-768). Modulation of the actin cytoskeleton as well as dispersion of PE to single cells followed by reaggregation cells to clusters can induce NEUROG3 expression and differentiation to EP and hPSCs-endocrine cells (Mamidi - Nature. - 2018 Dec;564(7734):114-118, Hogrebe et al. - Nat Biotechnol. - 2020 Apr;38(4):460-470). Inhibition of TGF|3 signalling and Notch signalling progressed PE to a pancreatic endocrine phenotype (Rezania et al. - Diabetes. - 2011 Jan;60(1):239-47, Nostro et al. - Development. - 2011 Mar;138(5):861-71 , Pagliuca et al. - Cell. - 2014 Oct 9;159(2):428-39, Rezania et al. - Nat 15 Biotechnol. - 2014 Nov;32(11):1121-33, Rezania et al. - Differentiation of human embryonic stem cells - 2015 Jun 23). However, permitting TGF|3 signalling appears to be required for differentiation to more mature insulin producing-like cells (Velazco-Cruz et al. - Stem Cell Reports. - 2019 Feb 12;12(2):351- 365).

[0203] A protocol for generating pancreatic endocrine progenitor cells is described in WO2015 / 028614 which is incorporated herein by reference in its entirety.

[0204] Pancreatic Endocrine Cells (PEC)

[0205] As used herein, the term “pancreatic endocrine cells” or “PEC” refers to cells expressing CHGA and ISL1 .

[0206] In one embodiment, DE cell population obtainable by the methods of the present invention are further differentiated into pancreatic endocrine cells by one or more known protocols. In the following, references are given to already known protocols for the differentiation of pancreatic endocrine progenitors into pancreatic endocrine cells:

[0207] Glucagon expressing alpha-like cells derived from hPSCs display molecular and functional characteristics of bona fide pancreatic alpha cells (Rezania et al. - Diabetes - 2011 Jan;60(1):239-47, Peterson et al. - Nat Commun. - 2020 May 7;11 (1):2241). Differentiation protocols for maturing hPSCs-derived insulin producing-like cells that are capable of secreting insulin in response to elevated glucose concentrations have recently been reported (Rezania et al. - Nat Biotechnol. - 2014 Nov;32(11):1121-33^ Pagliuca et al. - Cell. - 2014 Oct 9;159(2):428-39, Velazco-Cruz et al. - Stem Cell Reports. - 2019 Feb 12;12(2):351-365, Hogrebe et al. - Nat Biotechnol. - 2020 Apr;38(4):460-470, Liu et al. - Nat Commun. - 2021 Jun 7;12(1):3330, Nair et al. - Nat Cell Biol. - 2019 Feb;21 (2):263- 274).

[0208] Single cell gene expression analysis has delineated the differentiation path of hPSCs towards pancreatic endocrine (PEC) cells including insulin producing-like cells (Petersen et al. - Stem Cell Reports. - 2017 Oct 10;9(4): 1246-1261 , Ramond et al. - Development. - 2018 Aug 15; 145(16):dev165480, Docherty et al. - Diabetes. - 2021 Nov;70(11):2554-2567, Veres et al. - Nature. - 2019 May;569(7756):368-373) and detailed characterization of the hPSCs-derived insulin producing-like cells both in vitro and in vivo have revealed many similarities to bona fide pancreatic insulin producing cells (Velazco-Cruz et al. - Stem Cell Reports. - 2019 Feb 12;12(2):351-365, Augsornworawat et al. - Cell Rep. - 2020 Aug 25;32(8): 108067, Balboa et al. - Functional, metabolic and transcriptional maturation of stem cell derived insulin producing cells - 2021 .03.31 ,437748v1). Interestingly, formation of non-endocrine cells as well as nonpancreas endocrine enterochromaffin cells has recently been reported for protocols aiming and differentiation hPSCs towards the pancreatic endocrine lineage (Petersen et al. - Stem Cell Reports. - 2017 Oct 10;9(4): 1246-1261 , Veres et al. - Nature. - 2019 May;569(7756):368-373).

[0209] The pancreatic endocrine (PEC) cells obtained by differentiation of the DE produced by the method of the present invention include islet-like cells. Islet-like cells include alpha-like cells, insulin producing-like cells, epsilon-like cells, delta-like cells and gamma-like cells.

[0210] As used herein, the term “islet-like cells” refers to islet cells obtained in vitro after culturing of stem cells. Islet-like cells include insulin producing cells, alpha cells, delta cells, gamma cells. As used herein, the term “alpha cells” refer to cells expressing GCG, and optionally one of more of ISL1 and ARX. In pancreas, the alpha cells produce the hormone glucagon.

[0211] As used herein, the term “insulin producing cells” or “insulin producing-like cells” refers to cells that reside within small cell clusters called islets of Langerhans in the pancreas. Insulin producing cells express INS (gene), and optionally one or more of PDX1 , ISL1 and NKX6.1. Insulin producing cells are characterized by the co-expression of INS / NKX6.1 and C-PEP / NKX6.1 . In pancreas, the insulin producing cells produce the hormone insulin and amylin.

[0212] In one embodiment, DE cell population obtainable by the methods of the present invention are further differentiated into insulin producing cells by one or more known protocols.

[0213] A protocol for generating insulin producing cells is described in WO2017 / 144695 which is incorporated herein by reference in its entirety.

[0214] As used herein, the term “delta cells” refer to cells expressing SST, and optionally one or more of ISL1 and HHEX. In pancreas, the delta cells secrete the peptide hormone somatostatin.

[0215] As used herein, the term “epsilon cells” refer to cells expressing GHRL, and optionally one or more of ISL1 , ARX and ETV1 . In the pancreas, epsilon cells produce the hormone ghrelin.

[0216] As used herein, the term “gamma cells” is in the current context used interchangeably with “Pancreatic polypeptide cells”, “PP cells”, “y-cells”, or“F cells” and refers to endocrine cells expressing PPY, and optionally one or more of ISL1 and PAX6. In the pancreas, they help synthesize and regulate the release of pancreatic polypeptide (PP).

[0217] Stem cell-derived products

[0218] As used herein, the term “differentiated cells” refers to cells such as pluripotent stem cells which have progressed from an undifferentiated state to a less immature state. Differentiated cells may be e.g., less immature specialized cell such as progenitor cells or matured fully into a specialized / terminal cell type.

[0219] As used herein, the term “cell lineage” refers to the developmental origin of a cell type or cell types starting from pluripotent stem cells and progressing to less immature cells and further to specialized / terminally differentiated cell types. As used herein, the term “cell population” refers to a plurality of cells in the same culture. The cell population may be e.g., a mixture of cells of different types, or cells at various developmental stages such as cells at various maturity stages towards the same or similar specialized feature or it may be a more homogeneous composition of cells with common markers.

[0220] In a preferred embodiment, the cell population is a DE cell population.

[0221] In one embodiment, the cell population is a mesodermal cell population.

[0222] Genes required for mesoderm formation

[0223] In one embodiment, the one or more genes required for the formation of mesodermal cell population are essential or critical for the formation of mesodermal cell population.

[0224] In one embodiment, the one or more genes required for the formation of mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0225] In one embodiment, the one or more genes required for the formation of mesodermal cell population are listed in table 1 below.

[0226] In one embodiment, the one or more genes required for the formation of mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2 or CDX4.

[0227] In one embodiment, the one or more genes required for the formation of mesodermal cell population comprises MESP1 and / or MESP2.

[0228] In one embodiment, the one gene required for the formation of mesodermal cell population is MESP1.

[0229] In one embodiment, the one gene required for the formation of mesodermal cell population is MESP2.

[0230] In one embodiment, the one or more genes required for the formation of mesodermal cell population is MESP1 and MESP2.

[0231] In one embodiment, the one gene required for the formation of mesodermal cell population is TBXT. In one embodiment, the one or more genes required for the formation of mesodermal cell population is MESP1 and / or MESP2 or TBXT.

[0232] In one embodiment, the one or more genes required for the formation of mesodermal cell population is CDX1 and CDX2.

[0233] In one embodiment, the one or more genes required for the formation of mesodermal cell population is CDX1 , CDX2 and CDX4.

[0234] As used herein, the terms “genetically modified” and “genetically engineered” in reference to a cell may be used interchangeably and refer to a cell which has been subjected to an artificial manipulation, modification, or recombination of DNA or other nucleic acid molecules in order to alter the characteristics (phenotype) of that cell. Such a cell can no longer be considered a naturally occurring cell. In case of genetically modified stem cells the traits resulting from the gene editing persist even as the stem cell is further differentiated into a specialized cell, thus rendering the specialized cell genetically modified and artificial, i.e., non-naturally occurring.

[0235] In one embodiment, the one or more genes is inactivated by using a genetic engineering technology selected from MAD7 nuclease, CRISPR nuclease, base editing, prime editing, zinc finger nucleases, transcription activator-like effector nucleases.

[0236] In one embodiment, alternative approaches such as silencing of essential lineage genes by siRNA or similar could also be considered for inactivating the one or more genes required for the formation of the mesodermal cell population.

[0237] Methods for preventing stromal cell-like formation

[0238] As used herein, the term “stromal cell” or “stromal-like cell”, means differentiating cells found in abundance within bone marrow but may also be seen all around the body. Stromal cells can become connective tissue cells of an organ. Stromal cells may also be called mesenchymal stromal cells. The cells are non-hematopoietic, multipotent, and selfreplicating. Some stromal cells can be considered stem cells but not all therefore it cannot be broadly termed a stem cell.

[0239] As used herein, “PRRX1 ” refers to the gene identified by Ensembl identifier ENSG00000116132.

[0240] As used herein, “PRRX2” refers to the gene identified by Ensembl identifier

[0241] ENSG00000167157. As used herein, “ERG” refers to the gene identified by Ensembl identifier ENSG00000157554.

[0242] As used herein, “ANXA1” refers to the gene identified by Ensembl identifier ENSG00000135046.

[0243] As used herein, “TBX18” refers to the gene identified by Ensembl identifier ENSG00000112837.

[0244] As used herein, “RUNX1” refers to the gene identified by Ensembl identifier ENSG00000159216.

[0245] As used herein, “CREB5” refers to the gene identified by Ensembl identifier ENSG00000146592.

[0246] As used herein, “FOSL1” refers to the gene identified by Ensembl identifier ENSG00000175592.

[0247] As used herein, “FOSL2” refers to the gene identified by Ensembl identifier ENSG00000075426.

[0248] As used herein, “PROX1” refers to the gene identified by Ensembl identifier ENSG00000117707.

[0249] As used herein, “TCEA3” refers to the gene identified by Ensembl identifier ENSG00000204219.

[0250] As used herein, “DACH1” refers to the gene identified by Ensembl identifier ENSG00000276644.

[0251] As used herein, “SOX4” refers to the gene identified by Ensembl identifier ENSG00000124766.

[0252] As used herein, “TCF12” refers to the gene identified by Ensembl identifier ENSG00000140262.

[0253] As used herein, “TWIST1” refers to the gene identified by Ensembl identifier ENSG00000122691.

[0254] As used herein, “TWIST2” refers to the gene identified by Ensembl identifier ENSG00000233608.

[0255] As used herein, “NFATC4” refers to the gene identified by Ensembl identifier ENSG00000100968.

[0256] As used herein, “SMAD3” refers to the gene identified by Ensembl identifier ENSG00000166949. As used herein, “TEAD2” refers to the gene identified by Ensembl identifier ENSG00000074219.

[0257] Methods for preventing ductal epithelium and non-pancreatic endoderm

[0258] As used herein, the term “ductal epithelium”, means the cells of the pancreas that form the epithelial lining of the branched tubes that deliver enzymes produced by pancreatic acinar cells into the duodenum. In addition, these cells secrete bicarbonate that neutralizes stomach acidity.

[0259] As used herein, the term “non-pancreatic endoderm” means definitive endoderm is the germ layer that gives rise to the gastrointestinal system, including the respiratory and digestive tracts, thyroid, thymus, liver and pancreas. Non-pancreatic endoderm is defined as endoderm subtypes able to develop into all of these lineages except for the pancreatic lineages.

[0260] As used herein, “GATA4” refers to the gene identified by Ensembl identifier ENSG00000136574.

[0261] As used herein, “GATA5” refers to the gene identified by Ensembl identifier ENSG00000130700.

[0262] As used herein, “OSR1” refers to the gene identified by Ensembl identifier ENSG00000143867.

[0263] As used herein, “OSR2” refers to the gene identified by Ensembl identifier ENSG00000164920.

[0264] As used herein, “HNF1A” refers to the gene identified by Ensembl identifier ENSG00000135100.

[0265] As used herein, “HNF4A” refers to the gene identified by Ensembl identifier ENSG00000101076.

[0266] As used herein, “HNF4G” refers to the gene identified by Ensembl identifier ENSG00000164749.

[0267] As used herein, “ASCL1” refers to the gene identified by Ensembl identifier ENSG00000139352.

[0268] As used herein, “SOX4” refers to the gene identified by Ensembl identifier ENSG00000124766.

[0269] As used herein, “SOX21” refers to the gene identified by Ensembl identifier

[0270] ENSG00000125285. As used herein, “OTX2” refers to the gene identified by Ensembl identifier ENSG00000165588.

[0271] As used herein, “CDX1” refers to the gene identified by Ensembl identifier ENSG00000113722.

[0272] As used herein, “CDX2” refers to the gene identified by Ensembl identifier ENSG00000165556.

[0273] As used herein, “ONECUT2” refers to the gene identified by Ensembl identifier ENSG00000119547.

[0274] As used herein, “ONECUT3” refers to the gene identified by Ensembl identifier ENSG00000205922.

[0275] As used herein, “FOSL2” refers to the gene identified by Ensembl identifier ENSG00000075426.

[0276] As used herein, “KLF3” refers to the gene identified by Ensembl identifier ENSG00000109787.

[0277] As used herein, “KLF5” refers to the gene identified by Ensembl identifier ENSG00000102554.

[0278] As used herein, “KLF6” refers to the gene identified by Ensembl identifier ENSG00000067082.

[0279] As used herein, “ELF3” refers to the gene identified by Ensembl identifier ENSG00000163435.

[0280] As used herein, “HES1” refers to the gene identified by Ensembl identifier ENSG00000114315.

[0281] As used herein, “HES4” refers to the gene identified by Ensembl identifier ENSG00000188290.

[0282] As used herein, “HEY1” refers to the gene identified by Ensembl identifier ENSG00000164683.

[0283] As used herein, “PITX1” refers to the gene identified by Ensembl identifier ENSG00000069011 .

[0284] As used herein, “PITX2” refers to the gene identified by Ensembl identifier ENSG00000164093.

[0285] As used herein, “HHEX” refers to the gene identified by Ensembl identifier

[0286] ENSG00000152804. As used herein, “SALL4” refers to the gene identified by Ensembl identifier ENSG00000101115.

[0287] As used herein, “TBX1” refers to the gene identified by Ensembl identifier ENSG00000184058.

[0288] As used herein, “BARX2” refers to the gene identified by Ensembl identifier ENSG00000043039.

[0289] As used herein, “TGIF1” refers to the gene identified by Ensembl identifier ENSG00000177426.

[0290] As used herein, “FOXA1” refers to the gene identified by Ensembl identifier ENSG00000129514.

[0291] As used herein, “IRX3” refers to the gene identified by Ensembl identifier ENSG00000177508.

[0292] As used herein, “MAF” refers to the gene identified by Ensembl identifier ENSG00000178573.

[0293] As used herein, “LITAF” refers to the gene identified by Ensembl identifier ENSG00000189067.

[0294] As used herein, “NFIA” refers to the gene identified by Ensembl identifier ENSG00000162599.

[0295] As used herein, “NFIB” refers to the gene identified by Ensembl identifier ENSG00000147862.

[0296] As used herein, “EHF” refers to the gene identified by Ensembl identifier ENSG00000135373.

[0297] As used herein, “GLIS3” refers to the gene identified by Ensembl identifier ENSG00000107249.

[0298] As used herein, “MYRF” refers to the gene identified by Ensembl identifier ENSG00000124920.

[0299] As used herein, “HNF1 B” refers to the gene identified by Ensembl identifier ENSG00000275410.

[0300] As used herein, “IER2” refers to the gene identified by Ensembl identifier ENSG00000160888.

[0301] As used herein, “CEBPA” refers to the gene identified by Ensembl identifier ENSG00000245848. As used herein, “ATF3” refers to the gene identified by Ensembl identifier ENSG00000162772.

[0302] As used herein, “MAFK” refers to the gene identified by Ensembl identifier ENSG00000198517.

[0303] As used herein, “TRNP1” refers to the gene identified by Ensembl identifier ENSG00000253368.

[0304] As used herein, “JDP2” refers to the gene identified by Ensembl identifier ENSG00000140044.

[0305] As used herein, “NABP1” refers to the gene identified by Ensembl identifier ENSG00000173559.

[0306] As used herein, “CREB3L1” refers to the gene identified by Ensembl identifier ENSG00000157613.

[0307] As used herein, “RELB” refers to the gene identified by Ensembl identifier ENSG00000104856.

[0308] As used herein, “NFKB2” refers to the gene identified by Ensembl identifier ENSG00000077150.

[0309] As used herein, “ELK4” refers to the gene identified by Ensembl identifier ENSG00000158711.

[0310] As used herein, “HMGA2” refers to the gene identified by Ensembl identifier ENSG00000149948.

[0311] As used herein, “ID4” refers to the gene identified by Ensembl identifier ENSG00000172201.

[0312] As used herein, “TCF4” refers to the gene identified by Ensembl identifier ENSG00000196628.

[0313] Methods for preventing pancreatic acinar cells

[0314] As used herein, the term “Pancreatic acinar cells”, means the functional unit of the exocrine pancreas. The cells synthesize, store, and secrete digestive enzymes.

[0315] As used herein, “RBPJL” refers to the gene identified by Ensembl identifier ENSG00000124232.

[0316] As used herein, “PTF1A” refers to the gene identified by Ensembl identifier ENSG00000168267. As used herein, “HHEX” refers to the gene identified by Ensembl identifier ENSG00000152804.

[0317] As used herein, “BHLHA15” refers to the gene identified by Ensembl identifier ENSG00000180535.

[0318] As used herein, “EPAS1” refers to the gene identified by Ensembl identifier ENSG00000116016.

[0319] As used herein, “NR5A2” refers to the gene identified by Ensembl identifier ENSG00000116833.

[0320] As used herein, “NR4A1” refers to the gene identified by Ensembl identifier ENSG00000123358.

[0321] As used herein, “MECOM” refers to the gene identified by Ensembl identifier ENSG00000085276.

[0322] As used herein, “CEBPD” refers to the gene identified by Ensembl identifier ENSG00000221869.

[0323] As used herein, “ATF4” refers to the gene identified by Ensembl identifier ENSG00000128272.

[0324] As used herein, “EEF1 D” refers to the gene identified by Ensembl identifier ENSG00000104529.

[0325] As used herein, “XBP1” refers to the gene identified by Ensembl identifier ENSG00000100219.

[0326] As used herein, “YBX3” refers to the gene identified by Ensembl identifier ENSG00000060138.

[0327] As used herein, “APLP2” refers to the gene identified by Ensembl identifier ENSG00000084234.

[0328] As used herein, “SOX6” refers to the gene identified by Ensembl identifier ENSG00000110693.

[0329] As used herein, “MAFF” refers to the gene identified by Ensembl identifier ENSG00000185022.

[0330] Knock-in and Knock-out

[0331] The term “knock-in” or “knocking-in” as used herein refers to the insertion of a gene into a genome. With knock-in techniques, the gene insertion is targeted, which means that the gene is inserted into a specific locus, in a location on the genome that has been predefined and is specifically targeted, as opposed to a random gene insertion with other genetic engineering methods.

[0332] The term “knock-out” or “knocking-out” as used herein refers to the inactivation by deletion or disruption of a gene from a genome. T o achieve the deletion or disruption of a given gene of interest, knock-out techniques usually require a genetic modification in a specifically targeted location on the genome.

[0333] In one embodiment, one or more genes required for the formation of the mesodermal cell population is inactivated by knocking out said genes in hPSCs prior to differentiation thereof.

[0334] In one embodiment, one or more genes are inactivated in the hPSCs according to the method of the present invention as a double knock out.

[0335] In one embodiment, one or more genes are inactivated in the hPSCs according to the method of the present invention as a triple knock out.

[0336] Several knock-in and knock-out techniques exist and are well defined in the art.

[0337] As used herein, the term “cell composition” refers to a cell culture medium and one or more cell populations.

[0338] In one embodiment, the cell composition is a therapeutic cell composition.

[0339] Hereinafter, the methods according to the present invention are described in more detail by non-limiting embodiments and examples.

[0340] Compositions comprising the DE obtained by any of the methods of the invention

[0341] In a further aspect, it is described herein a medicament comprising pancreatic endocrine cells (PEC) or insulin producing cells obtained by differentiating the DE cells derived from hPSCs comprising one or more inactivated genes by any of the methods of the invention according to the present description.

[0342] In a preferred embodiment, the medicament described herein comprises enriched or homogenous, thawed and re-aggregated cryopreserved pancreatic endocrine cells (PEC) or insulin producing cells obtained by differentiating DE obtainable by any of the methods of the present invention.

[0343] Medical use of pancreatic endocrine (PEC) cells obtained by any of the methods of the invention

[0344] Methods of treating diabetes (Type 1 and Type 2) are also provided herein. For example, provided herein is a method of treating type-1 diabetes in a mammal. In some embodiments, the method includes the steps of selecting a mammal with type-1 diabetes and administering to the mammal pancreatic endocrine cells or insulin producing cells obtained by further differentiating DE obtainable by any of the methods of the present invention. In other embodiments, methods include preventing type 1 diabetes in a mammal at risk for developing type 1 diabetes by administering to the mammal endocrine cells obtained by any of the methods of the invention.

[0345] In the current context, the term “mammal” includes human and veterinary subjects.

[0346] In the current context, the term “mammal” relates to e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex.

[0347] One of skill in the art identifies and selects mammals with type 1 diabetes and mammals at risk for developing type 1 diabetes using any methods of diagnosis and identification. For example, diagnosis is based on an elevated blood glucose level after fasting or on a glucose tolerance test. Furthermore, diagnosis of type 1 diabetes includes various physical symptoms and characteristics.

[0348] Mammals with insulin dependent type 2 diabetes or at risk for developing type 2 diabetes similarly benefit from the administration of pancreatic endocrine cells obtained by any of the methods of the invention. Thus, provided herein is a method that includes the steps of selecting a mammal with, or at risk of developing, type-2 diabetes and administering to the mammal pancreatic endocrine cells obtained by any of the methods of the invention in an amount sufficient. Diagnosis is usually based on fasting glucose levels, on a glucose tolerance test, or on the level of blood insulin.

[0349] The invention is further described by the following non-limiting embodiments:

[0350] 1. A method for inhibiting or reducing the formation of a mesodermal cell population during in vitro differentiation of hPSCs into DE comprising inactivating or reducing expression of one or more genes in the hPSCs, wherein said one or more genes are required for the formation of the mesodermal cell population.

[0351] 2. The method according to embodiment 1 , wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2 or CDX4. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 and MESP2, or TBXT. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population comprises MESP1 or MESP2 or TBXT. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is MESP1 and MESP2. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is TBXT. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is CDX1 , CDX2. he method according to any one of the preceding embodiments, wherein said one or more genes required for the formation of the mesodermal cell population is CDX1 , CDX2 and CDX4 The method according to any one of the embodiments 1 to 9, wherein reduced expression of said one or more genes is by a decrease in the amount of RNA transcript (mRNA) of said one or more genes, a decrease in the amount of protein encoded by said one or more genes, and / or a decrease in the amount of activity of said one or more genes. The method according to any one of the preceding embodiments, wherein inactivating or reducing expression of said one or more genes required for the formation of the mesodermal cell population is by knocking out or knocking down the said genes in the hPSCs. The method according to any of the preceding embodiments, wherein inactivating or reducing expression of said one or more genes required for the formation of the mesodermal cell population is performed by using a genetic engineering technology selected from MAD7 nuclease, CRISPR nuclease, base editing, prime editing, zinc finger nucleases, Transcription activator-like effector nucleases or homologous recombination.

[0352] 13. The method according to any one of the preceding embodiments, wherein the hPSCs are human embryonic stem cells or human induced pluripotent stem cells.

[0353] 14. An in vitro method for differentiating hPSCs into DE comprising a step of culturing the hPSCs in a cell culture medium, wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in the hPSCs.

[0354] 15. The method according to embodiment 14, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , TBXT, HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0355] 16. The method according to embodiment 14, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2 or CDX4.

[0356] 17. The method according to embodiment 14, wherein said one or more genes required for the formation of the mesodermal cell population comprises MESP1 and MESP2.

[0357] 18. The method according to embodiment 17, wherein said one or more genes required for the formation of the mesodermal cell population is MESP1 or MESP2.

[0358] 19. The method according to embodiment 17, wherein said one or more genes required for the formation of the mesodermal cell population is MESP1 and MESP2 or TBXT.

[0359] 20. The method according to embodiment 14, wherein said one or more genes required for the formation of the mesodermal cell population is CDX1 and CDX2.

[0360] 21 . The method according to embodiment 14, wherein said one or more genes required for the formation of the mesodermal cell population is CDX1 , CDX2 and CDX4. 22. The method according to embodiment 14, wherein the cell culture medium comprises a WNT signalling activator.

[0361] 23. The method according to embodiment 22, wherein the WNT signalling activator is CHIR99021 , CP21 R7 or WNT3a and BIO.

[0362] 24. The method according to embodiment 22, wherein the concentration of the WNT signalling activator is about 0.5-25 pm.

[0363] 25. The method according to embodiment 22, wherein the concentration of the WNT signalling activator is about 1-8 pm.

[0364] 26. The method according to embodiment 22, wherein the concentration of the WNT signalling activator is about 2-8 pm.

[0365] 27. The method according to embodiment 22, wherein the concentration of the WNT signalling activator is about 3-6 pm.

[0366] 28. The method according to any one of the preceding embodiments 24-25, wherein the concentration of the WNT signalling activator is about 1 pm.

[0367] 29. The method according to any one of the preceding embodiments 25-27, wherein the concentration of the WNT signalling activator is 4 pm.

[0368] 30. The method according to any one of the preceding embodiments 25-27, wherein the concentration of the WNT signalling activator is 5 pm.

[0369] 31. The method according to any one of the preceding embodiments 25-27, wherein the concentration of the WNT signalling activator is 6 pm.

[0370] 32. The method according to any one of the preceding embodiments 14-31 , wherein the step of culturing the hPSCs in a cell culture medium comprising a WNT signalling activator is for at least 24 hours.

[0371] 33. The method according to embodiment 23, wherein the concentration of CHIR99021 is about 0.5-25 pm or the concentration of CP21 R7 is about 1 pm.

[0372] 34. The method according to embodiment 23, the concentration of CHIR99021 is about 2-8 pm.

[0373] 35. The method according to embodiment 23, the concentration of CHIR99021 is about 3-6 pm. 36. The method according to any one of the embodiments 33-35, wherein the concentration of CHIR99021 is 4 pm.

[0374] 37. The method according to any one of the embodiments 33-35, wherein the concentration of CHIR99021 is 5 pm.

[0375] 38. The method according to any one of the embodiments 33-35, wherein the concentration of CHIR99021 is 6 pm.

[0376] 39. The method according to any one of the preceding embodiments 23-38, wherein the step of culturing the hPSCs in a cell culture medium comprising CHIR99021 or CP21 R7 is for at least 24 hours.

[0377] 40. The method according to any of the preceding embodiments 14-39, comprising an intermediate step of differentiation of the hPSCs into primitive streak.

[0378] 41 . The method according to embodiment 40, wherein said one or more genes required for the formation of the mesodermal cell population is inactivated in the hPSCs to prevent differentiation of the primitive streak into mesoderm.

[0379] 42. The method according to any one of the preceding embodiments 14-41 , wherein the hPSCs are human embryonic stem cells or human induced pluripotent stem cells.

[0380] 43. The method according to embodiment 40, further comprising differentiating primitive streak into DE.

[0381] 44. The method according to embodiment 43, comprising culturing the primitive streak in a medium comprising activin A.

[0382] 45. The method according to embodiment 44, comprising culturing primitive streak in a medium comprising 20-100ng / ml of activin A.

[0383] 46. The method according to embodiment 45, comprising culturing primitive streak in a medium comprising 100ng / ml of activin A.

[0384] 47. The method according to embodiment 44, comprising culturing primitive streak in a medium comprising activin A for 72 hours.

[0385] 48. The method according to any one of the preceding embodiments 14-47, wherein the DE is for further differentiation into pancreatic endoderm. 49. The method according to any one of the preceding embodiments 14-47, wherein the DE is for further differentiation into endocrine progenitor cells.

[0386] 50. The method according to any one of the preceding embodiments 14-47, wherein the DE is for further differentiation into pancreatic endocrine cells.

[0387] 51. The method according to any one of the preceding embodiments 14-47, wherein the DE is for further differentiation into insulin producing cells.

[0388] 52. A method for inhibiting or reducing the expression of one or more genes in a population of DE cells comprising the steps of:

[0389] (i) obtaining hPSCs,

[0390] (ii) inactivating said one or more genes in the hPSCs, the one or more genes required for the formation of the mesodermal cell population,

[0391] (iii) differentiating the hPSCs obtained in step (ii) into DE cells by treating said hPSCs in a culture medium.

[0392] 53. The method according to embodiment 52, wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , TBXT, HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0393] 54. The method according to any one of the embodiments 52 to 53, wherein reduced expression of said one or more genes is by a decrease in the amount of RNA transcript (mRNA) of said one or more genes, a decrease in the amount of protein encoded by said one or more genes, and / or a decrease in the amount of activity of said one or more genes.

[0394] 55. The method according to embodiment 54, wherein the method reduces the expression of said one or more genes required for the formation of the mesodermal cell population in the population of DE compared to DE cells obtained from hPSCs where the one or more genes required for the formation of the mesodermal cell population have not been inactivated.

[0395] 56. The method according to embodiment 52, wherein the culture medium comprises a WNT signalling activator. 57. The method according to embodiment 56, wherein the WNT signalling activator is used in a concentration of 0.5-25pm.

[0396] 58. The method according to embodiment 57, wherein the WNT signalling activator is used in a concentration of 2-8pm.

[0397] 59. The method according to any one of the embodiments 56-58, wherein the WNT signalling activator is used in a concentration of 4 pm.

[0398] 60. The method according to any one of the embodiments 56-58, wherein the WNT signalling activator is used in a concentration of 5 pm.

[0399] 61. The method according to any one of the embodiments 56-58, wherein the WNT signalling activator is used in a concentration of 6 pm.

[0400] 62. The method according to embodiment 56 to 61 , wherein the WNT signalling activator is CHIR99021 , CP21 R7 or WNT3a or BIO.

[0401] 63. The method according to embodiment 62, wherein the WNT signalling activator is CHIR99021.

[0402] 64. A genetically engineered cell, wherein the cell is genetically modified to prevent formation of mesodermal cells during the differentiation of hPSCs into DE, PE or PEC cells.

[0403] 65. The genetically engineered cell according to embodiment 64, wherein the cell is genetically modified by knock-out of one or more genes selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , TBXT, HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0404] 66. The genetically engineered cell according to embodiment 64, wherein the cell comprises MESP1 and / or MESP2 or TBXT genes that have been inactivated or have reduced expression.

[0405] 67. The genetically engineered cell according to any one of the preceding embodiments 64 to 66, wherein the cell is a mammalian cell, preferably a human cell.

[0406] 68. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is a human pluripotent stem cell (hPSCs). 69. The genetically engineered cell according to embodiment 68, wherein the human pluripotent stem cell is a human embryonic stem cells or induced human pluripotent stem cell.

[0407] 70. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is a DE cell.

[0408] 71. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is a pancreatic endoderm cell.

[0409] 72. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is an endocrine progenitor cell.

[0410] 73. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is a pancreatic endocrine cell.

[0411] 74. The genetically engineered cell according to any one of the preceding embodiments 64 to 67, wherein the genetically engineered cell is an insulin producing cell.

[0412] 75. An in vitro cell population of genetically engineered cells according to embodiment 64 or DE derived from human pluripotent stem cell wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in the human pluripotent stem cells, wherein the one or more gene is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , TBXT, HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT

[0413] 76. The in vitro cell population according to embodiment 75, derived from human pluripotent stem cell comprising inactivated or reduced expression of MESP1 and / or MESP2 or TBXT genes.

[0414] 77. The cell population according to any one of the preceding embodiments 75 or 76, wherein said population comprises less than 2% or 1% and / or 0.05% hPSCs. The cell population according to any one of the preceding embodiments 75-77, wherein the human pluripotent stem cell is a human embryonic stem cells or human induced pluripotent stem cell. The cell population according to any one of the preceding embodiments 75-78, for further differentiation into pancreatic endocrine cells or insulin producing cells for use as a medicament in the treatment of diabetes by administering or grafting or transplanting the pancreatic endocrine cells or insulin producing cells or tissue or organ derived from the pancreatic endocrine cells or insulin producing cells into a subject. The cell population according to any one of the preceding embodiments 76 to 79, wherein the cell population comprises of genetically engineered cells according to any one of the embodiments 64 to 74. A cell composition comprising genetically engineered cells according to any one of the embodiments 64 to 74 or in vitro cell population according to any one of the preceding embodiments 75-79 and a cell culture medium. A method for inhibiting formation of stromal and / or stromal-like cells during in vitro differentiation of hPSCs into defined cell types, comprising reducing expression of one or more genes in the hPSCs, said one or more genes being selected from the group consisting of PRRX1 , PRRX2, ERG, ANXA1 , TBX18, RUNX1 , CREB5, FOSL1 , FOSL2, PROX1 , TCEA3, DACH1 , SOX4, TCF12, TWIST1 , TWIST2, NFATC4, SMAD3, and TEAD2. The method according to embodiment 82, wherein the hPSCs are human embryonic stem cells or induced hPSCs. The method according to embodiments 82 to 83, wherein the reduced expression of the one or more genes is by a decrease in the amount of RNA transcript (mRNA) of the one or more genes, a decrease in the amount of protein encoded by the one or more genes, and / or a decrease in the amount of activity of the one or more genes. The method according to embodiments 82 to 84, wherein the expression is reduced by epigenetic silencing, interference with RNA transcripts, and / or genetic engineering. 86. The method according to embodiments 82 to 85, wherein the hPSCs are differentiated into neural cells, cardiomyocytes, photoreceptors, retinal pigment epithelium cells, kidney cells, or pancreatic islet-like cells.

[0415] 87. The method according to embodiment 86, wherein the neural cells are forebrain neural cells, ventral midbrain neural cells, hindbrain neural cells, or spinal cord neural cells.

[0416] 88. The method according to embodiments 86 to 87, wherein the hPSCs are differentiated into neural cells, and wherein the expression of PRRX1 and PRRX2 is reduced.

[0417] 89. The method according to embodiment 88, wherein the neural cells are ventral midbrain neural cells.

[0418] 90. The method according to embodiments 82 to 89, wherein the expression of the one or more genes is reduced at least during the differentiation of the cells into differentiated cells.

[0419] 91 . A genetically engineered cell, wherein the cell is genetically modified to prevent differentiation into a stromal-like cell.

[0420] 92. The genetically engineered cell according to embodiment 91 , wherein the cell is genetically modified by knock-out of one or more genes selected from PRRX1 , PRRX2, ERG, ANXA1 , TBX18, RUNX1 , CREB5, FOSL1 , FOSL2, PROX1 , TCEA3, DACH1 , SOX4, TCF12, TWIST1 , TWIST2, NFATC4, SMAD3, and TEAD2.

[0421] 93. The genetically engineered cell according to any one of the embodiments 91 to 92, wherein the cell is a mammalian cell, preferably a human cell.

[0422] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention. EXAMPLES

[0423] The following are non-limiting examples for carrying out the invention.

[0424] Example 1 : Identification of genes involved in mesoderm differentiation

[0425] Applying scRNA-sequencing time series of hPSCs to DE differentiation (figure 5) we focused on the PS population for identifying genes involved in mesoderm differentiation at this stage. Cells with low Unique Molecular Identifier (UMI) counts and in G2 / M cell cycle were excluded from the analysis. We predefined three on-target marker genes (LEFTY1 , GDF3 and FOXA2) and three off-target marker genes (HES7, MESP1 , TBX6). Examples for FOXA2 and MESP1 are shown in figure 7A. We used the predefined genes to calculate on- and off-target module scores for all cells from the DE01 sample using the Seurat R package. We extracted the cells with unique on or off-target module scores by applying thresholds of >0.1 on-target score and <0 off-target score, and vice-versa. This resulted in 578 on-target cells, 638 off-target cells and 2271 undefined cells. We then performed a differential expression of on-target vs. off-target cells using the Seurat FindMarkers® function. Manual curation of the list and selection of primary transcription factors as well as receptors / ligands resulted in the candidate list of genes likely involved in mesoderm specification shown in table 1 .

[0426] Table 1 :

[0427] Example 2: Inactivation of MESP1 and MESP2 genes by gene editing of hPSCs

[0428] For the generation of E1 C3 human embryonic stem cells (hESC) with loss of function of MESP1 and MESP2, the guideRNAs (gRNAs) were designed to target the coding region of genes. The gRNAs were synthesised by the company IDT and screened for efficiency in E1C3 hESC using the electroporation protocol Neon Transfection system recommended by the manufacturer Thermo Fischer Scientific. In brief, gRNAs and corresponding protein were diluted to a concentration of 75pM and 10pg / pl in IDTE buffer, respectively. To form the RNP (ribonucleoprotein) complex, 1 l gRNA and 1 pl corresponding protein were mixed in a sterile Eppendorf tube followed by incubation step for 20min at room temperature (RT) and stored on ice if not proceeded directly with the transfection. For transfection, cultured hESC were harvested, washed and 300,000 hESC were re-suspended in 9pl buffer R together with 2p I of the formed Ribonucleoprotein complex and 10pl of Neon Transfection kit. Immediately after hESC were electroporated using the Neon Transfection system and program P13 (2 pulses of 1100V and 20ms pulse width). After electroporation, electroporated cells were left inside electroporation needle at RT for 10 min. Thereafter, electroporated cells were transferred to 12-well dish and incubated with cultivating medium plus added supplements (3 mL NutriStem medium + 6 pL ROCK-inhibitor Y2763+ 5 pL iMatrix 511). Medium was changed 2 hours after transfection with same composition. After 48h post transfection, cells were harvested and gRNA cutting efficiency was analysed by the IDAA method (Indel Detection by Amplicon Analysis) (Yang et al., 2015, PMID:25753669). The efficient cutting gRNA.MESP1.1 and gRNA. MESP2.3 were selected for further single and double gene KO. Bulk-sorted cells were expanded, and single-cell sorted to 96 well plates on day 4 using a Sony Sorter SH800 respectively. Survived clones were collected and analysis by IDAA and sanger sequencing to confirm the out-frame mutation, thus the loss of function of MESP1 and MESP2.

[0429] MESP1 and MESP2 alleles were inactivated by introduction of frame shifts using gene editing (insertions or deletions) in a human pluripotent stem cell line (hPSCs). Sequence alignment of WT MESP1 and MESP2 alleles and the inactivated alleles in the two MESP1 / MESP2 knock out clones (EST008.B1 and EST008.B2) are shown below:

[0430] Clone name: EST008.B1

[0431] MESP1

[0432] (Wild type) WT_MESP1 : GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCATGAGTCTGGGGACGAGA CGAGGGAGCGGCC (SEQ ID NO: 1)

[0433] (Allele 1) MESP1 (-2bp):

[0434] GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCAT- GTCTGGGGACGAGACGAGGGAGCGGCC (SEQ ID NO: 2)

[0435] (Allele 2) MESP1 (-13bp)

[0436] GGGCTGTCGGCTGGGGTGCTGCCCCATG -

[0437] GTCTGGGGACGAGACGAGGGAGCGGCC (SEQ ID NO: 3)

[0438] MESP2

[0439] (Wild type) WT_MESP2: CCCGGCCTCCTCCTCCGA-TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 4)

[0440] (Allele 1) MESP2 (+1 bp)

[0441] CCCGGCCTCCTCCTCC— TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 5)

[0442] (Allele 2) MESP2 (-2bp)

[0443] CCCGGCCTCCTCCTCCGAATGCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID

[0444] NO: 6)

[0445] Clone name: EST008.B2

[0446] (Wild type) WT_MESP1

[0447] GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCATGAGTCTGGGGACGAGA

[0448] CGAGGGAGCGGCC (SEQ ID NO:1)

[0449] (Allele 1) MESP1 (-2bp)

[0450] GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCAT-

[0451] GTCTGGGGACGAGACGAGGGAGCGGCC (SEQ ID NO: 2)

[0452] (Allele 2) MESP1 (-13bp)

[0453] GGGCTGTCGGCTGGGGTGCTGCCCCATG -

[0454] GTCTGGGGACGAGACGAGGGAGCGGCC (SEQ ID NO: 3)

[0455] MESP2

[0456] (Wild type) WT_MESP2:

[0457] CCCGGCCTCCTCCTCCGA-TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 4)

[0458] (Allele 1) MESP2 (+1 bp)

[0459] CCCGGCCTCCTCCTCCGAATGCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID

[0460] NO: 5)

[0461] (Allele 2) MESP2 (-5bp)

[0462] CCCGGCCTCCTCCTCC - GTCGTGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO:

[0463] 7) Example 3: Inactivation of TBXT, MESP1 and MESP2 genes by gene editing of hPSCs using MAD7

[0464] For the generation of E1 C3 human embryonic stem cells (hESC) with loss of function of MESP1 , MESP2 and TBXT, gRNAs were designed to target the coding region of genes. The gRNAs were synthesised by the company IDT® and screened for efficiency in E1C3 hESC using the electroporation protocol Neon Transfection® system recommended by the manufacturer Thermo Fischer Scientific. In brief, the gRNAs and the nuclease protein (MAD7) were diluted to a concentration of 75pM and 10pg / pl in IDTE buffer, respectively. To form the RNP (ribonucleoprotein) complex, 1 l gRNA and 1 pl MAD7 were mixed in a sterile Eppendorf® tube followed by incubation step for 20min at room temperature (RT). For electroporation, cultured hESC were harvested, washed with R buffer (Neon Transfection® kit) and 300,000 hESC were resuspended in 11 pl R buffer (Neon Transfection® kit) together with 2pl of the formed RNP complex. After the 20min incubation, hESC were electroporated using the Neon Transfection® system with the following program: P13 (2 pulses of 1100V and 20ms pulse width). Thereafter, electroporated cells were transferred to a 24-well dish and incubated with cultivating medium plus added supplements (600 pl StemFit medium + 0.8 pL ROCK-inhibitor Y27632 + 1 .9 pL iMatrix 511). After 48h post electroporation, cells were harvested and gRNA cutting efficiency was analysed by NGS sequencing (Genewiz from Azenta Life Sciences). The efficient cutting gRNA MESP1 .1 , gRNA MESP2.1 , gRNA TBXT-7 and gRNA TBXT-10 were selected for further generating KO cell lines. Electroporated cells were expanded, and single cell sorted to 96 well plates on day 7 using a Sony Sorter SH800 respectively. Survived clones were collected and analysed by NGS sequencing to confirm the frame shift mutation, thus the loss of function of MESP1 and / or MESP2 or TBXT.

[0465] MESP1 , MESP2 and TBXT alleles were inactivated by introduction of frame shifts using gene editing (insertions or deletions) in a human pluripotent stem cell line (hPSCs).

[0466] MESP1 knock out clones (Clone 1 and clone 2) are shown below:

[0467] Guide RNA 5 ’-3 ’target

[0468] MESP1 .1 TACCGCCGTCCGTGGCGCCCGC (SEQ ID NO: 8)

[0469] MESP1 knock out clone 1 :

[0470] (Wild type) WT_MESP1 : CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACC GCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGAC AGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTG

[0471] GCCCGCGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCG

[0472] GGCCAGCGTGCGCATGC (SEQ ID NO: 9)

[0473] (Allele 1) MESP1 (-2bp)

[0474] CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACC

[0475] GCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGAC

[0476] AGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTG GCC—

[0477] CGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCA

[0478] GCGTGCGCATGC (SEQ ID NO: 10)

[0479] (Allele 2) MESP1 (-4 bp)

[0480] CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACC

[0481] GCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGAC

[0482] AGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTG GCCC— -

[0483] GCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCG

[0484] TGCGCATGC (SEQ ID NO: 11)

[0485] MESP1 knock out clone 2

[0486] (Wild type) WT_MESP1 :

[0487] CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACC

[0488] GCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGAC

[0489] AGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTG

[0490] GCCCGCGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCG

[0491] GGCCAGCGTGCGCATGC (SEQ ID NO: 9)

[0492] (Allele 1 and Allele 2) MESP1 (-16 bp):

[0493] CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACC

[0494] GCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGAC

[0495] AGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCT-

[0496] GGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCAT

[0497] GC (SEQ ID NO: 12) MESP2 knock out clone 1

[0498] Guide RNA 5 ’-3 ’target

[0499] MESP2.1 TGCCTCCCTCCTTGGCGCCGGC (SEQ ID NO: 13)

[0500] (Wild type) WT_MESP2:

[0501] CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTC

[0502] CGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAG

[0503] CCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAG

[0504] CGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAAC

[0505] TGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCC

[0506] CTCCTTGGCGCCGGCCGGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCC ATCCGCTACATCGGCCACCTATCGGCCGTGCTG (SEQ ID NO: 14)

[0507] (Allele 1 and Allele 2) MESP2 (-10bp)

[0508] CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTC

[0509] CGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAG

[0510] CCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAG

[0511] CGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAAC

[0512] TGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCC

[0513] CTCCTT -

[0514] GGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCC

[0515] ACCTATCGGCCGTGCTG (SEQ ID NO: 15)

[0516] MESP2 knock out clone 2

[0517] (Wild type) WT MESP2:

[0518] CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTC

[0519] CGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAG

[0520] CCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAG

[0521] CGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAAC

[0522] TGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCC

[0523] CTCCTTGGCGCCGGCCGGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCC

[0524] ATCCGCTACATCGGCCACCTATCGGCCGTGCTG (SEQ ID NO: 14)

[0525] (Allele 1) MESP2 (-23 bp)

[0526] CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTC

[0527] CGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAG CCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAG

[0528] CGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAAC

[0529] TGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCT -

[0530] GCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCAC CTATCGGCCGTGCTG (SEQ ID NO: 16)

[0531] (Allele 2) MESP2 (-16bp)

[0532] CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTC

[0533] CGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAG CCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAG CGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAAC

[0534] TGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCC

[0535] CT -

[0536] CCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACC

[0537] TATCGGCCGTGCTG (SEQ ID NO: 17)

[0538] TBXT knock out clones (Clone TBXT_7_36 KO and Clone TBXT_10_22 KO) are shown below:

[0539] Clone TBXT_7_36 KO

[0540] Guide RNA 5 ’-3 ’target

[0541] #1 CGGTGCTGAAGGTGAACGTGT (SEQ ID NO: 18)

[0542] #2 CAGGAGGATGTTTCCGGTGCT (SEQ ID NO: 19)

[0543] (Wild type) WT_TBXT

[0544] AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCAGCACCGGAAA CATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTA GGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 20)

[0545] (Allele 1) TBXT (-5bp):

[0546] AAGGAGTACATGGCGTTGGGGTCCAGGCCAG— -

[0547] TTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGA CCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 21)

[0548] (Allele 2) TBXT (-4bp): AAGGAGTACATGGCGTTGGGGTCCAGGCCAG— - GTTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAG GACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 22)

[0549] Clone TBXT_10_22 KO

[0550] (Wild type) WT_TBXT: AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCAGCACCGGAAA CATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTA GGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 20)

[0551] (Allele 1) TBXT (+1 bp, 3bp substitutions): AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCCTTCAGCGGAA ACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGT AGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 23)

[0552] (Allele 2) TBXT (-5bp):

[0553] AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTC— - CGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGAC CAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQ ID NO: 24)

[0554] Example 4: Differentiation of hPSCs into DE

[0555] (i) Culturing of hPSCs (hPSCs)

[0556] Culturing of hPSCs was performed in tissue culture vessels (e.g. tissue culture flasks, cell stacks) coated with an appropriate matrix and in a medium designed to maintain and expand hPSCs. More specifically, tissue culture vessels were coated with iMatrix-511 MG (Nippi, product, no. 892-005) at 0.25pg / cm2. Coating was done by spiking iMatrix-511 MG directly into the hPSCs culture medium prior to seeding cells or by precoating tissue culture vessels with iMatrix-511 MG diluted in PBS+ / + (Gibco, product no. 14040-174) for 1 h at 37°C. For pre-coating, the iMatrix-511 MG solution was aspirated immediately prior to adding hPSCs to the tissue culture vessels. hPSCs were cultured in NutriStem hPSCs XF medium (Sartorius, product no. 05- 100-1 A). Single cell suspensions of hPSCs were prepared in NutriStem hPSCs XF medium containing 10pM Y-27632 dihydrochloride (Tocris Bioscience, product no. TB1254-GMP). hPSCs were seeded into tissue culture vessels coated with iMatrix- 511 MG at concentrations between 12.000-25.000 live cells / cm2. Medium was replenished daily with NutriStem hPSCs XF without Y-27632 dihydrochloride and hPSCs were cultured for 3-4 days at 37°C, 5% CO2prior to passaging.

[0557] Passaging of hPSCs were performed as follows: Medium was aspirated from tissue culture vessel and PBS- / - (Gibco, product no. 14190-169) was added to the vessel and briefly swirled to cover the cells. PBS- / - was removed and TrypLE Select enzyme (Gibco, product no. 12563-011) was added to the cells. Tissue culture vessels were incubated for 5-10 minutes at 37°C until hPSCs were completely dissociated from the vessels and into a single cell suspension. NutriStem hPSCs XF medium was added to neutralize the TrypLE Select enzyme and the cell suspension was transferred to a centrifugation tube. hPSCs were pelleted for 5 mins at 300xG and medium was subsequently aspirated. hPSCs were resuspended in NutriStem hPSCs XF medium with 10pM Y-27632 and the concentration of the hPSCs suspension was determined using an automated cell counter.

[0558] (ii) Aggregate formation of hPSCs in suspension culture

[0559] For aggregate formation hPSCs were dissociated to a single cell suspension as described in section (i) above, with the only differences being that Accutase cell detachment solution (STEMCELL Technologies, product no. 7920) was applied instead of TrypLE Select enzyme.

[0560] A hPSCs single cell suspension was prepared in NutriStem hPSCs XF medium containing 10pM Y-27632 dihydrochloride and 100ng / ml bFGF (Peprotech, product no. 100-18B) at 0.5-1.5 x 106live cells / ml. The hPSCs suspension was seeded into appropriate suspension culture vessels. Suspension culture vessels include Erlenmeyer Shake Flasks (Corning), disposable spinner flask system (Corning) ABLE Biott 3D Magnetic stir and disposable bioreactor systems (ABLE Biott / Reprocell) and Eppendorf DASGIP or DASBOX Parallel Bioreactor Systems (Eppendorf).

[0561] For the ABLE Biott system, 30 or 100ml bioreactors with hPSCs suspension was placed on magnetic stir plates at 60RPM in 37C, 5% CO2 and cultured for 72h with daily medium change. During medium change hPSCs aggregates were settled by gravity in the bioreactors and medium was removed and replenished with NutriStem hPSCs XF medium containing 10pM Y-27632 dihydrochloride and 100ng / ml bFGF. In certain cases, medium was transitioned to StemFit Basic 03 (Ajinomoto, product no. 34770) containing 5pM Y-27632 dihydrochloride and 100ng / ml bFGF. Briefly, hPSCs were seeded in in NutriStem hPSCs XF medium containing 10pM Y-27632 dihydrochloride and 100ng / ml bFGF and after the first 24h, a half medium change was performed with StemFit Basic 03 containing 5pM Y-27632 dihydrochloride and 100ng / ml bFGF and after 48 a full medium change with StemFit Basic 03 containing 5pM Y-27632 dihydrochloride and 100ng / ml bFGF. Following 72h of suspension culture, hPSCs aggregate size and numbers were determined using an automatic islet cell counter (BIOREP, product no. ICC-04).

[0562] (iii) Differentiation of hPSCs aggregates to DE hPSCs aggregates were transferred to 6-well ultra-low attachment plates (Corning, product no. 3471) or kept in ABLE Biott 3D Magnetic stir and disposable bioreactor systems for DE differentiation. hPSCs aggregates were washed once in RPMI 1640 medium, and medium was subsequently changed to RPMI 1640 medium, with CHIR 99021 (Tocris Bioscience, product no. TB4423-GMP) added in concentrations ranging from 2 to 8pM or 1 M CP21 R7. 6-well ultra-low attachment plates containing 5ml medium were placed on a Celltron shaker set to 120RPM (INFORS HT). ABLE Biott bioreactors were placed on magnetic stir plates set to 60RPM, both in 37C, 5% CO2standard incubator. After 24h, aggregates were settled by gravity and washed once in RPMI 1640 medium. Medium was changed to RPMI 1640 medium with 100ng / ml Activin A (Peprotech, product no. 120-14E). Medium change was repeated after 48h, no medium change at 72h and DE differentiation was completed after 96h. The schematic overview of differentiation of hPSCs to DE is shown in figure 2A.

[0563] Example 5: Differentiation of DE into pancreatic endocrine cells

[0564] Further differentiation of DE towards pancreatic endocrine cells including beta cells was carried out in 30ml volume ABLE Biott bioreactors rotating at 60RPM, in 37C, 5% CO2 standard incubator. DE was differentiated towards pancreatic endoderm by washing DE aggregates in RPMI 1640 medium subsequently changed to RPMI 1640 medium containing 12% Knock-out serum replacement (GIBCO, product no. 10828-028), 1 :1000 (v / v) Revitacell (GIBCO, product no. A4238401), 12.5nM LDN193189 (Tocris, product no. 6053) and 3pm AGN 193109 (Tocris, product no. 5758) for 48h with daily medium changes. Aggregates were washed as above and further differentiated for 48h with daily medium changes in RPMI 1640 medium containing 12% Knock-out serum replacement, 1 :1000 (v / v) Revitacell, 64ng / ml bFGF (Peprotech, product no. 100-18B), 12.5nM LDN 193189, 1 pM AM 580 (Tocris, product no. 0760) and 10pM SP 600125 (Tocris, product no. 1496). Aggregates were washed as above and further differentiated for additional seven days in RPMI 1640 medium containing 12% Knock-out serum replacement, 1 :1000 (v / v) Revitacell, 64ng / ml bFGF, 0.05pM AM580 and 10pM SP 600125. Pancreatic endoderm was further differentiated towards pancreatic endocrine cells by washing cells in MCDB131 medium (Gibco, product no. 10372019) and subsequently adding MCDB131 medium containing 0.05% human serum albumin (Origin, product no. ART-3003), final concentration of 25,5mM glucose (Sigma-Aldrich, product no. G8769), 14.64mM NaHCO3 (Gibco, product no. 25080094), 1 :200 (v / v) ITS-X (Gibco, product no. 51500056), 1 :100 Glutamax (Gibco, product no. 35050038), 0.25pM Ascorbic acid (JT Baker, product no.0937-07) and 10pM ZnSO4 (Merck, product no. 1088811000). Medium was replenished every 48h. The following compounds were included during the first four days of the differentiation: 2pM XX (Tocris, product no. 4489), 1 M T3 (Tocris, product no. 6666), 5pM Y-27632 dihydrochloride (Tocris, product no. 1254), 100nM LDN 193189, 60ng / ml Betacellulin (R&D Systems, product no. 261-CE-250), 10pg / ml heparin (Akron Biotech, product no. AK9987-1000), 3.3nM Staurosporine (Tocris, product no. 1258), 10pM forskolin (Tocris, product no. 1099), 5pM TCS JNK 6o (Tocris, product no. 3222) and 3.5pM Linifanib (Tocris, product no. 7743). The following compounds were included for the subsequent three days of differentiation: 1 M XX, 1 M T3, 5pM Y-27632 dihydrochloride, 100nM LDN 193189, 10pg / ml heparin, 3.3nM Staurosporine and 3.5pM Linifanib.

[0565] Example 6: Single cell dissociation for flow cytometry and single cell RNA- sequencing

[0566] Approximately 1-5ml of cell aggregates (undifferentiated hPSCs, DE, pancreatic endoderm and pancreatic endocrine cells) were sampled from differentiations and transferred to 15ml centrifugation tubes. Aggregates were sedimented and supernatant removed. Aggregates were washed in 10ml of PBS - / - and subsequently incubated with 2ml of TrypLE Select enzyme for 5-7 minutes at 37°C, horizontally shaking. Aggregate dissociation to single cells were facilitated by pipetting carefully up and down a few times and the enzymatic reaction was subsequently terminated by adding 10ml of RPMI 1640 containing 0.5% Knock-out serum replacement. Cells were filtered through a 40pm cell strainer (Corning, product no. CLS431750). Cell number and viability was determined using an automated cell counter (Chemometec, NC-202). The single cell suspension was subsequently processed for flow cytometry analysis or single cell RNA-sequencing.

[0567] Example 7: Flow cytometry sample preparation and analysis

[0568] 2.5 x 106 live single cells were pelleted (400xG, 5min) and subsequently washed once in PBS - / -. Cells were resuspended in PBS - / - at 1 x 106 live cells / ml and 1 pl / ml of LIVE / DEAD fixable Near-IR solution (Thermofisher, L10119) was added. Cells were incubated for 15 min. at room temperature and light protected. Cells were pelleted (400xG, 5min), supernatant removed and resuspended in 1ml of 4% formaldehyde. Cells were incubated for 20 min. at 4°C and light protected. 12ml of PBS - / - containing 1% bovine serum albumin (BSA) was added and cells pelleted (800xG, 3min) and subsequently resuspended in PBS - / - containing 1% BSA. Following fixation, cells were stored at 4°C until further processed. Cells were pelleted (800xG, 3min) and subsequently resuspended in PBS - / - containing 0.2% Triton X-100 and 2% BSA and incubated for 30min at room temperature. Cells were pelleted (800xG, 3min), supernatant removed and primary / directly conjugated antibody solution was added to the cells. Incubate overnight at 4°C / 30min at room temperature. After incubation, cells were washed in PBS - / - with 1% BSA. For primary / secondary antibody staining, cells were incubated with secondary antibody in PBS - / - containing 0.2% Triton X-100 and 2% BSA for 30min at room temperature followed by washing as above. Cells were subsequently filtered through a 40pm mesh filter and samples processed on standard flow cytometry equipment.

[0569] Example 8: Single-cell RNA-sequencing

[0570] Single cell RNA sequencing was performed on single cells fixed with formaldehyde. Briefly, single cells were fixed according to manufactures protocol (10x Genomics, CG000478). Fixed cells were subsequently processed using the Chromium Fixed RNA profiling reagent kit from 10x Genomics (CG000527).

Claims

CLAIMS1 . A method for inhibiting the formation of a mesodermal cell population during in vitro differentiation of human pluripotent stem cells into definitive endoderm comprising inactivating or reducing the expression of one or more genes in the human pluripotent stem cells, wherein said one or more genes are required for the formation of the mesodermal cell population.

2. The method according to claim 1 , wherein said one or more genes required for the formation of the mesodermal cell population is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEFT3. The method according to any one of the preceding claims, wherein said one or more genes required for the formation of the mesodermal cell population comprises MESP1 and / or MESP2 or TBXT.

4. The method according to any one of the preceding claims, wherein reduced expression of said one or more genes is by a decrease in the amount of RNA transcript (mRNA) of said one or more genes, a decrease in the amount of protein encoded by said one or more genes, and / or a decrease in the amount of activity of said one or more genes.

5. The method according to any of the preceding claims, wherein inactivating said one or more genes is performed or achieved by knocking out or knocking down said genes in the human pluripotent stem cells by using a genetic engineering technology selected from MAD7 nuclease, CRISPR nuclease, base editing, prime editing, zinc finger nucleases, transcription activator-like effector nucleases, or homologous recombination.

6. The method according to any one of the preceding claims, wherein in vitro differentiation of the human pluripotent stem cells into definitive endoderm comprises a step of culturing the human pluripotent stem cells in a cell culture medium comprising a WNT signalling activator.

7. The method according to claim 6, wherein the WNT signalling activator is CHIR or CP21 R7 or WNT3a or BIO.

8. The method according to claim 6 or 7, wherein the concentration of the WNT signalling activator in said culture medium is 1-8 pM.

9. The method according to any one of the preceding claims comprising an intermediate step of differentiating said human pluripotent stem cells into primitive streak.

10. The method according to any one of the preceding claims 1 to 8, further comprising differentiating said definitive endoderm into pancreatic endocrine cells or insulin producing cells.11 . A genetically engineered cell, wherein the cell is genetically modified to prevent formation of mesodermal cells during the differentiation of human pluripotent stem cells into definitive endoderm, pancreatic endoderm or pancreatic endocrine cells, wherein the genetically engineered cell comprises MESP1 and / or MESP2 or TBXT genes that have been inactivated or have a reduced expression.

12. An in vitro cell population of genetically engineered cells according to claim 11 or definitive endoderm derived from human pluripotent stem cells wherein one or more genes required for the formation of a mesodermal cell population has been inactivated in said human pluripotent stem cells, wherein said one or more gene is selected from MESP1 , MESP2, TBX6, HES7, CDX1 , CDX2, CDX4, TBXT, HOXA1 , HOXB1 , HOXB3, HOXB4, MSX1 , MSX2, MSGN1 , ETV1 , EVX1 , HAND1 , HAND2, SOX7, FOXF1 , FOXC1 , FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS or LEF1 .

13. The cell population according to claim 12, wherein said population comprises less than 1% or 2% mesodermal cells and / or less than 0.05% residual human pluripotent stem cells.

14. The cell population according to claim 12 to 13, further differentiated or for further differentiation into pancreatic endocrine cells or insulin producing cells for use as a medicament in the treatment of diabetes by administering or grafting or transplanting the pancreatic endocrine cells or insulin producing cells or tissue or organ derived from the pancreatic endocrine cells or insulin producing cells into a subject.

15. A cell composition comprising in vitro cell population according to any one of the preceding claims 12-14 and a cell culture medium.