Methods and compositions for immunosuppressant resistant cellular therapies
Patent Information
- Application Number
- EP2024886962
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-01
- Filing Date
- 2024-11-01
- Publication Date
- 2026-09-09
AI Technical Summary
Existing cellular therapies, such as CAR-T cells and viral specific T cells, face efficacy challenges due to the inhibitory effects of immunosuppressive agents like calcineurin inhibitors, which are commonly used in patients undergoing allogeneic hematopoietic cell transplantation.
Engineering immune cells to be resistant to immunosuppressant drugs by gene editing the PPIA gene, specifically editing exon 5 to modify Cyclophilin A, using CRISPR-associated proteins and single guide RNAs, thereby conferring resistance to cyclosporine and voclosporin.
The modified Cyclophilin A in engineered immune cells demonstrates significant resistance to cyclosporine and voclosporin, maintaining proliferation and effector function even in the presence of these immunosuppressive agents, thus enhancing the effectiveness of cellular therapies.
Smart Images

Figure US2024054075_08052025_PF_FP_ABST
Abstract
Description
METHODS AND COMPOSITIONS FOR IMMUNOSUPPRESSANT RESISTANTCELLULAR THERAPIESCROSS-REFERENCE TO RELATED APPUICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 546,806 filed November 1, 2023, the contents of which are incorporated herein by reference in their entirety.GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant Number Al 174967, awarded by the National Institutes of Health. The Government has certain rights in the invention.SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on October 29, 2024, is named 701039-000137WOPT_SL.xml and is 8,759 bytes in size.TECHNICAL FIELD
[0004] The technology described herein relates to methods and compositions related to immunosuppressant resistant cellular therapies, e.g., calcineurin inhibitor resistant T-cells.BACKGROUND
[0005] Relapse of a patient’s underlying malignancy, and complications related to viral reactivation are prominent causes of morbidity and mortality after allogeneic hematopoietic cell transplantation (HCT). In fact, there are numerous scenarios in hematopoietic cell transplantation, solid organ transplantation, and autoimmune disease that may warrant treatment with a cellular therapy. Immune effector cells (IEC) are increasingly deployed to prevent and treat these complications. These include therapies such as CAR-T cells, CAR-Tregs, and viral specific T cells, i.e., anti-CD19 CAR-T-cells used for post-HCT B-ALL relapse, as well as viral specific T cells (VSTs) targeting EBV, CMV, and others. However, patients with these medical conditions may have chronic defects in immune tolerance and may already be on a calcineurin inhibitor like cyclosporine or voclosporin which suppresses T cell activity for their maintenance therapy. Thus, the efficacy of these lECs early after HCT may be compromised by the inhibitory effects of immunosuppressive agents used. This can create an uncomfortable clinical scenario in which a physician is not sure if the drug can be continued through giving the cellular therapy and may wean or discontinue the drug out of caution, meanwhile inadvertently resulting in a disease flare.SUMMARY
[0006] The technology described herein is directed to methods and compositions relating to the enhanced cell therapies, in particular engineering immune cells to be resistant to immunosuppressant drugs. Aspects of the technology described herein are based on the inventors’ discovery that gene editing strategies to modify Cyclophilin A protein, which is encoded by the gene PPIA, can result in immunosuppressant drug resistance.
[0007] In one aspect of any of the embodiments, described herein is a method for engineering a human immune cell, the method comprising gene editing the cell by editing exon 5 of the PPIA gene encoding Cyclophilin A, wherein the gene editing results in a modified cyclophilin A.
[0008] In some embodiments of any of the aspects, the gene editing comprises introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cell. In some embodiments of any of the aspects, the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.
[0009] In some embodiments of any of the aspects, the human immune cell is a T cell.
[0010] In one aspect of any of the embodiments, described herein is a method for preparing an engineered human immune cell, the method comprising isolating immune cells or T cells from a subject; stimulating the immune cells or T cells with antibodies, a virus-derived antigen, another pathogen-derived antigen, or a cancer antigen; isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells; gene editing the cells of said composition to edit the PPIA gene, encoding Cyclophilin A, by introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cells of said composition; and selecting engineered cells by culturing the cells in the presence of an immunosuppressant agent capable of interacting with Cyclophilin A.
[0011] In some embodiments of any of the aspects, the sgRNA used to engineer a human immune cell targets the sequence GTGTTTGGCAAAGTGAAAGA. In some embodiments of any of the aspects, the human immune cell is a Pan-T cell. In some embodiments of any of the aspects, the human immune cell is a T cell specific for a virus, another pathogen, or a cancer antigen. In some embodiments of any of the aspects, the human immune cell is a CAR-T cell.
[0012] In one aspect of any of the embodiments, described herein is a cell or a population of cells produced by the methods of any of the embodiments.
[0013] In one aspect of any of the embodiments, described herein is an engineered cell comprising a gene edited PPIA gene, wherein the gene edit is in exon 5 of the gene, and wherein the gene edited PPIA gene encodes a modified Cyclophilin A.
[0014] In some embodiments of any of the aspects, the engineered cell is a human cell. In some embodiments of any of the aspects, the engineered cell is an immune cell. In some embodiments of any of the aspects, the engineered cell is a T cell. In some embodiments of any of the aspects, the engineered cell is a T cell specific for a virus, another pathogen, or a cancer antigen. In some embodiments of any of the aspects, the engineered cell is primed in an antigen-specific manner by stimulation with antibodies, an antigen from a virus, another pathogen, or a cancer antigen. In some embodiments of any of the aspects, the engineered cell is a regulatory T cell. In some embodiments of any of the aspects, the engineered cell is a CAR-T cell. In some embodiments of any of the aspects, the engineered cell is produced by CRISPR / Cas-mediated gene editing of the PPIA gene. In some embodiments of any of the aspects, the engineered cell is produced by CRISPR / Cas-mediated gene editing of the PPIA gene, wherein the single guide RNA used targets the sequence GTGTTTGGCAAAGTGAAAGA. In one aspect of any of the embodiments, described herein is a population of cells comprising engineered cells of any one of the embodiments.
[0015] In one aspect of any of the embodiments, described herein is a pharmaceutical composition comprising a cell of any of the embodiments.
[0016] In one aspect of any of the embodiments, described herein is a method for treating a subject in need thereof comprising administering to the subject the cells or pharmaceutical composition of any of the embodiments.
[0017] In some embodiments of any of the aspects, the subject in need thereof is also administered an immunosuppressant. In some embodiments of any of the aspects, the immunosuppressant is a calcineurin inhibitor. In some embodiments of any of the aspects, the calcineurin inhibitor is cyclosporine or voclosporin.BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Fig. 1 demonstrates that terminal exon editing leads to a narrow indel profile, with two major edits - a +1 bp edit resulting in frameshift, as well as a -1 bp edit, leading to frameshift and early stop codon. These CRISPR edits are stable over 3-4 weeks in culture, suggesting no deleterious effect on cell viability.
[0019] Fig. 2 demonstrates by Flow cytometry, Western Blot, and Confocal microscopy that terminal exon edited PPIAACT cells preserve expression of Cyclophilin A.
[0020] Fig. 3 shows Jurkat Cell line in which the +1 indel (most common) was isolated via plating single cell colonies; demonstrating that this specific indel corresponds to a protein product that can be identified on flow cytometry.
[0021] Fig. 4 shows when bulk RNA-seq was performed comparing PPIAWTvs. PPIAACCD8 T cells after 4 hours of anti-CD3 / CD28 bead stimulation (no drug), there were no differentially expressed genes, supporting that there is no deleterious effect of the edit on T cell activation.
[0022] Fig. 5 demonstrates High Indel percentage in Pan-T Cells after CRISPR-Cas9 editing.
[0023] Fig 6 shows schematic of mixed lymphocyte reaction function assay.
[0024] Fig. 7 demonstrates mixed lymphocyte reaction. 100,000 PPIAWTand PPIAACconventional T cells were co-cultured with 300,000 irradiated, allogeneic stimulator PBMCs for 5 days. Division of PPIAWTor PPIAACResponder T cells was assesses based on Cell Trace Violet (CTV) dilution, normalizing data to the drug-free control. Data shown reflects responder T cells gated on CD8. 2-way ANOVA with Sidak post-hoc test used for statistical analysis.
[0025] Figs 8 shows PPIAACT are fully sensitive to Tacrolimus and Rapamycin as expected since PPIA editing should not affect sensitivity to these drugs.
[0026] Fig 9 demonstrates High Indel percentage in CD 19 CAR-T Cells after CRISPR-Cas9 editing.
[0027] Fig 10 shows schematic of a CAR-T proliferation assay.
[0028] Fig. 11 shows edited CD 19 CAR T cells that were stimulated by NALM6 cells at a 1:0.1 ratio. Division of PPIAWTor PPIAACCAR T cells was assessed based on CTV dilution on Day 3, normalizing data to the drug-free control. 2-way ANOVA with Sidak post-hoc test used for statistical analysis.
[0029] Fig. 12 shows PPIAWTor PPIAACCAR T cells that were stimulated for 4 hours in the presence of protein transport inhibitor + / - PMA / ionomycin (left) or NALM6 cells (right) and stained for cytokine production. lOOng / mL of CsA was used.
[0030] Fig. 13 shows PPIAWTor PPIAACCAR T cells co-cultured for 4 hours with NALM6 cells at different effector to target ratios and then assessed for live NALM6 cells to calculate “% killing”. This was done for CD19 CAR-T cells that have both 41BB and CD28 costimulatory domains.
[0031] Fig 14 demonstrates High Indel percentage in Viral Specific T-Cells (VSTs) after CRISPR-Cas9 editing.
[0032] Fig 15 shows a schematic for CMV VST production and evaluation.
[0033] Fig. 16 shows VST proliferation assays were read out on Day 4 after peptamer stimulation and analyzed as described for Pan T and CAR T cells.
[0034] Fig. 17 shows PPIAWTor PPIAACViral Specific T cells were stimulated for 4 hours in the presence of protein transport inhibitor + / - PMA / ionomycin or pp65 peptamer and stained for cytokine production. lOOng / mL CsA used.
[0035] Fig. 18 demonstrates High Indel percentage in CAR-Treg after CRISPR-Cas9 editing.
[0036] Fig. 19 shows PPIAACTreg have normal expression of Treg markers.
[0037] Fig. 20 shows PPIAACTreg fully express activation marker (CD70) in the setting of CsA, which is otherwise suppressed by CsA in PPIAWTTreg.DETAILED DESCRIPTION
[0038] As demonstrated herein, the inventors have discovered that gene editing the peptidylprolyl isomerase A gene (PPIA), which encodes the protein cyclophilin A, by editing exon 5 results in a modified cyclophilin A. Furthermore, the inventors discovered that the modified cyclophilin A confers immunosuppressant drug resistance, specifically conferring resistance to cyclosporine and voclosporin. Described herein are methods for engineering immune cells and preparing engineered immune cells to edit PPIA such that the engineering results in modified cyclophilin A. Also described herein are engineered cells and comprising a gene edited PPIA gene, and pharmaceutical compositions comprising said cells. Finally, described herein are methods of use of the cells and compositions for cellular therapy to improve hematopoietic cell transplantation, solid organ transplantation, and autoimmune disease treatment.
[0039] Peptidylprolyl isomerase A gene (PPIA) codes for Cyclophilin A, which is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. Cyclophilin A is a ubiquitously distributed protein belonging to the immunophilin family. Cyclophilin A is a critical binding partner for cyclosporine and voclosporin, allowing them exert their immunosuppressive function. Cyclophilin A also interacts with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. CyclophilinA function is known to those skilled in the art, see, for example, Nigro P., et al Cell Death Dis (2013), Satoh K., et al Circ J, (2010), and Luban J. (2013) Cyclophilin A and HIV-1 Replication. In:Encyclopedia of AIDS, which are incorporated hereby by reference.
[0040] PPIA / Cyclophilin A sequences are known for a number of species, e.g., human PPIA (NCBI Gene ID: 5478), mRNA (e.g., NM_021130.5, SEQ ID NO: 1), and polypeptide (e.g.,NP_066953. 1, SEQ ID NO: 2). Antibodies for specific detection of cyclophilin A are available, for example, from RND Systems, see Human Cyclophilin A Antibody, MAB3589. The canonical transcript, NM_021130.5, has 5 total exons. PPIA can refer to human PPIA, including naturally occurring variants, molecules, and alleles thereof.
[0041] SEQ ID NO: 1 is a nucleic acid sequence that encodes variant 1 of human PPIA.1 gttttgcaga cgccaccgcc gaggaaaacc gtgtactatt agccatggtc aaccccaccg61 tgttcttcga cattgccgtc gacggcgagc ccttgggccg cgtctccttt gagctgtttg121 cagacaaggt cccaaagaca gcagaaaatt ttcgtgctct gagcactgga gagaaaggat181 ttggttataa gggttcctgc tttcacagaa ttattccagg gtttatgtgt cagggtggtg241 acttcacacg ccataatggc actggtggca agtccatcta tggggagaaa tttgaagatg301 agaacttcat cctaaagcat acgggtcctg gcatcttgtc catggcaaat gctggaccca361 acacaaatgg ttcccagttt ttcatctgca ctgccaagac tgagtggttg gatggcaagc421 atgtggtgtt tggcaaagtg aaagaaggca tgaatattgt ggaggccatg gagcgctttg481 ggtccaggaa tggcaagacc agcaagaaga tcaccattgc tgactgtgga caactcgaat541 aagtttgact tgtgttttat cttaaccacc agatcattcc ttctgtagct caggagagca601 cccctccacc ccatttgctc gcagtatcct agaatctttg tgctctcgct gcagttccct661 ttgggttcca tgttttcctt gttccctccc atgcctagct ggattgcaga gttaagttta721 tgattatgaa ataaaaacta aataacaatt gtcctcgttt gagttaagag tgttgatgta781 ggctttattt taagcagtaa tgggttactt ctgaaacatc acttgtttgc ttaattctac 841 acagtactta gatttttttt actttccagt cccaggaagt gtcaatgttt gttgagtgga 901 atattgaaaa tgtaggcagc aactgggcat ggtggctcac tgtctgtaat gtattacctg 961 aggcagaaga ccacctgagg gtaggagtca agatcagcct gggcaacata gtgagacgct 1021 gtctctacaa aaaataatta gcctggcctg gtggtgcatg cctagtccta gctgatctgg 1081 aggctgacgt gggaggattg cttgagccta gagtgagcta ttatcatgcc actgtacagc 1141 ctgggtgttc acagatcttg tgtctcaaag gtaggcagag gcaggaaaag caaggagcca 1201 gaattaagag gttgggtcag tctgcagtga gttcatgcat ttagaggtgt tcttcaagat 1261 gactaatgtc aaaaattgag acatctgttg cggttttttt tttttttttt tcccctggaa 1321 tgcagtggcg tgatctcagc tcactgcagc ctccgcctcc tgggttcaag tgattctagt 1381 gcctcagcct cctgagtagc tgggataatg ggcgtgtgcc accatgccca gctaattttt 1441 gtatttttag tatagatggg gtttcatcat tttgaccagg ctggtctcaa actcttgacc 1501 tcagctgatg cgcctgcctt ggcctcccaa actgctgaga ttacagatgt gagccaccgc 1561 accctacctc attttctgta acaaagctaa gcttgaacac tgttgatgtt cttgagggaa 1621 gcatattggg ctttaggctg taggtcaagt ttatacatct taattatggt ggaattccta1681 tgtagagtct aaaaagccag gtacttggtg ctacagtcag tctccctgca gagggttaag 1741 gcgcagacta cctgcagtga ggaggtactg cttgtagcat atagagcctc tccctagctt 1801 tggttatgga ggctttgagg ttttgcaaac ctgaccaatt taagccataa gatctggtca 1861 aagggatacc cttcccacta aggacttggt ttctcaggaa attatatgta cagtgcttgc 1921 tggcagttag atgtcaggac aatctaagct gagaaaaccc cttctctgcc caccttaaca 1981 gacctctagg gttcttaacc cagcaatcaa gtttgcctat cctagaggtg gcggatttga 2041 tcatttggtg tgttgggcaa tttttgtttt actgtctggt tccttctgcg tgaattacca 2101 ccaccaccac ttgtgcatct cagtcttgtg tgttgtctgg ttacgtattc cctgggtgat 2161 accattcaat gtcttaatgt acttgtggct cagacctgag tgcaaggtgg aaataaacat 2221 caaacatctt ttcatta
[0042] SEQ ID NO: 2 is an amino acid sequence of variant 1 of human PPIA.1 mvnptvffdi avdgeplgrv s fel fadkvp ktaenfrals tgekgfgykg scfhriipgf61 mcqggdftrh ngtggksiyg ekfedenfil khtgpgilsm anagpntngs qffictakte 121 wldgkhvvfg kvkegmnive amerfgsrng ktskkitiad cgqle
[0043] In one aspect of any of the embodiments, described herein are methods for engineering a cell or methods for preparing an engineered cell, comprising gene editing the cell by editing the PPIA gene. In some embodiments, the gene editing results in a modified cyclophilin A. In some embodiments, the gene editing targets the PPIA gene. In some embodiments, the gene editing targets exon 5 of the PPIA gene.
[0044] In one embodiment, the gene-editing system is a CRISPR-associated nuclease. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas9-mediated gene disruption has been widely used in generating loss-of-function mutations in diverse organisms including mammals (Cong et al., 2013, Science, 339(6121):819-23; reviewed in Hsu et al., 2014, Cell, 157(6): 1262-78)). Cas9- based knockout screens have been applied in identifying essential genes and genes involved in drug resistance in various cell lines. With respect to general information on CRISPR-Cas Systems, components thereof, and delivery of such components, including methods, materials, delivery vehicles, vectors, particles, AAV, and making and using thereof, including as to amounts and formulations, all useful in the practice of the instant invention, reference is made to: US Patents Nos. 8,999,641, 8,993,233, 8,945,839, 8,932,814, 8,906,616, 8,895,308, 8,889,418, 8,889,356, 8,871,445, 8,865,406, 8,795,965, 8,771,945 and 8,697,359; US Patent Publications US 2014-0310830, US 2014-0287938, US 2014-0273234, US2014-0273232, US 2014-0273231, US 2014-0256046, US 2014- 0248702, US 2014-0242700, US 2014-0242699, US 2014-0242664, US 2014-0234972, US 2014- 0227787, US 2014-0189896, US 2014-0186958, US 2014-0186919, US 2014-0186843, US 2014- 0179770 and US 2014-0179006, US 2014-0170753; European Patents EP 2 784 162 Bl and EP 2 771 468 Bl; European Patent Applications EP 2 771 468 (EP13818570.7), EP 2 764 103 (EP13824232.6), and EP 2 784 162 (EP14170383.5); and International Application No. WO 2014 / 093661, all of which are incorporated herein by reference in their entirety.
[0045] Any CRISPR-associated nuclease can be used in the system and methods of the invention. CRISPR nuclease systems are known to those of skill in the art, e.g. Cas9, Casl2, Casl2a, or the like, see Patents / applications 8,993,233, US 2015 / 0291965, US 2016 / 0175462, US 2015 / 0020223, US 2014 / 0179770, 8,697,359; 8,771,945; 8, 795,965; WO 2015 / 191693; US 8,889,418; WO 2015 / 089351; WO 2015 / 089486; WO 2016 / 028682; WO 2016 / 049258; WO 2016 / 094867; WO 2016 / 094872; WO 2016 / 094874; WO 2016 / 112242; US 2016 / 0153004; US 2015 / 0056705; US 2016 / 0090607; US 2016 / 0029604; 8,865,406; 8,871,445; each of which are incorporated by reference in their entirety. The nuclease can also be a phage Cas nuclease, e.g., Cas<b (e.g., Pausch et al. Science 369:333-7 (2020); which is incorporated by reference herein in its entirety).
[0046] In these methods, the Cas protein and the one or more guide RNAs may be on the same or on different vectors of the system and are integrated into each cell, whereby each guide sequence targets a sequence within the continuous genomic region in each cell in the population of cells. The Cas protein is operably linked to a regulatory element to ensure expression in said cell, more particularly a promoter suitable for expression in the cell of the cell population. In particular embodiments, the promoter is an inducible promoter, such as a doxycycline inducible promoter.When transcribed within the cells of the cell population, the guide RNA comprising the guide sequence directs sequence-specific binding of a CRISPR-Cas system to a target sequence in the continuous genomic region. Typically binding of the CRISPR-Cas system induces cleavage of the continuous genomic region by the Cas protein
[0047] The full-length guide nucleic acid strand can be any length. For example, the guide nucleic acid strand can be about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments of the various aspects described herein, a nucleic acid strand is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. For example, the guide nucleic acid sequence is 10-30 nucleotides long. In some embodiments of various aspects described herein, the guide nucleic acid sequence is 20 nucleotides long.
[0048] In addition to a sequence that is complementary to a target nucleic acid, in some embodiments, the guide nucleic acid (gNA) also comprises a scaffold sequence. Expression of a gNAencoding both a sequence complementary to a target nucleic acid and scaffold sequence has the dual function of both binding (hybridizing) to the target nucleic acid and recruiting the endonuclease to the target nucleic acid, which may result in site-specific CRISPR activity. In some embodiments, such a chimeric gNA may be referred to as a single guide RNA (sgRNA).
[0049] In some embodiments of the various aspects described herein, the guide nucleic acid is designed using a guide design tool (e.g., Benchling™; Broad Institute GPP™; CasOFFinder™; CHOPCHOP™; CRISPOR™; Deskgen™; E-CRISP™; Geneious™; GenHub™; GUIDES™ (e.g., for library design); Horizon Discovery™; IDT™; Off-Spotter™; and Synthego™; which are available on the world wide web).
[0050] As described herein, the gene editing system is used to specifically target sequences within the continuous genomic region of interest. The targeting typically comprises introducing into each cell of a population of cells a vector system of one or more vectors comprising an engineered, non-naturally occurring CRISPR-Cas system comprising: at least one Cas protein, and one or more guide RNAs.
[0051] It is contemplated herein that the Cas9 / CRISPR system of genome editing be employed with the methods, cells and compositions described herein. Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems is useful for RNA-programmable genome editing (see e.g., Jinek, M. et al. Science (2012) 337(6096): 816-821).
[0052] Trans-activating crRNA (tracrRNA) is a small trans-encoded RNA. It was first discovered in the human pathogen Streptococcus pyogenes. (See Deltcheva E, et al. (2011). Nature 471 (7340): 602-7). In bacteria and archaea, CRISPR / Cas (clustered, regularly interspaced short palindromic repeats / CRISPR-associated proteins) constitute an RNA-mediated defense system which protects against viruses and plasmids. This defensive pathway has three steps. First a copy of the invading nucleic acid is integrated into the CRISPR locus. Next, CRISPR RNAs (crRNAs) are transcribed from this CRISPR locus. The crRNAs are then incorporated into effector complexes, where the crRNA guides the complex to the invading nucleic acid and the Cas proteins degrade this nucleic acid. (See e.g., Terns MP and Terns RM (2011). Curr Opin Microbiol 14 (3): 321-7). There are several pathways of CRISPR activation, one of which requires a tracrRNA which plays a role in the maturation of crRNA. TracrRNA is complementary to and base pairs with a pre-crRNA forming an RNA duplex. This is cleaved by RNase III, an RNA-specific ribonuclease, to form a crRNA / tracrRNA hybrid. This hybrid acts as a guide for the endonuclease Cas9, which cleaves the invading nucleic acid, (see e.g., Deltcheva E, et al. supra; Jinek M, et al. (2012), Science 337 (6096): 816-21; and Brouns SJ (2012), Science 337 (6096): 808-9).
[0053] In some embodiments of the various aspects described herein, the guide nucleic acid is designed to target the PPIA gene.
[0054] In some embodiments of the various aspects described herein, the guide nucleic acid targets exon 5 of the PPIA gene.
[0055] In some embodiments of the various aspects described herein, the guide nucleic acid targets exon 5 of the PPIA gene and results in a modified cyclophilin A gene product. Exon 5 sequence is gttg gatggcaagc atgtggtgtt tggcaaagtg aaagaaggca tgaatattgt ggaggccatg gagcgctttg ggtccaggaa tggcaagacc agcaagaaga tcaccattgc tgactgtgga caactcgaat aagtttgact tgtgttttat cttaaccacc agatcattcc ttctgtagct caggagagca cccctccacc ccatttgctc gcagtatcct agaatctttg tgctctcgct gcagttccct ttgggttcca tgttttcctt gttccctccc atgcctagct ggattgcaga gttaagttta tgattatgaa ataaaaacta aataacaatt gtcctcgttt gagttaagag tgttgatgta ggctttattt taagcagtaa tgggttactt ctgaaacatc acttgtttgc ttaattctac acagtactta gatttttttt actttccagt cccaggaagt gtcaatgttt gttgagtgga atattgaaaa tgtaggcagc aactgggcat ggtggctcac tgtctgtaat gtattacctg aggcagaaga ccacctgagg gtaggagtca agatcagcct gggcaacata gtgagacgct gtctctacaa aaaataatta gcctggcctg gtggtgcatg cctagtccta gctgatctgg aggctgacgt gggaggattg cttgagccta gagtgagcta ttatcatgcc actgtacagc ctgggtgttc acagatcttg tgtctcaaag gtaggcagag gcaggaaaag caaggagcca gaattaagag gttgggtcag tctgcagtga gttcatgcat ttagaggtgt tcttcaagat gactaatgtc aaaaattgag acatctgttg cggttttttt tttttttttt tcccctggaa tgcagtggcg tgatctcagc tcactgcagc ctccgcctcc tgggttcaag tgattctagt gcctcagcct cctgagtagc tgggataatg ggcgtgtgcc accatgccca gctaattttt gtatttttag tatagatggg gtttcatcat tttgaccagg ctggtctcaa actcttgacc tcagctgatg cgcctgcctt ggcctcccaa actgctgaga ttacagatgt gagccaccgc accctacctc attttctgta acaaagctaa gcttgaacac tgttgatgtt cttgagggaa gcatattggg ctttaggctg taggtcaagt ttatacatct taattatggt ggaattccta tgtagagtct aaaaagccag gtacttggtg ctacagtcag tctccctgca gagggttaag gcgcagacta cctgcagtga ggaggtactg cttgtagcat atagagcctc tccctagctt tggttatgga ggctttgagg ttttgcaaac ctgaccaatt taagccataa gatctggtca aagggatacc cttcccacta aggacttggt ttctcaggaa attatatgta cagtgcttgc tggcagttag atgtcaggac aatctaagct gagaaaaccc cttctctgcc caccttaaca gacctctagg gttcttaacc cagcaatcaa gtttgcctat cctagaggtg gcggatttga tcatttggtg tgttgggcaa tttttgtttt actgtctggt tccttctgcg tgaattacca ccaccaccac ttgtgcatct cagtcttgtg tgttgtctgg ttacgtattc cctgggtgat accattcaat gtcttaatgt acttgtggct cagacctgag tgcaaggtgg aaataaacat caaacatctt ttcatta (SI Q ID NO: 3)
[0056] In some embodiments of the various aspects described herein, the guide nucleic acid targets the sequence GTGTTTGGCAAAGTGAAAGA (SEQ ID NO: 4).
[0057] In some embodiments, the gene editing results in a modified gene product. In some embodiments, the gene editing produces a modified cyclophilin A protein. In some embodiments, the gene editing results in a modified gene product, but does not affect protein expression. In some embodiments, the gene editing results in a functional gene product. In some embodiments, the gene editing has no negative impact on cell function, i.e., T cell function.
[0058] As used herein, modified refers to an alteration of the product, e.g., cyclophilin A, such that the amino acid sequence is different from the native sequence (e.g., sequences naturally found in the cell). In some embodiments, the gene editing results in a frameshift, e.g., of the PPIA gene. Insome embodiments, the gene editing results in a frameshift in exon 5 of the PPIA gene. In some embodiments, the modified gene product, e.g., cyclophilin A, has altered residues near the C- terminus. In some embodiments, the modified gene product is truncated. In some embodiments, modified refers to truncated.
[0059] In some embodiments, the methods described herein, result in engineered cells that are resistant to cyclosporine and voclosporin.
[0060] As a consequence of the gene editing, the cells of the population, e.g., at least 10% of the cells of the population are resistant to the action of an immunosuppressant agent capable of interacting with the Cyclophilin A, optionally, at least 20%, preferably, at least 50%, e.g., 70%, at least 90%, at least 99% or most preferably, 100%.
[0061] In some embodiments, the gene editing is achieved using a DNA-targeting molecule, such as a DNA-binding protein or DNA-binding nucleic acid, or complex, compound, or composition, containing the same, which specifically binds to or hybridizes to the gene, e.g., PPIA. In some embodiments, the DNA-targeting molecule comprises a DNA-binding domain, e.g., a zinc finger protein (ZFP) DNA-binding domain, a transcription activator-like protein (TAL) or TAL effector (TALE) DNA-binding domain, a clustered regularly interspaced short palindromic repeats (CRISPR) DNA-binding domain, or a DNA-binding domain from a meganuclease. Zinc finger, TALE, and CRISPR system binding domains can be engineered to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger or TALE protein. Engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and / or TALE designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Publication No. 2011 / 0301073.
[0062] In one embodiment, the engineered cells are immune cells. For example, in some embodiments of the methods described herein, the cell type that is engineered to gene edit Cyclophilin A is an immune cell. As used herein, “immune cell” refers to a cell that plays a role in the immune response. Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes. In some embodiments, the cell is a T cell; a NK cell; a NKT cell; lymphocytes, such as B cells and T cells; and myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes. In some embodiments, the cell is a T cell. One skilled in the art will be able to isolate and engineer an immune cells using standard techniques in the art and described herein
[0063] As used herein, “T-cells” refers to a type of white blood cell that plays a significant role in the body’s immune defenses. Methods for determining a T cell include, but are not limited to, flow cytometry to assess for T cell-specific cell surface markers. Cell surface markers for T-cells are known in the art and include, but are not limited to CD3, CD8, CD4, CXCR3, CD25, CD28, CD 127, CD 152, and FoxP3. Various types of T-cells are known in the art. Such types include, but are not limited to, a CD3+T cell; a CD5+ T cell, a CD4+CD8+ T cell; a CD4 CD8 T cell, a CD4 CD8+T cell, a CD8+T cell, a T-cell receptor (TCR)ab+T cell, a TCRgd+ T cell, an NKT cell, a CD27+lymphocyte, a CD19+B cell, a CD20+B-cell, a CD56+NK cell, or a CD16+NK cell.
[0064] As used herein, the term “isolating cells” refers to the selective separation or enrichment of a target cell, cell type or class of cells from a sample comprising other cells, cell types of cell classes such that the cell population resulting from such separation has a high degree of cell purity as determined by specific cell markers (e.g., CD8a for a CD8 positive T cell or B cell).
[0065] While higher degrees of cell purity are preferred over lower, cell “isolation” as the term is used herein does not require 100% purity of the resulting cell population. Target cells (e.g., immune cells) or a population thereof will generally be considered “isolated” as the term is used herein if they comprise at least 60% of a target cell population, such as a CD-3 / 28 positive cell population, resulting from an isolation method as described herein, and preferably at least 70%, at least 80%, at least 90% or more. In some embodiments, the isolated cells are Pan-T cells.
[0066] T cells are typically isolated from peripheral blood mononuclear cells (PBMCs) collected by leukapheresis. The main methods for clinical-scale T cell isolation include (i) immunodepletion of undesired cells (e.g., proliferating or cancerous cells) followed by selection of T cell populations using antibody-conjugated magnetic beads (e.g., CliniMACS) and (ii) “traceless” selection using Streptamer technology, which is based on fragment antigen-binding (Fab) constructs immobilized on magnetic beads.
[0067] Methods for identifying and isolating a particular type T cell are known in the art, e.g., assessing a T cell for a cell surface marker that distinguishes a type of T cells, e.g., as described herein above.
[0068] In some embodiments, provided herein is a method for preparing an engineered human immune cell, the method comprising, (a) isolating immune cells or T cells from a subject, (b) stimulating the immune cells or T cells with antibodies, a virus-derived antigen, another pathogen derived antigen, or a cancer antigen, (c) isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells, (d) gene editing the cells of said composition to edit the PPIA gene encoding Cyclophilin A, introducing a ribonucleoprotein complex comprising a Cas and sgRNA targeting PPIA, and (e) selecting engineered cells by culturing the cells in the presence of an immunosuppressant agent capable of interacting with Cyclophilin A.
[0069] In some embodiments, the antibodies used to stimulate T cells bind to T cell specific markers. In some embodiments, the antibodies are anti-CD3 and / or anti-CD28.
[0070] In some embodiments, the cell may be an immune effector cell (IEC). As used herein “immune effector cell” is a cell that can create an immune response within the body. Examples of immune effector cells include, but are not limited to chimeric antigen receptor (CAR) T-cells and antigen specific T-cells which target viruses, fungi, and / or bacteria.
[0071] In some embodiments, the cell may be a T cell specific for a virus, another pathogen or a cancer antigen. For example, the T cell may be a virus-specific T cell. The virus may be but is not limited to a virus selected from the group comprising CMV, EBV, BKV, HPV, ADV, influenza virus, parvovirus, rubella virus, hepatitis viruses (HBV, HCV, HAV, HDV, HEV), coxsackie virus, respiratory syncytial virus (RSV), coronaviruses, such as but not only: MERS, SARS-CoVl and SARS-CoV-2. The T cells may also be multi -virus specific T cells, e.g., T cells activated and selected by addition of antigens from multiple viruses.
[0072] In another embodiment of the invention, the cell is a regulatory T cell, preferably, a CD4+CD25+ regulatory T cell, optionally, a CD4+CD25+CD127 regulatory T cell. It may be a regulatory T cell product consisting of polyclonal repertoire or specific for a defined antigen, e.g., a certain allogenic MHC molecule, autoantigen, or a virus such as MERS, SARS-CoVl and SARS- CoV-2.
[0073] Chimeric Antigen Receptors (CARs) are recombinant proteins that allow T cells modified to express them to recognize a specific protein (antigen) on tumor cells. T cells engineered to express a CAR, referred to as CAR T cells, are expanded in the laboratory and are then provided with the ability to target a desired target. In some embodiments, the CAR-T cells are infused into a subject in need thereof. After the infusion, the T cells multiply in the subject’s body and, with guidance from their engineered receptor, recognize and kill cells that display the antigen on their surfaces. Methods of engineering chimeric antigen receptor T cells (also known as CAR T cells) are known in the art. See e.g., US Patents US7446190, US8399645, US8822647, US9212229, US9273283, US9447194, US9587020, US9932405, USI0I25 I93, USI022I245, US10273300, US10287354; US patent publication US20I60I52723; PCT publication W02009091826, W02012079000, WO20I4I65707, WO2015164740, WO2016168595A1, W02017040945, W02017100428, WO2017117112, WO20I7I495 I5, WO20I8067992, WO2018102787, WO2018102786, WO2018165228, WO2019084288; the contents of each of which are incorporated herein by reference in their entireties.
[0074] In some embodiments, methods of genetically modifying a cell to express a CAR can comprise but are not limited to: transfection or electroporation of a cell with a vector encoding a CAR; transduction with a viral vector (e.g., retrovirus, lentivirus) encoding a CAR; gene editing using zin finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganuclease-TALENs, or CRISPR-Cas; or any other methods known in the art of genetically modifying a cell to express a CAR.
[0075] In one embodiment, the cells are obtained directly from the subject to whom they are to be administered (i.e., autologous transplantation). In another embodiment, the transplantation can be non-autologous or allogeneic. As used herein, “allogeneic” refers to cells (e.g., CAR T cells) obtained from one or more different donors of the same species, where the genes at one or more loci are not identical. For example, a cell composition being administered to a subject can be derived from umbilical cord blood obtained from one more unrelated donor subjects, or from one or more nonidentical siblings. In some embodiments, syngeneic cell populations can be used, such as those obtained from genetically identical animals, or from identical twins. In other embodiments of this aspect, the cells are autologous cells; that is, the cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.
[0076] In some embodiments, the antigen-binding region of the CAR is directed against an antigen involved in a disease or disorder, such as but not limited to cancer, autoimmune disease, or heart disease.
[0077] For non-autologous transplantation, the recipient is preferably given an immunosuppressive drug to reduce the risk of rejection of the transplanted cell. Methods of administering cells include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and epidural routes. The cells can be administered by any convenient route, and can be administered together with other biologically active agents. The route of administration is preferably intravenous. The titer of therapeutic cells to be transplanted or administered and which will be effective in the treatment of a particular disease or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances.
[0078] In some aspects, the methods provided herein comprise administering engineered cells to a subject. As described herein, the engineered cell compositions can be administered according to any method known in the art or can be incorporated into pharmaceutical compositions suitable for administration to a subject, e.g., for in vivo delivery to tissues, or organs of the subject.
[0079] The dosage ranges for the therapeutic cell composition includes amounts large enough to produce the desired effect, e.g., treatment of a disease or symptom thereof. The dosage should not be so large as to cause unacceptable adverse side effects. Generally, the dosage will vary with the particular characteristics of therapeutic cell composition, and with the age, condition, and sex of thepatient. The dosage can be determined by one of skill in the art and, unlike traditional cell therapies, can also be adjusted by the individual physician in the event of any complication.
[0080] In some embodiments, the therapeutic cell composition is delivered for a repeated or limited amount of time. In some embodiments, the doses are given once a day, or multiple times a day. The duration of treatment depends upon the subject’s clinical progress and responsiveness to therapy.
[0081] Compositions comprising a therapeutic cell population can be delivered to target cells or tissues by surgical implantation, intravenous administration, intra-arterial administration, intraperitoneal administration, limb perfusion, (optionally, isolated limb perfusion of a leg and / or arm; see, e.g., Arruda et al., (2005) Blood 105: 3458-3464), and / or direct intramuscular injection. Administration to a muscle (e.g. the diaphragm) can be by any suitable method including intravenous administration, intra-arterial administration, and / or intra-peritoneal administration.
[0082] In some embodiments, provided herein a population of engineered immune cells produced by a method described herein, wherein cells are gene edited to produce modified cyclophilin A. In some embodiments, the population of cells further comprises a pharmaceutically acceptable carrier. These engineered immune cells can be culture expanded to increase the number of cells for use.
[0083] In some embodiments, the engineered immune cells described herein are useful in cellular therapy and other medical treatment in subjects having the need. For example, patients in need of cell transplantation or organ transplantation, particularly, when the subject is also receiving an immunosuppressant. Alternatively, the engineered immune cells described herein are useful in the laboratory for biological studies.
[0084] In some embodiments, provided herein is a method for treating a subject in need thereof, e.g., for the treatment of cancer, autoimmune disorders, hematological diseases, or other genetic diseases and disorders in a subject.
[0085] Hematological diseases are disorders which primarily affect the blood. Non-limiting such diseases or disorders include myeloid derived disorders such as hemoglobinopathies (congenital abnormality of the hemoglobin molecule or of the rate of hemoglobin synthesis), examples, sickle-cell disease, thalassemia, and methemoglobinemia; Anemias (lack of red blood cells or hemoglobin), Pernicious anemia; disorders resulting in decreased numbers of cells, such as myelodysplastic syndrome, neutropenia (decrease in the number of neutrophils), and thrombotic thrombocytopenic purpura (TTP), thrombocytosis, hematological malignancies such as lymphomas, myelomas, and leukemia. Lymphomas such as Hodgkin's disease, Non-Hodgkin's lymphoma, Burkitt's lymphoma, Anaplastic large cell lymphoma, Splenic marginal zone lymphoma, Hepatosplenic T-cell lymphoma, and Angioimmunoblastic T-cell lymphoma (AILT); myelomas such as Multiple myeloma, Waldenstrom macroglobulinemia, Plasmacytoma; leukemias that increases defect WBC such as Acutelymphocytic leukemia (ALL), Chronic lymphocytic leukemia (CLL), Acute myelogenous leukemia (AML), Chronic Idiopathic Myelofibrosis (MF), Chronic myelogenous leukemia (CML), T-cell prolymphocytic leukemia (T-PLL), B-cell prolymphocytic leukemia (B-PLL), Chronic neutrophilic leukemia (CNL), Hairy cell leukemia (HCL), T-cell large granular lymphocyte leukemia (T-LGL), and Aggressive NK-cell leukemia.
[0086] In some embodiments, one or more additional compounds can also be included with the therapeutic cell composition (i.e., a cell population with a modified cyclophilin A) to alleviate symptoms of a disease or to otherwise assist or support the function of the administered cells.
[0087] Provided herein is a method of treating an autoimmune disease, which comprises administering an effective amount of an immune cell or population thereof, or a composition, or a pharmaceutical composition as described herein to a patient in need thereof. “Autoimmune disease” refers to a class of diseases in which a subject's own antibodies react with host tissue or in which immune effector T cells are autoreactive to endogenous self-peptides and cause destruction of tissue. Thus an immune response is mounted against a subject's own antigens, referred to as self-antigens. A “self-antigen” as used herein refers to an antigen of a normal host tissue. Normal host tissue does not include neoplastic cells.
[0088] Non-limiting examples of autoimmune diseases that can be treated include pemphigus (pemphigus vulgaris, pemphigus foliaceus or paraneoplastic pemphigus), Crohn's disease, idiopathic thrombocytopenic purpura (ITP), heparin induced thrombocytopenia (HIT), thrombotic thrombocytopenic purpura (TTP), Myasthenia Gravis (MG), and Chronic Inflammatory Demyelinating Polyneuropathy (CIDP). Additional non-limiting autoimmune diseases include autoimmune thrombocytopenia, immune neutropenia, antihemophilic FVIII inhibitor, antiphospholipid syndrome, Kawasaki Syndrome, ANCA-associated disease, polymyositis, bullous pemphigoid, multiple sclerosis (MS), Guillain-Barre Syndrome, chronic polyneuropathy, ulcerative colitis, diabetes mellitus, autoimmune thyroiditis, Graves' ophthalmopathy, rheumatoid arthritis, ulcerative colitis, primary sclerosing cholangitis, systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, Hashimoto's thyroiditis, Goodpasture's syndrome, autoimmune hemolytic anemia, scleroderma with anticollagen antibodies, mixed connective tissue disease, pernicious anemia, idiopathic Addison's disease, autoimmune-associated infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), insulin resistance, and autoimmune diabetes mellitus (type 1 diabetes mellitus; insulin dependent diabetes mellitus). Autoimmune disease has been recognized also to encompass atherosclerosis and Alzheimer's disease. In another embodiment, the autoimmune diseases include hepatitis, autoimmune hemophilia, autoimmune lymphoproliferative syndrome (ALPS), autoimmune uveoretinitis, glomerulonephritis, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, autoimmune angioedema, autoimmune aplastic anemia, autoimmune dysautonomia, autoimmune hyperlipidemia, autoimmune immunodeficiency,autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, autoimmune urticarial neuropathy, autoimmune axonal neuropathy, Balo disease, Behcet's disease, Castleman disease, celiac disease, Chagas disease, chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss syndrome, cicatricial pemphigoid, benign mucosal pemphigoid, Cogan's syndrome, cold agglutinin disease, coxsackie myocarditis, CREST disease, essential mixed cryoglobulinemia, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), dilated cardiomyopathy, discoid lupus, Dressier's syndrome, endometriosis, eosinophilic angiocentric fibrosis, Eosinophilic fasciitis, Erythema nodosum, Evans syndrome, Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Hashimoto's encephalitis, Henoch-Schonlein purpura, Herpes gestationis, Idiopathic hypocomplementemic tubulointerstitial nephritis, multiple myeloma, multifocal motor neuropathy, NMDA receptor antibody encephalitis, IgG4-related disease, IgG4-related sclerosing disease, inflammatory aortic aneurysm, inflammatory pseudotumour, inclusion body myositis, interstitial cystitis, juvenile arthritis, Kuttner's tumour, Lambert-Eaton syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosus, Ligneous conjunctivitis, Linear IgA disease (LAD), Lyme disease, chronic, mediastinal fibrosis, Meniere's disease, Microscopic polyangiitis, Mikulicz's syndrome, Mooren's ulcer, Mucha-Habermann disease, multifocal fibrosclerosis, narcolepsy, optic neuritis, Ormond's disease (retroperitoneal fibrosis), palindromic rheumatism, PANDAS (pediatric autoimmune neuropsychiatric disorders associated with Streptococcus), paraneoplastic cerebellar degeneration, paraproteinemic polyneuropathies, paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, Parsonnage-Tumer syndrome, periaortitis, periarteritis, peripheral neuropathy, perivenous encephalomyelitis, POEMS syndrome, polyarteritis nodosa, Type I, II, & III autoimmune polyglandular syndromes, polymyalgia rheumatic, postpericardiotomy syndrome, progesterone dermatitis, primary biliary cirrhosis, psoriasis, psoriatic arthritis, idiopathic pulmonary fibrosis, pyoderma gangrenosum, pure red cell aplasia, Raynaud's phenomenon, reflex sympathetic dystrophy, Reiter's syndrome, relapsing polychondritis, restless legs syndrome, rheumatic fever, Riede's thyroiditis, sarcoidosis, Schmidt syndrome, scleritis, Sjogren's syndrome, sperm and testicular autoimmunity, stiff person syndrome, subacute bacterial endocarditis (SBE), Susac's syndrome, sympathetic ophthalmia, Takayasu's arteritis, Tolosa-Hunt syndrome, transverse myelitis, undifferentiated connective tissue disease (UCTD), vesiculobullous dermatosis, vitiligo, Rasmussen's encephalitis, Waldenstrom's macroglobulinaemia.
[0089] In various embodiments, the engineered immune cells described herein are optionally expanded ex vivo prior to administration to a subject. In other embodiments, the engineered immune cells are optionally cryopreserved for a period, then thawed prior to administration to a subject.
[0090] In some embodiments, the additional compound can be a therapeutic agent. The therapeutic agent can be selected from any class suitable for the therapeutic objective. In other words, the therapeutic agent can be selected according to the treatment objective and biological actiondesired. Furthermore, the active ingredients of the therapeutic agent can be mixed with optional pharmaceutical additives such as excipients or carriers which are pharmaceutically acceptable and compatible with the active ingredient.
[0091] In one embodiment, the term “effective amount" as used herein refers to the amount of a population of therapeutic cells (e.g., those cells with modified cyclophilin A) needed to alleviate at least one or more symptom of a disease (e.g., an autoimmune disease), and relates to a sufficient amount of a composition to provide the desired effect, e.g., treat a subject having a disease, such as an autoimmune disease. The term "therapeutically effective amount" therefore refers to an amount of therapeutic cells or a composition thereof that is sufficient to promote a particular effect when administered to a typical subject, such as one who has or is at risk of an autoimmune disease. An effective amount as used herein would also include an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate “effective amount" can be determined by one of ordinary skill in the art using routine experimentation.
[0092] As used herein, “administered” refers to the delivery of a composition comprising therapeutic cells as described herein into a subject by a method or route which results in at least partial localization of the cell composition at a desired site. A cell composition can be administered by any appropriate route which results in effective treatment in the subject, i.e. administration results in delivery to a desired location in the subject where at least a portion of the composition delivered to the desired site for a period of time. Modes of administration include injection, infusion, instillation, or ingestion. “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion. For the delivery of therapeutic cells or a composition thereof, administration by injection or infusion is generally preferred.
[0093] In one embodiment, such therapeutic cells as described herein are administered systemically. The phrases “systemic administration," “administered systemically", “peripheral administration" and “administered peripherally" as used herein refer to the administration of a population of therapeutic cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject’s circulatory system and, thus, is subject to metabolism and other like processes.
[0094] The efficacy of a treatment comprising a therapeutic cell composition as described herein for the treatment of a given disease can be determined by the skilled clinician. However, a treatment is considered “effective treatment," as the term is used herein, if any one or all of the signs or symptoms of the disease are altered in a beneficial manner, other clinically accepted symptoms or markers of disease are improved or ameliorated, e.g., by at least 10% following treatment with the therapeuticcells. Efficacy can also be measured by failure of an individual to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in an individual or an animal (some nonlimiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of a given disease; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of disease.
[0095] Following in vitro or ex vivo cell culture, isolation, or differentiation as described herein, isolated or enriched therapeutic cells are prepared for treatment and / or implantation. The cells are suspended in a physiologically compatible carrier, such as cell culture medium (e.g., Eagle's minimal essential media), phosphate buffered saline, or a T cell specific medium. The volume of cell suspension to be implanted will vary depending on the site of implantation, treatment goal, and cell density in the solution.
[0096] It will be appreciated by one of skill in the art that a cell composition useful for treating a given disease does not need to be a pure, homogeneous culture of e.g., therapeutic cells with a modified cyclophilin A. Accordingly, in one embodiment, the composition administered comprises at least 2% therapeutic cells. In other embodiments, the composition comprises at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more therapeutic cells as described herein.
[0097] The cells can be administered to a subject by any appropriate route that results in delivery of the therapeutic cells to a desired location in the subject where at least a portion of the cells remain viable. It is preferred that at least 5% remain viable. In other embodiments, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more of the therapeutic cells remain viable after administration into a subject. The period of viability of the therapeutic cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as a few weeks to months.
[0098] To accomplish these methods of administration, the therapeutic cell composition(s) can be inserted into a delivery device that facilitates introduction by injection or implantation of the therapeutic cells into the subject. Typically, the therapeutic cells are injected into the target area as a cell suspension. Alternatively, the cells can be embedded in a solid or semisolid support matrix when contained in such a delivery device.
[0099] In some embodiments, administration of a composition comprising therapeutic cells is repeated after a given interval of time (e.g., one day, three days, one week, two weeks, three weeks,one month or more. Repeated treatments can be performed, for example, to establish or maintain a threshold level of engraftment necessary to continue effective treatment, as necessary. In some embodiments, the method is repeated twice, three times, four times, five times or more.
[0100] As used herein, surface markers “specific for” a target cell or cell fraction or population of interest are polypeptides or other molecules expressed on the surface of a target cell or cell fraction that are distinct to that target cell or cell fraction and thereby permit the identification and isolation of that cell or cell fraction using a method as described herein. In some embodiments, a single surface marker is sufficient to identify a target cell, e.g., CD8a identifies a CD8+ T cell. In other embodiments, two or more markers can together identify a target cell or cell population or fraction. In other embodiments, a single marker can identify a class of target cells. In other embodiments the cell surface marker is a membrane lipid, peptide, polypeptide, or protein.
[0101] As used herein, the term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder, for example, cancer. For example, the term "treating" and "treatment" refers to administering to a subject an effective amount of a composition, e.g., an PPIA engineered cell described herein so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, disease stabilization (e.g., not worsening), delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. In some embodiments, treating can refer to prolonging survival as compared to expected survival if not receiving treatment. Thus, one of skill in the art realizes that a treatment can improve the disease condition, but may not be a complete cure for the disease. Successful treatment can also be assessed by a reduction in the need for medical interventions, reduction in hospital or emergency room visits, reduction in fatigue, or other markers of an improved quality of life. In some embodiments, treatment can include prophylaxis. However, in alternative embodiments, treatment does not include prophylaxis
[0102] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0103] As used herein, the terms "pharmaceutically acceptable", "physiologically tolerable" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upsetand the like. A pharmaceutically acceptable carrier will not promote the raising of an immune response to an agent with which it is admixed, unless so desired. The preparation of a pharmacological composition that contains active ingredients dissolved or dispersed therein is well understood in the art and need not be limited based on formulation. Typically, such compositions are prepared as injectable either as liquid solutions or suspensions, however, solid forms suitable for solution, or suspensions, in liquid prior to use can also be prepared. The preparation can also be emulsified or presented as a liposome composition. The active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhance the effectiveness of the active ingredient. Therapeutic compositions as described herein can include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like. Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of an active agent used with the methods described herein that will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.
[0104] In some embodiments, the composition of engineered immune cells described further comprises a pharmaceutically acceptable carrier.
[0105] As used herein, the term “subject” includes humans and mammals. The term "mammal" is intended to encompass a singular "mammal" and plural "mammals," and includes, but is not limited to humans; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats,hamsters and guinea pigs; and bears. In some preferred embodiments, a mammal is a human. A subject can be of any age including a neonate, toddler, child, teen, adult or a geriatric subject.
[0106] A “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.
[0107] In some embodiments, the subject is a patient, e.g., a patient requiring immunosuppression, for example because of a transplantation or another unwanted immune response, such as autoimmunity, allergy, or unspecific immunopathology. The patient may already be immunosuppressed, or immunosuppression may be intended in the future, e.g., after the sample is taken. However, the subject may also be a healthy subject.
[0108] In some embodiments, the subject is also administered an immunosuppressant. In some embodiments, the subject is also administered a calcineurin inhibitor. In some embodiments, the subject is also administered cyclosporine or voclosporin.
[0109] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the claimed technology, yet open to the inclusion of unspecified elements, whether essential or not.
[0110] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0111] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0112] As used in this specification and the appended claims, the singular forms “a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus for example, references to "the method" includes one or more methods, and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth
[0113] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.
[0114] As used herein, the term “cell” refers to a single cell as well as to a population of (i.e., more than one) cells. The population may be a pure population comprising one cell type, such as a population of engineered immune cells. As used herein, the term “population” refers to a pure population or to a population comprising a majority (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%) of one cell type. Alternatively, the population may comprise more than one cell type, for example a mixed cell population. It is not meant to limit thenumber of cells in a population; for example, a mixed population of cells may comprise at least one differentiated cell. In the present invention, there is no limit on the number of cell types that a mixed cell population may comprise.
[0115] The term "isolated" as used herein signifies that the cells are placed into conditions other than their natural environment. The term "isolated" does not preclude the later use of these cells thereafter in combinations or mixtures with other cells.
[0116] As used herein, a “cell-surface marker” refers to any molecule that is expressed on the surface of a cell. Cell-surface expression usually requires that a molecule possesses a transmembrane domain. Some molecules that are normally not found on the cell-surface can be engineered by recombinant techniques to be expressed on the surface of a cell. Many naturally occurring cell-surface markers are termed “CD” or “cluster of differentiation” molecules. Cell-surface markers often provide antigenic determinants to which antibodies can bind to.
[0117] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single -stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double -stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g., genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA, iRNA, miRNA, siRNA, etc.
[0118] The nucleic acid can be selected, for example, from a group including: nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide -nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), and locked nucleic acid (LNA). Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, microRNAi (miRNA), and antisense oligonucleotides.
[0119] As used herein, the term “engraftment” in reference to a recipient host is when the new blood-forming cells start to grow and which are derived from the implanted cells and make healthy blood stem cells that show up in recipient’s blood after a minimum period of 10 days after implantation. Engraftment can occur as early as 10 days after transplant but is more common around 14-20 days.
[0120] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at leastabout 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
[0121] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, a “increase” is a statistically significant increase in such level.
[0122] Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide -directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are very well established and include, for example, those disclosed by Walder et al. (Gene 42: 133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462, which are herein incorporated by reference in their entireties. Any cysteine residue not involved in maintaining the proper conformation of the polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to the polypeptide to improve its stability or facilitate oligomerization.
[0123] The term "expression" refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. Expression can refer to the transcription and stable accumulation of sense (mRNA) orantisense RNA derived from a nucleic acid fragment or fragments of the invention and / or to the translation of mRNA into a polypeptide.
[0124] In some embodiments, a polypeptide, nucleic acid, or cell as described herein can be engineered. As used herein, “engineered" refers to the aspect of having been manipulated by the hand of man. For example, a polypeptide is considered to be “engineered" when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature. As is common practice and is understood by those in the art, progeny of an engineered cell are typically still referred to as “engineered" even though the actual manipulation was performed on a prior entity.
[0125] In some embodiments, the engineered immune cell described herein is exogenous. In some embodiments, the engineered immune cell described herein is ectopic. In some embodiments, the engineered immune cell described herein is not endogenous.
[0126] The term "exogenous" refers to a substance present in a cell other than its native source. The term "exogenous" when used herein can refer to a nucleic acid (e.g. a nucleic acid encoding a polypeptide) or a polypeptide that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is not normally found and one wishes to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, “exogenous” can refer to a nucleic acid or a polypeptide that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is found in relatively low amounts and one wishes to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., to create ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is native to the biological system or cell. As used herein, “ectopic” refers to a substance that is found in an unusual location and / or amount. An ectopic substance can be one that is normally found in a given cell, but at a much lower amount and / or at a different time. Ectopic also includes substance, such as a polypeptide or nucleic acid that is not naturally found or expressed in a given cell in its natural environment.
[0127] Nucleic acids encoding a polypeptide as described herein (e.g. a CAR polypeptide) can be comprised by a vector. The term "vector", as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be viral or non-viral. The term “vector” encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells. A vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc.
[0128] The vector can be recombinant, e.g., it comprises sequences originating from at least two different sources. In some embodiments, the vector comprises sequences originating from at least two different species. In some embodiments, the vector comprises sequences originating from at least twodifferent genes, e.g., it comprises a fusion protein or a nucleic acid encoding an expression product which is operably linked to at least one non-native (e.g., heterologous) genetic control element (e.g., a promoter, suppressor, activator, enhancer, response element, or the like.
[0129] In some embodiments, the vector or nucleic acid described herein is codon-optimized, e.g., the native or wild-type sequence of the nucleic acid sequence has been altered or engineered to include alternative codons such that altered or engineered nucleic acid encodes the same polypeptide expression product as the native / wild-type sequence, but will be transcribed and / or translated at an improved efficiency in a desired expression system. In some embodiments, the expression system is an organism other than the source of the native / wild-type sequence (or a cell obtained from such organism). In some embodiments, the vector and / or nucleic acid sequence described herein is codon- optimized for expression in a mammal or mammalian cell, e.g., a mouse, a murine cell, or a human cell. In some embodiments, the vector and / or nucleic acid sequence described herein is codon- optimized for expression in a human cell. In some embodiments, the vector and / or nucleic acid sequence described herein is codon-optimized for expression in a yeast or yeast cell. In some embodiments, the vector and / or nucleic acid sequence described herein is codon-optimized for expression in a bacterial cell. In some embodiments, the vector and / or nucleic acid sequence described herein is codon-optimized for expression in an E. coli cell.
[0130] As used herein, the term "expression vector" refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.
[0131] As used herein, the term “viral vector" refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes. The vector and / or particle may be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art. Non-limiting examples of a viral vector of this invention include an AAV vector, an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector a baculovirus vector, and a chimeric virus vector.
[0132] It should be understood that the vectors described herein can, in some embodiments, be combined with other suitable compositions and therapies. For example, the use of a suitable episomal vector provides a means of maintaining the nucleotide of interest in the subject in high copy number extra chromosomal DNA thereby eliminating potential effects of chromosomal integration.
[0133]
[0134] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
[0135] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.
[0136] Other terms are defined herein within the description of the various aspects of the invention.
[0137] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this applicationare expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0138] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[0139] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.
[0140] In some embodiments, the present technology may be defined in any of the following numbered paragraphs:1. A method for engineering a human immune cell, the method comprising gene editing the cell by editing exon 5 of the gene encoding Cyclophilin A (PPIA), wherein the gene editing results in a truncated cyclophilin A.2. The method of paragraph 1, wherein the gene editing comprises introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cell.3. The method of paragraph 2, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.4. The method of any one of the preceding paragraphs, wherein the human immune cell is a T cell.5. A method for preparing an engineered human immune cell, the method comprising a) isolating immune cells or T cells from a subject, b) stimulating the immune cells or T cells with a virus-derived antigen, another pathogen-derived antigen, or a cancer antigen, c) isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells, d) gene editing the cells of said composition to edit the PPIA gene encoding Cyclophilin A, introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cells of said composition, and e) selecting engineered cells by culturing the cells in the presence of an immunosuppressant agent capable of interacting with Cyclophilin A.6. The method of paragraph 5, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.7. The method of paragraph 5, wherein the engineered human cell is a Pan-T cell.8. The method of paragraph 5, wherein the engineered human cell is a T cell specific for a virus, another pathogen, or a cancer antigen.9. The method of paragraph 5, wherein the engineered human cell is a CAR-T cell.10. A cell or a population of cells produced by the method of any one of the preceding paragraphs.11. An engineered cell comprising a gene edited PPIA gene, wherein the gene edit is in exon 5 of the gene, and wherein the gene edited PPIA gene encodes a truncated Cyclophilin A.12. The cell of paragraph 11, wherein the cell is a human cell.13. The cell of paragraph 11 or 12, wherein the cell is an immune cell.14. The cell of any one of paragraphs 11-13, wherein the cell is a T cell.15. The cell of any one of paragraphs 11-14, wherein the cell is a T cell specific for a virus, another pathogen, or a cancer antigen.16. The cell of any one of paragraphs 11-15, wherein the cell is primed in an antigen-specific manner by stimulation with an antigen from a virus, another pathogen, or a cancer antigen.17. The cell of any one of paragraphs 11-16, wherein the cell is a regulatory T cell.18. The cell of any one of paragraphs 11-17, wherein the cell is a CAR-T cell.19. The cell of any one of paragraphs 11-18, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene.20. The cell of any one of paragraphs 11-19, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene, wherein the single guide RNA used targets the sequence GTGTTTGGCAAAGTGAAAGA.21. A population of cells comprising cells of any one of paragraphs 11-20.22. A pharmaceutical composition comprising a cell of any one of the preceding paragraphs.23. A method for treating a subject in need thereof comprising administering to the subject the cells of paragraph 21 or the pharmaceutical composition of paragraph 22.24. The method of paragraph 23, wherein the subject is also administered an immunosuppressant.25. The method of paragraph 24, wherein the immunosuppressant is a calcineurin inhibitor.26. The method of paragraph 25, wherein the calcineurin inhibitor is cyclosporin or voclosporin.27. A method for engineering a human immune cell, the method comprising gene editing the cell by editing exon 5 of the gene encoding Cyclophilin A (PPIA), wherein the gene editing results in a modified cyclophilin A.28. The method of paragraph 27, wherein the gene editing comprises introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cell.29. The method of paragraph 28, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.30. The method of any one of paragraphs 27-30, wherein the human immune cell is a T cell.31. A method for preparing an engineered human immune cell, the method comprising a) isolating immune cells or T cells from a subject,b) stimulating the immune cells or T cells with antibodies, a virus-derived antigen, another pathogen-derived antigen, or a cancer antigen, c) isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells, d) gene editing the cells of said composition to edit the PPIA gene encoding Cyclophilin A, introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cells of said composition, and e) selecting engineered cells by culturing the cells in the presence of an immunosuppressant agent capable of interacting with Cyclophilin A.32. The method of paragraph 31, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.33. The method of paragraph 31, wherein the engineered human cell is a Pan-T cell.34. The method of paragraph 31, wherein the engineered human cell is a T cell specific for a virus, another pathogen, or a cancer antigen.35. The method of paragraph 31, wherein the engineered human cell is a CAR-T cell.36. A cell or a population of cells produced by the method of any one of paragraphs 27-36.37. An engineered cell comprising a gene edited PPIA gene, wherein the gene edit is in exon 5 of the gene, and wherein the gene edited PPIA gene encodes a modified Cyclophilin A.38. The cell of paragraph 37, wherein the cell is a human cell.39. The cell of paragraph 37 or 38, wherein the cell is an immune cell.40. The cell of any one of paragraphs 37-39, wherein the cell is a T cell.41. The cell of any one of paragraphs 37-40, wherein the cell is a T cell specific for a virus, another pathogen, or a cancer antigen.42. The cell of any one of paragraphs 37-41, wherein the cell is primed in an antigen-specific manner by stimulation with an antigen from a virus, another pathogen, or a cancer antigen.43. The cell of any one of paragraphs 37-42, wherein the cell is a regulatory T cell.44. The cell of any one of paragraphs 37-43, wherein the cell is a CAR-T cell.45. The cell of any one of paragraphs 37-44, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene.46. The cell of any one of paragraphs 37-45, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene, wherein the single guide RNA used targets the sequence GTGTTTGGCAAAGTGAAAGA.47. A population of cells comprising cells of any one of paragraphs 37-46.48. A pharmaceutical composition comprising a cell of any one of paragraphs 27-47.49. A method for treating a subject in need thereof comprising administering to the subject the cells of paragraph 47 or the pharmaceutical composition of paragraph 48.50. The method of paragraph 49, wherein the subject is also administered an immunosuppressant.51. The method of paragraph 50, wherein the immunosuppressant is a calcineurin inhibitor.52. The method of paragraph 51, wherein the calcineurin inhibitor is cyclosporine or voclosporin.
[0141] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1MethodsImmune Cell Isolation
[0142] Donor peripheral blood mononuclear cells (PBMCs) were isolated from healthy human donors using a Ficoll gradient (n = 10). When applicable, a Pan-T cell isolation kit (Miltenyi) was used to isolate T cells. Cells were cultured in X-VIVO 15 (Lonza) media supplemented with 10% fetal bovine serum, 1% penicillin / streptomycin, 2 mM of Glutamax, and 50ft -mercaptoethanol.IL-2 (R&D) was added to make 100 lU / mL for T-cell expansion with 1: 1 anti-CD3 / 28 Dynabeads and 25 lU / mL for when beads were removed. No cytokines were added during cell proliferation assays.Viral Specific T-cell Production
[0143] PBMCs from HLA-A*02 positive donors (n=3) were resuspended in 50 ^L / million cells of pp65 peptide mix (JPT Technology) in media at a peptide concentration of 1 ng / ^L. After a 60- minute incubation, cells were plated at 1 million cells / mL in a 24-well plate in media containing IL-4 and IL-7 (both at 10 ng / mL). Fresh media with cytokines were added everything three days. CMVspecificity of expanded CD8+ T cells was assessed using the HLA-A*02-specific dextramer NLVPMVATV (Immudex).CAR-T Production
[0144] A plasmid encoding a lentiviral construct for an anti-CD19-CD28-CD3z CAR was purchased from Vector Builder. Viral packaging was performed. Freshly isolated Pan-T cells were stimulated with anti-CD3 / CD28 Dynabeads and transduced with lentivirus on Day +2 using a standard protocol.CRISPR Editing
[0145] Freshly isolated PBMCs were used to generate Pan-T, CAR-T, or VST cells as described above. Pan-T cells were CRISPR edited after two days of anti-CD3 / CD28 Dynabead stimulation, CAR-T cells were edited after a further two days of Dynabead stimulation after viral transduction. pp65 peptide stimulated PBMCs were edited after three days of exposure to viral peptide mix. CRISPR editing was performed per manufacturer’s protocol (IDT). Briefly, guide RNAs (gRNA) were made by combining tracr RNA (IDT) with negative control cRNA (IDT) or cRNA for PPIA (GTGTTTGGCAAAGTGAAAGA), annealing at 95°C for 5 minutes. To make ribonucleoprotein, gRNA was then combined with Cas 9 enzyme (IDT) for 15 minutes ahead of electroporation using a standard protocol. DNA was sampled at Days 3-5 and 3 weeks, sequenced through Azenta Life Sciences (primers for PPIA Forward: TGTGGTTGCCAGTCATAGTGAT and Reverse: CAGCGAGAGCACAAAGATTCTA). Synthego ICE was used to determine the gene edit (frameshift) efficiency.Cyclophilin Protein Validation
[0146] Flow cytometry for Cyclophilin A was performed with two different antibodies. For both, cells were initially fixed with BD Cytofix and then permeabilized using BD Cytoperm. In a double staining protocol, cells were initially labelled with rabbit Cyclophilin A polyclonal antibody (Fisher; cat no. PAI-025) at a 1: 100 dilution followed by Donkey Anti-Rabbit IgG H&L (Alexa Fluor® 488; Abeam) at a 1:300 dilution. In a single staining protocol, CoraLite®594-conjugated Cyclophilin A Monoclonal antibody was used at a 1:50 dilution (Proteintech).Calcineurin Inhibitor Preparation
[0147] Cyclosporine and voclosporin (Millipore-Sigma) powders were reconstituted initially at 50 mg / mL and 5 mg / mL in dimethyl sulfoxide (DMSO), respectively. These were further diluted to 1 mg / mL working solutions using DMSO. Tacrolimus (Prograf 5mg / mL) and rapamycin (LC laboratories) were also used for assays.Mixed Lymphocyte Reaction (MLR)
[0148] CRISPR edited Pan-T cell “Responders” were labelled with Cell Trace Violet (CTV;Thermofisher) per manufacturer’s instructions (modification: 1fL CTV per 10 million cells). In a 96- well U-bottom plate, 100,000 edited responder T cells were plated with 300,000 HLA-A*02 disparate, irradiated (30 Gy) ‘stimulator’ PBMCs in a total volume of 200 ^L. Cyclosporine, voclosporin, tacrolimus, and rapamycin were added at different doses on the day of assay set up. Assays were read on day 5 on a BD Fortessa flow cytometer after staining for CD4 (L200), CD8 (RPA-T8), and HLA- A*02 (BB7.2).CAR-T and VST Proliferation Assays
[0149] Edited CAR-T cells were rested (Dynabeads removed) for one week then stained with CTV and co-cultured with a CD 19 positive NALM-6 (ATCC) line with a Beta-2 -microglobulin knockout to focus on CAR-specific proliferation (vs. allo-proliferation). Cells were collected for flow cytometry analysis on day 3 of co-culture. For VST assays, 7-10 days after peptamer-stimulated PBMCs were CRISPR edited, cells were labelled with CTV and re-stimulated with fresh pp65 peptide mix, either by pre -incubating the VSTs with peptamer, or by co-culturing VSTs with peptamer loaded onto autologous PHA blasts. Samples were collected for flow cytometry analysis on day 4.Proliferation Data Analysis
[0150] Flow cytometry data were initially analyzed using FlowJo version 10.7.1. The %1 - *M*e**™V*x 100%suppression by drug is a normalized value calculated by (Srus) Data were graphed using GraphPad Prism v9 with two-way ANOVA with multiple comparisons (Sidak or Tukey post-test).CAR-T and VST Cytokine Stimulation Assay
[0151] Cytokine proliferation assays were performed by adding Protein Transport Inhibitor Cocktail (eBioscience) to rested CAR-T and VST cells. For stimulation, either pp65 pepmix was added (for VSTs) or PMA / ionomycin as part of the Cell Stimulation Cocktail (eBioscience; VST, CAR-T). Intracellular staining was performed using the BD Cytofix / Cytoperm kit, and the following antibodies: FITC anti-human TNF-'5’ (MAbl l), BV421 anti-human IL-2 (MQ1-17H12), and BD Horizon™ BV711 Mouse Anti-Human IFN-F (B27).CAR-T Cytotoxicity Assay
[0152] Edited CAR-T cells were rested for one week and co-cultured with NALM6 cells for 4 hours after which cells were stained with Caspase 3 / 7 (Thermofisher), Zombie Aqua (Biolegend), and anti-CD19 antibody (HIB19) after initially adding Precision Counting Beads (Biolegend). The number of live, CD 19+ cells (events normalized to counting beads) was used to calculate % killing based on 100% 1 - (NALM6mixed / NALM6aiOne) based on the CAR-T co-culture vs. NALM6 monoculture.Example 2Cyclosporine and Voclosporin Resistant Immune Effector Cells to Improve Outcomes after Stem Cell Transplantation
[0153] Relapse of a patient’s underlying malignancy, and complications related to viral reactivation are prominent causes of morbidity and mortality after allogeneic hematopoietic cell transplantation (HCT). Immune effector cells (IEC) are increasingly deployed to prevent and treat these complications. These include anti-CD19 CAR-T-cells used for post-HCT B-ALL relapse, as well as viral specific T cells (VSTs) targeting EBV, CMV, and others. However, the efficacy of these lECs early after HCT may be compromised by the inhibitory effects of immunosuppressive agents used to prevent graft-versus host-disease (GVHD).
[0154] A commonly employed immunosuppressant used for GVHD prophylaxis is the calcineurin inhibitor (CNI) cyclosporine (CsA). A structural analog, voclosporin (VCS), is now FDA approved for lupus nephritis and in trials to prevent rejection after solid organ transplantation. Given its favorable pharmacodynamic and toxicity profile versus CsA and tacrolimus, VCS is poised to become an important option for HCT patients. Both CsA and VCS interact with calcineurin only in the presence of their immunophilin binding partner - cyclophilin A (PPIA). Tacrolimus and sirolimus interact with a distinct immunophilin, FKBP12. This creates the opportunity to delete a single immunophilin (eg. PPIA) to create lECs resistant to one class of CNI (CsA / VCS) but sensitive to other immunosuppressive agents, an important safety feature. Described herein, are CsA / VCS- resistant lECs by CRISPR / Cas9 editing of PPIA. These cells exhibited superior proliferation and preserved effector function in the presence of CsA and VCS.
[0155] Described herein are immune cells that are simultaneously resistant to both CsA and VCS via CRISPR-mediated editing of PPIA. Proliferation, cytotoxicity, and cytokine production of PPIA edited conventional T cells (Tcon), CMV (pp65)-specific VSTs, and CD 19 CAR-T cells were tested against wildtype cells in functional in vitro assays with escalating doses of CsA and VCS.
[0156] PPIA edited Tcon demonstrated high editing efficiency (88-92%), high viability, and robust expansion in culture. Indeed, PPIA edited efficiency was maintained over several weeks in culture, suggestive of no survival disadvantage of cells bearing this deletion. Importantly, when PPIA edited cells were used as Responders in a mixed lymphocyte reaction in the presence of CsA, theedited cells demonstrated significant resistance to drug-mediated suppression of CD4+ and CD8+ T cell proliferation across the dose-response curve (p < 0.01;). Similar results were observed with VCS, with PPIA edited cells significantly resistant to VCS-mediated suppression across otherwise highly suppressive doses (p<0.0001;).
[0157] CRISPR-edited VSTs and CD 19 CAR-T cells showed similar editing efficiencies to Tcon. Consistent with prior results, CMV-specific PPIA edited responder VSTs were significantly resistant to suppression of proliferation by CsA vs wildtype cells at all doses tested (p=0.0004, not shown). Proliferation in the presence of drug was then assessed in edited CAR-T cells using the CD19+ NALM6 line as stimulators. Division of PPIA edited responder CD19 CAR-T cells was almost completely unaffected by CsA and VCS across escalating doses. For example, at an effector- to-target (E:T) ratio of 1:0.1 and a CsA dose of 50 ng / mL, there was 40.6 ± 2.3 % suppression of division in Wildtype CD8+ CAR-T cells vs. -0.2 ± 0.4 % in PPIA edited CD8+ CAR-T cells (p<0.0001). Similar findings were observed with CD4+ responder CAR-T cells (p<0.0001, not shown). PPIA edited CAR-T cells also demonstrated intact cytotoxic function with no significant differences in % killing between the Wildtype and PPIA edited groups at 3 different E:T ratios. For example, at a 1: 1 E:T ratio, there was 59 ± 15% killing vs. 55 ± 12% killing in Wildtype vs PPIA edited groups, respectively (not shown).
[0158] These data demonstrate that editing of PPIA is an effective strategy for engineering resistance to CsA and VCS in cellular therapies. In addition, these data demonstrate that PPIA edited conventional T cells, VSTs, and CAR-T cells were markedly resistant to the otherwise suppressive effects on T cell proliferation that are hallmarks of both CsA and VCS. Engineering CNI-resistance into lECs will enhance the ability to deploy these cells early after transplant to prevent or treat both malignant relapse and viral reactivation.Example 3
[0159] Cellular therapies are emerging as potentially definitive treatment strategies for patients with graft-vs-host disease, organ rejection after transplantation, autoimmune disease, and certain infections. However, if may be unsafe for patients to come off their current maintenance drug therapy before receiving a cellular therapy. These maintenance regimens often include the drug class called “calcineurin inhibitors” (CNIs). CNIs work by suppressing T cell activation and division and may have an undesirable effect on novel T cell therapies.
[0160] The two main calcineurin inhibitors are cyclosporine (CsA) and tacrolimus (Tac). Voclosporin (VCS) is a modified version of cyclosporine that is approved for lupus nephritis in adults and is being investigated in renal allograft rejection. FKBP12 and CypA (cyclophilin A) are immunophilin binding partners that allow their respective drugs to interact with calcineurin.
[0161] There is an unmet need for a way to confer CNI resistance to T cell therapies such that they can have maximum therapeutic benefit.
[0162] Previous approaches to knockout immunophilin FKBP12, which binds calcineurin inhibitor tacrolimus are less ideal for application to regulatory T-cell therapies. FKBP12 also interacts with the mTOR pathway and confers resistance to rapamycin (a.k.a. sirolimus), which is a drug that is used in ex vivo expansion of regulatory T cell products to promote their regulatory T cell phenotype. Making cell resistant to rapamycin would thus be detrimental to regulatory T cell therapies. Another approach that has been explored is site-directed mutagenesis of the calcineurin protein so that it can no longer bind to drug. However, this is a much more challenging approach to do at a clinical scale and it risks more off target gene edits.
[0163] Gene editing Cyclophilin A (PPIA), as described herein, results in engineered cyclosporine / voclosporin resistant cells. This method relies on CRISPR-Cas9 mediated editing of the last exon of the gene (exon 5). This results in a low rate of non-sense mediated decay but may result in a protein that lacks important amino acids near the C-terminus for the CypA-CsA-calcineurin interaction; consequently, some of the homeostatic functions of CypA may be preserved while still achieving drug resistance. In vitro pre-clinical data described herein shows, that modified of Cyclophilin A using CRISPR technology is highly effective at conferring T cell resistance to drug. While Crispr-Cas9 is demonstrated, a variety of gene editing technologies could be used to achieve this same end.
[0164] CRISPR editing of the C-terminal exon of PPIA leads to high rates of frameshifts that result in cyclosporine and voclosporin resistant cells. The inventors demonstrated this in CAR-T cells, viral specific T cells, and regulatory T cells, all of which could comprise critical therapies for patients that have received transplants who are on cyclosporine maintenance therapy. Importantly, there was no negative effect of these edits on cell behavior. This editing strategy is highly promising for enhancing performance of diverse cellular therapies.
Claims
CLAIMS1. A method for engineering a human immune cell, the method comprising gene editing the cell by editing exon 5 of the gene encoding Cyclophilin A (PPIA), wherein the gene editing results in a modified cyclophilin A.
2. The method of claim 1, wherein the gene editing comprises introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPI A gene into the cell.
3. The method of claim 2, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.
4. The method of any one of the preceding claims, wherein the human immune cell is a T cell.
5. A method for preparing an engineered human immune cell, the method comprising a) isolating immune cells or T cells from a subject, b) stimulating the immune cells or T cells with antibodies, a virus-derived antigen, another pathogen-derived antigen, or a cancer antigen, c) isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells, d) gene editing the cells of said composition to edit the PPIA gene encoding Cyclophilin A, introducing a ribonucleoprotein complex comprising a CRISPR associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene into the cells of said composition, and e) selecting engineered cells by culturing the cells in the presence of an immunosuppressant agent capable of interacting with Cyclophilin A.
6. The method of claim 5, wherein the sgRNA targets the sequence GTGTTTGGCAAAGTGAAAGA.
7. The method of claim 5, wherein the engineered human cell is a Pan-T cell.
8. The method of claim 5, wherein the engineered human cell is a T cell specific for a virus, another pathogen, or a cancer antigen.
9. The method of claim 5, wherein the engineered human cell is a CAR-T cell.
10. A cell or a population of cells produced by the method of any one of the preceding claims.
11. An engineered cell comprising a gene edited PPIA gene, wherein the gene edit is in exon 5 of the gene, and wherein the gene edited PPIA gene encodes a modified Cyclophilin A.
12. The cell of claim 11, wherein the cell is a human cell.
13. The cell of claim 11 or 12, wherein the cell is an immune cell.
14. The cell of any one of claims 11-13, wherein the cell is a T cell.
15. The cell of any one of claims 11-14, wherein the cell is a T cell specific for a virus, another pathogen, or a cancer antigen.
16. The cell of any one of claims 11-15, wherein the cell is primed in an antigen-specific manner by stimulation with an antigen from a virus, another pathogen, or a cancer antigen.
17. The cell of any one of claims 11-16, wherein the cell is a regulatory T cell.
18. The cell of any one of claims 11-17, wherein the cell is a CAR-T cell.
19. The cell of any one of claims 11-18, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene.
20. The cell of any one of claims 11-19, wherein the cell is produced by CRISPR / Cas- mediated gene editing of the PPIA gene, wherein the single guide RNA used targets the sequence GTGTTTGGCAAAGTGAAAGA (SEQ ID NO: 4).
21. A population of cells comprising cells of any one of claims 11-20.
22. A pharmaceutical composition comprising a cell of any one of the preceding claims.
23. A method for treating a subject in need thereof comprising administering to the subject the cells of claim 21 or the pharmaceutical composition of claim 22.
24. The method of claim 23, wherein the subject is also administered an immunosuppressant.
25. The method of claim 24, wherein the immunosuppressant is a calcineurin inhibitor.
26. The method of claim 25, wherein the calcineurin inhibitor is cyclosporine or voclosporin.