Method of modulating cell death and inflammation

Abstract

The present disclosure provides the use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1) Complex II, fortreating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA. In one embodiment, the RBP is FTO or XPOS, and the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer, an inflammatory disorder, or an infectious disease. Also disclosed is a method of regulating cell death, comprising the provision of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is an RBP or an RNA.

Description

[0001] Method of modulating cell death and inflammation

[0002] This application claims priority from SG 102023031 12Y filed 02 November 2023, and SG 10202400127X filed 16 January 2024, the contents and elements of which are hereby incorporated by reference for all purposes.

[0003] Technical Field

[0004] The present disclosure relates to medical treatment and prophylaxis, particularly of diseases in which TNFR1 -mediated signalling is pathologically-implicated.

[0005] Background

[0006] TNF is a critical inflammatory cytokine that has been implicated in cellular and developmental programs (Rickard et al., Cell. 2024. 157, 1 175-1 188). Aberrant activation of TNF-dependent inflammation is a leading cause of several human ailments.

[0007] Upon binding to TNFR1 , tumor necrosis factor (TNF) can trigger cell survival and cell death signaling pathways. Cancer cells have developed mechanisms to evade cell death, allowing them to survive and proliferate uncontrollably. On the other hand, excessive activation of cell death signaling contributes to the development of inflammatory disorders such as rheumatoid arthritis (RA) and inflammatory bowel disease (IBD). The global cost of cancer care exceeds $40 trillion annually, highlighting the significant burden it poses to public health. Despite advances in treatment, cancer remains a major threat. In the case of inflammatory disorders, the global expenditure on anti-TNF inhibitors alone surpasses $40 billion annually.

[0008] Anti-TNF drugs have transformed the treatment of many previously intractable chronic inflammatory diseases (loannidis et al., Nat Rev Rheumatol. 2013. 9, 665-673). This has prompted clinical efforts to develop cell death inhibitors as therapeutic interventions for inflammatory ailments. Furthermore, inhibiting cell death could have therapeutic benefits in the context of neuroinflammation, Alzheimer’s disease and Parkinson’s disease where excessive cell death contributes to disease progression (Mifflin et al., Nat Rev Drug Discov. 2020. 19, 553-571 ).

[0009] While TNF-inhibitors have demonstrated efficacy in treating RA, their high cost and limited effectiveness raise concerns. Furthermore, it is noteworthy that a significant number of patients discontinue treatment within the first year due to the development of treatment resistance. Accordingly, while anti-TNF drugs have shown some promise, more effective and precise therapeutic interventions for treating cancer, inflammatory disorders, and infectious diseases, are needed.

[0010] Summary

[0011] In a first aspect, the present disclosure provides a modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)- binding protein (RBP) or an RNA. In another aspect, the present disclosure provides the use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, in the manufacture of a medicament for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

[0012] In another aspect, the present disclosure provides a method of treating or preventing a disease in which signalling mediated by tumor necrosis factor receptor 1 (TNFR1 ) is pathologically-implicated, wherein the method comprises administering to a subject a therapeutically- or prophylactical ly-effective amount of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

[0013] In some embodiments, the RBP component of TNFR1 Complex II comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 or SEQ ID NO:6.

[0014] In some embodiments, the RNA component of TNFR1 Complex II is an RNA capable of associating with an RBP component of TNFR1 Complex II.

[0015] In some embodiments, the RNA component of TNFR1 Complex II is a non-coding RNA.

[0016] In some embodiments, the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to a ribonucleotide sequence determined from Table 1 or Table 2.

[0017] In some embodiments, the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to the ribonucleotide sequence of: FATALR1 , DOCK4, ARHGAP24, PDE10A, RAD51 B, ABTB2, AFF3, MIR4451 , MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1 , GPR22, MIR28, EHMT1 , PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1 , IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1 , FMNL2, NIBAN1 , MIR6529, HIVEP2, MIR3921 , MIR4768, AKAP13, MIR586, LINC02605, TBC1 D4, RNVU1 -4, RBFOX2, JAZF1 -AS1 , FOXC1 , MAPKAP1 , SIK3, LRCH1 , RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1 , CSF2, MIR3194, SDK1 , RBMS3-AS1 , HIVEP1 , MB21 D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1 , PARP8, RNU1 -2, JARID2, ZFAND3, SLIT2-IT1 , MAGI1 -AS1 , FER, LINC00673, SBF2, LIMS1 , EIF4G3, THSD4-AS1 , ARID4B, DENND1 A, WWC1 , ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 , or KLHL29

[0018] In some embodiments, the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to the ribonucleotide sequence of: FATALR1 , RAD51 B, or AFF3. In some embodiments, the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to the ribonucleotide sequence of: FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the RNA is selected from the group consisting of: FATALR1 , DOCK4, ARHGAP24, PDE10A, RAD51 B, ABTB2, AFF3, MIR4451 , MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1 , GPR22, MIR28, EHMT1 , PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1 , IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1 , FMNL2, NIBAN1 , MIR6529, HIVEP2, MIR3921 , MIR4768, AKAP13, MIR586, LINC02605, TBC1 D4, RNVU1 -4, RBFOX2, JAZF1 -AS1 , FOXC1 , MAPKAP1 , SIK3, LRCH1 , RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1 , CSF2, MIR3194, SDK1 , RBMS3-AS1 , HIVEP1 , MB21 D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1 , PARP8, RNU1 -2, JARID2, ZFAND3, SLIT2-IT1 , MAGI1 -AS1 , FER, LINC00673, SBF2, LIMS1 , EIF4G3, THSD4-AS1 , ARID4B, DENND1 A, WWC1 , ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 , and KLHL29.

[0019] In some embodiments, the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a ribonucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:10, SEQ ID NO:11 , or SEQ ID NO:25.

[0020] In some embodiments, the modulator inhibits the expression and / or activity of the component of TNFR1 Complex II.

[0021] In some embodiments, the modulator is selected from the group consisting of: a small molecule that binds to the component of TNFR1 Complex II, an inhibitory nucleic acid targeting the component of TNFR1 Complex II, and a nucleic acid encoding a site-specific nuclease (SSN) system targeting nucleic acid encoding the component of TNFR1 Complex II.

[0022] In some embodiments, the modulator upregulates the expression and / or activity of the component of TNFR1 Complex II.

[0023] In some embodiments, the modulator comprises or consists of nucleic acid encoding an RBP or an RNA component of TNFR1 Complex II.

[0024] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of Caspase-8, Caspase-3, Caspase-10, RIPK1 , RIPK3 and / or PARP activity.

[0025] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of cell death.

[0026] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a cytokine storm. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer.

[0027] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is an inflammatory disorder and / or an infectious disease.

[0028] In some embodiments, the cancer is selected from: a solid tumor, breast cancer, breast carcinoma, ductal carcinoma, gastric cancer, gastric carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, ovarian cancer, ovarian carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, cholangiocarcinoma, uterine cancer, uterine corpus endometrial carcinoma, thyroid cancer, thyroid carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma and thymoma..

[0029] In some embodiments, the inflammatory disorder is selected from: a chronic inflammatory disease, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudlak syndrome, Graves’ disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-associated hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer’s disease, Parkinson's disease, Huntington’s disease, amyotrophic lateral sclerosis, hippocampal atrophy, pulmonary disease, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn’s disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Alport syndrome, adult-onset Still’s disease, Castleman’s disease, cytokine release syndrome, sepsis, septic shock, a retinal disorder, age-related macular degeneration, wet age- related macular degeneration, retinitis pigmentosa, Peutz-Jeghers syndrome, a skeletal muscle disorder, and muscular dystrophy.

[0030] In some embodiments, the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0031] In another aspect, the present disclosure provides a method of regulating cell death, wherein the method comprises the provision of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is an RBP or an RNA. Description

[0032] The present disclosure is based on the inventors’ unexpected finding that ribonucleic acid (RNA)-binding proteins (RBPs) and RNAs are components of TNFR1 complexes and are involved in TNFR1 -mediated signalling. Inventors also found that the modulation of RBP and RNA components of TNFR1 complexes affected levels of cell death and inflammation.

[0033] Targeting RBP and / or RNA components of TNFR1 complexes results in an additional level of specificity compared with anti-TNF drugs. This is due to their cell type-specific expression patterns, and also due their inducibility under disease conditions.

[0034] TNFR1 complexes

[0035] Tumor necrosis factor (TNF), also referred to as TNFa, is an adipokine and a cytokine. TNF is a member of the TNF superfamily, which consists of various proteins with a homologous TNF domain. TNF is a central mediator in the immunologic processes of infection control, autoimmunity, allergic disease, and responses to cancer (Gough and Myles. Front Immunol. 2020: 11 : 585880). Interestingly, TNF activity has also been implicated in the development of cancers (Wang and Lin. Acta Pharmacol Sin. 2008 Nov; 29(1 1 ): 1275-1288). As an adipokine, TNF promotes insulin resistance, and is associated with obesity- induced type 2 diabetes. As a cytokine, TNF is used by the immune system for cell signaling.

[0036] TNF signaling occurs through two receptors: tumor necrosis factor receptor 1 (TNFR1 ) and tumor necrosis factor receptor 2 (TNFR2). TNFR1 is constitutively expressed on most cell types, whereas TNFR2 is expressed primarily by endothelial, epithelial, and subsets of immune cells. Activation of signaling by TNF through TNFR1 and TNFR2 initiates a variety of potential outcomes, including cell proliferation, gene activation or cell death. Mediating this variety of cellular responses from just two receptors requires complex control of signal transduction within the cell (Gough and Myles. Front Immunol. 2020; 11 : 585880).

[0037] TNFR1 is the major TNF receptor that mediates most of the pathophysiological roles of TNF. Binding of TNF to TNFR1 transcriptionally upregulates a number of downstream genes (Anderton et al., Nat Rev Rheumatol. 2020. 16, 496-513). TNFR1 includes a death domain (DD), that is constitutively expressed on most cell types and is activated by TNF. Following activation by binding TNF, intracellular signaling via TNFR1 is initiated via its DD.

[0038] When activated, a core signaling complex is constructed on the cytoplasmic tail of TNFR1 . The first step in this process is the trimerization of TNFR1 to form a TNFR1 trimer ( / .e., an association of three molecules of TNFR1 ), initiated by contact with TNF.

[0039] Once TNFR1 forms a trimer, the TNFR1 DD recruits TN FR1 -associated death domain (TRADD). TRADD acts as a scaffold for the formation of the core signaling complex. TRADD recruits TNF receptor- associated factor (TRAF) 2, or TRAF5, and receptor-interacting serine / threonine-protein kinase 1 (RIPK1 ). TRAF2 may then provide a platform for recruitment of cellular inhibitor of apoptosis protein (clAP) 1 and clAP2. The level of ubiquitination of RIPK1 and / or the level of NF-KB activity regulates the formation of different TNFR1 complexes: TNFR1 Complex I, or TNFR1 Complex II.

[0040] A complex (or a macromolecule complex), in the context of this application, is an assembly of associated macromolecules, such as an assembly of associated polypeptides and RNAs. In some embodiments, the complex comprises a polypeptide and an RNA. In some embodiments, the complex comprises a polypeptide. In some embodiments, the complex comprises an RNA. In some embodiments, the complex is a protein complex. In some embodiments, the complex is an RNA-protein complex. A protein complex, or a multiprotein protein complex, is a group of two or more associated polypeptide chains. An RNA- protein complex is a group of macromolecules comprising at least one polypeptide chain and at least one RNA molecule.

[0041] A TNFR1 complex is a macromolecule complex which is formed following activation of TNFR1 . In other words, the formation of a TNFR1 complex is mediated by TNFR1 activation. In some embodiments, the TNFR1 complex is a macromolecule complex comprising a polypeptide chain. In some embodiments, the TNFR1 complex is a macromolecule complex comprising a polypeptide chain and an RNA molecule. In some embodiments, the TNFR1 complex does not comprise TNFR1 . In some embodiments, TNFR1 is not a structural component of the TNFR1 complex.

[0042] In some embodiments, the TNFR1 complex is TNFR1 Complex I or TNFR1 Complex II.

[0043] Ubiquitin chains act as scaffolds for the formation of TNFR1 Complex I. If ubiquitination is incomplete, TNFR1 Complex II is formed.

[0044] Both TNFR1 Complex I and TNFR1 Complex II are well known to the skilled person. For example, TNFR1 Complex I and TNFR1 Complex II are discussed in Muppidi et al. (2004. Immunity, Vol. 21 , 61 - 465), Gough and Myles (2020. Front Immunol. 1 1 : 585880), and Dostert et a!. (2019. Physiol Rev. 99: 115-160), each of which are hereby incorporated by reference in their entirety.

[0045] In some documents, ‘TNFR1 Complex I’ and ‘TNFR1 Complex II' are alternatively referred to as ‘Complex I’ and ‘Complex II’, or ‘TNFR1 signalling Complex I’ and ‘TNFR1 signalling Complex II’. Therefore, TNFR1 Complex I may be referred to as Complex I, and TNFR1 Complex II may be referred to as Complex II. In some embodiments, the TNFR1 complex is Complex I or Complex II. The terms ‘TNFR1 Complex I’, ‘Complex I’, and ‘TNFR1 signalling Complex I’ may be used interchangeably. Additionally, the terms ‘TNFR1 Complex II’, ‘Complex II’ and ‘TNFR1 signalling Complex II’ may be used interchangeably.

[0046] TNFR1 Complex I activates NF-KB, JNK, and p38 pathways to induce cytokine signaling and cell survival. TNFR1 Complex II activity leads to apoptotic or necrotic cell death. Maintaining a balance between TNFR1 Complex I and TNFR1 Complex II is important for maintaining physiological homeostasis, and an imbalance can lead to various conditions including cancers, inflammatory disorders, and infectious diseases.

[0047] In some embodiments, TNFR1 Complex I comprises TNFR1 , TRADD and RIPK1 . In some embodiments, TNFR1 Complex I comprises TNF. In some embodiments, TNFR1 Complex I comprises TRAF2 and / or TRAF5. In some embodiments, TNFR1 Complex I comprises clAP1 and / or clAP2. In some embodiments, TNFR1 Complex I comprises TNFR1 , TRADD, RIPK1 , TNF, TRAF2, TRAF5, clAP1 and / or clAP2.

[0048] TNFR1 Complex I does not comprise RIPK3, a pro-caspase, or a caspase.

[0049] In some embodiments, the TNFR1 complex is TNFR1 Complex II.

[0050] When RIPK1 is not fully ubiquitinated, it dissociates from the core signaling complex. Once released into the cytosol, RIPK1 may associate with other components of TNFR1 Complex II. Therefore, TNFR1 Complex II does not comprise TNFR1 or TNF.

[0051] In some embodiments, TNFR1 Complex II comprises FADD, RIPK1 , and RIPK3. In some embodiments, TNFR1 Complex II comprises TRADD. In some embodiments, TNFR1 Complex II comprises a precaspase. In some embodiments, TNFR1 Complex II comprises pre-caspase-3. In some embodiments, a TNFR1 Complex II comprises pre-caspase-8. In some embodiments, TNFR1 Complex II comprises precaspase-10. In some embodiments, TNFR1 Complex II comprises a caspase. In some embodiments, a TNFR1 Complex II comprises Caspase-3. In some embodiments, TNFR1 Complex II comprises Caspase-8. In some embodiments, TNFR1 Complex II comprises Caspase-10. In some embodiments, TNFR1 Complex II comprises FADD, RIPK1 , RIPK3, TRADD, a pre-caspase, and / or a caspase.

[0052] Variants of TNFR1 Complex II are well known by the skilled person. In some embodiments, the TNFR1 complex is TNFR1 Complex Ila, TNFR1 Complex lib, or TNFR1 Complex lie. In some embodiments, TNFR1 Complex II is TNFR1 Complex Ila, TNFR1 Complex lib, or TNFR1 Complex He.

[0053] Formation of TNFR1 Complex Ila is initiated when RIPK1 is de-ubiquitinated by cylindromatosis (CYLD). Incomplete ubiquitination of RIPK1 can also be caused by depletion or degradation of clAP1 / 2, which results in the absence or reduction of K63 poly-ubiquitin chains added to RIPK1 , leading to the formation of Complex lib. Complex lib includes the same components as Complex Ila, except it lacks TRADD. Both TNFR1 Complex Ila and TNFR1 Complex lib are capable of activating caspases, and caspase-mediated cleavage of proteins upregulates cell death mechanisms such as apoptosis and pyroptosis. Pyroptosis is a programmed form of lytic cell death. Pyroptosis is triggered downstream of inflammasome complexes by caspase-mediated cleavage of gasdermin D (GSDMD). TNFR1 Complex lie forms in the absence of caspases and is capable of necroptosis via the activity of RIPK1 and RIPK3. Necroptosis is a programmed form of necrosis.

[0054] In some embodiments, TNFR1 Complex II is TNFR1 Complex Ila. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, and TRADD. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and a pro-caspase. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and pro-caspase-8. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and pro-caspase- 3. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and procaspase-10. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and a caspase. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and Caspase-8. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and Caspase-3. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, and Caspase-10. In some embodiments, TNFR1 Complex Ila comprises FADD, RIPK1 , RIPK3, TRADD, Caspase-3, Caspase-8, and / or Caspase-10.

[0055] In some embodiments, the TNFR1 complex is TNFR1 Complex lib.

[0056] In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , and RIPK3. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and a pro-caspase. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and pro-caspase-8. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and pro-caspase-3. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and pro-caspase-10. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and a caspase. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and Caspase-8. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and Caspase-3. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, and Caspase-10. In some embodiments, TNFR1 Complex lib comprises FADD, RIPK1 , RIPK3, Caspase-3, Caspase-8, and / or Caspase-10.

[0057] In some embodiments, the TNFR1 complex is TNFR1 Complex lie

[0058] In some embodiments, TNFR1 Complex lie does not comprise a caspase or a pro-caspase. In some embodiments, the TNFR1 Complex lie comprises RIPK1 . In some embodiments, the TNFR1 Complex lie comprises RIPK3. In some embodiments, the TNFR1 Complex lie comprises FADD. In some embodiments, the TNFR1 Complex lie comprises RIPK1 , and RIPK3. In some embodiments, the TNFR1 Complex lie comprises FADD, RIPK1 , and RIPK3. In some embodiments, TNFR1 Complex He comprises FADD, RIPK1 , RIPK3, and / or TRADD.

[0059] Human TRADD is a 34 kDa protein with two functional domains connected by an unstructured peptide of -37 amino acid residues (Li et al., Comput Struct Biotechnol J. 2020; 18: 2867-2876). TRADD is a death domain containing adaptor molecule. TRAD is capable of binding TRAF2 and is capable of reducing the recruitment of inhibitor-of-apoptosis proteins (lAPs) by TRAF2. This protein can also interact with FAS and FADD. In some embodiments, TRADD is a component of a TNFR1 complex. In some embodiments, TRADD is a component of TNFR1 Complex I. In some embodiments, TRADD is a component of TNFR1 Complex II. In some embodiments, TRADD is a component of TNFR1 Complex Ila. In some embodiments, TRADD is a component of TNFR1 Complex lie.

[0060] TRAF2 is intracellular adapter protein with E3 ligase activity (Siegmund et al., Cancers (Basel). 2022 Aug; 14(16): 4055). The protein complex formed by TRAF2 and TRAF1 interacts with the IAP family members clAP1 and clAP2, and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of lAPs for the direct inhibition of caspase activation. In some embodiments, TRAF2 is a component of a TNFR1 complex. In some embodiments, TRAF2 is a component of TNFR1 Complex I.

[0061] TRAF5 is functionally similar to TRAF2 in that they both mediate activation of NF-KB and implicate TRAF5 as a signal transducer for LT-pR (Nakano et al., JBC. 1996. 271 (25):14661 -14664). In some embodiments, TRAF5 is a component of a TNFR1 complex. In some embodiments, TRAF5 is a component of TNFR1 Complex I. clAP1 and clAP2 are members of a highly conserved and critically important family of inhibitor of apoptosis proteins (lAPs) that function to mitigate both intrinsic and extrinsic death signalling (Graber and Holcik. Cell Death & Disease. 2011 . volume 2, e135). In some embodiments, clAP1 is a component of a TNFR1 complex. In some embodiments, clAP1 is a component of TNFR1 Complex I. In some embodiments, clAP2 is a component of a TNFR1 complex. In some embodiments, clAP2 is a component of TNFR1 Complex I.

[0062] RIPK1 and RIPK3 (receptor-interacting serine / threonine protein kinases 1 / 3) interact by virtue of their RIP homotypic interaction motifs to mediate necroptosis (Newton. Trends Cell Biol. 2015 Jun;25(6):347-53). In some embodiments, RIPK1 is a component of a TNFR1 complex. In some embodiments, RIPK1 is a component of TNFR1 Complex I. In some embodiments, RIPK1 is a component of TNFR1 Complex II. In some embodiments, RIPK1 is a component of TNFR1 Complex Ila. In some embodiments, RIPK1 is a component of TNFR1 Complex lib. In some embodiments, RIPK1 is a component of TNFR1 Complex lie. In some embodiments, RIPK3 is a component of a TNFR1 complex. In some embodiments, RIPK3 is a component of TNFR1 Complex II. In some embodiments, RIPK3 is a component of TNFR1 Complex lib. In some embodiments, RIPK3 is a component of TNFR1 Complex lie.

[0063] FADD is a 28-kDa adaptor protein that is a critical component of the death receptors’ apoptotic signaling pathway. It initiates the formation of a death-inducing signaling complex and serves as a docking site for Caspase-8 (Osborn et al., 2010. PNAS. 107 (29) 13034-13039). In some embodiments, FADD is a component of a TNFR1 complex. In some embodiments, RIPK3 is a component of TNFR1 Complex II. In some embodiments, RIPK3 is a component of TNFR1 Complex Ila.

[0064] Caspases are a family of endoproteases that provide critical links in cell regulatory networks controlling inflammation and cell death. The activation of these enzymes is tightly controlled by their production as inactive pro-caspases (zymogens) that gain catalytic activity following signaling events promoting their aggregation into dimers or macromolecular complexes. Caspases are key regulators of apoptosis and inflammation. Insufficient caspase activity can promote tumorigenesis or infection; excess caspase activity can promote neurodegeneration or inflammatory conditions (McIlwain et a / ., 2013. Cold Spring Harb Perspect Biol. 5(4): a008656.).

[0065] Initiation of apoptosis requires the conversion of a pro-caspase to an active caspase. Active (or mature caspases are simply referred to as caspases herein. Pro-caspases comprise a pro-domain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing.

[0066] Caspase-3 (CPP32, apopain, or YAMA) is an endoprotease which comprises two subunits with 3 and 5 thiol functions respectively (Miller, 1997). The role of Caspase-3 in apoptosis is to cleave and activate caspase-6, caspase-7, and caspase-9 to break down the apoptotic cells before removal (Kashyap et al., 2021 . Advances in Protein Chemistry and Structural Biology. Volume 125, Pages 73-120).

[0067] In some embodiments, pro-caspase-3 is a component of a TNFR1 complex. In some embodiments, procaspase-3 is a component of TNFR1 Complex II. In some embodiments, pro-caspase-3 is a component of TNFR1 Complex Ila. In some embodiments, pro-caspase-3 is a component of TNFR1 Complex lib.

[0068] In some embodiments, Caspase-3 is a component of a TNFR1 complex. In some embodiments, Caspase-3 is a component of TNFR1 Complex II. In some embodiments, Caspase-3 is a component of TNFR1 Complex Ila. In some embodiments, Caspase-3 is a component of TNFR1 Complex lib.

[0069] Caspase-8 (also known as FADD-like IL-1 p converting enzyme (FLICE), ALPS2B, CAP4, MACH, and MCH5) is an enzyme comprising an N-terminal FADD-like death effector domain. Caspase-8 interacts with FADD. Caspase-8 cleaves the downstream effector caspases, which mediates apoptosis (Kashyap et al., 2021 . Advances in Protein Chemistry and Structural Biology. Volume 125, Pages 73-120).

[0070] In some embodiments, pro-caspase-8 is a component of a TNFR1 complex. In some embodiments, procaspase-8 is a component of TNFR1 Complex II. In some embodiments, pro-caspase-8 is a component of TNFR1 Complex Ila. In some embodiments, pro-caspase-8 is a component of TNFR1 Complex lib.

[0071] In some embodiments, Caspase-8 is a component of a TNFR1 complex. In some embodiments, Caspase-8 is a component of TNFR1 Complex II. In some embodiments, Caspase-8 is a component of TNFR1 Complex Ila. In some embodiments, Caspase-8 is a component of TNFR1 Complex lib.

[0072] Caspase-10 (also known as ALPS2, FLICE2, and MCH4) cleaves and activates Caspase-3 and Caspase-7, and the protein itself is processed by Caspase-8. Caspase-10 has a similar activation mechanism and substrate preference to Caspase-8 (Wachmann et al., Biochemistry. 2010. 49(38): 8307- 8315)

[0073] In some embodiments, pro-caspase-10 is a component of a TNFR1 complex. In some embodiments, pro- caspase-10 is a component of TNFR1 Complex II. In some embodiments, pro-caspase-10 is a component of TNFR1 Complex Ila. In some embodiments, pro-caspase-10 is a component of TNFR1 Complex lib. In some embodiments, Caspase-10 is a component of a TNFR1 complex. In some embodiments, Caspase-10 is a component of TNFR1 Complex II. In some embodiments, Caspase-10 is a component of TNFR1 Complex Ila. In some embodiments, Caspase-10 is a component of TNFR1 Complex lib.

[0074] Inventors unexpectedly found that ribonucleic acid (RNA)-binding proteins (RBPs) and RNAs are integral components of TNFR1 complexes.

[0075] In some embodiments, a component of a TNFR1 complex is an RBP. In some embodiments, a component of TNFR1 Complex I is an RBP. In some embodiments, a component of TNFR1 Complex II is an RBP. In some embodiments, a component of TNFR1 Complex Ila is an RBP. In some embodiments, a component of TNFR1 Complex lib is an RBP. In some embodiments, a component of TNFR1 Complex lie is an RBP.

[0076] An RBP is a protein which binds to RNA. In some embodiments, the RBP is capable of binding RNA. In some embodiments, the RBP binds RNA. In some embodiments, the RBP is bound to RNA. In some embodiments, the RBP comprises an RNA binding domain (RBD). In some embodiments, the RBP comprises an RBD and binds RNA through the RBD.

[0077] Binding of an RBP to an RNA may alternatively be described as RBP associating with an RNA, or RBP interacting with an RNA. RBPs bind (or associate / interact with) RNA through the molecular interactions of chemical moieties between protein residues and RNA nucleotides. In some embodiments, molecular interactions between RBPs and RNAs comprise hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and stacking. RBP interactions with RNA are reviewed by Corley et al. (2020. Molecular Cell 78, 9-29), which is hereby incorporated by reference in its entirety.

[0078] In some embodiments, the RBP is capable of binding to an RNA which is a component of a TNFR1 complex. In some embodiments, the RBP is capable of binding to an RNA which is a component of TNFR1 Complex I. In some embodiments, the RBP is capable of binding to an RNA which is a component of TNFR1 Complex II. In some embodiments, the RBP is capable of binding to an RNA which is a component of TNFR1 Complex Ila. In some embodiments, the RBP is capable of binding to an RNA which is a component of TNFR1 Complex lib. In some embodiments, the RBP is capable of binding to an RNA which is a component of TNFR1 Complex lie.

[0079] In some embodiments, the RBP binds an RNA which is a component of a TNFR1 complex. In some embodiments, the RBP binds an RNA which is a component of TNFR1 Complex I. In some embodiments, the RBP binds an RNA which is a component of TNFR1 Complex II. In some embodiments, the RBP binds an RNA which is a component of TNFR1 Complex Ila. In some embodiments, the RBP binds an RNA which is a component of TNFR1 Complex lib. In some embodiments, the RBP binds an RNA which is a component of TNFR1 Complex lie. In some embodiments, the RBP is FTO or Exportin-5 (XPO5). In some embodiments, the RBP is FTO. In some embodiments, the RBP is XPO5.

[0080] FTO (also known as alpha-ketoglutarate-dependent dioxygenase FTO) is a N6methyladenosine (m6A) demethylase, a fat mass and obesity-associated protein, and mediates oxidative demethylation of different RNA species. In this specification ‘FTO’ refers to FTO from any species and includes FTO isoforms, fragments, variants (including mutants) or homologues from any species. In some embodiments, the FTO is human FTO.

[0081] Human FTO is a protein which may be identified by UniProt: Q9C0B1 . The canonical isoform of FTO has the amino acid sequence shown in SEO ID NO:1 . The canonical isoform of FTO comprises a N-terminal domain (SEO ID NO:2), an Fe2OG dioxygenase domain (SEQ ID NO:3), and a C-terminal domain (SEQ ID NO:4). The mature form of human FTO is shown in SEQ ID NO:5.

[0082] XPO5 is an RBP that is traditionally known as a microRNA (miRNA) transporter. In this specification ‘XPO5’ refers to XPO5 from any species and includes XPO5 isoforms, fragments, variants (including mutants) or homologues from any species. In some embodiments, the XPO5 is human XPO5.

[0083] Human XPO5 is a protein which may be identified by UniProt: Q9HAV4. The canonical isoform of XPO5 has the amino acid sequence shown in SEQ ID NO:6. a Ran-interaction domain (SEQ ID NO:7), an ILF3- interaction domain (SEQ ID NO:8), and a pre-miRNA binding domain at positions 641 -642 of SEQ ID NO:6 (SEQ ID NO:9).

[0084] As used herein, a ‘fragment’, ‘variant’ or ‘homologue’ of a protein may optionally be characterized as having at least 60%, preferably one of 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to the amino acid sequence of the reference protein (e.g., a reference isoform). In some embodiments, fragments, variants, isoforms and homologues of a reference protein may be characterized by ability to perform a function performed by the reference protein.

[0085] A ‘fragment’ generally refers to a fraction of the reference protein. A ‘variant’ generally refers to a protein having an amino acid sequence comprising one or more amino acid substitutions, insertions, deletions or other modifications relative to the amino acid sequence of the reference protein, but retaining a considerable degree of sequence identity {e.g., at least 60%) to the amino acid sequence of the reference protein. An ‘isoform’ generally refers to a variant of the reference protein expressed by the same species as the species of the reference protein. A ‘homologue’ generally refers to a variant of the reference protein produced by a different species as compared to the species of the reference protein.

[0086] A ‘fragment’ of a reference protein may be of any length (by number of amino acids), although may optionally be at least 20% of the length of the reference protein (that is, the protein from which the fragment is derived) and may have a maximum length of one of 50%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the length of the reference protein. A fragment of an RBP may have a minimum length of one of 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1 100, or 1200 amino acids, and may have a maximum length of one of 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, or 1200 amino acids.

[0087] In some embodiments, the RBP is an RBP from a mammal (e.g., a primate (rhesus, cynomolgous, nonhuman primate or human) and / or a rodent (e.g., rat or murine) RBP). Isoforms, fragments, variants or homologues of an RBP may optionally be characterized as having at least 70%, preferably one of 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to the amino acid sequence of an immature or mature an RBP isoform from a given species, e.g., human.

[0088] Isoforms, fragments, variants or homologues may optionally be functional isoforms, fragments, variants or homologues, e.g., having a functional property / activity of the reference an RBP, as determined by analysis by a suitable assay for the functional property / activity. For example, an isoform, fragment, variant or homologue of an RBP may display association with an RNA is capable of binding to an RNA which is a component of a TNFR1 complex.

[0089] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NOS, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and / or SEQ ID NO:9.

[0090] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NOS, SEQ ID NO:7, SEQ ID NO:8, and / or SEQ ID NO:9.

[0091] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NOS, SEQ ID NO:4, and / or SEQ ID NOS.

[0092] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:1 , SEQ ID NOS, SEQ ID NOS, SEQ ID NO:4, and / or SEQ ID NOS.

[0093] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 , SEQ ID NOS, and / or SEQ ID NO:4. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 . In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NOS. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:4.

[0094] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:1 .

[0095] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:2.

[0096] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:3.

[0097] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:4.

[0098] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:5.

[0099] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:6, SEQ ID NO:7, and / or SEQ ID NO:8. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:6. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:7. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:8.

[0100] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:6, SEQ ID NO:7, and / or SEQ ID NO:8. In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:6.

[0101] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:7.

[0102] In some embodiments, the RBP comprises or consists of an amino acid sequence having at least 75% amino acid sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% amino acid sequence identity to the amino acid sequence of SEQ ID NO:8.

[0103] In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and / or SEQ ID NO:9.

[0104] In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:1 . In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:2. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:3. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:4. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:5. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:6. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:7. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:8. In some embodiments, the RBP comprises or consists of the amino acid sequence of SEQ ID NO:9.

[0105] In some embodiments, a component of a TNFR1 complex is an RNA. In some embodiments, a component of TNFR1 Complex I is an RNA. In some embodiments, a component of TNFR1 Complex II is an RNA. In some embodiments, a component of TNFR1 Complex Ila is an RNA. In some embodiments, a component of TNFR1 Complex lib is an RNA. In some embodiments, a component of TNFR1 Complex lie is an RNA.

[0106] Ribonucleic acid (RNA) is a nucleic acid molecule that is assembled as a chain of nucleotides. RNA differs from DNA chemically in two respects: (1 ) the nucleotides in RNA are ribonucleotides, as they contain the sugar ribose rather than deoxyribose; (2) RNA contains the base uracil (U) instead of the thymine (T) which is found in DNA. RNA is essential for most biological functions, either by performing the function itself (non-coding RNA) or by forming a template for the production of proteins as messenger RNA (mRNA). The skilled person is well aware of RNA. Types of RNAs are reviewed, for example, in Bhatti et al., (Metab Brain Dis. 2021 ; 36(6): 11 19-1 134). A component of a TNFR1 complex which is an RNA molecule, may also be referred to as an ‘RNA component of a TNFR1 complex’. An RNA component of a TNFR1 complex may be an RNA capable of interacting with a component of the TNFR1 complex. An RNA component of a TNFR1 complex may be an RNA identified as interacting with a component of the TNFR1 complex, e.g. by a protein-RNA interaction assay (e.g. RNA pull-down assays, oligonucleotide-targeted RNase H protection assays, Surveying Targets by APOBEC-Mediated Profiling (STAMP), and / or fluorescent in situ hybridization colocalization). In some embodiments, an RNA component of a TNFR1 complex is an RNA identified by a STAMP assay as interacting with a component of the TNFR1 complex.

[0107] In some embodiments, the RNA is capable of binding to an RBP. In some embodiments, the RNA binds an RBP. In some embodiments, the RNA is bound to an RBP.

[0108] In some embodiments, the RNA is capable of binding to an RBP component of a TNFR1 complex. In some embodiments, the RNA is capable of binding to an RBP component of TNFR1 Complex I. In some embodiments, the RNA is capable of binding to an RBP component of TNFR1 Complex II. In some embodiments, the RNA is capable of binding to an RBP component of TNFR1 Complex Ila. In some embodiments, the RNA is capable of binding to an RBP component of TNFR1 Complex lib. In some embodiments, the RNA is capable of binding to an RBP component of TNFR1 Complex lie.

[0109] Binding of an RNA to an RBP may alternatively be defined as RNA associating with an RBP, or RNA interacting with an RBP. RNAs bind (or associate / interact with) RBPs through the molecular interactions of chemical moieties between protein residues and RNA nucleotides. In some embodiments, molecular interactions between RNA and RBPs comprise hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and stacking. RBP interactions with RNA are reviewed by Corley et al. (2020. Molecular Cell 78, 9-29), which is hereby incorporated by reference in its entirety.

[0110] In some embodiments, the RNA is messenger RNA (mRNA), intron-derived RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), telomerase RNA, tRNA fragment (tRF), tRNA-derived stress-induced RNAs (tiRNAs), micro RNA (miRNA), small interfering RNA (siRNA), Piwi-interacting RNA (piRNA), enhancer RNA (eRNA), circular RNA, Y RNA, centromere repeat associated short interacting (crasi) RNA, telomere specific small RNA (Tels RNA), chromatin associated RNA (caRNA), promoter associated RNA (paRNA), endogenous retroviral element (ERE) RNA, long terminal repeat (LTR) RNA, endogenous retrovirus-K (ERVK) RNA, long interspersed nuclear element (LINE) RNA, and short interspersed nuclear element (SINE) RNA, or an Alu element.

[0111] In some embodiments, the RNA is a non-coding RNA.

[0112] A non-coding RNA is an RNA molecule which is not translated into a protein. In some embodiments, a non-coding RNA performs a function as an RNA molecule. In other words, a non-coding RNA may perform a function without being transcribed into a protein. Non-coding RNAs can be categorised broadly in two domains on the basis of transcript size, small non-coding RNA (sncRNA; < 200 nucleotides) and long non-coding RNA (IncRNA; > 200 nucleotides). In some embodiments, the non-coding RNA is a IncRNA or a sncRNA. In some embodiments, the non-coding RNA is a IncRNA. In some embodiments, the non-coding RNA is a sncRNA.

[0113] In some embodiments, the non-coding RNA is intron-derived RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), telomerase RNA, tRNA fragment (tRF), tRNA-derived stress-induced RNAs (tiRNAs), micro RNA (miRNA), small interfering RNA (siRNA), Piwi-interacting RNA (piRNA), enhancer RNA (eRNA), circular RNA, Y RNA, centromere repeat associated short interacting (eras!) RNA, telomere specific small RNA (Tels RNA), chromatin associated RNA (caRNA), promoter associated RNA (paRNA), endogenous retroviral element (ERE) RNA, long terminal repeat (LTR) RNA, endogenous retrovirus-K (ERVK) RNA, long interspersed nuclear element (LINE) RNA, and short interspersed nuclear element (SINE) RNA, or an Alu element.

[0114] In some embodiments, the non-coding RNA is ERE RNA, paRNA, LTR RNA, ERVK RNA, LINE RNA, SINE RNA, and / or an Alu element.

[0115] In some embodiments, the RNA is ERE RNA. In some embodiments, the RNA is paRNA. In some embodiments, the RNA is LTR RNA. In some embodiments, the RNA is ERVK RNA. In some embodiments, the RNA is LINE RNA. In some embodiments, the RNA is SINE RNA. In some embodiments, the RNA is an Alu element. In some embodiments, the RNA is mRNA.

[0116] It is known in the art that mRNAs have non-coding functions in addition to their role in protein translation (Boraas et al., Non-coding function for mRNAs in Focal Adhesion Architecture and Mechanotransduction. bioRxiv. 2021 ). In some embodiments, the RNA is a coding RNA with non-coding functionality. In some embodiments, the RNA is mRNA with non-coding functionality. In some embodiments, the mRNA is intron-derived mRNA.

[0117] Transcription of DNA yields RNA which is complementary to the template DNA strand. RNA includes the base uracil (U) in place of thymine (T), i.e., the base uracil (U) takes the place of thymine in RNA. Uracil is found in RNA, but not DNA. Thymine is found in DNA but not RNA. Both uracil and thymine are complimentary to adenine (A). The sequence of an RNA molecule corresponding to a specified DNA molecule may be determined by substituting thymine (T) bases of the specified DNA molecule for uracil (U) bases; the identity and location of adenine (A), cytosine (C), guanine (G) bases are unchanged.

[0118] The sequence of an RNA molecule which is complimentary to a DNA molecule may be determined based on nucleobase complementarity. Adenine (A) is complimentary to uracil (U), and cytosine (C) is complimentary to guanine (G). The skilled person is aware of the differences between DNA and RNA, and is able to determine complimentary RNA sequences based on a DNA sequence template (either manually, or by using an appropriate tool / program). Numerous freely available bioinformatic programs are available to determine the sequence of an RNA molecule transcribed from a given DNA molecule (e.g., the Transcription and Translation Tool, freely available from La Universidad de Alcala), and the skilled person would be aware of this and would be capable of using such tools. Furthermore, the skilled person may use computing environments, such as MATLAB, to determine the sequence of an RNA molecule transcribed from a given DNA molecule.

[0119] Table 1 and Table 2 also show the genomic location of DNA sequences which encode RNAs identified as RNA molecules which interact with components of TNFR1 complexes. Therefore, Table 1 and Table 2 can be used to determine the ribonucleotide sequences of RNA component of TNFR1 complexes.

[0120] By way of example, the nucleotide sequence of the RNA molecule of AFF3 is the ribonucleotide sequence transcribed from positions 100418069 to 100745658 of the negative strand of human chromosome 2 (Table 1 Locus #7).

[0121] By way of example, the DNA sequence of positions 100418069 to 100418168 of human chromosome 2 is:

[0122] TTCCCATTTCCTTCGGGACAATCTGGATGCAGGAGGCTGCTGTGCTAAAAAGTTTTCACCAT GTCACTAGCTTGACATCTACTTTTACGACCTCTCATTC (SEQ ID NO:14)

[0123] The RNA transcribed from positions 100418069 to 100418168 of the negative strand of human chromosome 2 is:

[0124] GAAUGAGAGGUCGUAAAAGUAGAUGUCAAGCUAGUGACAUGGUGAAAACUUUUUAGCACA GCAGCCUCCUGCAUCCAGAUUGUCCCGAAGGAAAUGGGAA (SEQ ID NO:24)

[0125] By way of further example, the nucleotide sequence of the RNA molecule referred to herein as 'RUPTR7’ is the ribonucleotide sequence transcribed from positions 23426206 to 23433775 of the positive strand of human chromosome 20 (Table 2 Locus #107)

[0126] In some embodiments, the RNA is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence of an RNA transcribed from a locus identified in Table 1 or Table 2.

[0127] In some embodiments, the RNA is an RNA comprising or consisting of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% sequence identity to a nucleotide sequence of an RNA transcribed from a locus identified in Table 1 or Table 2.

[0128] Table 1. Genomic location for the transcription of the RNAs identified through STAMP assay.

[0129] Table 2. Genomic location for the transcription of the RNAs identified through STAMP assay.

[0130] In some embodiments, the RNA is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of: (#1 a) the nucleotide sequence of an RNA transcribed from positions 145959299 to 145969262 of human chromosome 1 .

[0131] (#1 b) the nucleotide sequence of an RNA transcribed from positions 147502825 to 147510900 of human chromosome 1 . (#2) the nucleotide sequence of an RNA transcribed from positions 111659317 to 11 1846428 of human chromosome 7.

[0132] (#3) the nucleotide sequence of an RNA transcribed from positions 86396528 to 86922184 of human chromosome 4.

[0133] (#4) the nucleotide sequence of an RNA transcribed from positions 165899418 to 166077274 of human chromosome 6.

[0134] (#5) the nucleotide sequence of an RNA transcribed from positions 68290286 to 68644674 of human chromosome 14.

[0135] (#6) the nucleotide sequence of an RNA transcribed from positions 34254566 to 34379410 of human chromosome 1 1 .

[0136] (#7) the nucleotide sequence of an RNA transcribed from positions 100418069 to 100745658 of human chromosome 2.

[0137] (#8) the nucleotide sequence of an RNA transcribed from positions 86522442 to 86669286 of human chromosome 4.

[0138] (#9) the nucleotide sequence of an RNA transcribed from positions 99261673 to 99434556 of human chromosome 15.

[0139] (#10) the nucleotide sequence of an RNA transcribed from positions 39917349 to 40178399 of human chromosome 13.

[0140] (#1 1 ) the nucleotide sequence of an RNA transcribed from positions 34603358 to 35104032 of human chromosome 10.

[0141] (#12) the nucleotide sequence of an RNA transcribed from positions 126719089 to 126784246 of human chromosome 10.

[0142] (#13) the nucleotide sequence of an RNA transcribed from positions 128596422 to 128841778 of human chromosome 6.

[0143] (#14) the nucleotide sequence of an RNA transcribed from positions 6461 1344 to 64672035 of human chromosome 3.

[0144] (#15) the nucleotide sequence of an RNA transcribed from positions 89445931 to 89526681 of human chromosome 16.

[0145] (#16) the nucleotide sequence of an RNA transcribed from positions 1893151 to 2245677 of human chromosome 6.

[0146] (#17) the nucleotide sequence of an RNA transcribed from positions 134256502 to 134309412 of human chromosome 8.

[0147] (#18) the nucleotide sequence of an RNA transcribed from positions 106964857 to 107157063 of human chromosome 7.

[0148] (#19) the nucleotide sequence of an RNA transcribed from positions 188347397 to 188533178 of human chromosome 3.

[0149] (#20) the nucleotide sequence of an RNA transcribed from positions 140514285 to 140590155 of human chromosome 9.

[0150] (#21 ) the nucleotide sequence of an RNA transcribed from positions 61542606 to 61920401 of human chromosome 3.

[0151] (#22) the nucleotide sequence of an RNA transcribed from positions 65892334 to 66385973 of human chromosome 5. (#23) the nucleotide sequence of an RNA transcribed from positions 110151629 to 110176276 of human chromosome 12.

[0152] (#24) the nucleotide sequence of an RNA transcribed from positions 18786971 1 to 1881 12441 of human chromosome 3.

[0153] (#25) the nucleotide sequence of an RNA transcribed from positions 64356475 to 64590847 of human chromosome 17.

[0154] (#26) the nucleotide sequence of an RNA transcribed from positions 10195009 to 10245811 of human chromosome 3.

[0155] (#27) the nucleotide sequence of an RNA transcribed from positions 106330722 to 106659430 of human chromosome 8.

[0156] (#28) the nucleotide sequence of an RNA transcribed from positions 100558333 to 100680965 of human chromosome 11 .

[0157] (#29) the nucleotide sequence of an RNA transcribed from positions 149041318 to 149386381 of human chromosome 4.

[0158] (#30) the nucleotide sequence of an RNA transcribed from positions 245999527 to 246670404 of human chromosome 1 .

[0159] (#31 ) the nucleotide sequence of an RNA transcribed from positions 29677541 to 29904086 of human chromosome X.

[0160] (#32) the nucleotide sequence of an RNA transcribed from positions 23250209 to 23521712 of human chromosome 3.

[0161] (#33) the nucleotide sequence of an RNA transcribed from positions 66975015 to 67215923 of human chromosome 14.

[0162] (#34) the nucleotide sequence of an RNA transcribed from positions 7566739 to 7966915 of human chromosome 18.

[0163] (#35) the nucleotide sequence of an RNA transcribed from positions 59826238 to 60230486 of human chromosome 20.

[0164] (#36) the nucleotide sequence of an RNA transcribed from positions 104918024 to 105155677 of human chromosome 12.

[0165] (#37) the nucleotide sequence of an RNA transcribed from positions 143671031 to 147850490 of human chromosome 1 .

[0166] (#38) the nucleotide sequence of an RNA transcribed from positions 40812253 to 41217827 of human chromosome 4.

[0167] (#39) the nucleotide sequence of an RNA transcribed from positions 19837625 to 19869554 of human chromosome 6.

[0168] (#40) the nucleotide sequence of an RNA transcribed from positions 189696844 to 189838594 of human chromosome 3.

[0169] (#41 ) the nucleotide sequence of an RNA transcribed from positions 148736110 to 148766960 of human chromosome 1 .

[0170] (#42) the nucleotide sequence of an RNA transcribed from positions 11802659 to 1 1993721 of human chromosome 12.

[0171] (#43) the nucleotide sequence of an RNA transcribed from positions 102247784 to 102456356 of human chromosome 2. (#44) the nucleotide sequence of an RNA transcribed from positions 171757455 to 171959434 of human chromosome 3.

[0172] (#45) the nucleotide sequence of an RNA transcribed from positions 188124039 to 188343878 of human chromosome 3.

[0173] (#46) the nucleotide sequence of an RNA transcribed from positions 153191855 to 153378429 of human chromosome 2.

[0174] (#47) the nucleotide sequence of an RNA transcribed from positions 184834202 to 184943833 of human chromosome 1 .

[0175] (#48) the nucleotide sequence of an RNA transcribed from positions 119653285 to 119807106 of human chromosome 3.

[0176] (#49) the nucleotide sequence of an RNA transcribed from positions 1431 15825 to 143285504 of human chromosome 6.

[0177] (#50) the nucleotide sequence of an RNA transcribed from positions 99641779 to 99758184 of human chromosome 3.

[0178] (#51 ) the nucleotide sequence of an RNA transcribed from positions 17420660 to 17494454 of human chromosome X.

[0179] (#52) the nucleotide sequence of an RNA transcribed from positions 85923977 to 86198925 of human chromosome 15.

[0180] (#53) the nucleotide sequence of an RNA transcribed from positions 44854771 to 45229571 of human chromosome 6.

[0181] (#54) the nucleotide sequence of an RNA transcribed from positions 79733899 to 79850706 of human chromosome 8.

[0182] (#55) the nucleotide sequence of an RNA transcribed from positions 75935953 to 76056352 of human chromosome 13.

[0183] (#56) the nucleotide sequence of an RNA transcribed from positions 144301054 to 144541576 of human chromosome 1 .

[0184] (#57) the nucleotide sequence of an RNA transcribed from positions 36177613 to 36425639 of human chromosome 22.

[0185] (#58) the nucleotide sequence of an RNA transcribed from positions 28012120 to 28209146 of human chromosome 7.

[0186] (#59) the nucleotide sequence of an RNA transcribed from positions 1607960 to 1892955 of human chromosome 6.

[0187] (#60) the nucleotide sequence of an RNA transcribed from positions 128246768 to 128469388 of human chromosome 9.

[0188] (#61 ) the nucleotide sequence of an RNA transcribed from positions 116854504 to 116968939 of human chromosome 11 .

[0189] (#62) the nucleotide sequence of an RNA transcribed from positions 47127605 to 47233991 of human chromosome 13.

[0190] (#63) the nucleotide sequence of an RNA transcribed from positions 206667573 to 206757842 of human chromosome 1 .

[0191] (#64) the nucleotide sequence of an RNA transcribed from positions 60596474 to 60768540 of human chromosome 5. (#65) the nucleotide sequence of an RNA transcribed from positions 761 14103 to 76432164 of human chromosome 10.

[0192] (#66) the nucleotide sequence of an RNA transcribed from positions 7971 1 11 to 8406585 of human chromosome 18.

[0193] (#67) the nucleotide sequence of an RNA transcribed from positions 29060442 to 29545467 of human chromosome 1 1 .

[0194] (#68) the nucleotide sequence of an RNA transcribed from positions 16371311 to 16437191 of human chromosome 21 .

[0195] (#69) the nucleotide sequence of an RNA transcribed from positions 131409474 to 131440762 of human chromosome 5.

[0196] (#70) the nucleotide sequence of an RNA transcribed from positions 49962691 to 501 14102 of human chromosome 20.

[0197] (#71 ) the nucleotide sequence of an RNA transcribed from positions 3340909 to 4167031 of human chromosome 7.

[0198] (#72) the nucleotide sequence of an RNA transcribed from positions 29650814 to 30051606 of human chromosome 3.

[0199] (#73) the nucleotide sequence of an RNA transcribed from positions 12008853 to 12151073 of human chromosome 6.

[0200] (#74) the nucleotide sequence of an RNA transcribed from positions 192554458 to 192635399 of human chromosome 3.

[0201] (#75) the nucleotide sequence of an RNA transcribed from positions 74451668 to 74710375 of human chromosome 13.

[0202] (#76) the nucleotide sequence of an RNA transcribed from positions 234040499 to 234383480 of human chromosome 1 .

[0203] (#77) the nucleotide sequence of an RNA transcribed from positions 184020384 to 184088355 of human chromosome 4.

[0204] (#78) the nucleotide sequence of an RNA transcribed from positions 108103176 to 108335534 of human chromosome 13.

[0205] (#79) the nucleotide sequence of an RNA transcribed from positions 23435467 to 23494419 of human chromosome 1 .

[0206] (#80) the nucleotide sequence of an RNA transcribed from positions 49962374 to 501 13788 of human chromosome 5.

[0207] (#81 ) the nucleotide sequence of an RNA transcribed from positions 16830300 to 17076624 of human chromosome 1 .

[0208] (#82) the nucleotide sequence of an RNA transcribed from positions 15244245 to 15452572 of human chromosome 6.

[0209] (#83) the nucleotide sequence of an RNA transcribed from positions 37784676 to 381 18126 of human chromosome 6.

[0210] (#84) the nucleotide sequence of an RNA transcribed from positions 20323631 to 204571 17 of human chromosome 4.

[0211] (#85) the nucleotide sequence of an RNA transcribed from positions 65339155 to 65907397 of human chromosome 3. (#86) the nucleotide sequence of an RNA transcribed from positions 108082406 to 108460035 of human chromosome 5.

[0212] (#87) the nucleotide sequence of an RNA transcribed from positions 70479923 to 70588817 of human chromosome 17.

[0213] (#88) the nucleotide sequence of an RNA transcribed from positions 10095845 to 10319831 of human chromosome 1 1 .

[0214] (#89) the nucleotide sequence of an RNA transcribed from positions 109150930 to 109276049 of human chromosome 2.

[0215] (#90) the nucleotide sequence of an RNA transcribed from positions 21376800 to 21554467 of human chromosome 1 .

[0216] (#91 ) the nucleotide sequence of an RNA transcribed from positions 71471994 to 71633960 of human chromosome 15.

[0217] (#92) the nucleotide sequence of an RNA transcribed from positions 235423963 to 235491373 of human chromosome 1 .

[0218] (#93) the nucleotide sequence of an RNA transcribed from positions 126475318 to 126692155 of human chromosome 9.

[0219] (#94) the nucleotide sequence of an RNA transcribed from positions 167710188 to 167813852 of human chromosome 5.

[0220] (#95) the nucleotide sequence of an RNA transcribed from positions 10560487 to 10657638 of human chromosome 5.

[0221] (#96) the nucleotide sequence of an RNA transcribed from positions 4801 1532 to 48132940 of human chromosome 3.

[0222] (#97) the nucleotide sequence of an RNA transcribed from positions 178063133 to 178395500 of human chromosome 1 .

[0223] (#98) the nucleotide sequence of an RNA transcribed from positions 35684412 to 35824606 of human chromosome 1 1 .

[0224] (#99) the nucleotide sequence of an RNA transcribed from positions 175001674 to 1751 14226 of human chromosome 2.

[0225] (#100) the nucleotide sequence of an RNA transcribed from positions 23608068 to 23868206 of human chromosome 2.

[0226] (#101 ) the nucleotide sequence of an RNA transcribed from positions 46064217 to 46210823 of human chromosome 1 .

[0227] (#102) the nucleotide sequence of an RNA transcribed from positions 109737142 to 109775071 of human chromosome 1 .

[0228] (#103) the nucleotide sequence of an RNA transcribed from positions 77043779 to 77122468 of human chromosome 7.

[0229] (#104) the nucleotide sequence of an RNA transcribed from positions 157556333 to 157587186 of human chromosome 2.

[0230] (#105) the nucleotide sequence of an RNA transcribed from positions 11417591 to 1 1461284 of human chromosome 6.

[0231] (#106) the nucleotide sequence of an RNA transcribed from positions 157398215 to 157460007 of human chromosome 5. (#107) the nucleotide sequence of an RNA transcribed from positions 23426206 to 23433775 of human chromosome 20.

[0232] (#108) the nucleotide sequence of an RNA transcribed from positions 30952569 to 30992458 of human chromosome 1 1 .

[0233] (#109) the nucleotide sequence of an RNA transcribed from positions 148264179 to 148330482 of human chromosome 2.

[0234] (#1 10) the nucleotide sequence of an RNA transcribed from positions 117290 to 135277 of human chromosome 22.

[0235] (#1 1 1 ) the nucleotide sequence of an RNA transcribed from positions 175989480 to 176027571 of human chromosome 1 .

[0236] (#1 12) the nucleotide sequence of an RNA transcribed from positions 9735487 to 9741 115 of human chromosome 8.

[0237] (#1 13) the nucleotide sequence of an RNA transcribed from positions 63785231 to 63805565 of human chromosome 8.

[0238] (#1 14) the nucleotide sequence of an RNA transcribed from positions 96720566 to 96739955 of human chromosome 12.

[0239] (#1 15) the nucleotide sequence of an RNA transcribed from positions 230328832 to 230342173 of human chromosome 2.

[0240] (#1 16) the nucleotide sequence of an RNA transcribed from positions 106463621 to 106496054 of human chromosome 12.

[0241] (#1 17) the nucleotide sequence of an RNA transcribed from positions 16437525 to 16552529 of human chromosome 9.

[0242] (#1 18) the nucleotide sequence of an RNA transcribed from positions 156352787 to 156388675 of human chromosome 6.

[0243] (#1 19) the nucleotide sequence of an RNA transcribed from positions 63729009 to 63848896 of human chromosome 8.

[0244] (#120) the nucleotide sequence of an RNA transcribed from positions 162719146 to 162753094 of human chromosome 1 .

[0245] (#121 ) the nucleotide sequence of an RNA transcribed from positions 37916555 to 37926178 of human chromosome 1 .

[0246] (#122) the nucleotide sequence of an RNA transcribed from positions 49925315 to 50042315 of human chromosome X.

[0247] (#123) the nucleotide sequence of an RNA transcribed from positions 1968590 to 1987324 of human chromosome 5.

[0248] (#124) the nucleotide sequence of an RNA transcribed from positions 148384870 to 148446265 of human chromosome 3.

[0249] (#125) the nucleotide sequence of an RNA transcribed from positions 28318533 to 28405425 of human chromosome 14.

[0250] (#126) the nucleotide sequence of an RNA transcribed from positions 113215997 to 113218504 of human chromosome 2.

[0251] (#127) the nucleotide sequence of an RNA transcribed from positions 37974838 to 38015373 of human chromosome 9. (#128) the nucleotide sequence of an RNA transcribed from positions 8384099 to 8405959 of human chromosome 21 .

[0252] (#129) the nucleotide sequence of an RNA transcribed from positions 66788980 to 66803872 of human chromosome 17.

[0253] (#130) the nucleotide sequence of an RNA transcribed from positions 71147339 to 71174844 of human chromosome 1 1 .

[0254] (#131 ) the nucleotide sequence of an RNA transcribed from positions 150017499 to 150223165 of human chromosome X.

[0255] (#132) the nucleotide sequence of an RNA transcribed from positions 87518316 to 87613876 of human chromosome X.

[0256] (#133) the nucleotide sequence of an RNA transcribed from positions 132212148 to 132284358 of human chromosome 11 .

[0257] (#134) the nucleotide sequence of an RNA transcribed from positions 163256988 to 163425802 of human chromosome 5.

[0258] (#135) the nucleotide sequence of an RNA transcribed from positions 49396244 to 49422714 of human chromosome 15.

[0259] (#136) the nucleotide sequence of an RNA transcribed from positions 48173220 to 48198075 of human chromosome 1 .

[0260] (#137) the nucleotide sequence of an RNA transcribed from positions 32902124 to 32925352 of human chromosome 2.

[0261] (#138) the nucleotide sequence of an RNA transcribed from positions 13413791 to 13421599 of human chromosome 21 .

[0262] (#139) the nucleotide sequence of an RNA transcribed from positions 114823036 to 114998256 of human chromosome 6.

[0263] (#140) the nucleotide sequence of an RNA transcribed from positions 111468836 to 11 1491662 of human chromosome 2.

[0264] (#141 ) the nucleotide sequence of an RNA transcribed from positions 144995201 to 145092834 of human chromosome 1 .

[0265] (#142) the nucleotide sequence of an RNA transcribed from positions 40161637 to 40189054 of human chromosome 1 .

[0266] (#143) the nucleotide sequence of an RNA transcribed from positions 3471518 to 3535252 of human chromosome 20.

[0267] (#144) the nucleotide sequence of an RNA transcribed from positions 71964876 to 72352094 of human chromosome 14.

[0268] (#145) the nucleotide sequence of an RNA transcribed from positions 52685691 to 52785534 of human chromosome 5.

[0269] (#146) the nucleotide sequence of an RNA transcribed from positions 3999688 to 4023872 of human chromosome 1 1 .

[0270] (#147) the nucleotide sequence of an RNA transcribed from positions 4007064 to 4027993 of human chromosome 3.

[0271] (#148) the nucleotide sequence of an RNA transcribed from positions 76995521 to 77044203 of human chromosome 1 . (#149) the nucleotide sequence of an RNA transcribed from positions 1671 to 3229 of human chromosome M.

[0272] (#150) the nucleotide sequence of an RNA transcribed from positions 40994854 to 41007439 of human chromosome 9.

[0273] (#151 ) the nucleotide sequence of an RNA transcribed from positions 136093037 to 1361 17070 of human chromosome 7.

[0274] (#152) the nucleotide sequence of an RNA transcribed from positions 70660217 to 70664661 of human chromosome 15.

[0275] (#153) the nucleotide sequence of an RNA transcribed from positions 24094298 to 241 11073 of human chromosome 16.

[0276] (#154) the nucleotide sequence of an RNA transcribed from positions 60726214 to 60774900 of human chromosome 13.

[0277] (#155) the nucleotide sequence of an RNA transcribed from positions 97306298 to 97373560 of human chromosome 1 .

[0278] (#156) the nucleotide sequence of an RNA transcribed from positions 25664976 to 25795773 of human chromosome 14.

[0279] (#157) the nucleotide sequence of an RNA transcribed from positions 20981625 to 20994089 of human chromosome 17.

[0280] (#158) the nucleotide sequence of an RNA transcribed from positions 161973418 to 162054090 of human chromosome 6.

[0281] (#159) the nucleotide sequence of an RNA transcribed from positions 209299939 to 209304476 of human chromosome 2.

[0282] (#160) the nucleotide sequence of an RNA transcribed from positions 29467682 to 29485833 of human chromosome 16.

[0283] (#161 ) the nucleotide sequence of an RNA transcribed from positions 119273709 to 119291164 of human chromosome 4.

[0284] (#162) the nucleotide sequence of an RNA transcribed from positions 112271606 to 112360361 of human chromosome 1 .

[0285] (#163) the nucleotide sequence of an RNA transcribed from positions 14713296 to 14886754 of human chromosome 2.

[0286] (#164) the nucleotide sequence of an RNA transcribed from positions 29505794 to 29527687 of human chromosome 16.

[0287] (#165) the nucleotide sequence of an RNA transcribed from positions 199016466 to 199041555 of human chromosome 1 .

[0288] (#166) the nucleotide sequence of an RNA transcribed from positions 14619511 1 to 146774270 of human chromosome 7.

[0289] (#167) the nucleotide sequence of an RNA transcribed from positions 12833755 to 12850658 of human chromosome 3.

[0290] (#168) the nucleotide sequence of an RNA transcribed from positions 10650114 to 10657816 of human chromosome 5.

[0291] (#169) the nucleotide sequence of an RNA transcribed from positions 113217376 to 113218609 of human chromosome 2. (#170) the nucleotide sequence of an RNA transcribed from positions 63148830 to 63154859 of human chromosome 7.

[0292] (#171 ) the nucleotide sequence of an RNA transcribed from positions 9809791 to 9819161 of human chromosome 6.

[0293] (#172) the nucleotide sequence of an RNA transcribed from positions 10649266 to 10657816 of human chromosome 5.

[0294] (#173) the nucleotide sequence of an RNA transcribed from positions 82475712 to 82477258 of human chromosome 15.

[0295] (#174) the nucleotide sequence of an RNA transcribed from positions 88729338 to 88734551 of human chromosome 2.

[0296] Table 1 also shows the name of RNAs identified as RNA molecules which interact with components of TNFR1 complexes. In some embodiments, the RNA is selected from the group consisting of: FATALR1 , DOCK4, ARHGAP24, PDE10A, RAD51 B, ABTB2, AFF3, MIR4451 , MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1 , GPR22, MIR28, EHMT1 , PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1 , IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1 , FMNL2, NIBAN1 , MIR6529, HIVEP2, MIR3921 , MIR4768, AKAP13, MIR586, LINC02605, TBC1 D4, RNVU1 -4, RBFOX2, JAZF1 -AS1 , FOXC1 , MAPKAP1 , SIK3, LRCH1 , RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1 , CSF2, MIR3194, SDK1 , RBMS3-AS1 , HIVEP1 , MB21 D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1 , PARP8, RNU1 -2, JARID2, ZFAND3, SLIT2-IT1 , MAGI1-AS1 , FER, LINC00673, SBF2, LIMS1 , EIF4G3, THSD4-AS1 , ARID4B, DENND1 A, WWC1 , ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 , and KLHL29. In some embodiments, the RNA is FATALR1 , RAD51 B, or AFF3.

[0297] In some embodiments, the RNA is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to the nucleotide sequence of FATALR1 , DOCK4, ARHGAP24, PDE10A, RAD51 B, ABTB2, AFF3, MIR4451 , MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9- AS2, LOC101927817, GMDS, NDRG1 , GPR22, MIR28, EHMT1 , PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1 , IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1 , FMNL2, NIBAN1 , MIR6529, HIVEP2, MIR3921 , MIR4768, AKAP13, MIR586, LINC02605, TBC1 D4, RNVU1 -4, RBFOX2, JAZF1 -AS1 , FOXC1 , MAPKAP1 , SIK3, LRCH1 , RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1 , CSF2, MIR3194, SDK1 , RBMS3-AS1 , HIVEP1 , MB21 D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1 , PARP8, RNU1 -2, JARID2, ZFAND3, SLIT2-IT1 , MAGI1 -AS1 , FER, LINC00673, SBF2, LIMS1 , EIF4G3, THSD4-AS1 , ARID4B, DENND1 A, WWC1 , ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 , or KLHL29.

[0298] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% nucleotide sequence identity to a nucleotide sequence of FATALR1 , D0CK4, ARHGAP24, PDE10A, RAD51 B, ABTB2, AFF3, MIR4451 , MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1 , GPR22, MIR28, EHMT1 , PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1 , IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1 , FMNL2, NIBAN1 , MIR6529, HIVEP2, MIR3921 , MIR4768, AKAP13, MIR586, LINC02605, TBC1 D4, RNVU1 -4, RBFOX2, JAZF1 -AS1 FOXC1 , MAPKAP1 , SIK3, LRCH1 , RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1 , CSF2, MIR3194, SDK1 , RBMS3-AS1 , HIVEP1 , MB21 D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1 , PARP8, RNU1 -2, JARID2, ZFAND3, SLIT2-IT1 , MAGI1 -AS1 , FER, LINC00673, SBF2, LIMS1 , EIF4G3, THSD4-AS1 , ARID4B, DENND1 A, WWC1 , ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 , or KLHL29.

[0299] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:25.

[0300] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98% or >99% nucleotide sequence identity to a nucleotide sequence of SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:25.

[0301] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:10.

[0302] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% nucleotide sequence identity to a nucleotide sequence of SEQ ID NO:10.

[0303] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:1 1 .

[0304] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% nucleotide sequence identity to a nucleotide sequence of SEQ ID NO:1 1 .

[0305] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:25.

[0306] In some embodiments, the RNA comprises or consists of a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, or 100% nucleotide sequence identity to a nucleotide sequence of SEQ ID NO:25.

[0307] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence of an RNA motif identified according to the method of Example 1 1 .

[0308] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%, or 100% sequence identity to a nucleotide sequence of an RNA motif identified according to the method of Example 1 1 .

[0309] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence of an RNA motif presented in Figure 16A or Figure 16B.

[0310] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%, or 100% sequence identity to a nucleotide sequence of an RNA motif presented in Figure 16A or Figure 16B.

[0311] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence of SEQ ID NO:29, SEQ ID NQ:30, and / or SEQ ID NO:31.

[0312] In some embodiments, the RNA is an RNA comprising a nucleotide sequence having at least 75% nucleotide sequence identity, e.g., one of >75%, >80%, >85%, >86%, >87%, >88%, >89%, >90%, >91 %, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%, or 100% sequence identity to a nucleotide sequence of SEQ ID NO:29, SEQ ID NO:30, and / or SEQ ID NO:31 .

[0313] In some embodiments, the component of a TNFR1 complex is a component of TNFR1 Complex II. In some embodiments, the component of TNFR1 Complex II is a component of TNFR1 Complex Ila, a component of TNFR1 Complex lib, and / or a component of TNFR1 Complex lie. In some embodiments, the component of TNFR1 Complex II is a component of TNFR1 Complex Ila. In some embodiments, the component of TNFR1 Complex II is a component of TNFR1 Complex lib. In some embodiments, the component of TNFR1 Complex II is a component of TNFR1 Complex lie.

[0314] In some embodiments, the component of TNFR1 Complex II is TRADD, RIPK1 , RIPK3, FADD, procaspase-3, pro-caspase-8, or Caspase-10, Caspase-3, Caspase-8, Caspase-10, FTO, XPO5, FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the component of TNFR1 Complex Ila is TRADD, RIPK1 , RIPK3, FADD, procaspase-3, pro-caspase-8, or pro-caspase-10, Caspase-3, Caspase-8, Caspase-10, FTO, XPO5, FATALR1 , RAD51 B, AFF3, and / or RUPTR7.

[0315] In some embodiments, the component of TNFR1 Complex lib is RIPK1 , RIPK3, FADD, pro-caspase-3, pro-caspase-8, or pro-caspase-10, Caspase-3, Caspase-8, Caspase-10, FTO, XPO5, FATALR1 , RAD51 B, AFF3, and / or RUPTR7.

[0316] In some embodiments, the component of TNFR1 Complex lie is TRADD, RIPK1 , RIPK3, FADD, FTO, XPO5, FATALR1 , RAD51 B, AFF3, and / or RUPTR7.

[0317] In some embodiments, the RBP component of a TNFR1 Complex is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 Complex II is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 Complex Ila is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 Complex lib is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 Complex lie is FTO and / or XPO5.

[0318] In some embodiments, the RBP component of a TNFR1 Complex is FTO. In some embodiments, the RBP component of TNFR1 Complex II is FTO. In some embodiments, the RBP component of TNFR1 Complex Ila is FTO. In some embodiments, the RBP component of TNFR1 Complex lib is FTO. In some embodiments, the RBP component of TNFR1 Complex lie is FTO.

[0319] In some embodiments, the RBP component of a TNFR1 Complex is XPO5. In some embodiments, the RBP component of TNFR1 Complex II is XPO5. In some embodiments, the RBP component of TNFR1 Complex Ila is XPO5. In some embodiments, the RBP component of TNFR1 Complex lib is XPO5. In some embodiments, the RBP component of TNFR1 Complex lie is XPO5.

[0320] In some embodiments, the RNA component of a TNFR1 Complex is FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the RNA component of TNFR1 Complex II is FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the RNA component of TNFR1 Complex Ila is FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the RNA component of TNFR1 Complex lib is FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the RNA component of TNFR1 Complex lie is FATALR1 , RAD51 B, AFF3, and / or RUPTR7.

[0321] In some embodiments, the RNA component of a TNFR1 Complex is FATALR1 . In some embodiments, the RNA component of TNFR1 Complex II is FATALR1 . In some embodiments, the RNA component of TNFR1 Complex Ila is FATALR1 . In some embodiments, the RNA component of TNFR1 Complex lib is FATALR1 . In some embodiments, the RNA component of TNFR1 Complex lie is FATALR1 .

[0322] In some embodiments, the RNA component of a TNFR1 Complex is RAD51 B. In some embodiments, the RNA component of TNFR1 Complex II is RAD51 B. In some embodiments, the RNA component of TNFR1 Complex Ila is RAD51 B. In some embodiments, the RNA component of TNFR1 Complex lib is RAD51 B. In some embodiments, the RNA component of TNFR1 Complex lie is RAD51 B.

[0323] In some embodiments, the RNA component of a TNFR1 Complex is AFF3. In some embodiments, the RNA component of TNFR1 Complex II is AFF3. In some embodiments, the RNA component of TNFR1 Complex Ila is AFF3. In some embodiments, the RNA component of TNFR1 Complex lib is AFF3. In some embodiments, the RNA component of TNFR1 Complex lie is AFF3.

[0324] In some embodiments, the RNA component of a TNFR1 Complex is RUPTR7. In some embodiments, the RNA component of TNFR1 Complex II is RUPTR7. In some embodiments, the RNA component of TNFR1 Complex Ila is RUPTR7. In some embodiments, the RNA component of TNFR1 Complex lib is RUPTR7. In some embodiments, the RNA component of TNFR1 Complex lie is RUPTR7.

[0325] Further RBP components of TNFR1 complexes (e.g., RBP components of TNFR1 Complex I and RBP components of TNFR1 Complex II) may be identified by employing the experimental procedures of the examples of the present disclosure, e.g., Example 1 . Additionally, further RBP components of TNFR1 complexes (e.g., RBP components of TNFR1 Complex I and RBP components of TNFR1 Complex II) may be identified by modifying the experimental procedures of Example 1.

[0326] Pulldown assays were used in Example 1 of this disclosure. The pulldown assay is an in vitro technique used to detect physical interactions between two or more proteins and an invaluable tool for confirming a predicted protein-protein interaction or identifying novel interacting partners. A molecule of interest is used as a “bait” molecule to identify other molecules that bind to the molecule of interest. Pulldown assays could be performed in a similar way to the experiments of Example 1 , but with the use of different components of TNFRI complexes as a “bait” molecule. For example, TNF, TNFR1 , TRADD, RIPK1 , TRAF2, TRAF5, clAP1 , clAP2, FADD, RIPK3, a pre-caspase, a caspase, FTO, XPO5, FATALR1 , RAD51 B, AFF3, and RUPTR7 could be used as a “bait” molecule to identify further novel components of TNFR1 complexes.

[0327] Further RBP components of TNFR1 complexes (e.g., RBP components of TNFR1 Complex I and RBP components of TNFR1 Complex II) may be identified by employing any suitable method known in the art. Protein-Protein Interaction assays could be employed. Protein-protein interaction assays include: coimmunoprecipitation (co-IP), crosslinking protein interaction analysis, label transfer protein interaction analysis, and / or far-western blot analysis. Alternatively, protein-RNA interaction assays could be employed. Protein-RNA Interaction assays include: RNA pull-down assays, oligonucleotide-targeted RNase H protection assays, Surveying Targets by APOBEC-Mediated Profiling (STAMP), and / or fluorescent in situ hybridization co-localization.

[0328] Further RNA components of TNFR1 complexes (e.g., RNA components of TNFR1 Complex I and RNA components of TNFR1 Complex II) may be identified by employing the experimental procedures of the examples of the present disclosure, e.g., Example 3. For example, the STAMP assay used in Example 3 could be modified to RNA molecules which interact with XPO5 during BT-induced apoptosis. Further RNA components of TNFR1 complexes (e.g., RNA components of TNFR1 Complex I and RNA components of TNFR1 Complex II) may be identified by employing any suitable method known in the art. Protein-RNA Interaction assays could be employed. Protein-RNA interaction assays include: RNA pulldown assays, oligonucleotide-targeted RNase H protection assays, STAMP, and / or fluorescent in situ hybridization co-localization.

[0329] TNFR1 -mediated signalling

[0330] TNF signaling occurs through two receptors: TNFR1 and TNFR2. TNFR1 is constitutively expressed on most cell types, whereas TNFR2 is restricted primarily to endothelial, epithelial, and subsets of immune cells. Activation of signaling by TNF through TNFR1 and TNFR2 initiates a variety of potential outcomes, including cell proliferation, gene activation or cell death.

[0331] Herein, ‘TNFR1 -mediated signalling’ refers to signaling mediated by TNFR1 and / or a TNFR1 complex such as TNFR1 Complex I, TNFR1 Complex II, TNFR1 Complex Ila, TNFR1 Complex lib, TNFR1 Complex lie. Signalling’ refers to signal transduction and other cellular processes governing cellular activity. TNFR1 -mediated signalling may be mediated by a TNFR1 complex (e.g., TNFR1 Complex II). TNFR1 -mediated signalling may be mediated by TNFR1 receptor-containing complexes (e.g., TNFR1 Complex I). TNFR1 -mediated signalling may be mediated by a TNFR1 complex formed following TNFR1 activation (e.g., TNFR1 Complex II). TNFR1 -mediated signalling may be mediated by a TNFR1 complex formed following dissociation of RIPK1 from TNFR1 (e.g., TNFR1 Complex II). TNFR1 -mediated signalling may be ligand-dependent, e.g., triggered by binding of TNF to TNFR1 , or may be ligandindependent.

[0332] TNFR1 -mediated signalling progresses intracellularly through the formation of different TNFR1 complexes. TNFR1 Complex I promotes cell survival, primarily by activating the nuclear factor-KB (NF-KB) and mitogen-activated protein kinase (MARK) signalling pathways, while Complex II promotes cell death through the activation of caspases (van Loo and Bertrand, 2022. Nat Rev Immunol, 1 -15).

[0333] In some embodiments, the TNFR1 -mediated signalling is TNFR1 Complex l-mediated signalling, TNFR1 Complex Il-mediated signalling, TNFR1 Complex Ila-mediated signalling, TNFR1 Complex lib-mediated signalling, and / or TNFR1 Complex llc-mediated signalling. In some embodiments, the TNFR1 -mediated signalling is TNFR1 Complex l-mediated signalling. In some embodiments, the TNFR1 -mediated signalling is TNFR1 Complex Il-mediated signalling. In some embodiments, the TNFR1 -mediated signalling is TNFR1 Complex Ila-mediated signalling. In some embodiments, the TNFR1 -mediated signalling is TNFR1 Complex lib-mediated signalling. In some embodiments, the TNFR1 -mediated signalling is TNFRI Complex llc-mediated signalling.

[0334] TNFR1 -mediated signalling is described e.g., in van Loo and Bertrand (2022. Nat Rev Immunol, 1 -15), Gough and Myles (Front Immunol. 2020; 11 : 585880), Muppidi et al. (2004. Immunity, Vol. 21 , 461 -465), Gough and Myles (2020. Front Immunol. 11 : 585880), and Dostert et al. (2019. Physiol Rev99: 1 15-160), all of which are hereby incorporated by reference in their entirety. TNFR1 Complex l-mediated signalling may result in the activation of multiple pathways. The activation of NF-KB, JNK, and p38, by Complex I is achieved by parallel assembly of proteins, recruited via their ubiquitin-binding domains, to activate TGFp-activated kinase 1 (TAK1) and inhibitor of IKB kinase (IKK). TAK1 also activates mitogen-activated protein kinase kinases (MAPKKs), which activate JUN NH2- terminal kinase (JNK) and p38 pathways, in some embodiments, TNFR1 Complex l-mediated signalling increases the activation of NF-KB and mitogen-activated protein kinase MAPK signalling pathways, in some embodiments, TNFR1 Complex l-mediated signalling promotes cell survival. In some embodiments, TNFR1 Complex l-mediated signalling increases cell proliferation. In some embodiments, TNFR1 Complex l-mediated signalling increases cancer cell proliferation.

[0335] TNFR1 Complex Il-mediated signalling promotes cell death and comprises the downstream activity of cell death inducing enzymes such as caspases and protein kinases (Gough and Myles. Front Immunol. 2020; 11 : 585880). In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of FADD, RIPK1 , and RIPK3. In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of TRADD. In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of a caspase. In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of Caspase-3. In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of Caspase-8. In some embodiments, TNFR1 Complex Il-mediated signalling comprises activity of Caspase-10.

[0336] In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the conversion of procaspases to caspases. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates cell death. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates pyroptosis.

[0337] In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of a caspase. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex Il- mediated signalling upregulates the expression and / or activity of Caspase-3. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of Caspase-8. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of Caspase-10. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the activity of a caspase. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the activity of Caspase-3. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the activity of Caspase- 8. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the activity of Caspase-10. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of RIPK1 . In some embodiments, TNFR1 Complex Il-mediated signalling upregulates apoptosis via the expression and / or activity of RIPK1 .

[0338] In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of a receptor-interacting serine / threonine protein kinase. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of RIPK1 . In some embodiments, TNFR1 Complex Il-mediated signalling upregulates the expression and / or activity of RIPK3. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis via the expression and / or activity of a receptor-interacting serine / threonine protein kinase. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis via the activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis via the activity of RIPK1 . In some embodiments, TNFR1 Complex Il-mediated signalling upregulates necroptosis via the activity of RIPK3.

[0339] In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the conversion of procaspases to caspases. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates cell death. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the expression and / or activity of a caspase. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the expression and / or activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the expression and / or activity of Caspase-3. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the expression and / or activity of Caspase-8. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates the expression and / or activity of Caspase-10. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis via the activity of a caspase. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis via the activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis via the activity of Caspase-3. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis via the activity of Caspase- 8. In some embodiments, TNFR1 Complex Ila-mediated signalling upregulates apoptosis via the activity of Caspase-10.

[0340] In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the conversion of procaspases to caspases. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates cell death. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of a caspase. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of Caspase-3. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of Caspase-8. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of Caspase-10. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the activity of a caspase. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the activity of Caspase-3, Caspase-8, and / or Caspase-10. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the activity of Caspase-3. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the activity of Caspase- 8. In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the activity of Caspase-10.

[0341] In some embodiments, TNFR1 Complex lib-mediated signalling upregulates the expression and / or activity of RIPK1 . In some embodiments, TNFR1 Complex lib-mediated signalling upregulates apoptosis via the expression and / or activity of RIPK1 .

[0342] In some embodiments, TNFR1 Complex llc-mediated signalling upregulates necroptosis. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates the expression and / or activity of a receptor-interacting serine / threonine protein kinase. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates the expression and / or activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates the expression and / or activity of RIPK1 . In some embodiments, TNFR1 Complex llc-mediated signalling upregulates the expression and / or activity of RIPK3. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates necroptosis via the activity of a receptor-interacting serine / threonine protein kinase. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates necroptosis via the activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 Complex llc-mediated signalling upregulates necroptosis via the activity of RIPK1 . In some embodiments, TNFR1 Complex llc-mediated signalling upregulates necroptosis via the activity of RIPK3.

[0343] In some embodiments, TNFR1 Complex activity results in the regulation of downstream biomolecules, such as enzymes and RNAs. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of caspase, protein kinase, and / or polymerase activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of Caspase-3, Caspase-8, Caspase-10, RIPK1 , RIPK3, and / or poly (ADP-ribose) polymerase (PARP) expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of Caspase-3, Caspase-8, Caspase-10, RIPK1 , RIPK3, and / or PARP expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of Caspase-3 expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of Caspase-8 expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of Caspase-10 expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of RIPK1 expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of RIPK3 expression and / or activity. In some embodiments, TNFR1 Complex activity results in the upregulation or downregulation of PARP expression and / or activity. Caspases are a family of endoproteases that provide critical links in cell regulatory networks controlling inflammation and cell death. Caspase-mediated apoptotic cell death is accomplished through the cleavage of proteins required for cellular functioning and survival. In some embodiments, caspase activity comprises endoprotease activity. In some embodiments, caspase activity comprises the upregulation of cell death. In some embodiments, caspase activity comprises the upregulation of apoptosis. In some embodiments, caspase activity comprises the cleavage of proteins. In some embodiments, caspase activity comprises caspase-mediated apoptotic cell death. In some embodiments, the caspase activity is Caspase-3 activity, Caspase-8 activity, and / or Caspase-10 activity. In some embodiments, the caspase activity is Caspase-3 activity. In some embodiments, the caspase activity is Caspase-8 activity. In some embodiments, the caspase activity is Caspase-10 activity.

[0344] RIPK1 and RIPK3 activity contributes to the regulation of cell death. RIPK1 and RIPK3 interact with target molecules by virtue of their RIP homotypic interaction motifs to mediate necroptosis. In some embodiments, RIPK1 activity comprises kinase activity. In some embodiments, RIPK1 activity comprises the upregulation of necroptosis. In some embodiments, RIPK3 activity comprises kinase activity. In some embodiments, RIPK3 activity comprises the upregulation of necroptosis.

[0345] RIPK1 activity also contributes to regulation of apoptosis. In some embodiments, RIPK1 mediates apoptosis, In some embodiments, RIPK1 activity comprises kinase activity. In some embodiments, RIPK1 activity comprises the upregulation of apoptosis.

[0346] PARP (or PARP-1 ) participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. The normal function of poly (ADP-ribose) polymerase-1 (PARP-1 ) is the routine repair of DNA damage by adding poly (ADP ribose) polymers in response to a variety of cellular stresses (Chaitanya et al. Cell Common Signal. 2010; 8: 31 ). PARP is one of several known cellular substrates of caspases. Cleavage of PARP-1 by caspases is considered to be a hallmark of apoptosis. Cleavage of PARP-1 by caspase-3 has been implicated in several neurological diseases e.g., cerebral ischemia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, traumatic brain injury, NMDA-mediated excitotoxicity and brain tumours, especially gliomas. PARP fragments have been shown to be involved in various forms of cell death. In some embodiments, PARP activity comprises polymerase activity. In some embodiments, PARP activity comprises the upregulation of cell death. In some embodiments, PARP activity comprises the upregulation of apoptosis.

[0347] The downstream activities of biomolecules may alternatively be described as correlates of TNFR1 complex activity. For example, the upregulation of caspase expression and / or activity is a correlate of TNFR1 Complex II activity.

[0348] In some embodiments, the upregulation of Caspase-3, Caspase-8, Caspase-10, RIPK1 and / or RIPK3 expression and / or activity is a correlate of TNFR1 Complex II activity. In some embodiments, the upregulation of Caspase-3 expression and / or activity is a correlate of TNFR1 Complex II activity. In some embodiments, the upregulation of Caspase-8 expression and / or activity is a correlate of TNFR1 Complex II activity. In some embodiments, the upregulation of Caspase-10 expression and / or activity is a correlate of TNFR1 Complex II activity. In some embodiments, the upregulation of RIPK1 expression and / or activity is a correlate of TNFR1 Complex II activity. In some embodiments, the upregulation of RIPK3 expression and / or activity is a correlate of TNFR1 Complex II activity.

[0349] In some embodiments, the upregulation of Caspase-3, Caspase-8, Caspase-10, RIPK1 and / or RIPK3 expression and / or activity is a correlate of TNFR1 Complex Ila activity. In some embodiments, the upregulation of Caspase-3 expression and / or activity is a correlate of TNFR1 Complex Ila activity. In some embodiments, the upregulation of Caspase-8 expression and / or activity is a correlate of TNFR1 Complex Ila activity. In some embodiments, the upregulation of Caspase-10 expression and / or activity is a correlate of TNFR1 Complex Ila activity. In some embodiments, the upregulation of RIPK1 expression and / or activity is a correlate of TNFR1 Complex Ila activity. In some embodiments, the upregulation of RIPK3 expression and / or activity is a correlate of TNFR1 Complex Ila activity.

[0350] In some embodiments, the upregulation of Caspase-3, Caspase-8, Caspase-10, RIPK1 and / or RIPK3 expression and / or activity is a correlate of TNFR1 Complex lib activity. In some embodiments, the upregulation of Caspase-3 expression and / or activity is a correlate of TNFR1 Complex lib activity. In some embodiments, the upregulation of Caspase-8 expression and / or activity is a correlate of TNFR1 Complex lib activity. In some embodiments, the upregulation of Caspase-10 expression and / or activity is a correlate of TNFR1 Complex Ibl activity. In some embodiments, the upregulation of RIPK1 expression and / or activity is a correlate of TNFR1 Complex lib activity. In some embodiments, the upregulation of RIPK3 expression and / or activity is a correlate of TNFR1 Complex lib activity.

[0351] In some embodiments, the upregulation of RIPK1 expression and / or activity is a correlate of TNFR1 Complex lib activity.

[0352] In some embodiments, the upregulation of RIPK1 and / or RIPK3 expression and / or activity is a correlate of TNFR1 Complex lie activity. In some embodiments, the upregulation of RIPK1 expression and / or activity is a correlate of TNFR1 Complex lie activity. In some embodiments, the upregulation of RIPK3 expression and / or activity is a correlate of TNFR1 Complex lie activity.

[0353] Modulators

[0354] The present disclosure relates generally to the modulation of TNFR1 complexes, and therefore the modulation of TNFR1 -mediated signalling. Modulators of a component of a TNFR1 complex are provided.

[0355] Modulation of TNFR1 complexes / TNRF1 -mediated signalling by modulators of the present disclosure may occur by targeting RBPs, RNA, RBP-RNA interaction and / or RNA modification.

[0356] A ‘modulator’ is an agent that is capable of upregulating or downregulating the expression and / or activity of a given molecule. In some embodiments, the modulator is an agent that upregulates expression and / or activity of a given molecule. In some embodiments, the modulator is an agent that downregulates expression and / or activity of a given molecule. A modulator of a component of a TNFR1 complex may directly upregulate or downregulate the expression and / or activity of a component of a TNFR1 complex. As used herein, a modulator that ‘directly’ regulates the expression and / or activity of a given component of a TNFR1 complex, contacts / interacts with the given component or a nucleic acid encoding the given component. In some embodiments, the modulator is an agent that directly upregulates or downregulates the expression and / or activity of a component of a TNFR1 complex.

[0357] A modulator of a component of a TNFR1 complex may indirectly upregulate or downregulate the expression and / or activity of a component of a TNFR1 complex. As used herein, a modulator that ‘indirectly’ regulates the expression and / or activity of a given component of a TNFR1 complex does not contact / interact with the given component or a nucleic acid encoding the given component. Indirect regulation can be achieved e.g. via interaction with / regulation of an interacting partner of the given component, or interaction with / regulation of a regulator of the given component. In some embodiments, the modulator is an agent that indirectly upregulates or downregulates the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator is an agent that modulates the expression and / or activity of an interacting partner of a component of a TNFR1 complex. In some embodiments, the modulator is an agent that modulates the expression and / or activity of a regulator of a component of a TNFR1 complex.

[0358] A modulator of a component of a TNFR1 complex may target an RBP, an RNA, a protein -protein interaction, an RBP-RNA interaction, an RNA modification, and / or an RNA-RNA interaction. In some embodiments, a modulator of a TNFR1 complex is capable of one or more of the following: binding to an RBP, binding to an interaction partner of an RBP, binding to an RNA, binding to an interaction partner of an RNA, inhibiting / reducing binding of an RBP to an interaction partner, inhibiting / reducing binding of an RNA to an interaction partner, inhibiting / reducing binding of an RBP to a partner RNA, inhibiting / reducing RNA modification of an RNA (e.g. A-to-l editing, m6A, m6Am, m1A, m3C), increasing binding of an RBP to an interaction partner, increasing binding of an RNA to an interaction partner, increasing binding of an RBP to a partner RNA, and increasing RNA modification of an RNA (e.g. A-to-l editing, m6A, m6Am, m1A, m3C).

[0359] A modulator of a component of a TNFR1 complex is an agent that is capable of upregulating or downregulating the expression and / or activity of a component of a TNFR1 complex. A modulator of a component of TNFR1 Complex II is an agent that is capable of upregulating or downregulating the expression and / or activity of a component of TNFR1 Complex II.

[0360] In some embodiments, the modulator of a component of a TNFR1 complex is capable of upregulating or downregulating the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator of a component of a TNFR1 complex is capable of upregulating the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator of a component of a TNFR1 complex is capable of downregulating the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator of a component of a TNFR1 complex upregulates or downregulates the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator of a component of a TNFR1 complex upregulates the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator of a component of a TNFR1 complex downregulates the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the TNFR1 complex is TNFR1 Complex I, TNFR1 Complex II, TNFR1 Complex Ila, TNFR1 Complex lib, or TNFR1 Complex lie.

[0361] In some embodiments, the modulator of a component of TNFR1 Complex II is capable of upregulating or downregulating the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the modulator of a component of TNFR1 Complex II is capable of upregulating the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the modulator of a component of a TNFR1 complex is capable of downregulating the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the modulator of a component of TNFR1 Complex II upregulates or downregulates the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the modulator of a component of TNFR1 Complex II upregulates the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the modulator of a component of TNFR1 Complex II downregulates the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, TNFR1 Complex II is TNFR1 Complex Ila, TNFR1 Complex lib, or TNFRI Complex lie.

[0362] In some embodiments, the component of a TNFR1 complex is an RBP and / or an RNA. In some embodiments, the component of a TNFR1 Complex I is an RBP and / or an RNA. In some embodiments, the component of TNFR1 Complex II is an RBP and / or an RNA. In some embodiments, the component of TNFR1 Complex Ila is an RBP and / or an RNA. In some embodiments, the component of TNFR1 Complex is lib an RBP and / or an RNA. In some embodiments, the component of TNFR1 Complex lie is an RBP and / or an RNA.

[0363] In some embodiments, the component of a TNFR1 complex is an RBP. In some embodiments, the component of a TNFR1 Complex I is an RBP. In some embodiments, the component of TNFR1 Complex II is an RBP. In some embodiments, the component of TNFR1 Complex Ila is an RBP. In some embodiments, the component of TNFR1 Complex is lib an RBP. In some embodiments, the component of TNFR1 Complex lie is an RBP.

[0364] In some embodiments, the component of a TNFR1 complex is an RNA. In some embodiments, the component of a TNFR1 Complex I is an RNA. In some embodiments, the component of TNFR1 Complex II is an RNA. In some embodiments, the component of TNFR1 Complex Ila is an RNA. In some embodiments, the component of TNFR1 Complex is lib an RNA. In some embodiments, the component of TNFR1 Complex lie is an RNA. In some embodiments, the RBP is FTO or XPO5. In some embodiments, the RBP is FTO. In some embodiments, the RBP is XPO5.

[0365] In some embodiments, the modulator is capable of upregulating or downregulating the expression and / or activity of FTO and / or XPO5. In some embodiments, the modulator is capable of upregulating or downregulating the expression and / or activity of FTO. In some embodiments, the modulator is capable of upregulating or downregulating the expression and / or activity of XPO5.

[0366] In some embodiments, the RNA is FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the RNA is FATALR1 . In some embodiments, the RNA is RAD51 B. In some embodiments, the RNA is AFF3. In some embodiments, the RNA is RUPTR7.

[0367] In some embodiments, the RNA component of a TNFR1 complex is FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the RNA component of a TNFR1 complex is FATALR1 . In some embodiments, the RNA component of a TNFR1 complex is RAD51 B. In some embodiments, the RNA is AFF3. In some embodiments, the RNA is RUPTR7.

[0368] In some embodiments, the modulator is capable of upregulating and / or downregulating the expression or activity of FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the modulator is capable of upregulating or downregulating the expression and / or activity of FATALR1 . In some embodiments, the modulator is capable of upregulating or down regulating the expression and / or activity of RAD51 B. In some embodiments, the modulator is capable of upregulating and / or downregulating the expression or activity of AFF3. In some embodiments, the modulator is capable of upregulating and / or down regulating the expression or activity of RUPTR7.

[0369] Herein, “downregulation’’ may also be referred to as “antagonism”, “inhibition”, “reduction”, “repression”, and / or “prevention”. Therefore, a modulator which downregulates the expression and / or activity of a target may alternatively be described as a modulator which antagonises, inhibits, reduces, represses, and / or prevents the expression and / or activity of a target.

[0370] Herein, “upregulation” may also be referred to as “agonism", “promotion”, “increase”, “enhancement”, and / or “potentiation”. Therefore, a modulator which downregulates the expression and / or activity of a target may alternatively be described as a modulator which agonises, promotes, increases, enhances, and / or potentiates the expression and / or activity of a target.

[0371] In some embodiments, the modulator is an inhibitor. In some embodiments, the modulator is an inhibitor of the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the modulator is an inhibitor of the expression and / or activity of a component of TNFR1 Complex II.

[0372] In some embodiments, the modulator is selected from the group consisting of: a small molecule, an inhibitory nucleic acid, and nucleic acid encoding a site-specific nuclease (SSN) system. In some embodiments, the modulator is selected from the group consisting of: a small molecule that binds to the component of a TNFR1 complex, an inhibitory nucleic acid targeting the component of a TNFR1 complex, and nucleic acid encoding an SSN system targeting a nucleic acid encoding a TNFR1 complex.

[0373] In some embodiments, the modulator is a small molecule.

[0374] As used herein, a ‘small molecule’ refers to a low molecular weight (< 1000 Daltons, typically between -300-700 Daltons) organic compound. Small molecule inhibitors of a component of a TNFR1 complex may be identified by screening libraries of such small molecules for the ability to inhibit a component of a TNFR1 complex.

[0375] In some embodiments, the small molecule inhibits an activity of a target molecule. In some embodiments, the small molecule inhibits an activity of a TNFR1 complex. In some embodiments, the small molecule inhibits an activity of a component of a TNFR1 complex. In some embodiments, the small molecule inhibits an activity of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the small molecule inhibits an activity of an RBP component of a TNFR1 complex. In some embodiments, the small molecule inhibits an activity of an RNA component of a TNFR1 complex.

[0376] In some embodiments, the small molecule binds to and inhibits an activity of a target molecule. In some embodiments, the small molecule binds to and inhibits an activity of a component of a TNFR1 complex. In some embodiments, the small molecule binds to and inhibits an activity of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the small molecule binds to and inhibits an activity of an RBP component of a TNFR1 complex. In some embodiments, the small molecule binds to and inhibits an activity of an RNA component of a TNFR1 complex.

[0377] In some embodiments, the small molecule increases an activity of a target molecule. In some embodiments, the small molecule increases an activity of a TNFR1 complex. In some embodiments, the small molecule increases an activity of a component of a TNFR1 complex. In some embodiments, the small molecule increases an activity of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the small molecule increases an activity of an RBP component of a TNFR1 complex. In some embodiments, the small molecule increases an activity of an RNA component of a TNFR1 complex.

[0378] In some embodiments, the small molecule binds to and increases an activity of a target molecule. In some embodiments, the small molecule binds to and increases an activity of a component of a TNFR1 complex. In some embodiments, the small molecule binds to and increases an activity of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the small molecule binds to and increases an activity of an RBP component of a TNFR1 complex. In some embodiments, the small molecule binds to and increases an activity of an RNA component of a TNFR1 complex.

[0379] In some embodiments, the modulator is an inhibitory nucleic acid. Inhibitory nucleic acids according to the present disclosure may comprise or consist of DNA and / or RNA. Inhibitory nucleic acids may be single-stranded (e.g., in the case of antisense oligonucleotides (e.g., gapmers)). Inhibitory nucleic acids may be double-stranded or may comprise double-stranded region(s) (e.g., in the case of siRNA, shRNA, etc.). Inhibitory nucleic acids may comprise both double-stranded and single-stranded regions (e.g., in the case of shRNA and pre-miRNA molecules, which are doublestranded in the stem region of the hairpin structure, and single-stranded in the loop region of the hairpin structure).

[0380] In some embodiments, the inhibitory nucleic acid promotes degradation of an RNA target molecule or RNA encoding a target molecule. In some embodiments, the inhibitory nucleic acid reduces stability of an RNA target molecule or RNA encoding a target molecule. In some embodiments, the inhibitory nucleic acid disrupts splicing of an RNA target molecule or RNA encoding a target molecule. In some embodiments, the inhibitory nucleic acid inhibits translation of RNA encoding a target molecule. In some embodiments, the inhibitory nucleic acid inhibits transcription of an RNA target molecule.

[0381] In some embodiments, an inhibitory nucleic acid according to the present disclosure may be, comprise or encode an antisense polynucleotide. An ‘antisense polynucleotide’ refers to a polyribonucleotide or polydeoxyribonucleotide that is complementary to at least a portion of a target nucleotide sequence (e.g., of RNA encoding the polypeptide whose expression is to be inhibited). Antisense polynucleotides according to the present disclosure are preferably single-stranded nucleic acids and bind via complementary Watson-Crick base-pairing to a target nucleotide sequence. Complementary base-pairing may involve hydrogen bonding between complementary base pairs. Antisense polynucleotides may be provided as single-stranded molecules, as for example in the case of antisense oligonucleotides, or may be comprised in double-stranded molecular species, as for example in the case of siRNA, shRNA and pre-miRNA molecules.

[0382] In some embodiments, the antisense polynucleotide reduces / prevents transcription of nucleic acid comprising its target nucleotide sequence. In some embodiments, the antisense polynucleotide reduces / prevents association of factors required for normal transcription (e.g., enhancers, RNA polymerase) of nucleic acid comprising its target nucleotide sequence. In some embodiments, the antisense polynucleotide increases / potentiates degradation of nucleic acid comprising its target nucleotide sequence, e.g., through RNA interference. In some embodiments, the antisense polynucleotide reduces / prevents translation of nucleic acid comprising its target nucleotide sequence, e.g., through RNA interference or antisense degradation via RNase H activity.

[0383] RNA interference is described e.g., in Agrawal et a / ., Microbiol. Mol. Bio. Rev. (2003) 67(4): 657-685 and Hu et al., Sig. Transduc. Tar. Ther. (2020) 5(101 ), both of which are hereby incorporated by reference in their entirety. Briefly, double-stranded RNA molecules are recognised by the argonaute component of the RNA-induced silencing complex (RISC). The double-stranded RNAs are separated into single strands and integrated into an active RISC, by the RISC-Loading Complex (RLC). The RISC-integrated strands bind to their target RNA through complementary base pairing, and depending on the identity of the RISC- integrated RNA and degree of complementarity to the target RNA, the RISC then either cleaves the target RNA resulting in its degradation, or otherwise blocks access of ribosomes thereby preventing its translation. RNAi based therapeutics have been approved for a number of indications (see e.g., Kim, Chonnam Med J. (2020) 56(2): 87-93).

[0384] In some embodiments, an inhibitory nucleic acid according to the present disclosure is an siRNA, dsiRNA, miRNA, shRNA, pri-miRNA, pre-miRNA, saRNA or snoRNA or antisense oligonucleotide (e.g., a gapmer), comprising an antisense polynucleotide as described herein, or a nucleic acid encoding such a molecule.

[0385] In some embodiments, an inhibitory nucleic acid targeting a component of a TNFR1 complex is an inhibitory nucleic acid which is capable of downregulating the expression and / or activity of a component of a TNFR1 complex. In some embodiments, an inhibitory nucleic acid targeting a component of a TNFR1 complex is an inhibitory nucleic acid which is capable of downregulating the expression of a component of a TNFR1 complex. In some embodiments, an inhibitory nucleic acid targeting a component of a TNFR1 complex is an inhibitory nucleic acid which is capable of downregulating the activity of a component of a TNFR1 complex.

[0386] In some embodiments, an inhibitory nucleic acid targeting the component of TNFR1 Complex II is an inhibitory nucleic acid which is capable of downregulating the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, an inhibitory nucleic acid targeting the component of TNFR1 Complex II is an inhibitory nucleic acid which is capable of downregulating the expression of a component of TNFR1 Complex II. In some embodiments, an inhibitory nucleic acid targeting the component of TNFR1 Complex II is an inhibitory nucleic acid which is capable of downregulating the activity of a component of TNFR1 Complex II.

[0387] Exemplary inhibitory nucleic acid systems, which are capable of downregulating the activity of a component of TNFR1 Complex II are utilised in the examples of the present disclosure. For example, FTO and XPO5 expression and activity was downregulated using shRNA systems in Example 4. As a further example, RUPTR7 expression was downregulated using shRNA in Example 9.

[0388] In some embodiments, the inhibitory nucleic acid system (e.g. shRNA) comprises a nucleotide sequence of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:26 and / or SEQ ID NO:27, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification.

[0389] In some embodiments, the inhibitory nucleic acid system comprises a nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification. In some embodiments, shRNA comprises a nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification.

[0390] In some embodiments, the inhibitory nucleic acid system comprises a nucleotide sequence of SEQ ID NO:19 or SEQ ID NQ:20, or a variant thereof comprising a single nucleotide substitution. In some embodiments, shRNA comprises a nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising a single nucleotide substitution.

[0391] In some embodiments, the inhibitory nucleic acid system comprises or consists of a nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20. In some embodiments, shRNA comprises or consists of a nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20.

[0392] In some embodiments, the inhibitory nucleic acid system comprises a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification. In some embodiments, shRNA comprises a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification.

[0393] In some embodiments, the inhibitory nucleic acid system comprises a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising a single nucleotide substitution. In some embodiments, shRNA comprises a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising a single nucleotide substitution.

[0394] In some embodiments, the inhibitory nucleic acid system comprises or consists of a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27. In some embodiments, shRNA comprises or consists of a nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27.

[0395] In some embodiments, the modulator is a site-specific nuclease (SSN) system.

[0396] In some embodiments, the SSN system is a CRISPR system, a zinc-finger nuclease (ZFN) system, transcription activator-like effector nuclease (TALEN) system. In some embodiments, the CRISPR system is a CRISPR / Cas9, CRISPR / Cas13, CRISPR / Cpf1 , CRISPR / C2c1 , CRISPR / C2c2 and / or CRISPR / C2c3 system.

[0397] SSN systems may be employed to modulate the expression, stability, and / or activity of a target molecule. Gene editing using SSNs is reviewed e.g., in Eid and Mahfouz, Exp Mol Med. (2016) 48(10): e265, which is hereby incorporated by reference in its entirety. Enzymes capable of creating site-specific double strand breaks (DSBs) can be engineered to introduce DSBs to target nucleic acid sequence(s) of interest. DSBs may be repaired by either error-prone non-homologous end-joining (NHEJ), in which the two ends of the break are rejoined, often with insertion or deletion of nucleotides. Alternatively, DSBs may be repaired by homology-directed repair (HDR), in which a DNA template with ends homologous to the break site is supplied and introduced at the site of the DSB. SSNs capable of being engineered to generate target nucleic acid sequence-specific DSBs include zinc-finger nucleases (ZFNs), transcription activatorlike effector nucleases (TALENs), and clustered regularly interspaced palindromic repeats / CRISPR- associated-9 (CRISPR / Cas9) systems.

[0398] ZFN systems are reviewed e.g., in Umov et al., Nat Rev Genet. (2010) 11 (9):636-46, which is hereby incorporated by reference in its entirety. ZFNs comprise a programmable Zinc Finger DNA-binding domain and a DNA-cleaving domain (e.g., a Fokl endonuclease domain). The DNA-binding domain may be identified by screening a Zinc Finger array capable of binding to the target nucleic acid sequence. TALEN systems are reviewed e.g., in Mahfouz et al., Plant Biotechnol J. (2014) 12(8) :1006-14, which is hereby incorporated by reference in its entirety. TALEs comprise repeat domains consisting of repeats of 33-39 amino acids, which are identical except for two residues at positions 12 and 13 of each repeat which are repeat variable di-residues (RVDs). Each RVD determines binding of the repeat to a nucleotide in the target DNA sequence according to the following relationship: ‘HD’ binds to C, Nl’ binds to A, ‘NG’ binds to T and ‘NN’ or ‘NK’ binds to G (Moscou and Bogdanove, Science (2009) 326(5959):1501 .). CRISPR / Cas9 and related systems e.g., CRISPR / Cpf1 , CRISPR / C2c1 , CRISPR / C2c2 and CRISPR / C2c3 are reviewed e.g., in Nakade et al., Bioengineered (2017) 8(3):265-273, which is hereby incorporated by reference in its entirety. These systems comprise an endonuclease (e.g., Cas9, Cpf1 etc.) and the single-guide RNA (sgRNA) molecule. The sgRNA can be engineered to target endonuclease activity to nucleic acid sequences of interest.

[0399] In some embodiments, a CRISPR system comprises a guide RNA (gRNA or sgRNA) and a CRISPR- associated endonuclease (Gas protein). The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Gas-binding and a user-defined ~20 nucleotide spacer that defines the genomic target to be modified. Thus, one can change the genomic target of the Cas protein by simply changing the target sequence present in the gRNA.

[0400] In some embodiments, the CRISPR / Cas system is capable of RNA degradation, RNA stabilization, transcriptional activation, and / or transcriptional inactivation. In some embodiments, the downregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas-mediated RNA degradation and / or transcriptional inactivation. In some embodiments, the upregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas-mediated RNA stabilisation and / or transcriptional activation.

[0401] CRISPR / Cas9 is a SSN system which involves two essential components: a guide RNA to match a desired target gene, and Cas9 (CRISPR-associated protein 9) — an endonuclease which causes a double-stranded DNA break, allowing modifications to the genome. In some embodiments, the CRISPR / Cas9 system is capable of transcriptional inactivation. In some embodiments, the CRISPR / Cas9 system is capable of transcriptional activation. In some embodiments, the downregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas9-mediated transcriptional activation.

[0402] CRISPR / Cas13 is another SSN system, with similarities to CRISPR / Cas9. CRISPR / Cas13 systems comprise the programmable single-effector RNA-guided ribonuclease Cas13. In contrast with the DNA- targeting activity of Cas9, Cas13 is a single effector for RNA-guided RNA-interfering activity. In some embodiments, the CRISPR / Cas13 system is capable of RNA degradation or RNA stabilisation. In some embodiments, the downregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas13-mediated RNA degradation. In some embodiments, the SSN system is capable of downregulating the expression and / or activity of a component of a TNFR1 complex. In some embodiments, the SSN system is capable of downregulating the expression of a component of a TNFR1 complex. In some embodiments, the SSN system is capable of downregulating the activity of a component of a TNFR1 complex.

[0403] In some embodiments, the SSN system is capable of downregulating the expression and / or activity of a component of TNFR1 Complex II. In some embodiments, the SSN system is capable of downregulating the expression of a component of TNFR1 Complex II. In some embodiments, the SSN system is capable of downregulating the activity of a component of TNFR1 Complex II.

[0404] Exemplary SSN systems, which are capable of downregulating the activity of a component of TNFR1 Complex II are utilised in the examples of the present disclosure. For example, FTO and XPO5 expression and activity was downregulated using CRISPR / Cas9 systems in Example 2.

[0405] In some embodiments, the SSN system comprises DNA comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification. In some embodiments, CRISPR / Cas9 system comprises a gRNA spacer comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof comprising one or more nucleotide substitution, insertion, deletion, or other modification.

[0406] In some embodiments, the SSN system comprises DNA comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof comprising a single nucleotide substitution. In some embodiments, CRISPR / Cas9 system comprises a gRNA spacer comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof comprising a single nucleotide substitution.

[0407] In some embodiments, the SSN system comprises or consists of DNA comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18. In some embodiments, the CRISPR / Cas9 system comprises or consists of a gRNA spacer comprising a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18.

[0408] In some embodiments, the modulator is an agonist. In some embodiments, the modulator is an agonist of the expression and / or activity of the component of a TNFR1 complex. In some embodiments, the modulator is an agonist of the expression and / or activity of an RBP component of a TNFR1 complex. In some embodiments, the modulator is an agonist of the expression and / or activity of an RNA component of a TNFR1 complex. In some embodiments, the RBP is FTO or XPO5. In some embodiments, the RNA is FATALR1 , RAD51 B, AFF3, or RUPTR7.

[0409] In some embodiments, the modulator is an agonist of the expression and / or activity of the component of TNFR1 Complex II. In some embodiments, the modulator is an agonist of the expression and / or activity of an RBP component of TNFR1 Complex II. In some embodiments, the modulator is an agonist of the expression and / or activity of an RNA component of TNFR1 Complex II. In some embodiments, the RBP is FTO or XPO5. In some embodiments, the RNA is FATALR1 , RAD51 B, AFF3, or RUPTR7.

[0410] In some embodiments, the agonist mediates overexpression of a target molecule. In some embodiments, the agonist mediates overexpression of a component of a TNFR1 complex.

[0411] In some embodiments, the agonist mediates overexpression of an RNA. In some embodiments, the agonist mediates overexpression of FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the agonist mediates overexpression of an RNA which encodes an RBP. In some embodiments, the agonist mediates overexpression of an RNA which encodes FTO or XPO5.

[0412] In some embodiments, the agonist mediates transcriptional activation of a target molecule. In some embodiments, the agonist mediates transcriptional activation of an RNA. In some embodiments, the agonist mediates transcriptional activation of FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the agonist mediates transcriptional activation of an RNA which encodes an RBP. In some embodiments, the agonist mediates transcriptional activation of an RNA which encodes FTO or XPO5.

[0413] In some embodiments, the agonist mediates transcriptional stabilisation of a target molecule. In some embodiments, the agonist mediates transcriptional stabilisation of an RNA. In some embodiments, the agonist mediates transcriptional stabilisation of FATALR1 , RAD51 B, AFF3, or RUPTR7. In some embodiments, the agonist mediates transcriptional stabilisation of an RNA which encodes an RBP. In some embodiments, the agonist mediates transcriptional stabilisation of an RNA which encodes FTO or XPO5.

[0414] In some embodiments, the modulator consists or comprises nucleic acid encoding an RBP or an RNA component of a TNFR1 complex. In some embodiments, the modulator consists or comprises nucleic acid encoding a fragment of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the modulator consists or comprises nucleic acid encoding a functional fragment of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the modulator which upregulates an activity and / or the expression an RBP or an RNA component of a TNFR1 complex consists or comprises nucleic acid encoding an RBP or an RNA component of a TNFR1 complex.

[0415] In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:1 . In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:2. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:3. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:4. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:5. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:6. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:7. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:8. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:10. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:f 1 . In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:21 . In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:22. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:23. In some embodiments, the modulator consists or comprises nucleic acid encoding SEQ ID NO:25.

[0416] In some embodiments, the modulator consists or comprises nucleic acid encoding a fragment of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NQ:10, SEQ ID NO:11 , SEQ ID NO:21 , SEQ ID NO:22, SEQ ID NO:23, and / or SEQ ID NO:25.

[0417] In some embodiments, the modulator consists or comprises nucleic acid according to SEQ ID NQ:10, SEQ ID NO:1 1 , SEQ ID NO:21 , SEQ ID NO:22, SEQ ID NO:23, and / or SEQ ID NO:25.

[0418] In some embodiments, the nucleic acid may be, or may be comprised in, a vector, e.g., an expression vector. The nucleotide sequence of the nucleic acid may be contained in a vector, e.g., an expression vector. A “vector" as used herein is a nucleic acid molecule used as a vehicle to transfer exogenous nucleic acid into a cell. The vector may be a vector for expression of the nucleic acid in the cell. Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a peptide or polypeptide from a vector according to the present disclosure.

[0419] In some embodiments, the CRISPR / Cas9 system is capable of transcriptional activation. In some embodiments, the upregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas9-mediated transcriptional activation.

[0420] In some embodiments, the CRISPR / Cas13 system is capable of RNA stabilisation. In some embodiments, the upregulation of the expression and / or activity of a component of a TNFR1 Complex comprises CRISPR / Cas13-mediated RNA stabilisation.

[0421] In some embodiments, the target molecule is an RBP component of a TNFR1 complex. In some embodiments, the target molecule is FTO or XPO5. In some embodiments, the target molecule is an RNA component of a TNFR1 complex. In some embodiments, the target molecule is FATALR1 , RAD51 B, AFF3, or RUPTR7.

[0422] The modulator according to the present disclosure is preferably provided for introduction into a cell. In some embodiments, the modulator is provided as a nucleic acid and / or vector. In some embodiments, the inhibitory nucleic acid, the nucleic acid encoding a site-specific nuclease (SSN) system, and / or the nucleic acid encoding an RBP or an RNA component of a TNFR1 Complex are provided as a nucleic acid and / or vector. The nucleic acid and / or vector according to the present disclosure is preferably provided for introduction into a cell. Suitable vectors include plasmids, binary vectors, DNA vectors, mRNA vectors, viral vectors (e.g., gammaretroviral vectors (e.g., murine Leukemia virus (MLV)-derived vectors), lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia virus vectors and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g., yeast artificial chromosomes), e.g., as described in Maus et al., Annu Rev Immunol (2014) 32:189-225 or Morgan and Boyerinas (Biomedicines 2016. 4, 9) which are both hereby incorporated by reference in its entirety.

[0423] In some embodiments, the vector may be a eukaryotic vector, e.g., a vector comprising the elements necessary for expression of protein from the vector in a eukaryotic cell. In some embodiments, the vector may be a mammalian vector, e.g., comprising a cytomegalovirus (CMV) or SV40 promoter to drive protein expression. In some embodiments, the viral vector may be a lentiviral, retroviral, adenoviral, or Herpes Simplex Virus vector.

[0424] In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ to which it is desired to deliver the nucleic acid, e.g., a cell type / tissue / organ affected by the disease to be treated / prevented in accordance with the present disclosure (i.e., cells / tissue / an organ in which the symptoms of the disease manifest). In some embodiments, a vector is selected based on tropism for a macrophage or a precursor thereof (e.g., a monocyte, a macrophage / DC progenitor cell or a myeloid progenitor cell).

[0425] In some embodiments the nucleic acid and / or vector comprises one or more sequences for controlling expression of the nucleic acid. Accordingly, in some embodiments the nucleic acid / vector comprises a control element for inducible expression of the nucleic acid.

[0426] In some embodiments, the nucleic acid is a vector suitable for delivering a nucleic acid encoding an RBP or an RNA component of a TNFR1 complex as a gene therapy. In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0427] Adeno-associated virus vectors and their use in gene therapy is reviewed e.g., in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378 and Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272, both of which are hereby incorporated by reference in their entirety. In some embodiments, a vector may be an adeno-associated virus vector described in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378. In some embodiments, a vector may be an adeno-associated virus vector described in Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272.

[0428] In some embodiments, the vector is a self-complementary adeno-associated virus (scAAV) vector. Self- complementary adeno-associated virus vectors are described e.g., in McCarty, Mol Ther. (2008) 16(10):1648-56, which is hereby incorporated by reference in its entirety. Conventional AAV have a single-stranded DNA genome and depend on the DNA replication machinery of a transduced cell to synthesise the complementary strand, delaying transgene expression. By contrast, scAAV contain complementary sequences that spontaneously anneal upon infection, eliminating the requirement for DNA synthesis in the transduced host cell. Compared to classical, single-stranded AAV vectors, scAAV vectors have been shown to provide for accelerated onset of transgene expression, and an increased level of transgene expression.

[0429] In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV2, AAV2I8, AAV5, AAV6, AAV8, AAV9, AAV9.45, AAV10 or AAVrh74. In some embodiments, the vector is an AAV9 vector.

[0430] In some embodiments, a vector may be a cardiotropic adeno-associated viral vector. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV8, AAV9, AAV9.45.

[0431] In some embodiments, a vector may be a skeletal muscle tropic adeno-associated viral vector. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV6, AAV7, AAV8, AAV9, AAV9.45.

[0432] In some embodiments a vector comprises modification to increase binding to and / or transduction of a cell-type of interest (i.e., as compared to the level of binding / transduction by the unmodified vector). In some embodiments modification is to a capsid protein.

[0433] In some embodiments a vector comprises a capsid protein comprising a cell-targeting peptide. In some embodiments the cell-targeting peptide is a cell-targeting peptide described in Buning and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248-265, which is hereby incorporated by reference in its entirety.

[0434] In some embodiments a vector comprises a capsid protein comprising substitution to one or more tyrosine residues, e.g., one or more surface-exposed tyrosine residues. In some embodiments, one or more tyrosine residues of the capsid protein are substituted with phenylalanine. In some embodiments a vector comprises a capsid protein in which one or more tyrosine residues are substituted with another amino acid as described in lida et al., Biomed Res Int. (2013) 2013: 974819, which is hereby incorporated by reference in its entirety.

[0435] In some embodiments, a vector may be an adeno-associated virus vector described in Buning and Srivastava, supra. In some embodiments, a vector may be an adeno-associated virus vector described in lida et al., supra.

[0436] In some embodiments, a composition comprises a modulator according to the disclosure encapsulated in, or immobilised on, a nanoparticle, liposome, nanogel or nanolipogel.

[0437] Nanoparticles are reviewed e.g., in Mitchell et al., Nature Reviews Drug Discovery (2021 ) 20: 101 -124, which is hereby incorporated by reference in its entirety. In some embodiments, a nanoparticle is a polymeric nanoparticle (e.g., a polymersome, dendrimer, polymer micelle, nanogel or nanosphere), an inorganic nanoparticle (e.g., a silica nanoparticle, quantum dot, iron oxide nanoparticle or gold nanoparticle), or a lipid-based nanoparticle (e.g., a liposome, lipid nanoparticle or emulsion).

[0438] Nanolipogels are described e.g., in Cao et al., Nanoscale Adv. (2020) 2: 1040-1045, which is hereby incorporated by reference in its entirety. In some embodiments, a nanolipogel is a nano-sized core-shell system with a gelled core and a lipid bilayer.

[0439] In some embodiments a modulator described herein is (covalently or non-covalently) associated with a cell-penetrating peptide e.g., a cell-penetrating peptide described hereinabove), a cationic polymer, a cationic lipid or a viral carrier. In some embodiments a modulator described herein is associated with a peptide / polypeptide (e.g., antibody, peptide aptamer, ligand for a cell surface molecule / fragment thereof) or a nucleic acid (e.g., nucleic acid aptamer) capable of binding to a target cell of interest (or an antigen thereof.

[0440] Modulators may be identified through any suitable method known in the art. For example, a library of potential modulators could be screened for the ability to modulate a component of a TNFR1 complex. Alternatively, or in addition, rational design may be employed to generate modulators of a component of a TNFR1 complex.

[0441] Putative modulators may be screened using a number of assays to determine an ability to modulate a component of a TNFR1 complex. The ability of a putative modulator to upregulate or downregulate the expression or an activity of a component of a TNFR1 complex may be determined through any method known in the art, for example through the use of an assay used in the Examples of the present disclosure, or through another assay disclosed herein.

[0442] A library of putative modulators can be screened for the ability to modulate a component of a TNFR1 complex. For example, a library of small molecules could be screened for the ability to modulate a component of a TNFR1 complex.

[0443] Small molecules, SSN systems, and inhibitory nucleic acids can be designed to modulate a component of a TNFR1 complex, and such design methodologies are well known to the skilled person.

[0444] Components of SSN systems can be designed and engineered to target a predetermined nucleotide sequence. For example, gDNA, guide RNA (gRNA), DNA-binding domains, and other targeting sequences can be designed and engineered for SSN systems, using known methods in the art. In some embodiments, gDNA or gRNA sequences are designed and engineered for a CRISPR system to modulate a component of a TNFR1 complex. In some embodiments, gRNA sequences are designed and engineered for CRISPR / Cas9, to modulate a component of a TNFR1 complex. In some embodiments, gRNA sequences are designed and engineered for CRISPR / Cas13, to modulate a component of a TNFR1 complex. In some embodiments, DNA-binding domains are designed and engineered for SSN systems, to modulate a component of a TNFR1 complex. In some embodiments, DNA-binding domains are designed and engineered for a ZFN system, to modulate a component of a TNFR1 complex. In some embodiments, DNA-binding domains are designed and engineered for a TALEN system, to modulate a component of a TNFR1 complex. Methods of designing and engineering SSN systems are described by Hiranniramol et al. (Bioinformatics, Volume 36, Issue 9, May 2020, Pages 2684-2689), Wessels et al. (Nature Biotechnology. 38, 722-727. 2020), Granados-Riveron and Aquino-Jarquin (Cancer Res (2018) 78 (15): 4107-41 13), Heigwer et al. (Nucleic Acids Research, 41 (20), 2013, e190), and Carroll et al. (Nature Protocols. 1 , 1329-1341 .2006), each of which are hereby incorporated by reference in their entirety.

[0445] Additionally, inhibitory nucleic acids can be designed to modulate a component of a TNFR1 complex, and such design methodologies are well known to the skilled person. The skilled person is readily able in view of the present disclosure to select suitable inhibitory nucleic acids for reducing the activity and / or expression of a component of a TNFR1 complex. Methods of designing inhibitory nucleic acids are discussed in Moore et al. (Methods Mol Biol. 2010; 629: 141 -158), Fakhr et al. (Cancer Gene Therapy 23, 73-82. 2016), Mickiewicz et al. (Acta Biochim Pol. 2016 ;63(1 ):71 -77), and Aartsma-Rus et al. (Mol Ther. 2009; 17(3): 548-553), each of which are hereby incorporated by reference in their entirety.

[0446] In embodiments wherein it is desirable to inhibit the activity and / or expression of an RBP component of a TNFR1 complex, an inhibitory nucleic acid may comprise or encode antisense nucleic acid having a target nucleotide sequence which is a nucleotide sequence encoding an RBP component of a TNFR1 complex (e.g., a nucleotide sequence of RNA encoded by a gene encoding FTO, or a nucleotide sequence of RNA encoding XPO5). In some embodiments, the target nucleotide sequence comprises one or more nucleotides of an exon of RNA encoding FTO (e.g., is a nucleotide sequence of an exon of RNA encoding FTO). In some embodiments, the target nucleotide sequence comprises one or more nucleotides of an exon of RNA encoding XPO5 (e.g., is a nucleotide sequence of an exon of RNA encoding XPO5).

[0447] In embodiments wherein it is desirable to inhibit the activity and / or expression of an RNA component of a TNFR1 complex, an inhibitory nucleic acid may comprise or encode antisense nucleic acid having a target nucleotide sequence which is a nucleotide sequence of an RNA component of a TNFR1 complex. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of an RNA component of a TNFR1 complex determined from Table 1 . In some embodiments, the target nucleotide sequence comprises one or more nucleotides of FATALR1 . In some embodiments, the target nucleotide sequence comprises one or more nucleotides of RAD51 B. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of AFF3. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of RUPTR7.

[0448] Methods of upregulating the activity and / or expression of a gene, RNA, and / or protein are well known by the skilled person. Methods of generating modulators for the upregulation of the activity and / or expression of a gene, RNA, and / or protein are also well known by the skilled person. In some embodiments, the overexpression construct consists or comprises nucleic acid encoding an RBP or an RNA component of a TNFR1 complex. In some embodiments, the overexpression construct consists or comprises nucleic acid encoding a fragment of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the overexpression construct consists or comprises nucleic acid encoding a functional fragment of an RBP or an RNA component of a TNFR1 complex. In some embodiments, the modulator which upregulates an activity and / or the expression an RBP or an RNA component of a TNFR1 complex consists or comprises nucleic acid encoding an RBP or an RNA component of a TNFR1 complex. In some embodiments, the nucleic acid may be, or may be comprised in, a vector, e.g., an expression vector. The nucleotide sequence of the nucleic acid may be contained in a vector, e.g., an expression vector. A “vector" as used herein is a nucleic acid molecule used as a vehicle to transfer exogenous nucleic acid into a cell. The vector may be a vector for expression of the nucleic acid in the cell. Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a peptide or polypeptide from a vector according to the present disclosure. The design of modulators for the upregulation of the activity and / or expression of a gene, RNA, and / or protein, e.g., constructs for gene therapy, is well understood by the skilled person.

[0449] Functional properties of the modulators

[0450] The modulators described herein may be characterised by reference to certain functional properties. In some embodiments, the antigen-binding molecule described herein may possess one or more of the following properties: inhibits the expression and / or activity of an RBP component of a TNFR1 complex; inhibits the expression and / or activity an RNA component of a TNFR1 complex; inhibits cell death; inhibits caspase expression and / or activity; inhibits receptor-interacting serine / threonine-protein kinase expression and / or activity; upregulates the expression and / or activity of an RBP component of a TNFR1 complex; upregulates the expression and / or activity an RNA component of a TNFRf complex; upregulates cell death; upregulates caspase expression and / or activity; upregulates receptor-interacting serine / threonine-protein kinase expression and / or activity;

[0451] It will be appreciated that a given modulator may display more than one of the properties recited in the preceding paragraph. A given modulator may be evaluated for the properties recited in the preceding paragraph using suitable assays. For example, the assays may be e.g., in vitro assays, optionally cellbased assays or cell-free assays. In some embodiments, the assays may be e.g., in vivo assays, i.e., performed in non-human animals. In some embodiments, the assays may be e.g., ex vivo assays, i.e., performed using cells / tissue / an organ obtained from a subject.

[0452] Where assays are cell-based assays, they may comprise treating cells with a given modulator in order to determine whether the modulator displays one or more of the recited properties. Assays may employ species labelled with detectable entities in order to facilitate their detection. Assays may comprise evaluating the recited properties following treatment of cells separately with a range of quantities / concentrations of a given modulator (e.g., a dilution series).

[0453] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of an RBP component of a TNFR1 complex. In some embodiments, the modulator inhibits the expression of an RBP component of a TNFR1 complex. In some embodiments, the modulator upregulates the activity of an RBP component of a TNFR1 complex. The level of expression of an RBP component of a TNFR1 complex may be determined through any method known in the art.

[0454] In some embodiments, the expression of an RBP component of a TNFR1 complex is gene expression and / or protein expression. In some embodiments, the expression of an RBP component of a TNFR1 complex is gene expression. In some embodiments, the expression of an RBP component of a TNFR1 complex is protein expression.

[0455] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FTO. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of XPO5.

[0456] In some embodiments, the modulator inhibits or upregulates the expression of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the expression of FTO. In some embodiments, the modulator inhibits or upregulates the expression of XPO5.

[0457] In some embodiments, the modulator inhibits or upregulates the activity of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the activity of FTO. In some embodiments, the modulator inhibits or upregulates the activity of XPO5.

[0458] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of an RNA component of a TNFR1 complex. In some embodiments, the modulator inhibits or upregulates the expression of an RNA component of a TNFR1 complex. In some embodiments, the modulator inhibits or upregulates the activity of an RNA component of a TNFR1 complex. The level of expression of an RNA component of a TNFR1 complex may be determined through any method known in the art. The expression of an RNA component of a TNFR1 complex does not mean protein expression.

[0459] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FATALR1 . In some embodiments, the modulator inhibits or upregulates the expression and / or activity of RAD51 B. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of AFF3. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of RUPTR7.

[0460] In some embodiments, the modulator inhibits or upregulates the expression of FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the expression of FATALR1 . In some embodiments, the modulator inhibits or upregulates the expression of RAD51 B. In some embodiments, the modulator inhibits or upregulates the expression of AFF3. In some embodiments, the modulator inhibits or upregulates the expression of RUPTR7.

[0461] In some embodiments, the modulator inhibits or upregulates the activity of FATALR1 , RAD51 B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the activity of FATALR1 . In some embodiments, the modulator inhibits or upregulates the activity of RAD51 B. In some embodiments, the modulator inhibits or upregulates the activity of AFF3. In some embodiments, the modulator inhibits or upregulates the activity of RUPTR7.

[0462] The level of gene expression, i.e., the level of RNA transcribed from a gene, may be determined through any method known in the art, for example by quantitative real-time PCR (qRT-PCR), serial analysis of gene expression (SAGE), microarray analysis, and / or RNA sequencing (RNA-Seq). The level of RNA expression may be determined through any method known in the art, for example by microarray analysis, and / or RNA sequencing (RNA-Seq). The level of protein expression may be determined through any method known in the art, for example antibody-based methods, western blot, immunohistochemistry, immunocytochemistry, flow cytometry, and / or ELISA.

[0463] The level of an activity of a component of a TNFR1 complex may be determined through any method known in the art. In some embodiments, activity of a component of a TNFR1 complex comprises: binding to an interaction partner, binding to a component of a TNFR1 complex, activation of the NF-KB pathway, activation of the JNK pathway, activation of the p38 pathway, upregulation of cell death, upregulation of apoptosis, and / or upregulation of necroptosis.

[0464] In some embodiments, the activity of a component of TNFR1 Complex I comprises binding to an interaction partner, binding to a component of TNFRf Complex I, activation of the NF-KB pathway, activation of the JNK pathway, and / or activation of the p38 pathway. In some embodiments, the activity of a component of a TNFR1 Complex II comprises binding to an interaction partner, binding to a component of TNFRf Complex II, cell death upregulation, and / or apoptosis upregulation.

[0465] In some embodiments, the activity of a component of a TNFR1 Complex Ila comprises binding to an interaction partner, binding to a component of a TNFR1 Complex Ila, cell death upregulation, and / or apoptosis upregulation. In some embodiments, the activity of a component of a TNFR1 Complex lib comprises binding to an interaction partner, binding to a component of a TNFR1 Complex lib, cell death upregulation, and / or apoptosis upregulation. In some embodiments, the activity of a component of a TNFR1 Complex lie comprises binding to an interaction partner, binding to a component of a TNFR1 Complex lie, cell death upregulation, and / or necroptosis upregulation.

[0466] The level of NF-KB pathway activation can be determined through any method known in the art. In some embodiments, the level of NF-KB pathway activation is determined through the analysis of gene expression and / or protein expression analysis of genes / proteins activated by the NF-KB pathway. In some embodiments, the level of NF-KB pathway activation is determined by measuring p65 (RelA) protein that has been translocated to the nucleus. In some embodiments, the level of NF-KB pathway activation is determined through the use of the NF-KB Translocation Assay described in the Assay Guidance Manual (Markossian et al., Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004). In some embodiments, the level of NF-KB pathway activation is determined through the use of commercial NF-KB assays which are widely available.

[0467] The level of JNK pathway activation can be determined through any method known in the art. In some embodiments, activation of the JNK pathway is determined through the analysis of gene expression and / or protein expression analysis of genes / proteins activated by the JNK pathway. In some embodiments, an immune-complex kinase assay, AP1 reporter assay, or a commercial JNK pathway activation assay is used to determine the level of activation of the JNK pathway. In some embodiments, the assay employed by He et al. (Cell Death and Differentiation (1999) 6, 987-991 ) is used to determine the level of activation of the JNK pathway.

[0468] The level of p38 pathway activation can be determined through any method known in the art. In some embodiments, the activation of the p38 pathway is determined through the analysis of gene expression and / or protein expression analysis of genes / proteins activated by the p38 pathway. In some embodiments, the phosphorylation of p38 MAPK (p-p38) is detected by enzyme-linked immunosorbent assay (ELISA) to determine level of p38 pathway activation. In some embodiments, the assay employed by LaJevic et a / . (Immunology. 201 1 Feb; 132(2): 197-208).

[0469] The level of binding to an interaction partner, e.g., binding to a component of a TNFR1 complex, can be determined through any suitable method known in the art. In some embodiments, the level of binding to an interaction partner is determined through the use of a cell-based interaction assay. In some embodiments, the level of binding to an interaction partner is determined through the use of a cell-based protein interaction assay. Many types of cell-based interaction assays are known to the skilled person. In some embodiments, the level of binding to an interaction partner is determined through the use of a luminescence-based, fluorescence-based, and / or imaging-based assay. In some embodiments, the level of binding to an interaction partner is determined through the use of an assay described in in the Assay Guidance Manual (Markossian et al., Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004).

[0470] In some embodiments, the modulator inhibits or upregulates the level of cell death. The level of cell death may be determined through any method known in the art, such as the Annexin V / Propidium iodide (PI) assay used in the examples of the present disclosure. Cell death assays for drug discovery are reviewed by Kepp et al. (201 1. Nature Reviews Drug Discovery, volume 10, 221 -237), which is hereby incorporated by reference in its entirety. In some embodiments, the cell death is apoptosis. The level of apoptosis may be determined through any method known in the art, such as the Annexin V / Propidium iodide (PI) assay used in the examples of the present disclosure. Commercial apoptosis assays are available to the skilled person from many sources. In some embodiments, the cell death is necroptosis. The level of necroptosis may be determined through any method known in the art, such as assays reviewed by Degterev et al. (Methods Enzymol. 2014:545:1 -33). Commercial necroptosis assays are available to the skilled person.

[0471] In some embodiments, the modulator inhibits or upregulates the level of caspase expression and / or activity. In some embodiments, the caspase is Caspase-3, Caspase-8, and / or Caspase-10. The level of caspase expression may be determined through any method known in the art. In some embodiments, caspase expression is caspase gene expression and / or caspase protein expression. The level of gene expression and / or protein expression may be determined through any method known in the art. The level of caspase activity may be determined through any method known in the art, for example through the use of colorimetric assays, fluorometric Assays cellular imaging, and / or for the method used in Example 2 where processing of caspases (Caspase-8 and Caspase-3) was assayed. Caspase activity assays are reviewed by Niles et al. (Methods Mol Biol. 2008:414:137-50) which is hereby incorporated by reference in its entirety.

[0472] In some embodiments, the modulator inhibits or upregulates the level of Caspase-3 expression. In some embodiments, the modulator inhibits or upregulates the level of Caspase-3 activity. Caspase-3 initiates apoptosis or other cellular processes in mammalian cells. As a simple and convenient analysis method, the caspase-3 activity assay determines the activity of caspase by recognizing the sequence DEVD. This assay is based on spectrophotometric detection of chromophore p-nitroanilide (pNA) cleaved from the labelled substrate DEVD-pNA. Light emission of the pNA can be quantified using a spectrophotometer or a microtiter plate reader at 400-405 nm. Comparing the pNA absorbance of the treated samples and untreated controls allow determination of the fold increase in Caspase-3 activity.

[0473] In some embodiments, the modulator inhibits or upregulates the level of Caspase-8 expression. In some embodiments, the modulator inhibits or upregulates the level of Caspase-8 activity. Caspase-8 assays may be based on the recognition of the sequence lle-Glu-Thr-Asp (IETD). The assay is based on spectrophotometric detection of the pNA after it is cleaved from the labelled substrate lETD-pNA. The pNA light emission can be quantified using a spectrophotometer or a microtiter plate reader at OD 400 - 405 nm. Comparison of the absorbance of pNA from an apoptotic sample with an un-induced control allows determination of the fold increase in Caspase 8 activity.

[0474] In some embodiments, the modulator inhibits or upregulates the level of Caspase-10 expression. In some embodiments, the modulator inhibits or upregulates the level of Caspase-10 activity. Caspase-10 assays may be based on the recognition of the sequence AEVD. The assay is based on spectrophotometric detection of the chromophore p-NA after cleavage from the labelled substrate AEVD-p-NA. The p-NA light emission can be quantified using a spectrophotometer or a microtiter plate reader at 400- or 405 nm.

[0475] In some embodiments, the modulator inhibits or upregulates receptor-interacting serine / threonine-protein kinase expression and / or activity. The level of receptor-interacting serine / threonine-protein kinase expression and / or activity may be determined through any method known in the art, for example through the use of colorimetric assays, fluorometric Assays, and / or cellular imaging. In some embodiments, the serine / threonine-protein kinase is RIPK1 and / or RIPK3. In some embodiments, the modulator inhibits or upregulates the level of RIPK1 expression. In some embodiments, the modulator inhibits or upregulates the level of RIPK1 activity. In some embodiments, the modulator inhibits or upregulates the level of RIPK3 expression. In some embodiments, the modulator inhibits or upregulates the level of RIPK3 activity. In some embodiments, the level of RIPK1 and / or RIPK3 activity may be determined through any method known in the art, such as the method used in Example 2 where RIPK1 processing was assayed. Assays for the assessment of receptor-interacting serine / threonine-protein kinases are reviewed by Degterev et al. (Methods Enzymol. 2014:545:1 -33), which is hereby incorporated by reference in its entirety.

[0476] In some embodiments, in an appropriate expression assay, the modulator decreases the level of expression and / or activity of an RBP component of a TNFR1 complex to less than 1 times, e.g. <0.99 times, <0.95 times, <0.9 times, <0.85 times, <0.8 times, <0.75 times, <0.7 times, <0.65 times, <0.6 times, <0.55 times, <0.5 times, <0.45 times, <0.4 times, <0.35 times, <0.3 times, <0.25 times, <0.2 times, <0.15 times, <0.1 times, <0.05 times, or <0.01 times the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator inhibits more than 10%, e.g. >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >96%, >97%, >98% or >99% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule).

[0477] In some embodiments, in an appropriate expression assay, the modulator decreases the level of expression and / or activity of an RNA component of a TNFR1 complex to less than 1 times, e.g. <0.99 times, <0.95 times, <0.9 times, <0.85 times, <0.8 times, <0.75 times, <0.7 times, <0.65 times, <0.6 times, <0.55 times, <0.5 times, <0.45 times, <0.4 times, <0.35 times, <0.3 times, <0.25 times, <0.2 times, <0.15 times, <0.1 times, <0.05 times, or <0.01 times the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator inhibits more than 10%, e.g. >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >96%, >97%, >98% or >99% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule).

[0478] In some embodiments, in an appropriate expression assay, the modulator decreases the level of caspase and / or receptor-interacting serine / threonine-protein kinase expression / activity to less than 1 times, e.g. <0.99 times, <0.95 times, <0.9 times, <0.85 times, <0.8 times, <0.75 times, <0.7 times, <0.65 times, <0.6 times, <0.55 times, <0.5 times, <0.45 times, <0.4 times, <0.35 times, <0.3 times, <0.25 times, <0.2 times, <0.15 times, <0.1 times, <0.05 times, or <0.01 times the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator inhibits more than 10%, e.g. >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >96%, >97%, >98% or >99% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, in an appropriate assay, the modulator decreases the level of cell death (e.g., apoptosis, necroptosis, and / or pyroptosis) to less than 1 times, e.g. <0.99 times, <0.95 times, <0.9 times, <0.85 times, <0.8 times, <0.75 times, <0.7 times, <0.65 times, <0.6 times, <0.55 times, <0.5 times, <0.45 times, <0.4 times, <0.35 times, <0.3 times, <0.25 times, <0.2 times, <0.15 times, <0.1 times, <0.05 times, or <0.01 times the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator inhibits more than 10%, e.g. >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >96%, >97%, >98% or >99% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule).

[0479] In some embodiments, in an appropriate expression assay, the modulator increases the level of expression and / or activity of an RBP component of a TNFR1 complex to more than 1 times, e.g. >1.01 times, >1 .05 times, >1 .1 times, >1 .15 times, >1.2 times, >1.25 times, >1 .5 times, >1 .6 times, >1.7 times, >1 .8 times, >1 .9 times, >2 times, >3 times, >4 times, or >5 times, the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator upregulates the expression and / or activity to more than 110%, e.g. >120%, >125%, >130%, >135%, >140%, >145%, >150%, >155%, >160%, >165%, >170%, >175%, >180%, >185%, >190%, >195%, >200%, >250%, or >300% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a nonmodulating molecule).

[0480] In some embodiments, in an appropriate expression assay, the modulator increases the level of expression and / or activity of an RNA component of a TNFR1 complex to more than 1 times, e.g. >1 .01 times, >1 .05 times, >1 .1 times, >1 .15 times, >1.2 times, >1.25 times, >1 .5 times, >1 .6 times, >1.7 times, >1 .8 times, >1 .9 times, >2 times, >3 times, >4 times, or >5 times, the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator upregulates the expression and / or activity to more than 110%, e.g. >120%, >125%, >130%, >135%, >140%, >145%, >150%, >155%, >160%, >165%, >170%, >175%, >180%, >185%, >190%, >195%, >200%, >250%, or >300% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a nonmodulating molecule).

[0481] In some embodiments, in an appropriate expression assay, the modulator increases the level of caspase and / or receptor-interacting serine / threonine-protein kinase expression / activity to more than 1 times, e.g. >1.01 times, >1 .05 times, >1 .1 times, >1 .15 times, >1.2 times, >1.25 times, >1.5 times, >1.6 times, >1.7 times, >1 .8 times, >1 .9 times, >2 times, >3 times, >4 times, or >5 times, the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator upregulates the expression and / or activity to more than 1 10%, e.g. >120%, >125%, >130%, >135%, >140%, >145%, >150%, >155%, >160%, >165%, >170%, >175%, >180%, >185%, >190%, >195%, >200%, >250%, or >300% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a nonmodulating molecule).

[0482] In some embodiments, in an appropriate assay, the modulator increases the level of cell death (e.g., apoptosis, necroptosis, and / or pyroptosis) to more than 1 times, e.g. >1 .01 times, >1 .05 times, >1 .1 times, >1.15 times, >1 .2 times, >1 .25 times, >1.5 times, >1 .6 times, >1 .7 times, >1 .8 times, >1 .9 times, >2 times, >3 times, >4 times, or >5 times, the level observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule). In some embodiments, the modulator upregulates cell death to more than 1 10%, e.g. >120%, >125%, >130%, >135%, >140%, >145%, >150%, >155%, >160%, >165%, >170%, >175%, >180%, >185%, >190%, >195%, >200%, >250%, or >300% of the expression and / or activity observed in the absence of the modulator (or in the presence of an appropriate control molecule, e.g. a non-modulating molecule).

[0483] Treatment / prevention of diseases through modulation of a component of a TNFR1 complex

[0484] The modulators described herein, and compositions comprising the modulators described herein, find use in therapeutic and prophylactic methods.

[0485] The present disclosure provides a modulator of a component of a TNFR1 complex, for treating or preventing a disease described herein, wherein the component of the TNFR1 complex is an RBP or an RNA. Also provided is the use of a modulator of a component of a TNFR1 complex, in the manufacture of a medicament for treating or preventing a disease described herein, wherein the component of a TNFR1 complex is an RBP or an RNA. Also provided is a method of treating or preventing a disease described herein, wherein the method comprises administering to a subject a therapeutically- or prophylactically- effective amount of a modulator of a component of a TNFR1 complex, wherein the component of the TNFR1 complex is a RBP or an RNA.

[0486] The present disclosure also provides a modulator of a component of TNFR1 Complex I, for treating or preventing a disease described herein, wherein the component of TNFR1 Complex I is an RBP or an RNA. Also provided is the use of a modulator of a component of TNFR1 Complex I, in the manufacture of a medicament for treating or preventing a disease described herein, wherein the component of TNFR1 Complex I is an RBP or an RNA. Also provided is a method of treating or preventing a disease described herein, wherein the method comprises administering to a subject a therapeutically- or prophylactically- effective amount of a modulator of a component of TNFR1 Complex I, wherein the component of TNFR1 Complex I is a RBP or an RNA.

[0487] The present disclosure also provides a modulator of a component of TNFR1 Complex II, for treating or preventing a disease described herein, wherein the component of TNFR1 Complex II is an RBP or an RNA. Also provided is the use of a modulator of a component of TNFR1 Complex II, in the manufacture of a medicament for treating or preventing a disease described herein, wherein the component of TNFR1 Complex II is an RBP or an RNA. Also provided is a method of treating or preventing a disease described herein, wherein the method comprises administering to a subject a therapeutically- or prophylactically- effective amount of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is a RBP or an RNA.

[0488] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a disease in which TNFR1 Complex l-mediated signalling is pathologically-implicated. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a disease in which TNFR1 Complex Il-mediated signalling is pathologically-implicated. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a disease in which TNFR1 Complex Ila-mediated signalling is pathologically-implicated. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a disease in which TNFR1 Complex lib- mediated signalling is pathologically-implicated. In some embodiments, the disease in which TNFR1 - mediated signalling is pathologically-implicated is a disease in which TNFR1 Complex llc-mediated signalling is pathologically-implicated.

[0489] The methods may be effective to reduce the development or progression of a disease / condition, alleviation of the symptoms of a disease / condition or reduction in the pathology of a disease / condition. The methods may be effective to prevent progression of the disease / condition, e.g., to prevent worsening of, or to slow the rate of development of, the disease / condition. In some embodiments, the methods may lead to an improvement in the disease / condition, e.g., a reduction in the symptoms of the disease / condition or reduction in some other correlate of the severity / activity of the disease / condition. In some embodiments, the methods may prevent development of the disease / condition a later stage (e.g., a chronic stage or metastasis).

[0490] The experimental examples of the present disclosure describe the identification and functional characterization of modulators of components of TNFR1 complexes, said modulators having a unique profile of functional properties. In particular, the modulators of the present disclosure are demonstrated to be useful for the modulation of cell death and / or inflammation.

[0491] It will therefore be appreciated that the articles of the present disclosure find use in the treatment / prevention of essentially any disease / condition that would derive therapeutic or prophylactic benefit from the modulation of cell death and / or inflammation.

[0492] For example, the disease / condition may be a disease / condition in which an increased / upregulated / high level of cell death is positively associated with the onset, development, or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, an increased / upregulated / high level of cell death may be a risk factor for the onset, development, or progression of the disease / condition.

[0493] The disease / condition may be a disease / condition in which a decreased / downregulated / low level of cell death is positively associated with the onset, development, or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, a decreased / downregulated / low level of cell death may be a risk factor for the onset, development, or progression of the disease / condition.

[0494] The disease / condition may be a disease / condition in which an increased / upregulated / high level of inflammation is positively associated with the onset, development, or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, an increased / upregulated / high level of inflammation may be a risk factor for the onset, development, or progression of the disease / condition.

[0495] The disease / condition may be a disease / condition in which a decreased / downregulated / low level of inflammation is positively associated with the onset, development, or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, a decreased / downregulated / low level of inflammation may be a risk factor for the onset, development, or progression of the disease / condition.

[0496] It will also be appreciated that the articles of the present disclosure find use in the treatment / prevention of essentially any disease / condition that would derive therapeutic or prophylactic benefit from the modulation of TNFR1 -mediated signalling.

[0497] The disease / condition may be a disease / condition in which an increased / upregulated / high level of TNFR1 -mediated signalling is positively associated with the onset, development, or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, an increased / upregulated / high level of TNFR1 -mediated signalling may be a risk factor for the onset, development, or progression of the disease / condition.

[0498] As used herein, a disease / condition in which TNFR1 -mediated signalling is pathologically-implicated is a disease / condition in which an increased or decreased level of TNFR1 -mediated signalling is positively associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition, e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue). In some embodiments, a decreased / downregulated / low level of TNFR1 -mediated signalling may be a risk factor for the onset, development or progression of the disease / condition e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition, (e.g., in a healthy subject, or in equivalent non-diseased tissue).

[0499] A disease / condition in which TNFR1 -mediated signalling is pathologically-implicated may be characterised by one or more of the following:

[0500] An increased / upregulated / high level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue); An increased / upregulated / high level of TNFR1 Complex l-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue):

[0501] An increased / upregulated / high level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue):

[0502] An increased / upregulated / high level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0503] An increased / upregulated / high level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0504] An increased / upregulated / high level of caspase expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0505] An increased / upregulated / high level of receptor-interacting serine / threonine-protein kinase {e.g., RIPK1 or RIPK3) expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0506] An increased / upregulated / high level of PARP expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0507] An increased / upregulated / high level of inflammation e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0508] A decreased / downregulated / low level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0509] A decreased / downregulated / low level of TNFR1 Complex l-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0510] A decreased / downregulated / low level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0511] A decreased / downregulated / low level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0512] A decreased / downregulated / low level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0513] A decreased / downregulated / low level of caspase expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue); A decreased / downregulated / low level of receptor-interacting serine / threonine-protein kinase (e.g., RIPK1 or RIPK3) expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue):

[0514] A decreased / downregulated / low level of PARP expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0515] A decreased / downregulated / low level of inflammation e g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0516] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of cell death mediated by TNFR1 signalling. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of apoptosis mediated by TNFR1 signalling. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of apoptosis mediated by TNFR1 Complex II signalling.

[0517] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of caspase activity. In some embodiments, the disease in which TNFR1 - mediated signalling is pathologically-implicated is characterised by a dysregulation of Caspase-8, Caspase-3, Caspase-10, RIPK1 , RIPK3 and / or PARP activity.

[0518] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of RIPK1 activity. In some embodiments, the disease in which TNFR1 - mediated signalling is pathologically-implicated is characterised by a low level of RIPK1 expression and / or activity e.g., as compared to the expression / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue). In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a high level of RIPK1 expression and / or activity e.g., as compared to the expression / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue).

[0519] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a disease / condition in which RIPK1 activity is pathologically-implicated.

[0520] In some embodiments, the disease / condition is a disease / condition in RIPK1 is pathologically-implicated.

[0521] As used herein, a disease / condition in which RIPK1 is pathologically-implicated is a disease / condition in which an increased or decreased level of RIPK1 expression and / or activity is positively associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition, e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue). In some embodiments, a decreased / downregulated / low level of RIPK1 expression and / or activity may be a risk factor for the onset, development or progression of the disease / condition e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition, (e.g., in a healthy subject, or in equivalent non-diseased tissue).

[0522] A disease / condition in which RIPK1 is pathologically-implicated may be characterised by one or more of the following:

[0523] An increased / upregulated / high level of RIPK1 activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0524] An increased / upregulated / high level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0525] An increased / upregulated / high level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0526] An increased / upregulated / high level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0527] An increased / upregulated / high level of TNFR1 Complex l-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0528] An increased / upregulated / high level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0529] A decreased / downregulated / low level of RIPK1 activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0530] A decreased / downregulated / low level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0531] A decreased / downregulated / low level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0532] A decreased / downregulated / low level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0533] A decreased / downregulated / low level of TNFR1 Complex l-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0534] A decreased / downregulated / low level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue); In some embodiments, the disease / condition is a disease / condition in which apoptosis is pathologically- implicated.

[0535] As used herein, a disease / condition in which apoptosis is pathologically-implicated is a disease / condition in which an increased or decreased level of apoptosis is positively associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition, e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue). In some embodiments, a decreased / downregulated / low level of apoptosis may be a risk factor for the onset, development or progression of the disease / condition e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition, {e.g., in a healthy subject, or in equivalent non-diseased tissue).

[0536] A disease / condition in which apoptosis is pathologically-implicated may be characterised by one or more of the following:

[0537] An increased / upregulated / high level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0538] An increased / upregulated / high level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0539] An increased / upregulated / high level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0540] An increased / upregulated / high level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0541] An increased / upregulated / high level of caspase expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0542] An increased / upregulated / high level of TNF and / or interferon-gamma expression e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0543] A decreased / downregulated / low level of TNFR1 -mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0544] A decreased / downregulated / low level of TNFR1 Complex Il-mediated signalling e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0545] A decreased / downregulated / low level of cell death e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition {e.g., in a healthy subject, or in equivalent non-diseased tissue); A decreased / downregulated / low level of apoptosis e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0546] A decreased / downregulated / low level of caspase expression and / or activity e.g., as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue);

[0547] A decreased / downregulated / low level of TNF and / or interferon-gamma expression e.g., as compared to the level in the absence of the disease / condition (e.g., in a healthy subject, or in equivalent non-diseased tissue).

[0548] In some embodiments, the disease is a cancer, an inflammatory disorder and / or an infectious disease. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer, an inflammatory disorder and / or an infectious disease. In some embodiments, the disease in which apoptosis is pathologically-implicated is a cancer, an inflammatory disorder and / or an infectious disease.

[0549] In some embodiments, the disease is a cancer, an inflammatory disorder or an infectious disease. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer, an inflammatory disorder or an infectious disease. In some embodiments, the disease in which apoptosis is pathologically-implicated is a cancer, an inflammatory disorder or an infectious disease.

[0550] In some embodiments, the disease is a cancer. TNF activity and TNFR1 signalling has been implicated in the development of cancers (Wang and Lin. Acta Pharmacol Sin. 2008 Nov; 29(1 1 ): 1275-1288). TNFR1 - mediated signalling is dysregulated in various cancers and is associated with malignant progression. For example, TNFR1 -mediated signalling plays a pleiotropic role in the development of hepatocellular carcinoma (HCC), with TNFR1 Complex I supporting cancer cell survival while TNFR1 -Complex Il- mediated signalling leads to apoptosis (Zou et ai. Theranostics 2020; 10(23) :10434-10447). Therefore, an agonist of a component of TNFR1 Complex II has utility in the treatment of cancer. The examples of the present disclosure show that the upregulation of a component of TNFR1 Complex II has utility in the treatment of cancer.

[0551] A cancer in accordance with the present disclosure may be any unwanted cell proliferation (or any disease manifesting itself by unwanted cell proliferation), neoplasm or tumor. The cancer may be benign or malignant. The cancer may be primary or secondary (e.g., metastatic). A neoplasm or tumor may be any abnormal growth or proliferation of cells, and may be located in (and / or derived from cells of) any organ / tissue.

[0552] In some embodiments, a cancer is selected from: lung cancer (e.g., non-small cell lung cancer), skin cancer (e.g., melanoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), liver cancer (e.g'., hepatocellular carcinoma), glioblastoma, colorectal cancer, cervical cancer and breast cancer. A cancer may be of cells derived from e.g., the adrenal gland, adrenal medulla, anus, appendix, bladder, blood, bone, bone marrow, brain, breast, cecum, central nervous system (including or excluding the brain) cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelia), gallbladder, oesophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal glad, larynx, liver, lung, lymph, lymph node, lymphoblast, maxilla, mediastinum, mesentery, myometrium, nasopharynx, omentum, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissues, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsil, trachea, uterus, vulva, and / or white blood cells.

[0553] A cancer may be, or may comprise, one or more tumours. A cancer may be a glioma, medulloblastoma, meningioma, neurofibroma, ependymoma, Schwannoma, neurofibrosarcoma, astrocytoma and oligodendroglioma, melanoma, mesothelioma, myeloma, lymphoma, Non-Hodgkin’s lymphoma (NHL), Hodgkin's lymphoma, cutaneous T-cell lymphoma (CTCL), leukaemia, chronic myelogenous leukaemia (CML), acute myeloid leukaemia (AML), chronic lymphocytic leukaemia (CLL), myelodysplastic syndrome (MDS), hepatoma, epidermoid carcinoma, prostate cancer, breast cancer, lung cancer, non-small cell lung cancer (NSCLC), colon cancer, ovarian cancer, pancreatic cancer, thymic cancer, hematologic cancer or sarcoma.

[0554] In some embodiments, a cancer according to the present disclosure is selected from: a solid tumor, breast cancer, breast carcinoma, ductal carcinoma, gastric cancer, gastric carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, ovarian cancer, ovarian carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, cholangiocarcinoma, uterine cancer, uterine corpus endometrial carcinoma, thyroid cancer, thyroid carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma and thymoma.

[0555] In some embodiments, the cancer is characterised by a high level of expression of a component of a TNFR1 Complexes (e.g., compared to expression in a healthy subject, equivalent non-cancer tissue, or another cancer tissue). In some embodiments, the cancer is characterised by a high level of expression of an RNA component of a TNFR1 Complex (e.g., compared to activity in a healthy subject, equivalent non-cancer tissue, or another cancer tissue). In some embodiments, the cancer is characterised by a high level of expression of an RBP component of a TNFR1 Complex (e.g., compared to activity in a healthy subject, equivalent non-cancer tissue, or another cancer tissue). In some embodiments, the cancer is characterised by a high level of expression of FATALR1 , RAD51 B, AFF3, RUPTR7, FTC and / or XPO5. In some embodiments, the cancer is characterised by a high level of expression of FATALR1 . In some embodiments, the cancer is characterised by a high level of expression of RAD51 B. In some embodiments, the cancer is characterised by a high level of expression of AFF3. In some embodiments, the cancer is characterised by a high level of expression of RUPTR7. In some embodiments, the cancer is characterised by a high level of expression of FTO. In some embodiments, the cancer is characterised by a high level of expression of XPO5.

[0556] In some embodiments, the cancer is characterised by TNF and / or interferon-gamma expression. In some embodiments, the cancer is characterised by a high level of TNF and / or interferon-gamma expression (e.g., compared to expression in a healthy subject, equivalent non-cancer tissue, or another cancer tissue). In some embodiments, the cancer comprises a tumor microenvironment characterised by a high level of TNF and / or interferon-gamma expression (e.g., compared to expression in a healthy subject, equivalent non-cancer tissue, or tissue outside of the tumor microenvironment).

[0557] In some embodiments, the disease is an inflammatory disorder. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is an inflammatory disorder. In some embodiments, the disease in which cell death is pathologically-implicated is an inflammatory disorder.

[0558] Inflammatory disorders can develop and / or progress due to excessive cell death. As discussed previously, excessive cell death has been shown to arise through elevated levels of TNFR1 -mediated signalling. Elevated levels of TNFRt Complex Il-mediated signalling can lead to an upregulation of cell death promoting molecules, such as caspases. The examples of the present disclosure show that inhibition of RBP / RNA components of TNFR1 Complex II has utility in the treatment of inflammatory disorders.

[0559] In some embodiments an inflammatory disorder is any condition characterised by excess inflammation. The terms “inflammatory disorder” and “inflammatory disease” are used interchangeably herein.

[0560] In some embodiments, the inflammatory disorder is a chronic inflammatory disorder or a chronic inflammatory disease. In some embodiments, the inflammatory disorder is characterised by chronic inflammation.

[0561] Chronic inflammation represents a long-term reaction to an inflammatory stimulus characterized by continued recruitment of mononuclear leukocytes (monocytes and lymphocytes) accompanied by tissue injury due to the sustained inflammatory response. In contrast to acute inflammatory responses, chronic inflammation may last weeks, months, or even a lifetime in the case of some chronic inflammatory diseases. In addition to the accumulation of monocyte-derived macrophages and lymphocytes, chronic inflammation is characterized by changes associated with wound healing, such as proliferation of fibroblasts and small blood vessels. Many chronic inflammatory diseases begin as low-grade, protracted responses to pathogens or certain endogenous or exogenous substances. Chronic inflammation plays a key role in the development and progression of many chronic diseases including, but not limited to, autoimmune diseases, metabolic disorders such as atherosclerosis and obesity, fibrosis, and cancer. As used herein, inflammatory disorder is a disorder / disease / condition in which inflammation is a symptom of the disease / condition. Diseases and conditions characterised by inflammation include, but are not limited to:

[0562] Disorders / diseases / conditions affecting the respiratory system such as chronic obstructive pulmonary disease (COPD), emphysema, chronic bronchitis and asthma;

[0563] Disorders / diseases / conditions affecting the liver such as chronic liver disease, non-alcoholic fatty liver disease (NAFLD), steatohepatitis, non-alcoholic steatohepatitis (NASH), alcoholic liver disease (ALD), alcoholic fatty liver (AFL), alcoholic hepatitis, alcoholic steatohepatitis (ASH), primary biliary cirrhosis (PBC), schistosomal liver disease and hepatocellular carcinoma (HCC);

[0564] Disorders / diseases / conditions affecting the cardiovascular system such as hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), atrial fibrillation, Brugada syndrome, myocardial infarction, fibrotic vascular disease, hypertension, hypertensive heart disease, arrhythmogenic right ventricular cardiomyopathy (ARVC), atherosclerosis, arterial stiffness, chronic pulmonary hypertension, AIDS-associated pulmonary hypertension, heart failure with preserved ejection fraction (HFpEF), heart failure with reduced ejection fraction (HFrEF), varicose veins and cerebral infarcts;

[0565] Disorders / diseases / conditions affecting the kidneys such as nephritic syndrome, Alport's syndrome, HIV-associated nephropathy, polycystic kidney disease, Fabry's disease, diabetic nephropathy, chronic glomerulonephritis and nephritis associated with systemic lupus;

[0566] Disorders / diseases / conditions affecting the pancreas such as pancreatic fibrosis, cystic fibrosis and chronic pancreatitis;

[0567] Disorders / diseases / conditions affecting the nervous system such as gliosis, Alzheimer's disease and multiple sclerosis;

[0568] Disorders / diseases / conditions affecting the musculoskeletal system such as muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker’s muscular dystrophy (BMD) and fibrotic myopathy;

[0569] Disorders / diseases / conditions affecting the gastrointestinal system such as inflammatory bowel disease (IBD), Crohn’s disease, microscopic colitis and primary sclerosing cholangitis (PSC);

[0570] Disorders / diseases / conditions affecting the skin such as scleroderma, Dupuytren’s contracture and cutis keloid;

[0571] Disorders / diseases / conditions affecting the eye such as Grave's opthalmopathy, macular degeneration (e.g., wet age-related macular degeneration (AMD)), diabetic retinopathy, glaucoma, corneal fibrosis;

[0572] Disorders / diseases / conditions affecting the joints such as arthrofibrosis, arthritis and adhesive capsulitis;

[0573] Disorders / diseases / conditions affecting multiple tissues / organ systems, including progressive systemic sclerosis (PSS), chronic graft versus host disease (GVHD);

[0574] Cancers, such as hepatocellular carcinoma, gastric cancer, oesophageal cancer, head and neck cancer, colorectal cancer, pancreatic cancer, cervical cancer, and vulvar cancer.

[0575] In some embodiments, the inflammatory disorder is characterised by a high level of expression of a component of a TNFR1 Complexes (e.g> , compared to expression in a healthy subject, or equivalent nondiseased tissue). In some embodiments, the inflammatory disorder is characterised by a high level of expression of an RNA component of a TNFR1 Complex (e.g., compared to activity in a healthy subject, or equivalent non-diseased tissue). In some embodiments, the inflammatory disorder is characterised by a high level of expression of an RBP component of a TNFR1 Complex e.g., compared to activity in a healthy subject, or equivalent non-diseased tissue). In some embodiments, the inflammatory disorder is characterised by a high level of expression of FATALR1 , RAD51 B, AFF3, RUPTR7, FTO and / or XPO5. In some embodiments, the inflammatory disorder is characterised by a high level of expression of FATALR1 . In some embodiments, the inflammatory disorder is characterised by a high level of expression of RAD51 B. In some embodiments, the inflammatory disorder is characterised by a high level of expression of AFF3. In some embodiments, the inflammatory disorder is characterised by a high level of expression of RUPTR7. In some embodiments, the inflammatory disorder is characterised by a high level of expression of FTO. In some embodiments, the inflammatory disorder is characterised by a high level of expression of XPO5.

[0576] In some embodiments, the inflammatory disorder is selected from: a chronic inflammatory disease, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudlak syndrome, Graves’ disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-associated hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer’s disease, Parkinson's disease, Huntington’s disease, amyotrophic lateral sclerosis, hippocampal atrophy, pulmonary disease, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn’s disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Alport syndrome, adult-onset Still’s disease, Castleman’s disease, cytokine release syndrome, sepsis, septic shock, a retinal disorder, age-related macular degeneration, wet age- related macular degeneration, retinitis pigmentosa, Peutz-Jeghers syndrome, a skeletal muscle disorder, and muscular dystrophy.

[0577] In some embodiments, the disease is an infectious disease. In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is an infectious disease. In some embodiments, the disease in which cell death is pathologically-implicated is an infectious disease.

[0578] Infectious diseases can develop and / or progress due to excessive cell death. As discussed previously, excessive cell death has been shown to arise through elevated levels of TNFR1 -mediated signalling. Elevated levels of TNFR1 -mediated signalling can lead to an upregulation of cell death promoting molecules, such as caspases. As shown in Example 5 of the present disclosure, inhibitors of RNA / RBP components of TNFR1 Complexes has utility in the treatment of infectious diseases.

[0579] In some embodiments, the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0580] Examples of bacterial infections that may be treated include infection by Bacillus spp., Bordetella pertussis, Clostridium spp., Corynebacterium spp., Vibrio chloerae, Staphylococcus spp., Streptococcus spp. Escherichia, Klebsiella, Proteus, Yersinia, Erwina, Salmonella, Listeria sp, Helicobacter pylori, mycobacteria ie.g., Mycobacterium tuberculosis) and Pseudomonas aeruginosa. For example, the bacterial infection may be sepsis or tuberculosis. Examples of viral infections that may be treated include infection by influenza virus, measles virus, hepatitis B virus (HBV), hepatitis C virus (HCV), human immunodeficiency virus (HIV), lymphocytic choriomeningitis virus (LCMV), Herpes simplex virus and human papilloma virus (HPV). Examples of fungal infections that may be treated include infection by Alternaria sp, Aspergillus sp, Candida sp and Histoplasma sp. The fungal infection may be fungal sepsis or histoplasmosis. Examples of parasitic infections that may be treated include infection by Plasmodium species (e.g., Plasmodium falciparum, Plasmodium yoeli, Plasmodium ovale, Plasmodium vivax, or Plasmodium chabaudi chabaudi). The parasitic infection may be a disease such as malaria, leishmaniasis and toxoplasmosis. In some embodiments, the infectious disease is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (COVID).

[0581] In some embodiments, the infectious disease is characterised by a high level of expression of a component of a TNFR1 Complexes (e.g., compared to expression in a healthy subject, or equivalent nondiseased tissue). In some embodiments, the infectious disease is characterised by a high level of expression of an RNA component of a TNFR1 Complex (e.g., compared to activity in a healthy subject, or equivalent non-diseased tissue). In some embodiments, the infectious disease is characterised by a high level of expression of an RBP component of a TNFR1 Complex (e.g., compared to activity in a healthy subject, or equivalent non-diseased tissue). In some embodiments, the infectious disease is characterised by a high level of expression of FATALR1 , RAD51 B, AFF3, RUPTR7, FTO and / or XPO5. In some embodiments, the infectious disease is characterised by a high level of expression of FATALR1 . In some embodiments, the infectious disease is characterised by a high level of expression of RAD51 B. In some embodiments, the infectious disease is characterised by a high level of expression of AFF3. In some embodiments, the infectious disease is characterised by a high level of expression of RUPTR7. In some embodiments, the infectious disease is characterised by a high level of expression of FTO. In some embodiments, the infectious disease is characterised by a high level of expression of XPO5.

[0582] In some embodiments, the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a cytokine storm. In some embodiments, the cancer, inflammatory disorder and / or infectious disease is characterised by a cytokine storm.

[0583] Cytokine storm and cytokine release syndrome are life-threatening systemic inflammatory syndromes involving elevated levels of circulating cytokines and immune-cell hyperactivation that can be triggered by cell signalling pathways, including TNFR1 -mediated signalling.

[0584] A method of regulating TNFR1 -mediated signalling is provided, said method comprising the provision of a modulator according to the present disclosure, wherein the component of TNFR1 Complex II is an RBP or an RNA. In some embodiments, the method of regulating TNFR1 -mediated signalling is a method of inhibiting TNFR1 -mediated signalling. In some embodiments, the method of regulating TNFR1 -mediated signalling is a method of upregulating TNFR1 -mediated signalling. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method. A method of regulating cell death is provided, said method comprising the provision of a modulator according to the present disclosure, wherein the component of TNFR1 Complex II is an RBP or an RNA. In some embodiments, the method of regulating cell death is a method of inhibiting cell death. In some embodiments, the method of regulating cell death is a method of upregulating cell death. In some embodiments, the cell death is apoptosis. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method.

[0585] Kits

[0586] The present disclosure also provides kits of parts. A kit according to the present disclosure may comprise components for performing a method described herein, in whole or in part.

[0587] The kit may have at least one container having a predetermined quantity of one or more agents or compositions described herein. Agents / compositions may be provided in a predetermined quantity. Where the kit comprises multiple different agents / compositions, they may be provided in separate containers, or in the same container.

[0588] The kit may further comprise reagents, buffers and / or standards required for execution of a method according to the present disclosure.

[0589] Kits according to the present disclosure may include instructions for use, e.g., in the form of an instruction booklet or leaflet. The instructions may include a protocol for performing any one or more of the methods described herein. The kit may comprise instructions for evaluation of a disease to determine an appropriate agent for treatment.

[0590] Numbered statements

[0591] The following numbered paragraphs (paras) describe particular aspects and embodiments of the present disclosure:

[0592] 1 . A modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

[0593] 2. Use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, in the manufacture of a medicament for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

[0594] 3. A method of treating or preventing a disease in which signalling mediated by tumor necrosis factor receptor 1 (TNFR1 ) is pathologically-implicated, wherein the method comprises administering to a subject a therapeutically- or prophylactically-effective amount of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA. 4. The modulator for use according to para 1 , the use according to para 2, or the method of para 3, wherein the RBP component of TNFR1 Complex II comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NO:1 or SEQ ID NO:6.

[0595] 5. The modulator for use according to para 1 or para 4, the use according to para 2 or para 4, or the method according to para 3 or para 4, wherein the RNA component of TNFR1 Complex II is an RNA capable of associating with an RBP component of TNFR1 Complex II.

[0596] 6. The modulator for use according to any one of paras 1 , 4 or 5, the use according to any one of paras 2, 4 or 5, or the method according to any one of paras 3 to 5, wherein the RNA component of TNFR1 Complex II is a non-coding RNA.

[0597] 7. The modulator for use according to any one of paras 1 , or 4 to 6, the use according to any one of paras 2, or 4 to 6, or the method according to any one of paras 3 to 6, wherein the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of: the nucleotide sequence of an RNA transcribed from positions 145959299 to 145969262 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 147502825 to 147510900 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 111659317 to 11 1846428 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 86396528 to 86922184 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 165899418 to 166077274 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 68290286 to 68644674 of human chromosome 14, the nucleotide sequence of an RNA transcribed from positions 34254566 to 34379410 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 100418069 to 100745658 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 86522442 to 86669286 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 99261673 to 99434556 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 39917349 to 40178399 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 34603358 to 35104032 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 126719089 to 126784246 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 128596422 to 128841778 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 6461 1344 to 64672035 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 89445931 to 89526681 of human chromosome 16, the nucleotide sequence of an RNA transcribed from positions 1893151 to 2245677 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 134256502 to 134309412 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 106964857 to 107157063 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 188347397 to 188533178 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 140514285 to 140590155 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 61542606 to 61920401 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 65892334 to 66385973 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 110151629 to 110176276 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 18786971 1 to 1881 12441 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 64356475 to 64590847 of human chromosome 17, the nucleotide sequence of an RNA transcribed from positions 10195009 to 10245811 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 106330722 to 106659430 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 100558333 to 100680965 of human chromosome 11 , the nucleotide sequence of an RNA transcribed from positions 149041318 to 149386381 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 245999527 to 246670404 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 29677541 to 29904086 of human chromosome X, the nucleotide sequence of an RNA transcribed from positions 23250209 to 23521712 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 66975015 to 67215923 of human chromosome 14, the nucleotide sequence of an RNA transcribed from positions 7566739 to 7966915 of human chromosome 18, the nucleotide sequence of an RNA transcribed from positions 59826238 to 60230486 of human chromosome 20, the nucleotide sequence of an RNA transcribed from positions 104918024 to 105155677 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 143671031 to 147850490 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 40812253 to 41217827 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 19837625 to 19869554 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 189696844 to 189838594 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 148736110 to 148766960 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 11802659 to 1 1993721 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 102247784 to 102456356 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 171757455 to 171959434 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 188124039 to 188343878 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 153191855 to 153378429 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 184834202 to 184943833 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 119653285 to 119807106 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 1431 15825 to 143285504 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 99641779 to 99758184 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 17420660 to 17494454 of human chromosome X, the nucleotide sequence of an RNA transcribed from positions 85923977 to 86198925 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 44854771 to 45229571 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 79733899 to 79850706 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 75935953 to 76056352 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 144301054 to 144541576 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 36177613 to 36425639 of human chromosome 22, the nucleotide sequence of an RNA transcribed from positions 28012120 to 28209146 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 1607960 to 1892955 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 128246768 to 128469388 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 116854504 to 116968939 of human chromosome 11 , the nucleotide sequence of an RNA transcribed from positions 47127605 to 47233991 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 206667573 to 206757842 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 60596474 to 60768540 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 761 1 103 to 76432164 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 7971 1 11 to 8406585 of human chromosome 18, the nucleotide sequence of an RNA transcribed from positions 29060442 to 29545467 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 16371311 to 16437191 of human chromosome 21 , the nucleotide sequence of an RNA transcribed from positions 131409474 to 131440762 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 49962691 to 501 14102 of human chromosome 20, the nucleotide sequence of an RNA transcribed from positions 3340909 to 4167031 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 29650814 to 30051606 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 12008853 to 12151073 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 192554458 to 192635399 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 74451668 to 74710375 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 234040499 to 234383480 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 184020384 to 184088355 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 108103176 to 108335534 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 23435467 to 23494419 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 49962374 to 501 13788 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 16830300 to 17076624 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 15244245 to 15452572 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 37784676 to 381 18126 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 20323631 to 204571 17 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 65339155 to 65907397 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 108082406 to 108460035 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 70479923 to 70588817 of human chromosome 17, the nucleotide sequence of an RNA transcribed from positions 10095845 to 10319831 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 109150930 to 109276049 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 21376800 to 21554467 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 71471994 to 71633960 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 235423963 to 235491373 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 126475318 to 126692155 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 167710188 to 167813852 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 10560487 to 10657638 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 4801 1532 to 48132940 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 178063133 to 178395500 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 35684412 to 35824606 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 175001674 to 1751 14226 of human chromosome 2, and the nucleotide sequence of an RNA transcribed from positions 23608068 to 23868206 of human chromosome 2.

[0598] 8. The modulator for use according to any one of paras 1 , or 4 to 7, the use according to any one of paras 2, or 4 to 7 , or the method according to any one of paras 3 to 7, wherein the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a ribonucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:10 or SEQ ID NO:1 1 .

[0599] 9. The modulator for use according to any one of paras 1 , or 4 to 8, the use according to any one of paras 2, or 4 to 8, or the method according to any one of paras 3 to 8, wherein the modulator inhibits the expression and / or activity of the component of TNFR1 Complex II.

[0600] 10. The modulator for use according to any one of paras 1 , or 4 to 9, the use according to any one of paras 2, or 4 to 9, or the method according to any one of paras 3 to 9, wherein the modulator is selected from the group consisting of: a small molecule that binds to the component of TNFR1 Complex II , an inhibitory nucleic acid targeting the component of TNFR1 Complex II, and nucleic acid encoding a sitespecific nuclease (SSN) system targeting nucleic acid encoding the component of TNFR1 Complex II.

[0601] 11 . The modulator for use according to any one of paras 1 , or 4 to 8, the use according to any one of paras 2, or 4 to 8, or the method according to any one of paras 3 to 8, wherein the modulator upregulates the expression and / or activity of the component of TNFR1 Complex II.

[0602] 12. The modulator for use according to any one of paras 1 , 4 to 8 or 1 1 , the use according to any one of paras 2, or 4 to 8 or 1 1 , or the method according to any one of paras 3 to 8 or 1 1 , wherein the modulator comprises or consists of nucleic acid encoding an RBP or an RNA component of TNFR1 Complex II.

[0603] 13. The modulator for use according to any one of paras 1 , or 4 to 12, the use according to any one of paras 2, or 4 to 12, or the method according to any one of paras 3 to 12, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of Caspase-8, Caspase-3, Caspase-10, RIPK1 , RIPK3 and / or PARP activity.

[0604] 14. The modulator for use according to any one of paras 1 , or 4 to 13, the use according to any one of paras 2, or 4 to 13, or the method according to any one of paras 3 to 13, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of cell death. 15. The modulator for use according to any one of paras 1 , or 4 to 14, the use according to any one of paras 2, or 4 to 14, or the method according to any one of paras 3 to 14, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a cytokine storm.

[0605] 16. The modulator for use according to any one of paras 1 , 4 to 8, or 1 1 to 15, the use according to any one of paras 2, 4 to 8, or 11 to 15, or the method according to any one of paras 3 to 8, or 1 1 to 15, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer.

[0606] 17. The modulator for use according to any one of paras 1 , 4 to 10, or 13 to 15, the use according to any one of paras 2, 4 to 10, or 13 to 15, or the method according to any one of paras 3 to 4 to 10, or 13 to 15, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is an inflammatory disorder and / or an infectious disease.

[0607] 18. The modulator for use, the use, or the method according to para 16, wherein the cancer is selected from: a solid tumor, breast cancer, breast carcinoma, ductal carcinoma, gastric cancer, gastric carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, ovarian cancer, ovarian carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, cholangiocarcinoma, uterine cancer, uterine corpus endometrial carcinoma, thyroid cancer, thyroid carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma and thymoma..

[0608] 19. The modulator for use, the use, or the method according to para 17, wherein the inflammatory disorder is selected from: a chronic inflammatory disease, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, dermatitis, atopic dermatitis, psoriasis, Hermansky- Pudlak syndrome, Graves’ disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-associated hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer’s disease, Parkinson's disease, Huntington’s disease, amyotrophic lateral sclerosis, hippocampal atrophy, pulmonary disease, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn’s disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Alport syndrome, adult-onset Still’s disease, Castleman’s disease, cytokine release syndrome, sepsis, septic shock, a retinal disorder, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Peutz-Jeghers syndrome, a skeletal muscle disorder, and muscular dystrophy. 20. The modulator for use, the use, or the method according to para 17, wherein the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0609] 21 . A method of regulating cell death, wherein the method comprises the provision of a modulator of

[0610] 5 a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is an RBP or an RNA.

[0611] Sequence identity

[0612] As used herein, ‘sequence identity’ refers to the percent of nucleotides / amino acid residues in a subject

[0613] 10 sequence that are identical to nucleotides / amino acid residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum percent sequence identity between the sequences. Pairwise and multiple sequence alignment for the purposes of determining percent sequence identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software

[0614] 15 such as ClustalOmega (Soding, J. 2005, Bioinformatics 21 , 951 -960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772-780) software. When using such software, the default parameters, e.g., for gap penalty and extension penalty, are preferably used.

[0615] 20

[0616] Sequences

[0617] RNA sequences in the below table are provided with thymine (t) bases in place of uracil (u) bases, for compliance with WIPO Standard ST.26, wherein the symbol “t” is construed as thymine in DNA and uracil in RNA. NA motif 3 | UCGGCGGCCGCU

[0618] ***

[0619] The present disclosure includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.

[0620] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0621] Aspects and embodiments of the present disclosure will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.

[0622] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word ‘comprise,’ and variations such as ‘comprises’ and ‘comprising,’ will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0623] It must be noted that, as used in the specification and the appended claims, the singular forms ‘a’, ‘an’, and ‘the’ include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from ‘about’ one particular value, and / or to ‘about’ another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent ‘about’, it will be understood that the particular value forms another embodiment.

[0624] Where a nucleic acid sequence is disclosed or referred to herein, the reverse complement thereof is also expressly contemplated.

[0625] Methods described herein may preferably be performed in vitro. The term ‘in vitro’ is intended to encompass procedures performed with cells in culture whereas the term ‘in vivo' is intended to encompass procedures with / on intact multi-cellular organisms.

[0626] Values may be expressed herein as ‘about’ a particular value. Similarly, ranges may be expressed herein as from ‘about’ a particular value, and / or to ‘about’ another particular value. The term ‘about’ in relation to a numerical value is optional, and means for example + / - 10 %. By way of illustration, reference e.g., to ‘about 10 %’ is to be construed as 9 % to 11 %. In instances herein where ‘about’ is recited, the value it precedes is also specifically contemplated. By way of illustration, reference e.g., to ‘about 10 %’ also specifically contemplates 10 %.

[0627] Brief Description of the Figures

[0628] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures. Figure 1. RNA-binding proteins are novel components of TNFR complexes. (A) A graphical illustration of TNFR signaling and in vitro apoptosis model. (B) MDA-MB-231 cells were treated with Strepll-TNFa for 5 minutes. Immunoprecipitation for Complex I was performed with Strep beads. Identified Complex I components were detected by immunoblot. XPO5 was detected to be part of Complex I. (C) MDA-MB- 231 cells stably expressing Strepll-FADD were treated with birinapant and TNF (BT) for 2 hours. Complex II was purified using beads and eluted with Biotin. Eluents were injected into size exclusion column (Superose® 6 Increase 10 / 300) and the gel filtration plot is shown (upper panel). The peak fractions in the upper panel were collected for Western blot to probe for Complex II components. RBPs including XPO5 and FTO were detected in TNFR1 Complex II.

[0629] Figure 2. FTO and XPO5 are essential for TNFR-mediated cell death. (A-B) Quantitative summary of live cell percentage of both WT, FTO KO (A), XPO5 KO (B) cells treated with birinapant and TNF (BT) for the indicated time. (C-D) Both WT, FTO KO (C), and XPO5 KO (D) cells were treated with BT for the indicated time. Apoptosis markers were detected by immunoblot.

[0630] Figure 3. STAMP analysis identified RNA molecules assembled into Complex II. (A) A graphical presentation of the STAMP method used to identify RNA targets in Complex II. (B) Overlap analysis of the number of genes identified in cell lines expressing APOBEC1 -FTO and APOBEC1 -FADD in both UT and BT-treated conditions. (C) A heatmap showing top 50 hits according to the developed scoring system.

[0631] Figure 4. FATALR1 is a novel Complex II component. (A) FTO knockout cells reconstituted with either empty vector (EV) or Strepll-tagged FTO were treated with birinapant and TNF (BT) for 2 hours. 1% of cell lysate were kept as input, and the rest were subjected to Strepll beads overnight. RNA bound to FTO were isolated and reverse transcribed into cDNA. qPCR was completed and Cq values were used to calculate fold enrichment. (B) FADD knockout cells reconstituted with either empty vector (EV) or Strepll- tagged FADD were treated with BT for 2 hours. 1 % of cell lysate were kept as input, and the rest were subjected to Strepll beads overnight. RNA bound to FADD were isolated and reverse transcribed into cDNA. qPCR was completed and Cq values are used to calculate fold enrichment. (C) Cells stably overexpressing dCas13-eGFP, mCherry-FADD, and non-targeting gRNA (gNT) or the gRNA targeting FATALR1 (gRIAR) were treated without or with BT for 2 hours. Confocal images were taken to analyse the colocalization of FATALR1 and FADD in both conditions.

[0632] Figure 5. FATALR1 is responsible for TRADD recruitment to mediate TNFR-induced cell apoptosis. (A-B) Stable cell lines expressing control and FATALR1 shRNAs were generated in both SKOV3 (A) and MDA- MB-231 (B). Percentage of live cells was analysed by flow cytometry. Both Control and FATALR1 knockdown cells, with or without birinapant and TNF (BT) treatment, were stained with Annexin V and PI. Live cell percentage of the indicated condition are shown by bar graph. (C-D) Both Control and FATALR1 knockdown cells generated from SKOV3 (C) and MDA-MB-231 (D) were treated with BT for the indicated time. The lysates were used to detect apoptotic markers including p-RIPK1 , cleaved Caspase-8 / 3. (E) To assess Complex formation in both control and FATALR1 knockdown cells following BT treatment for 4 hours, we used anti-FADD antibody to pull down FADD. Well-known complex components were detected using immunoblotting in the anti-FADD immunoprecipitates.

[0633] Figure 6. Inhibiting FTO effectively reduces the production of inflammatory cytokines. WT and FTO KO cells were treated with birinapant and TNF (BT) for 4 hours. Total RNA was isolated for RNA-seq. Significantly downregulated inflammatory cytokines in FTO KO cells were labelled.

[0634] Figure 7. Inhibiting FATALR1 significantly reduces the expression of inflammatory cytokines. (A-D) WT and FATALR1 knockout cells were treated with or without birinapant and TNF (BT) for 6 hours. Total RNAs were isolated, and reverse transcribed into cDNA. Relative expression of TNFa (A), IL-6 (B), IL-8 (C), MCR1 (D) were measured by qPCR.

[0635] Figure 8. FATALR1 is upregulated in COVID patients and loss of FATALR1 protects monocytes from TNF / IFN which mimics cytokine storm in COVID patients. (A) Single cell analysis of the expression of FATALR1 in healthy, mild, and severe COVID patients. (B-C) The expression of FATALR1 (B), TNF and IFNG (C), in COVID patients compared to healthy groups in different cluster listed. (D-E) WT U937 cells, or Control and FATALR1 knockdown cells were treated without or with TNFcc / IFNy (IT) for 30 hours, and bar graphs show the live cell percentage of each treatment group.

[0636] Figure 9. Overexpression of FATALR1 confers increased sensitivity of cancer cells to chemotherapy treatment. A control RNA (Cnt), FATALR1 Fragment 1 (5' - SEQ ID NO:21 ), FATALR1 Fragment 2 (Mid - SEQ ID NO:22), and FATALR1 Fragment 3 (3' - SEQ ID NO:23) were transfected into FATALR1 knockout cells. All four conditions were treated with birinapant and TNF (BT) and subsequently subjected to flow cytometry analysis after staining with Annexin V. Bar graph shows the quantitative analysis of live cell percentage in each condition.

[0637] Figure 10. FTO regulates FATALR1 induction via m6A modifications. (A) WT and FTOKOMDA-MB-231 cells were treated with birinapant and TNF (BT) at the indicated time points (hrs). The relative expression levels of FATALR1 in WT (left-hand bar) and FTOKO(right-hand bar) MDA-MB-231 cells were analyzed by qPCR. The data is presented as mean ± SEM for n=3 experiments, p > 0.05 (n.s.), p < 0.05 (*), p < 0.01 ("), p < 0.001 (*“), statistics by two-tailed t test. (B) Two replicates (Rep 1 and Rep 2) of m6A sites (purple lines) and corresponding methylation levels (y axis) on FATALR1 were plotted after BT treatment. Chromosome 1 was presented and the genomic region coding for FATALR1 was indicated by a grey mark. Genomic locus of FATALR1 on chromosome 1 from human reference genome hg38 was labelled with a grey mark which was zoomed in and indicated in grey color with genomic coordinates. (C) WT and FATALR1 knockout (FATALR1K0) MDA-MB-231 cells were treated with BT at the indicated time points (hrs). The relative expression levels of FATALR1 in WT and FATALR1K0cells were analyzed by qPCR. The data is presented as mean ±SEM for n-3 experiments, statistics by two-tailed t test. (D) Quantification of the percentage of live cells in WT and FATALR1K0MDA-MB-231 cells treated with or without BT for 16 hrs. The data is presented as the mean ± SEM for n=3 experiments, p > 0.05 (n.s.), p < 0.05 (*), p < 0.01 (“), p < 0.001 (***), statistics by two-tailed t test. (E) WT and FATALR1K0MDA-MB-231 cells were treated with or without BT for 2 hrs. Total cell lysates and RIPK1 immunoprecipitates were probed for the indicated proteins.

[0638] Figure 11. FTO enhances RNA polymerase recruitment to FATALR1 promoter. (A-B) The levels of H3K27Ac marks (A) and association of RNA polymerase (B) on FATALR1 promoter were analyzed by chromatin immunoprecipitation assay (CHIP) and qPCR.

[0639] Figure 12. (A) Schematic illustration of Strepl I -tagged FTO constructs, including the wild type (WT), catalytically dead FTO mutants (Mut 1 / 2) with indicated residue mutations, and FTO truncated mutants (Mut 3 / 4). These targeted residues are critical for FTO’s demethylase activity. (B) FTOKOcells reconstituted with the indicated constructs were treated with or without BT for 2 hrs. Total cells lysates were probed for phosphorylated RIPK1 (p-RIPK1 ) and GAPDH.

[0640] Figure 13. RUPTR7 enhances RIPK1 phosphorylation. (A) qPCR quantification of the relative expression levels of RUPTR7 m RUPTR7 knockdown (s RUPTRT) cells compared to control (shCnt) cells. (B) Control (shCnt) and RUPTR7 knockdown (s RUPTR7) MDA-MB-231 cells were treated with BT at the indicated time points (hrs). The levels of clAP1 , phospho-RIPK1 (p-RIPK1 ), PARP, caspase-3 (C3), cleaved caspase-3 (CC3), and GAPDH were detected by immunoblotting.

[0641] Figure 14. Knockdown of FTO and FATALR1 provides protection against cell death. Graphs show the percentage of live control (shCnt), FTO knockdown (shFTO), and FATALR1 knockdown (shFATALRI -2) cells, before and after treatment with IT.

[0642] Figure 15. RNA immunoprecipitation (RIP) assay results show that FADD interacts with FATALR1 , RAD51 , ARHGAP24, and ABTB2.

[0643] Figure 16. Common RNA motifs in RNA molecules identified through STAMP assays. The 10 most common motifs found within the top 100 RNA hits from the FTO STAMP assay (Table 1 ) are shown in Figure 16A. The 10 most common motifs found within the top 100 RNA hits from the FADD STAMP assay (Table 2) are shown in Figure 16B.

[0644] Examples

[0645] Example 1 : RBPs are structural components of TNFR1 complexes

[0646] By treating cells with Twin-Strepll-tagged TNF, an RBP (XPO5) was identified as a component of TNFR1 Complex I, along with well-known components of TNFR1 Complex I such as RIPK1 , clAP1 , and TNFR1 (Fig. 1 B). In contrast, when cells ectopically expressed Strepll-tagged FADD and were treated with BT (100 nM birinapant and 10 ng / ml TNF), immunoprecipitation of Complex II using Strepll beads revealed the presence of FTO and XPO5 as novel RBP components of TNFR1 Complex II (Fig. 1 C).

[0647] Details of the experimental procedures are provided below.

[0648] Cell culture: MDA-MB-231 cells were cultured in DMEM media supplemented with 10% fetal bovine serum (FBS). Cells were passaged every 3 to 4 days using Trypsin (HyClone™). All cells were maintained in a humidified incubator at 37°C with 5% CO2.

[0649] TNFR1 Complex I pulldown:

[0650] MDA-MB-231 cells were treated with Twin-Strepll-tagged TNF or 5 minutes. Following the treatment, cells were quickly washed with ice-cold PBS and lysed using lysis buffer (20 mM Tris (pH 8.0), 137 mM NaCI, 1 mM EDTA, 1.5 mM MgCI2, 10% glycerol, 1 % Triton X-100) supplemented with PhosSTOP™ tablets (Roche) and complete™, EDTA-free Protease Inhibitor Cocktail (Roche), and biotin blocker (IBA). The cell lysates were cleared by centrifugation at 15000 rpm for 30 minutes and quantified using the Bradford protein assay (Bio-Rad). 1 mg of protein extracts were incubated with Strep-Tactin beads overnight at 4°C. The next day, the beads were washed six times with lysis buffer and resuspended with 2X NuPAGE™ LDS Sample Buffer. The eluents were proceeded with immunoblotting.

[0651] Size Exclusion Chromatography for Complex Ila:

[0652] MDA-MB-231 cells overexpressing Twin-Strepll-tagged FADD were treated with BT for 2 hours. To isolate total protein, cells were lysed using the same buffer and procedures as those used in the immunoprecipitation experiments. Biotin blocker was added to the soluble protein extracts and incubated with rotation at 4 °C for 30 minutes. The lysates were then incubated with Strep-Tactin beads overnight with rotation at 4 °C. The next day, the beads were washed with the lysis buffer for six times, and the elution was performed with Buffer BXT (IBA) for 2 hours with rotation at 4 °C. The eluents were collected and subjected to size exclusion chromatography using Superose™ 6 Increase on an AKTA machine.

[0653] Example 2: Targeting RBPs modulates TNFR1 -mediated cell death

[0654] Cell death, a downstream consequence of TNFR1 , can be blocked by FDA-approved anti-TNF drugs. To validate the inhibitory effects of targeting FTO or XPO5 on cell death, time course experiments were performed using wild type (WT), FTO knockout (KO), and XPO5 KO cells treated with BT. Flow cytometry analysis revealed that WT cells rapidly underwent cell death after BT treatment, whereas both FTO KO and XPO5 KO cells exhibited a significant delay in the induction of cell death as analysed by flow cytometry (Figs. 2A-B). Biochemically, in contrast to WT cells, cell death markers including the activation of RIPK1 , and processing of Caspase-8, Caspase-3, and PARP are markedly diminished in the absence of FTO or XPO5 (Figs. 2C-D). These findings strongly indicate that inhibiting FTO and XPO5, the newly discovered components of the TNFR1 complex, effectively reduces levels of cell death. Details of the experimental procedures are provided below.

[0655] Generation of knockout cell lines:

[0656] FTO KO and XPO5 KO knockout cell lines were generated using a CRISPR / Cas9 system. MDA-MB-231 and SKOV3 cell lines were co-transfected with Cas9 and gRNAs expression plasmids. Transfected cells were sorted into single clones using fluorescence markers, GFP and mCherry from Cas9 and gRNA expression vectors, respectively. Knockout clones were verified by targeted sequencing of genomic DNA and subsequent quantitative PCR (qPCR). gRNA sequences targeting each gene are listed below:

[0657] FTO (MDA-MB-231 ): AGCTTCGCGCTCTCGTTCCT (SEQ ID NO:15)

[0658] FTO (SKOV3): TCTGGTGGACAGGTCAGCGGTGG (SEO ID NO:16)

[0659] XPO5 (MDA-MB-231 ): GAAACGCGCTGTGCGAGCAGC (SEQ ID NO:17)

[0660] XPO5 (SKOV3): GGCTTCCAGCCGGTAGCGCT (SEQ ID NO:18)

[0661] Annexin V7 Propidium iodide (PI) apoptosis assay:

[0662] WT, FTO KO, and XPO5 KO cells were treated with BT. Samples were taken at different time points after BT treatment. Cells were washed once with 1XPBS and then trypsinized for 3 minutes. The trypsinized cells were then neutralized with media and collected in the same tube as the dead cells. The cells were harvested by spinning down at 4000 rpm, and the resulting cell pellet was washed with 1 XPBS and spun down again at the same speed. The cells were then stained with 5 pl Annexin V (BD Pharmingen™) in 1 X Annexin V binding buffer (0.01 M HEPES (pH 7.4), 0.14 M NaCI, 2.5 mM CaCI2 solution) for 15 minutes, followed by 1 pl Propidium Iodide Staining. The percentage of live cells was analysed by flow cytometry, which involved counting the number of double negative cells. Results are shown in Figure 2A-B.

[0663] Western blot:

[0664] Total protein was isolated using the NucleoSpin RNA / Protein kit following the manufacturer’s instructions. Protein concentrations were measured using a protein quantification assay kit (MACHEREY-NAGEL) and standardized to the same concentration across all samples. Protein extracts were separated on 4%-12% NuPAGE Bis-Tris gels in NuPAGE MOPS running buffer (Thermofisher) and transferred to PVDF membranes. The membranes were blocked with 5% nonfat milk in PBST for 1 hour, and then incubated overnight at 4°C with the specified primary antibodies. After incubation with primary antibodies, the membranes were washed three times with PBST for 10 minutes each, and then incubated with secondary antibodies for 1 hour at room temperature. The membranes were washed again with PBST (3 times, 10 minutes each) and developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermofisher). The samples were probed with anti-clAP1 (CST, #7065, 1 :1000), anti-phopho-RIPK1 (Ser166)(CST, # 44590, 1 :1000), anti-caspase-8 (Proteintech, 13423-1 -AP, 1 :1000), anti-cleaved caspase-8 (CST, #9748, 1 :1000); anti-caspase-3 (CST, #9662, 1 :1000), anti-cleaved caspase-3 (CST, #9662, 1 :1000), anti-PARP (CST, #9541 , 1 :1000), anti-FTO (abeam, ab92821 , 1 :1000), anti-HSP90 (BD bioscience, #610419, 1 :1000), Strep-Tactin® HRP conjugate (IBA, #2-1502-001 , 1 :1000), anti-RIP1 (CST, #3493S, 1 :1000), anti-RI P3 (CST, #13526S, 1 :1000), anti-FADD (Proteintech, 14906-1 -Ap, 1 :1000), anti-TNFR1 (Santa cruz, sc-8436, 1 :500), GAPDH (Santa cruz, sc-32233, 1 :500), anti-p65 (Sigma, #06418, 1 :1000), anti-TRADD (BD bioscience, 610573, 1 :1000), IKK (CST, #2678, 1 :1000), anti- MLKL (CST, #14993S, 1 :1000), anti-lkB (Santa cruz, sc-371 , 1 :500), anti-p-lkB (CST, #9246S, 1 :1000).

[0665] Example 3: RNA molecules are structural components of TNFR1 complexes

[0666] A Surveying Targets by APOBEC-Mediated Profiling (STAMP) assay was used to identify RNA molecules which interact with both FADD and FTO during BT-induced apoptosis. The STAMP assay is based on the use of an RNA editing enzyme, APOBEC1 , fused to either FTO or FADD. The binding of FTO or FADD to their respective RNA targets facilitates C- to-U conversion, mediated by the tethered APOBEC1 . Details of the experimental procedures are provided below. High throughput RNA sequencing was performed on samples prepared from cells overexpressing APOBEC1 -FADD or APOBEC1 -FTO to identify C-to-U edits and determine the interacting RNAs (Fig. 3A). Analysis revealed that under both UT- and BT-treated conditions, APOBEC1 -FTO edited a total of 815 and 1 1 18 genes, respectively, while AP0BEC1 -FADD edited 886 and 1470 genes, respectively.

[0667] It is noteworthy that among the edited genes, there were several overlaps between both the UT- and BT- treated conditions for APOBEC1 - FTO and APOBEC1 -FADD (Fig. 3B). Intriguingly, under UT conditions, 411 genes were identified as being edited by both APOBEC1 -FTO and APOBEC1 -FADD. Additionally, in the BT condition, 640 genes were edited by both APOBEC1 -FTO and APOBEC1 -FADD. This analysis led to the identification of RNAs associated with TNFR1 Complex-ll formation, which were ranked according to bioinformatic analyses as described below. The top 50 hits are shown in a heatmap in Figure 3C, and the top 100 hits are shown in Table 1 .

[0668] FATALR1 functions as a novel Complex II component. Pulldown both FTO (Fig. 4A) and FADD (Fig. 4B) enriched FATALR1 RNA, specifically in the BT-treated condition. Moreover, RNA-labelling using nuclease-dead CRISPR-Cas13 with guide RNA (gRNA) specifically for FATALR1 showed colocalization with FADD in foci in the cytoplasm after BT treatment (Fig. 4C). Together, these experiments identify FATALR1 as an RNA that interacts with Complex II components, including FADD and FTO.

[0669] STAMP assay:

[0670] The STAMP assay was performed using FTO and FADD knockout cells (FTO KO and FADD KO) which were generated according to the method described previously. FTO KO and FADD KO cells were transduced with APOBEC1 -FTO and APOBEC1 -FADD using lentiviral integration, respectively. A APOBEC1 plasmid was used as control. The expression of fusion protein was validated using immunoblot. The stable cell lines were treated with or without BT for 2 hours. Total RNA isolation was completed using Trizol, following standard manufacturer’s instructions. rRNA depletion and library preparation was performed according to standard procedures.

[0671] RNA-Seq analysis:

[0672] For RNA-seq libraries, raw sequencing reads were processed to remove adapters and low-quality reads using Trimmomatic v0.32 (Bolger et al., Bioinformatics. 2014. 30, 21 14-2120). The remaining reads were mapped to the human genome GRCh38 using hisat2 v2.1 .0 (Kim et al., Nat Biotechnol. 2019. 37, 907- 915) and reads mapping to features annotated in ensemble v84 were quantified by transcript using FeatureCounts subroutine of the subread v1 .6.2 (Liao et al., Bioinformatics. 2014. 30, 923-930) software. Finally, differential expression testing was performed in R (https: / / www.R-project.org / .) with the package edgeR (Robinson et al., Bioinformatics. 2010. 26, 139-140) by fitting to a linear model after count normalization. Results were plotted in R (https: / / www.R-project.org / ) using ggplot2 (https: / / ggplot2.tidyverse.org.) and ComplexHeatmap libraries (Gu et al., Bioinformatics. 2016. 32, 2847- 2849).

[0673] STAMP analysis: RNA STAMP libraries coming from untreated and treated experiments were processed using the SAILOR package as described previously (Brannan et al., Nat Methods. 2021 . 18, 507-519). In brief, sequencing reads were trimmed with Trimmomatic v0.32 (3) and mapped to the human genome (hg19) using STAR v2.7.10b (Dobin et al., Bioinformatics. 2013. 29, 15-21 ) with a clip index of 149 bp. Then, the SAILOR pipeline v1 .2 (located in a singularity container) was run per aligned file. Edits coming from different strands were merged per library using mergePeaks and annotated to the closest genomic features using annotatePeaks; both functions are part of the homer software v4.1 1 (Dobin et al., Bioinformatics. 2013. 29, 15-21 ). Finally, per annotated locus, the number and level of C>T edits were quantified and compared vs the control RNA library. To obtain a score per edited locus and per STAMP-RBP library, the mean level of edit per replicate in treated libraries were divided over the level on non-treated libraries and scaled by their edition level to rank the most edited locus. In the case that the level of editing was zero in the un-treated library, a pseudo-count of 0.1 was used to avoid division by zero and to counter the detection level limits of STAMP libraries. Finally, genomic visualizations were produced using the Gviz package.

[0674] Analysis of FA TALR1 :

[0675] FTO KO cells reconstituted with either empty vector (EV) or Strepll-tagged FTO were treated with BT for 2 hours. 1 % of cell lysate were kept as input, and the rest were subjected to Strepll beads overnight. RNA bound to FTO were isolated and reverse transcribed into cDNA. qPCR was completed and Cq values were used to calculate fold enrichment.

[0676] FADD KO cells reconstituted with either empty vector (EV) or Strepll-tagged FADD were treated with BT for 2 hours. 1 % of cell lysate were kept as input, and the rest were subjected to Strepll beads overnight. RNA bound to FADD were isolated and reverse transcribed into cDNA. qPCR was completed and Cq values are used to calculate fold enrichment.

[0677] Cells stably overexpressing dCas13-eGFP, mCherry-FADD, and non-targeting gRNA (gNT) or the gRNA targeting FATALR1 (gRIAR) were treated without or with BT for 2 hours. Confocal images were taken to analyse the colocalization of FATALR1 and FADD in both conditions.

[0678] Example 4: Targeting RNA modulates TNFR1 -mediated cell death

[0679] The interaction of FATALR1 with FTO and FADD following BT treatment suggests its functional role in TNFR1 -mediated apoptosis. Knockdown of FATALR1 using shRNAs protects cells against BT- induced apoptosis in both SKOV3 and MDA- MB-231 cells (Figs. 5A-B). These results are further corroborated by biochemical analysis showing decreased Caspase-3 and Caspase-8 processing in FATALR1 knockdown cells (Figs. 5C-D). In addition, Complex formation analysis shows that in the absence of FATALR1 , a defective Complex II lacking TRADD is formed (Fig. 5E). This observation suggests that FATALR1 plays a critical role in modulating cell death by facilitating the recruitment of TRADD and promoting the formation of Complex IL Details of the experimental procedures are provided below. shRNA-mediated knockdown experiments: shRNA sequences were designed using GPP Web Portal (https: / / portals.broadinstitute.org / gpp / public / ) and cloned into pLKO.1 - TRC vector following standard manufacturer’s instructions. The cloned constructs were validated by Sanger sequencing. Knockdown cell lines were generated using standard procedures using both SK0V3 and MDA- MB-231 host cells. The knockdown efficiency was evaluated using qPCR or immunoblot.

[0680] The following are shRNA sequences were used to generate shFATALR1 -1 , shFATALRI -2, and shFTO knockdown lines: shFATALRI -1 : TATGAAGAACAGAGCAAATTA (SEQ ID N0:19) shFATALRI -2: CCCGTTCGGTTGTTAACATAA (SEQ ID NO:20) shFTO: GCCTCAGTTTCCTCATCTGTA (SEQ ID NO: 28)

[0681] The shFATALRI -1 , shFATALRI -2, and sh FTO knockdown lines were also used in subsequent Examples.

[0682] Annexin 7 Propidium iodide (PI) apoptosis assay:

[0683] Performed on control (shCnt) and FATALR1 knockdown (shFATALRI ) cells. At 16 hours post BT treatment, the media containing dead cells was collected. The cells that remained attached to the wells were washed once with 1 XPBS and then trypsinized for 3 minutes. The trypsinized cells were then neutralized with media and collected in the same tube as the dead cells. The cells were harvested by spinning down at 4000 rpm, and the resulting cell pellet was washed with 1 XPBS and spun down again at the same speed. The cells were then stained with 5 pl Annexin V (BD Pharmingen™) in 1 X Annexin V binding buffer (0.01 M HEPES (pH 7.4), 0.14 M NaCI, 2.5 mM CaCI2 solution) for 15 minutes, followed by 1 pl Propidium Iodide Staining. The percentage of live cells was analysed by flow cytometry, which involved counting the number of double negative cells.

[0684] Western blot:

[0685] Total protein was isolated from control (shCnt) and FATALR1 knockdown (shFATALRI ) cells using the NucleoSpin RNA / Protein kit following the manufacturer’s instructions. Western blot analysis was performed as described in Example 2.

[0686] Example 5: The treatment of inflammatory diseases and cytokine storm

[0687] To further establish the potential of RBP components of TNFR1 Complex II as novel therapeutic targets for inflammatory diseases by modulating cell death, cell death was induced in both wild-type (WT) and FTO KO cells before RNA sequencing (RNA-seq) analysis was completed as described in previous examples. Upon exposure to cell death stimuli, WT cells exhibited a robust production of inflammatory cytokines such as TNFa and IL6, creating a cytokine-enriched environment. In contrast, FTO KO cells showed a significant reduction in the levels of these inflammatory cytokines (Fig. 6). These findings provide compelling evidence that targeting novel components of TNFR1 Complex II, such as FTO, holds promising therapeutic potential for the treatment of inflammatory diseases. Similar experiments were also performed to assess the potential of RNA components of TNFR1 Complex II as novel therapeutic targets for inflammatory diseases. Cell death was induced with BT treatment in both wild-type (WT) and FATALR1 KO cells, before RNA-seq analysis was completed as described previously. Upon BT treatment, a substantial upregulation of inflammatory cytokines was identified in WT cells. However, in the FATALR1 KO cells, the upregulation of these cytokines was significantly diminished (Figs. 7A-D). This compelling finding serves as evidence that targeting RNA components of TNFR Complex II, presents a novel therapeutic opportunity for inflammatory diseases.

[0688] Example 6: The treatment of infectious diseases

[0689] The expression of FATALR1 in healthy, mild, and severe COVID patients was determined through the analysis of public single cell RNA-seq datasets.

[0690] It was found that FATALR1 expression is higher in mild and severe COVID samples, compared to healthy samples (Fig. 8A). After assigning cell types, it was found that FATALR1 expression is elevated in a number of immune cell types, including lymphocytes (e.g., B cells and T-cells), dendritic cells (e.g., eDCs), and monocytes (Fig. 8B). TNF expression is also upregulated in these cell types (Fig. 8C).

[0691] Several studies have demonstrated that monocytes are the primary target of SARS-CoV-2 infection and undergo cell death. Therefore, the U937 monocyte cell line was used as an in vitro model to investigate the physiological significance of FATALR1 in cytokine-mediated cell death. WT U937 cells displayed a robust response to combined treatment with TNFa and IFNy (IT) (Fig. 8D). Conversely, knockdown of FATALR1 provided significant protection against IT (Fig. 8E), with significantly higher levels of cell death of control cells (shCnt) compared with FATALR1 knockdowns (shFATALR1 -1 and shFATALRI -2). Additionally, knockdown of FTO also provided protection against IT (Fig. 14), with higher levels of cell death of control cells (shCnt) compared with FTO knockdowns (shFTO). These data further reiterate the role of FATALR1 and FTO in cell death under physiological conditions.

[0692] Single Cell RNA data acquisition

[0693] Leveraging the organization of scRNA datasets in the DISCO database, alignment files analysed with the 10X genomics cell ranger pipeline v7.0.1 were kindly provided by the DISCO database authors. Per file, unique cell-barcode and UMI barcodes were collapsed and quantified on the FATALR1 regions using Samtools v1 .16.1 and Bedtools v2.30. Each count was assigned to a cell-barcode and integrated along to the respective count matrixes downloaded from the DISCO database using the DISCO toolkit v1 .0.0 (https: / / github.com / JinmiaoChenLab / DISCOtoolkit) in R v4.2.0 (R core team 2022) compiled with OpenBLAS. Only lung and blood COVID samples with an admission timepoint equal to zero in their DISCO metadata were used as COVID samples. To select healthy data, samples annotated as “Normal” belonging to the same projects of the selected COVID samples were used. Finally, the severity of the COVID infection was identified.

[0694] Single Cell RNA analysis

[0695] Each revised count matrix was converted into a Seurat object using the Seurat library v4. For each object, cells with low counts of RNA (< 200) or high content of mitochondrial RNA (> 5%) were removed and the mitotic phase of the remaining cells was inferred using the function CellCycleScoring and human specific markers. Subsequently, RNA counts in each library were log normalized, transformed in counts per million and scaled to identify up to 4000 variable features. Then, three different methods for data integration were performed, those being simple “merge” (via Seurat merge function), harmony integration, and Fastintegration, to reduce the batch effect per sample. For each merged Seurat object, principal component analysis (PCA) and uniform manifold approximation and projection (UMAP) plots were produced with up to 30 dimensions. Via manual inspection, the integration produced by harmony was selected for further analysis. Cell communities were identified using FindClusters from the Seurat package and cell types identified using CELLiD. Cell annotations were manually curated and plots per cell type and conditions were produced using ggplot2 and Seurat native functions.

[0696] Example 7: The treatment of cancer

[0697] Birinapant, currently undergoing clinical trials, shows potential for cancer treatment either as a monotherapy or in combination with other chemotherapy drugs (Nikkhoo et al., J Cell Biochem. 2019. 120, 9300-9314). However, not all cancer cells respond effectively to this treatment. Cancer cells were modified to overexpress FATALR1 and fragments of FATALR1 , and the resultant cells with upregulated FATALR1 expression were assayed for sensitivity to birinapant. Results demonstrate that overexpression of FATALR1 , particularly the middle portion or 3' terminus of the FATALR1 RNA, can restore sensitivity to birinapant in cancer cells that have developed resistance (Fig. 9). Also, drug resistance occurred due to FATALR1 modification in any cancer types can be restored the sensitivity for the drugs by implicating the FATALR1 over expression approach.

[0698] Overexpression of FATALR1: plasmid transfection

[0699] MDA-MB-231 cells were cultured in DMEM media supplemented with 10% fetal bovine serum (FBS). Cells were passaged every 3 to 4 days using Trypsin (HyClone™). All cells were maintained in a humidified incubator at 37°C with 5% COa.

[0700] FATALR1 knockout cells were generated from MDA-MB-231 cells using CRISPR-Cas9 technology. MDA- MB-231 cells were co-transfected with Cas9 and gRNAs expression plasmids. Transfected cells were sorted into single clones using fluorescence markers, GFP and mCherry from Cas9 and gRNA expression vectors, respectively. Knockout clones were verified by targeted sequencing of genomic DNA and analysis of RNA expression (qPCR). gRNA sequences targeting each gene are listed below:

[0701] - TCATGTTCACCGAGGCCTGC (SEQ ID NO:12)

[0702] - TAGTAGTGTTATAAGGACGG (SEQ ID NO:13)

[0703] Control RNA (Cnt), FATALR1 Fragment 1 (5' - SEQ ID NO:21 ), FATALR1 Fragment 2 (Mid - SEQ ID NO:22), and FATALR1 Fragment 3 (3' - SEQ ID NO:23) were then overexpressed in FATALR1 knockout cells to generate four different overexpression lines (Named in Figure 9 as (i) Cnt, (ii) 5’, (iii) Mid, and (iv) 3’). To generate the three overexpression lines and control line, FATALR1 knockout cells (generated as described above) were transfected with different plasmids. Each plasmid comprised a different transgene (Control RNA (Cnt), FATALR1 Fragment 1 (5' - SEQ ID NP:21 ), FATALR1 Fragment 2 (Mid - SEQ ID NO:22), or FATALR1 Fragment 3 (3' - SEQ ID NO:23)). All plasmids comprised a CMV promoter, a CMV enhancer, and a NeoR gene for selection of transfected cells. Transfected cells were then selected and validated.

[0704] After the overexpression lines were validated, they were treated with BT (100 nM Birinapant, and 10 ng / ml TNF) for 16 hours, and subsequently subjected to staining with Annexin V followed by flow cytometry analysis, to determine the percentage of live cells for each treatment group.

[0705] Example 8: FTP mediates induction of FATALR1

[0706] During BT-induced ceil death, FATALR1 expression exhibited a substantial upregulation in wild type (WT) cells, whereas the upregulation was significantly attenuated in FTOKOcells (Fig. 10A). This suggests that FTP is required for BT-induced FATALR1 expression.

[0707] FTP is a m6A demethylase and studies showed that the demethylation activity of FTP was required to facilitate TNF-induced apoptosis. Experiments were performed to determine whether FTP controlled the induction of FATALR1 through m6A modifications of FATALR1. TadA-assisted N6-methyladenosine sequencing (eTAM-seq) is an antibody-free method to quantitatively profile transcriptomic m6A sites at the single-base resolution. eTAM-seq was used to examine m6A sites on FATALR1, and an island of m6A was identified at its 5’ end (Fig. 10B). When the coding region encompassing the identified m6A sites was removed using CRISPR-Cas9 technology (FATALR1mBMef), the induction of FATALR1 after BT treatment was ablated (Fig. 10C), and consequently, cells were resistant to BT treatment (Fig. 10D), exhibiting disrupted complex Ila formation (Fig. 10E).

[0708] The mechanism underlying FTP-facilitated FATALR1 induction was investigated. H3K27ac marks were reduced at the region coding m6A-modified 5’ FATALR1 in the absence of FTP (Fig. 11 A). This indicated decreased chromatin accessibility without FTP, which is additionally supported by reduced RNA Polymerase II recruitment (Fig. 11 B). These results collectively suggested that FTP facilitates the opening of the chromatin region to enable FATALR1 transcription.

[0709] Cut & Tag (a transpose-assisted assay surveying DNA binding targets) was performed and found colocalization of FTP and RNA polymerase II to the 5’ end of FATALR1 which are enriched with m6A sites. These results together suggest that by binding to the promoter region of FATALR1, FTP enhances RNA polymerase II recruitment for FATALR1 transcription, which explains the essential role of FTP in regulating the induction of FATALR1 during cell death.

[0710] Example 9: Identification of RNA molecules regulating RIPK1 phosphorylation

[0711] RIPK1 autophosphorylation is a crucial determinant of cell death downstream of TNFR1 , influencing both apoptosis and necroptosis. Aberrant phosphorylation of RIPK1 has been linked to various diseases, including inflammatory and neurodegenerative disorders. Experiments were performed to identify RNAs that regulate RIPK1 phosphorylation.

[0712] Assays demonstrated a robust regulation of FTO on RIPK1 phosphorylation, and this regulation relies on FTO’s demethylase activity on RNA because only the reconstitution of WT FTO, not catalytically-inactive mutant FTO into FTOKOcells, successfully restored RIPK1 phosphorylation (Fig. 12A and 12B).

[0713] An FTO STAMP assay and an RIPK1 STAMP assay (as described in Example 3) were performed to identify FTO-regulated RNAs that potentially regulate RIPK1 activation during cell death. In addition to APOBEC1 , the RNA editing enzyme utilized in the conventional STAMP assay, an evolved TadA was included which performs A-to-G editing to eliminate sequence bias caused by different enzymes. Analysis of the STAMP assay generated a list of hits predicted to regulate RIPK1 phosphorylation (Table 2). shRNA screening was performed to verify RNA candidates which regulate RIPK1 phosphorylation. Notably, knockdown of RUPTR7 (Fig. 13A) resulted in a substantial reduction of RIPK1 phosphorylation following BT treatment, and cells were protected against apoptosis, as demonstrated by impaired processing of PARP and caspase-3 (Fig. 13B). These results suggested that RUPTR7 \s a positive regulator of RIPK1 phosphorylation.

[0714] Example 10: Interaction of FADD with RNA molecules (FATALR1 , RAD51 , ARHGAP24, and ABTB2) FADD knockout cells reconstituted with Strepll peptide or Strepll-FADD were used. 20 million cells with or without BT treatment were harvested by scraping and centrifuged at 1000 rpm for 5 mins. Cell pellets were washed twice with cold PBS, and then lysed using lysis buffer (100 mM KCI, 5 mM MgClz, 10 mM HEPES-NaOH (pH 7), 0.5% Nonidet P-40 (NP-40)) supplemented with protease inhibitor (Roche), phospho-stop (Roche), 200 U / ml RNase Inhibitor (NEB). Cell lysates were gently shaken at 4°C for 30 minutes, followed by sonication using Bioruptor UCD-200 (Diagenode) on high setting for 5 mins. After centrifugation at 15000 rpm for 30 minutes, 10% of the soluble extracts were saved as input, and the remaining extracts were incubated with 100 pL Strep-Tactin beads overnight with rotation. On the next day, the beads were washed with lysis buffer six times, and both the input and immunoprecipitates were subjected to protease digestion to elute RNA. RNA was then purified using RNA Clean and Concentrator (Zymo). All RNAs were reverse transcribed into cDNA, and fold enrichment was calculated by 2-AACt([ct(Rip>- ct(inPut)-iog2(diiution factorj] / Nisi) wherein the Ct values were determined by qPCR. Results are shown in Figure 15, which confirms that FADD interacts with FATALR1 , RAD51 , ARHGAP24, and ABTB2.

[0715] Example 11 : Common motifs in RNA molecules identified through STAMP assays

[0716] The nucleic acid sequences of RNA hits from both FTO STAMP (Table 1 ) and FADD STAMP (Table 2) assays were analyzed by the HOMER algorithm (http: / / homer.ucsd.edu / homer / motif / ) to identify the top common RNA motifs.

[0717] The 10 most common motifs found within the top 100 RNA hits from the FTO STAMP assay (Table 1 ) are shown in Figure 16A. The 10 most common motifs found within the top 100 RNA hits from the FADD STAMP assay (Table 2) are shown in Figure 16B. The following motifs were considered to be of particular interest: GCCGGCCG (SEQ ID NO:29), UUGUCCCUCA (SEQ ID NO:30), UCGGCGGCCGCU (SEQ ID NO:31 ).

Claims

Claims:1 . A modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

2. Use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1 ) Complex II, in the manufacture of a medicament for treating or preventing a disease in which TNFR1 -mediated signalling is pathologically-implicated, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

3. A method of treating or preventing a disease in which signalling mediated by tumor necrosis factor receptor 1 (TNFR1 ) is pathologically-implicated, wherein the method comprises administering to a subject a therapeutically- or prophylactically-effective amount of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is a ribonucleic acid (RNA)-binding protein (RBP) or an RNA.

4. The modulator for use according to claim 1 , the use according to claim 2, or the method of claim 3, wherein the RBP component of TNFR1 Complex II comprises or consists of an amino acid sequence having at least 70% amino acid sequence identity to SEQ ID NOU or SEQ ID NO:6.

5. The modulator for use according to claim 1 or claim 4, the use according to claim 2 or claim 4, or the method according to claim 3 or claim 4, wherein the RNA component of TNFR1 Complex II is an RNA capable of associating with an RBP component of TNFR1 Complex II.

6. The modulator for use according to any one of claims 1 , 4 or 5, the use according to any one of claims 2, 4 or 5, or the method according to any one of claims 3 to 5, wherein the RNA component of TNFR1 Complex II is a non-coding RNA.

7. The modulator for use according to any one of claims 1 , or 4 to 6, the use according to any one of claims 2, or 4 to 6, or the method according to any one of claims 3 to 6, wherein the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a nucleotide sequence having at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of: the nucleotide sequence of an RNA transcribed from positions 145959299 to 145969262 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 147502825 to 147510900 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 111659317 to 11 1846428 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 86396528 to 86922184 of human chromosome 4,the nucleotide sequence of an RNA transcribed from positions 165899418 to 166077274 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 68290286 to 68644674 of human chromosome 14, the nucleotide sequence of an RNA transcribed from positions 34254566 to 34379410 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 100418069 to 100745658 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 86522442 to 86669286 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 99261673 to 99434556 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 39917349 to 40178399 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 34603358 to 35104032 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 126719089 to 126784246 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 128596422 to 128841778 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 6461 1344 to 64672035 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 89445931 to 89526681 of human chromosome 16, the nucleotide sequence of an RNA transcribed from positions 1893151 to 2245677 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 134256502 to 134309412 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 106964857 to 107157063 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 188347397 to 188533178 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 140514285 to 140590155 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 61542606 to 61920401 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 65892334 to 66385973 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 110151629 to 110176276 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 18786971 1 to 1881 12441 of human chromosome 3,the nucleotide sequence of an RNA transcribed from positions 64356475 to 64590847 of human chromosome 17, the nucleotide sequence of an RNA transcribed from positions 10195009 to 10245811 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 106330722 to 106659430 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 100558333 to 100680965 of human chromosome 11 , the nucleotide sequence of an RNA transcribed from positions 149041318 to 149386381 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 245999527 to 246670404 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 29677541 to 29904086 of human chromosome X, the nucleotide sequence of an RNA transcribed from positions 23250209 to 23521712 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 66975015 to 67215923 of human chromosome 14, the nucleotide sequence of an RNA transcribed from positions 7566739 to 7966915 of human chromosome 18, the nucleotide sequence of an RNA transcribed from positions 59826238 to 60230486 of human chromosome 20, the nucleotide sequence of an RNA transcribed from positions 104918024 to 105155677 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 143671031 to 147850490 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 40812253 to 41217827 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 19837625 to 19869554 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 189696844 to 189838594 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 148736110 to 148766960 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 11802659 to 1 1993721 of human chromosome 12, the nucleotide sequence of an RNA transcribed from positions 102247784 to 102456356 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 171757455 to 171959434 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 188124039 to 188343878 of human chromosome 3,the nucleotide sequence of an RNA transcribed from positions 153191855 to 153378429 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 184834202 to 184943833 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 119653285 to 119807106 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 1431 15825 to 143285504 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 99641779 to 99758184 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 17420660 to 17494454 of human chromosome X, the nucleotide sequence of an RNA transcribed from positions 85923977 to 86198925 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 44854771 to 45229571 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 79733899 to 79850706 of human chromosome 8, the nucleotide sequence of an RNA transcribed from positions 75935953 to 76056352 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 144301054 to 144541576 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 36177613 to 36425639 of human chromosome 22, the nucleotide sequence of an RNA transcribed from positions 28012120 to 28209146 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 1607960 to 1892955 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 128246768 to 128469388 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 116854504 to 116968939 of human chromosome 11 , the nucleotide sequence of an RNA transcribed from positions 47127605 to 47233991 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 206667573 to 206757842 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 60596474 to 60768540 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 761 14103 to 76432164 of human chromosome 10, the nucleotide sequence of an RNA transcribed from positions 7971 1 11 to 8406585 of human chromosome 18,the nucleotide sequence of an RNA transcribed from positions 29060442 to 29545467 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 16371311 to 16437191 of human chromosome 21 , the nucleotide sequence of an RNA transcribed from positions 131409474 to 131440762 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 49962691 to 501 14102 of human chromosome 20, the nucleotide sequence of an RNA transcribed from positions 3340909 to 4167031 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 29650814 to 30051606 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 12008853 to 12151073 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 192554458 to 192635399 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 74451668 to 74710375 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 234040499 to 234383480 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 184020384 to 184088355 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 108103176 to 108335534 of human chromosome 13, the nucleotide sequence of an RNA transcribed from positions 23435467 to 23494419 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 49962374 to 501 13788 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 16830300 to 17076624 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 15244245 to 15452572 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 37784676 to 381 18126 of human chromosome 6, the nucleotide sequence of an RNA transcribed from positions 20323631 to 204571 17 of human chromosome 4, the nucleotide sequence of an RNA transcribed from positions 65339155 to 65907397 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 108082406 to 108460035 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 70479923 to 70588817 of human chromosome 17,the nucleotide sequence of an RNA transcribed from positions 10095845 to 10319831 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 109150930 to 109276049 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 21376800 to 21554467 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 71471994 to 71633960 of human chromosome 15, the nucleotide sequence of an RNA transcribed from positions 235423963 to 235491373 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 126475318 to 126692155 of human chromosome 9, the nucleotide sequence of an RNA transcribed from positions 167710188 to 167813852 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 10560487 to 10657638 of human chromosome 5, the nucleotide sequence of an RNA transcribed from positions 4801 1532 to 48132940 of human chromosome 3, the nucleotide sequence of an RNA transcribed from positions 178063133 to 178395500 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 35684412 to 35824606 of human chromosome 1 1 , the nucleotide sequence of an RNA transcribed from positions 175001674 to 1751 14226 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 23608068 to 23868206 of human chromosome 2, the nucleotide sequence of an RNA transcribed from positions 46064217 to 46210823 of human chromosome 14. the nucleotide sequence of an RNA transcribed from positions 109737142 to 109775071 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 77043779 to 77122468 of human chromosome 7. the nucleotide sequence of an RNA transcribed from positions 157556333 to 157587186 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 11417591 to 1 1461284 of human chromosome 6. the nucleotide sequence of an RNA transcribed from positions 157398215 to 157460007 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 23426206 to 23433775 of human chromosome 20. the nucleotide sequence of an RNA transcribed from positions 30952569 to 30992458 of human chromosome 1 1 .the nucleotide sequence of an RNA transcribed from positions 148264179 to 148330482 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 117290 to 135277 of human chromosome 22. the nucleotide sequence of an RNA transcribed from positions 175989480 to 176027571 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 9735487 to 9741 115 of human chromosome 8. the nucleotide sequence of an RNA transcribed from positions 63785231 to 63805565 of human chromosome 8. the nucleotide sequence of an RNA transcribed from positions 96720566 to 96739955 of human chromosome 12. the nucleotide sequence of an RNA transcribed from positions 230328832 to 230342173 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 106463621 to 106496054 of human chromosome 12. the nucleotide sequence of an RNA transcribed from positions 16437525 to 16552529 of human chromosome 9. the nucleotide sequence of an RNA transcribed from positions 156352787 to 156388675 of human chromosome 6. the nucleotide sequence of an RNA transcribed from positions 63729009 to 63848896 of human chromosome 8. the nucleotide sequence of an RNA transcribed from positions 162719146 to 162753094 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 37916555 to 37926178 of human chromosome 14. the nucleotide sequence of an RNA transcribed from positions 49925315 to 50042315 of human chromosome X. the nucleotide sequence of an RNA transcribed from positions 1968590 to 1987324 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 148384870 to 148446265 of human chromosome 3. the nucleotide sequence of an RNA transcribed from positions 28318533 to 28405425 of human chromosome 14. the nucleotide sequence of an RNA transcribed from positions 113215997 to 113218504 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 37974838 to 38015373 of human chromosome 9. the nucleotide sequence of an RNA transcribed from positions 8384099 to 8405959 of human chromosome 21 . the nucleotide sequence of an RNA transcribed from positions 66788980 to 66803872 of human chromosome 17.the nucleotide sequence of an RNA transcribed from positions 71147339 to 71174844 of human chromosome 1 1 . the nucleotide sequence of an RNA transcribed from positions 150017499 to 150223165 of human chromosome X. the nucleotide sequence of an RNA transcribed from positions 87518316 to 87613876 of human chromosome X. the nucleotide sequence of an RNA transcribed from positions 132212148 to 132284358 of human chromosome 11 . the nucleotide sequence of an RNA transcribed from positions 163256988 to 163425802 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 49396244 to 49422714 of human chromosome 15. the nucleotide sequence of an RNA transcribed from positions 48173220 to 48198075 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 32902124 to 32925352 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 13413791 to 13421599 of human chromosome 21 . the nucleotide sequence of an RNA transcribed from positions 114823036 to 114998256 of human chromosome 6. the nucleotide sequence of an RNA transcribed from positions 111468836 to 11 1491662 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 144995201 to 145092834 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 40161637 to 40189054 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 3471518 to 3535252 of human chromosome 20. the nucleotide sequence of an RNA transcribed from positions 71964876 to 72352094 of human chromosome 14. the nucleotide sequence of an RNA transcribed from positions 52685691 to 52785534 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 3999688 to 4023872 of human chromosome 1 1 . the nucleotide sequence of an RNA transcribed from positions 4007064 to 4027993 of human chromosome 3. the nucleotide sequence of an RNA transcribed from positions 76995521 to 77044203 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 1671 to 3229 of human chromosome M. the nucleotide sequence of an RNA transcribed from positions 40994854 to 41007439 of human chromosome 9.the nucleotide sequence of an RNA transcribed from positions 136093037 to 1361 17070 of human chromosome 7. the nucleotide sequence of an RNA transcribed from positions 70660217 to 70664661 of human chromosome 15. the nucleotide sequence of an RNA transcribed from positions 24094298 to 241 11073 of human chromosome 16. the nucleotide sequence of an RNA transcribed from positions 60726214 to 60774900 of human chromosome 13. the nucleotide sequence of an RNA transcribed from positions 97306298 to 97373560 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 25664976 to 25795773 of human chromosome 14. the nucleotide sequence of an RNA transcribed from positions 20981625 to 20994089 of human chromosome 17. the nucleotide sequence of an RNA transcribed from positions 161973418 to 162054090 of human chromosome 6. the nucleotide sequence of an RNA transcribed from positions 209299939 to 209304476 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 29467682 to 29485833 of human chromosome 16. the nucleotide sequence of an RNA transcribed from positions 119273709 to 119291164 of human chromosome 4. the nucleotide sequence of an RNA transcribed from positions 112271606 to 112360361 of human chromosome 1 . the nucleotide sequence of an RNA transcribed from positions 14713296 to 14886754 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 29505794 to 29527687 of human chromosome 16. the nucleotide sequence of an RNA transcribed from positions 199016466 to 199041555 of human chromosome 1 , the nucleotide sequence of an RNA transcribed from positions 14619511 1 to 146774270 of human chromosome 7, the nucleotide sequence of an RNA transcribed from positions 12833755 to 12850658 of human chromosome 3. the nucleotide sequence of an RNA transcribed from positions 10650114 to 10657816 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 1 13217376 to 113218609 of human chromosome 2. the nucleotide sequence of an RNA transcribed from positions 63148830 to 63154859 of human chromosome 7. the nucleotide sequence of an RNA transcribed from positions 9809791 to 9819161 of human chromosome 6.the nucleotide sequence of an RNA transcribed from positions 10649266 to 10657816 of human chromosome 5. the nucleotide sequence of an RNA transcribed from positions 82475712 to 82477258 of human chromosome 15. and the nucleotide sequence of an RNA transcribed from positions 88729338 to 88734551 of human chromosome 2.

8. The modulator for use according to any one of claims 1 , or 4 to 7, the use according to any one of claims 2, or 4 to 7, or the method according to any one of claims 3 to 7, wherein the RNA component of TNFR1 Complex II is an RNA comprising or consisting of a ribonucleotide sequence having at least 70% nucleotide sequence identity to SEQ ID NO:10, SEQ ID NO:11 , or SEQ ID NO:25.

9. The modulator for use according to any one of claims 1 , or 4 to 8, the use according to any one of claims 2, or 4 to 8, or the method according to any one of claims 3 to 8, wherein the modulator inhibits the expression and / or activity of the component of TNFR1 Complex II.

10. The modulator for use according to any one of claims 1 , or 4 to 9, the use according to any one of claims 2, or 4 to 9, or the method according to any one of claims 3 to 9, wherein the modulator is selected from the group consisting of: a small molecule that binds to the component of TNFR1 Complex II , an inhibitory nucleic acid targeting the component of TNFR1 Complex II, and nucleic acid encoding a sitespecific nuclease (SSN) system targeting nucleic acid encoding the component of TNFR1 Complex II.11 . The modulator for use according to any one of claims 1 , or 4 to 8, the use according to any one of claims 2, or 4 to 8, or the method according to any one of claims 3 to 8, wherein the modulator upregulates the expression and / or activity of the component of TNFR1 Complex II.

12. The modulator for use according to any one of claims 1 , 4 to 8 or 11 , the use according to any one of claims 2, or 4 to 8 or 1 1 , or the method according to any one of claims 3 to 8 or 1 1 , wherein the modulator comprises or consists of nucleic acid encoding an RBP or an RNA component of TNFR1 Complex II.

13. The modulator for use according to any one of claims 1 , or 4 to 12, the use according to any one of claims 2, or 4 to 12, or the method according to any one of claims 3 to 12, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of Caspase-8, Caspase-3, Caspase-10, RIPK1 , RIPK3 and / or PARP activity.

14. The modulator for use according to any one of claims 1 , or 4 to 13, the use according to any one of claims 2, or 4 to 13, or the method according to any one of claims 3 to 13, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a dysregulation of cell death.

15. The modulator for use according to any one of claims 1 , or 4 to 14, the use according to any one of claims 2, or 4 to 14, or the method according to any one of claims 3 to 14, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is characterised by a cytokine storm.

16. The modulator for use according to any one of claims 1 , 4 to 8, or 11 to 15, the use according to any one of claims 2, 4 to 8, or 1 1 to 15, or the method according to any one of claims 3 to 8, or 1 1 to 15, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is a cancer.

17. The modulator for use according to any one of claims 1 , 4 to 10, or 13 to 15, the use according to any one of claims 2, 4 to 10, or 13 to 15, or the method according to any one of claims 3 to 4 to 10, or 13 to 15, wherein the disease in which TNFR1 -mediated signalling is pathologically-implicated is an inflammatory disorder and / or an infectious disease.

18. The modulator for use, the use, or the method according to claim 16, wherein the cancer is selected from: a solid tumor, breast cancer, breast carcinoma, ductal carcinoma, gastric cancer, gastric carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, ovarian cancer, ovarian carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, cholangiocarcinoma, uterine cancer, uterine corpus endometrial carcinoma, thyroid cancer, thyroid carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma and thymoma..

19. The modulator for use, the use, or the method according to claim 17, wherein the inflammatory disorder is selected from: a chronic inflammatory disease, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, dermatitis, atopic dermatitis, psoriasis, Hermansky- Pudlak syndrome, Graves’ disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-associated hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer’s disease, Parkinson's disease, Huntington’s disease, amyotrophic lateral sclerosis, hippocampal atrophy, pulmonary disease, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn’s disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Alport syndrome, adult-onset Still’s disease, Castleman’s disease, cytokine release syndrome, sepsis, septic shock, a retinal disorder, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Peutz-Jeghers syndrome, a skeletal muscle disorder, and muscular dystrophy.

20. The modulator for use, the use, or the method according to claim 17, wherein the infectious disease is a bacterial, viral, fungal, or parasitic infection.21 . A method of regulating cell death, wherein the method comprises the provision of a modulator of a component of TNFR1 Complex II, wherein the component of TNFR1 Complex II is an RBP or an RNA.

Images