Antisense oligonucleotides and their use for treatment of neurodegenerative disorders
Patent Information
- Application Number
- EP2023821424
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-11-03
- Publication Date
- 2026-09-09
AI Technical Summary
There is a need for antisense oligonucleotides (ASOs) that can effectively induce Exon-2 skipping during pre-mRNA splicing of the CD33 gene for the treatment of neurodegenerative diseases, particularly Alzheimer's Disease.
The development of novel antisense oligonucleotides, such as MOE-296, MOE-305, MOE-307, and MOE-308, which are designed to induce Exon-2 skipping in the CD33 gene by binding to specific target regions in the pre-mRNA, thereby modulating splicing and potentially reducing the risk of late-onset Alzheimer's Disease.
These ASOs demonstrate a CD33 Exon-2 skipping efficiency of 30% or greater, as measured by Standard Exon-Skipping Efficiency Assays, indicating their potential therapeutic effectiveness in treating neurodegenerative diseases by altering CD33 expression.
Smart Images

Figure IMGF000012_0001 
Figure IMGF000012_0002 
Figure IMGF000027_0001
Abstract
Description
[0001] Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 ANTISENSE OLIGONUCLEOTIDES AND THEIR USE FOR TREATMENT OF NEURODEGENERATIVE DISORDERS Field [1] Disclosed herein are novel antisense oligonucleotides (“ASOs”) that may induce exon skipping during pre-mRNA splicing, pharmaceutical compositions comprising the same, and methods of using the same. Background [2] Neurodegenerative disorders are a group of disorders characterized by the decline of central nervous system and peripheral nervous system structure and function. While neurodegenerative disorders exhibit heterogeneous symptoms, they can share similar features. One neurodegenerative disease, Alzheimer’s Disease, is a neurodegenerative disorder characterized by buildup of amyloid beta plaques and neurofibrillary tangles. It is also the leading cause of dementia. Although some cases of rare familial Alzheimer’s Disease involve autosomal dominant mutations to the amyloid beta precursor protein, the majority of cases are late-onset Alzheimer’s Disease (LOAD), which do not follow Mendelian inheritance patterns. While the mechanics of LOAD are not completely understood, genome-wide association studies have identified genetic risk factors for LOAD. Scientists have shown the ability of these genes to impact the production, aggregation, or clearance of amyloid beta plaques. One such gene is CD33, also known as Siglec-3. Griciuc et al., Alzheimer’s Disease Risk Gene CD33 Inhibits Microglial Uptake of Amyloid Beta, 78 NEURON 631 (2013). [3] CD33 is expressed in myeloid-derived cells, including macrophages such as microglia, and encodes the CD33 protein. Microglia account for approximately 10% of the cells in the brain and represent the first line of immunological defense. Microglia modulate several important activities in the brain, such as homeostasis, cognition, and neurogenesis. Augusto-Oliveira et al., What Do Microglia Really Do in Healthy Adult Brain?, 8 CELLS 1293 (2019). Microglia cells are known to contribute to neurodegeneration by releasing proinflammatory substances in the central nervous system. Wojtera et al., Microglial cells in neurodegenerative disorders, 43 FOLIANEUROPATHOLOGY 311 (2005). [4] CD33 is a transmembrane receptor protein that has an extracellular receptor that binds the ligand sialic acid. The intracellular immunoreceptor tyrosine-based inhibition motif recruits phosphatases upon phosphorylation of its tyrosine residues, Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 leading to suppression of immune cell activity such as phagocytosis. CD33 has been found to inhibit microglial uptake of amyloid beta protein, which suggests that therapies targeting CD33 could be potential LOAD treatment options. Griciuc et al., Alzheimer’s Disease Risk Gene CD33 Inhibits Microglial Uptake of Amyloid Beta, 78 NEURON 631 (2013). [5] Two single nucleotide polymorphisms (SNPs) in the promoter region of the CD33 gene are associated with LOAD: rs3826656 and rs3865444. The rs3865444 SNP comes in two forms, rs3865444-C and rs3865444-A. The first form results in normal length CD33 protein. The second form, rs3865444-A, modulates splicing of CD33 pre-mRNA, resulting in skipping of Exon-2 and a CD33 protein lacking the sialic acid binding domain. Malik et al., CD33 Alzheimer’s Risk-Altering Polymorphism, CD33 Expression, and Exon 2 Splicing, 33 J. NEUROSCIENCE 13320 (2013). [6] In eukaryotic genes containing coding (exons) and noncoding (intron) sequences, the noncoding introns are excised from the pre-mRNA transcript and the coding exons are spliced together to form mRNA. If an intron is left in the final mRNA transcript or an exon is left out, the mRNA reading frame may be disrupted during translation of the mRNA. This may result in a non-functional polypeptide sequence or a premature stop codon. The splicing process is further complicated by alternative splicing, where the same pre-mRNA sequence can be spliced into different exon combinations to form multiple mRNA sequences. [7] Splicing of pre-mRNA is an intricate process involving a multi-megadalton ribonucleoprotein complex called the spliceosome. The spliceosome recognizes specific sequences in pre-mRNA to precisely excise introns and ligate exons. The spliceosome catalyzes intron excision in two transesterification reactions using three conserved RNA sequences. These RNA sequences are the 5’ splice site, 3’ splice site, and the branch site. Will & Luhrmann, Spliceosome Structure and Function, 3 COLD SPRING HARB. PERSPECT. BIOL.1 (2011). [8] Splicing begins with the 2’ OH group of the branch site binding to the 5’ splice site via a nucleophilic attack, causing cleavage of the 5’ exon at the 5’ splice site and forming a lariat. Then the 3’ OH group of the 5’ exon attacks the 3’ exon at the 3’ splice site, ligating the 5’ and 3’ exons and cleaving the intron lariat. Will & Luhrmann, Spliceosome Structure and Function, 3 COLDSPRINGHARB. PERSPECT. BIOL.1 (2011). Because the splicing process involves spliceosome recognition sites, Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 5’ and 3’ splice sites, and the branch site, a mutation in any one of these sites can disrupt the splicing process. [9] ASOs are polynucleotides designed to bind with specificity to a target nucleotide sequence, thereby affecting one or more aspects of gene expression, such as transcription, splicing, stability, and / or translation. ASOs may be directed to either RNA or DNA. ASOs directed to RNA can bind to target mRNA sequences, affecting mRNA stability or translation at the ribosome.
[0010] ASOs that bind to target sequences in pre-mRNA transcripts can affect the splicing process. In some cases, ASOs may be used to induce exon skipping during pre-mRNA splicing. For example, Duchenne Muscular Dystrophy (DMD) is caused by a mutation that alters the reading frame of dystrophin mRNA during translation, resulting in a premature stop codon and truncated dystrophin protein. ASOs may be utilized to correct the reading frame by inducing skipping of an exon during splicing. Removing an exon of the correct number of base pairs results in a shorter mRNA transcript, but the reading frame may be corrected. Because dystrophin RNA consists of 79 exons, skipping one or several exons during splicing still results in a partly functional protein. Echigoya et al., Multiple Exon Skipping in the Duchenne Muscular Dystrophy Hot Spots: Prospects and Challenges, 8 J. PERS. MED.41 (2018). The FDA approved an exon-skipping drug called Exondys 51 (eteplirsen) for treatment of DMD in 2016. Dowling, Eteplirsen therapy for Duchenne muscular dystrophy: skipping to the front of the line, 12 NATURE REV. NEUROLOGY 675 (2016).
[0011] In other cases, ASOs may be used to prevent or reduce exon skipping during pre-mRNA splicing. As an example, the ASO drug nusinersen (Spinraza®) reduces Exon-7 skipping during splicing of the SMN2 gene to treat spinal muscular atrophy. Son & Yokota, Recent Advances and Clinical Applications of Exon Inclusion for Spinal Muscular Atrophy, in EXONSKIPPING& INCLUSIONTHERAPIES, 57-68 (2018). The rs3865444-A variant that induces Exon-2 skipping of CD33 conveys protection against LOAD. Malik et al., CD33 Alzheimer’s Risk-Altering Polymorphism, CD33 Expression, and Exon 2 Splicing, 33 J. NEUROSCIENCE 13320 (2013). There remains a need, however, for ASOs that successfully induce Exon-2 skipping during pre- mRNA splicing of CD33 and for their use in treating neurodegenerative diseases. Summary of the Invention Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0012] Disclosed herein are ASOs, methods of using such ASOs to induce exon skipping during pre-mRNA splicing, pharmaceutical compositions that comprise such ASOs, and methods of using such compositions to treat neurodegenerative disease.
[0013] In some embodiments, the antisense oligonucleotides disclosed herein comprise all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), or MOE-308 (SEQ ID NO:12), wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt. In some embodiments, the antisense oligonucleotides disclosed herein are selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12), wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
[0014] In some embodiments, the antisense oligonucleotides disclosed herein have a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon- Skipping Efficiency Assay for MOE ASOs.
[0015] In some embodiments, disclosed here in is a composition comprising an antisense oligonucleotide and optionally a pharmaceutically acceptable carrier or excipient.
[0016] In some embodiments, disclosed herein is a method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing an antisense oligonucleotide into a cell, wherein the antisense oligonucleotide comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12), and wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt. In some embodiments, the cell is an animal cell. In some embodiments, the cell is a human cell.
[0017] In some embodiments, disclosed herein is a method of treating a subject having a neurodegenerative disease comprising administering to said subject a therapeutically effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12), and wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt. In some embodiments, Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 the subject is a human subject. In some embodiments, the neurodegenerative disease is Alzheimer’s Disease. In some embodiments, the antisense oligonucleotide has a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs. In some embodiments, the antisense oligonucleotide further comprises a pharmaceutically acceptable carrier or excipient.
[0018] In some embodiments, disclosed herein is an antisense oligonucleotide according for use in a method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing into a cell an antisense oligonucleotide, wherein the antisense oligonucleotide hybridizes to a target region of the CD33 gene and induces Exon-2 skipping during pre-mRNA splicing of the CD33 gene. In some embodiments, the cell is an animal cell. In some embodiments, the cell is a human cell. In some embodiments, a therapeutically effective amount of the antisense oligonucleotide is administered to the subject. In some embodiments, the subject is a human subject. In some embodiments, the neurodegenerative disease is Alzheimer’s Disease. In some embodiments, the antisense oligonucleotide is MOE- 296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), or MOE-308 (SEQ ID NO:12). In some embodiments, the antisense oligonucleotide is a sodium salt, calcium salt, magnesium salt, or potassium salt. In some embodiments, the antisense oligonucleotide has a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs. In some embodiments, the antisense oligonucleotide further comprises a pharmaceutically acceptable carrier or excipient. Brief Description of the Figures
[0019] FIG.1 shows a plot of in vitro Exon-2 skipping efficiency (%) as a function of ASO concentration (µM) for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in hCD33 mouse bone-marrow derived macrophage (mBMDM) cells.
[0020] FIG.2 shows a plot of in vitro Exon-2 skipping efficiency (%) as a function of ASO concentration (µM) for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in human iPSC microglia cells.
[0021] FIG.3 shows in vivo Exon-2 skipping efficiency of Compound MOE-296 in a 90-day duration study in hCD33 mice with 30 µg, 100 µg, and 300 µg doses. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0022] FIG.4 shows in vivo Exon-2 skipping efficiency of Compound MOE-305 in a 90-day duration study in hCD33 mice with 30 µg, 100 µg, and 300 µg doses.
[0023] FIG.5 shows in vivo Exon-2 skipping efficiency of Compound MOE-307 in a 90-day duration study in hCD33 mice with 30 µg, 100 µg, and 300 µg doses.
[0024] FIG.6 shows in vivo Exon-2 skipping efficiency of Compound MOE-308 in a 90-day duration study in hCD33 mice with 30 µg, 100 µg, and 300 µg doses.
[0025] FIG.7 shows pharmacokinetic (PK) and pharmacodynamic (PD) data for intracerebroventricular (ICV) administered Compound MOE-296 in hCD33 mice with 30 µg, 100 µg and 300 µg doses, including: a plot of MOE-296 concentration (nM) in the hippocampus as a function of time after dosing (days) (top left); a plot of Exon-2 skipping efficiency as a function of MOE-296 concentration (nM) in the hippocampus (top right); a plot of MOE-296 concentration (nM) in the cortex as a function of time after dosing (days) (bottom left); and a plot of Exon-2 skipping efficiency as a function of MOE-296 concentration (nM) in the cortex (bottom right).
[0026] FIG.8 shows pharmacokinetic (PK) and pharmacodynamic (PD) data for intracerebroventricular (ICV) administered Compound MOE-305 in hCD33 mice with 30 µg, 100 µg and 300 µg doses, including: a plot of MOE-305 concentration (nM) in the hippocampus as a function of time after dosing (days) (top left); a plot of Exon-2 skipping efficiency as a function of MOE-305 concentration (nM) in the hippocampus (top right); a plot of MOE-305 concentration (nM) in the cortex as a function of time after dosing (days) (bottom left); and a plot of Exon-2 skipping efficiency as a function of MOE-305 concentration (nM) in the cortex (bottom right).
[0027] FIG.9 shows pharmacokinetic (PK) and pharmacodynamic (PD) data for intracerebroventricular (ICV) administered Compound MOE-307 in hCD33 mice with 30 µg, 100 µg and 300 µg doses, including: a plot of MOE-307 concentration (nM) in the hippocampus as a function of time after dosing (days) (top left); a plot of Exon-2 skipping efficiency as a function of MOE-307 concentration (nM) in the hippocampus (top right); a plot of MOE-307 concentration (nM) in the cortex as a function of time after dosing (days) (bottom left); and a plot of Exon-2 skipping efficiency as a function of MOE-307 concentration (nM) in the cortex (bottom right).
[0028] FIG.10 shows pharmacokinetic (PK) and pharmacodynamic (PD) data for intracerebroventricular (ICV) administered Compound MOE-308 in hCD33 mice with 30 µg, 100 µg and 300 µg doses, including: a plot of MOE-308 concentration (nM) in the hippocampus as a function of time after dosing (days) (top left); a plot of Exon-2 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 skipping efficiency as a function of MOE-308 concentration (nM) in the hippocampus (top right); a plot of MOE-308 concentration (nM) in the cortex as a function of time after dosing (days) (bottom left); and a plot of Exon-2 skipping efficiency as a function of MOE-308 concentration (nM) in the cortex (bottom right).
[0029] FIG.11 shows in vivo Exon-2 skipping efficiency (%) for Compound MOE- 307 and two controls (PBS and NTC-4) in a 60-day study with 5XFAD hCD33 mice.
[0030] FIG.12 shows in vivo data in wild type (WT) mice treated with one of Compounds MOE-296, MOE-305, MOE-307, or MOE-308 (administered as 2 x 350 µg on day 0 and day 4), including: neurofilament-light chain (NF-L) concentration (pg / mL) in CSF on day 60 of WT mice treated with a control (PBS or NTC) or one of Compounds MOE-296, MOE-305, MOE-307, or MOE-308 (left); Concentration (nM) of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in the hippocampus on day 60 (center); and Concentration (nM) of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in the cortex on day 60 (right). Definitions
[0031] The term “and / or” is used herein to mean “both or either.” As an example, something that contains A and / or B could contain both A and B, contain only A, or contain only B.
[0032] The term “oligonucleotide” is used herein to refer to a nucleotide sequence comprising at least ten DNA or RNA nucleotides.
[0033] The term “antisense oligonucleotide,” abbreviated as “ASO,” is used herein to refer to a nucleotide sequence comprising an antisense sequence that is sufficiently complementary to a target nucleotide sequence in order to form a stable double stranded hybrid with the target nucleotide sequence. In some embodiments, the target nucleotide sequence is an RNA nucleotide sequence. Unless otherwise specified, ASOs represented herein are displayed in the 5′ to 3′ orientation.
[0034] The term “nucleobase” is used herein to refer to a base that is a component of a nucleoside. Example nucleobases include adenine, guanine, thymine, cytosine, and uracil.
[0035] The term “nucleoside” is used herein to refer to a nucleobase covalently linked to a sugar. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0036] The term “nucleotide” is used herein to refer to a nucleoside covalently linked to a phosphate group. Examples of naturally occurring nucleotides include adenosine, thymidine, uridine, cytidine, 5-methylcytidine, and guanosine.
[0037] The term “pharmaceutically acceptable salt” is used herein to refer to acid addition salts or base addition salts of the compounds in the present disclosure. A pharmaceutically acceptable salt is any salt which retains the activity of the parent compound and does not impart any unduly deleterious or undesirable effect on a subject to whom it is administered and in the context in which it is administered. Pharmaceutically acceptable salts include, but are not limited to, metal complexes and salts of inorganic acids, carboxylic acids, phosphates, and phosphorothioates. Pharmaceutically acceptable salts also include metal salts such as sodium, calcium, potassium, magnesium, aluminum, iron, manganese, and complex salts. In addition, pharmaceutically acceptable salts include, but are not limited to, acid salts such as acetic, aspartic, alkylsulfonic, arylsulfonic, benzenesulfonic, benzoic, bicarbonic, bisulfuric, bitartaric, butyric, calcium edetate, camsylic, carbonic, chlorobenzoic, citric, edetic, edisylic, estolic, esyl, esylic, formic, fumaric, glucoheptonic, gluconic, glutamic, glycolic, glycolylarsanilic, hexamic, hexylresorcinoic, hydrabamic, hydrobromic, hydrochloric, hydroiodic, hydroxynaphthoic, isethionic, lactic, lactobionic, maleic, malic, malonic, mandelic, methanesulfonic, methylnitric, methylsulfuric, mucic, muconic, napsylic, nitric, oxalic, p-nitromethanesulfonic, palmoic, pantothenic, phosphoric, monohydrogen phosphoric, dihydrogen phosphoric, phthalic, polygalactouronic, propionic, salicylic, stearic, succinic, sulfamic, sulfanilic, sulfonic, sulfuric, tannic, tartaric, teoclic, toluenesulfonic, and the like.
[0038] Within the ASO structure, the phosphate groups are commonly referred to as forming the “internucleotide linkages” of the ASO. The naturally occurring internucleotide linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. A “phosphoramidate” group comprises phosphorus having three attached oxygen atoms and one attached nitrogen atom, while a “phosphorodiamidate” group comprises phosphorus having two attached oxygen atoms and two attached nitrogen atoms. A “phosphorotriamidate” group (or a phosphoric acid triamide group) comprises phosphorus having one attached oxygen atom and three attached nitrogen atoms. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0039] The term “non-natural” is used herein to refer to molecules that contain man- made modifications relative to their naturally occurring counterparts. In some embodiments, “non-natural” may refer to one or more nucleotide subunits having at least one modification selected from (i) a modified internucleotide linkage, e.g., an internucleotide linkage other than the standard phosphodiester linkage found in naturally-occurring oligonucleotides, (ii) modified sugar moieties, e.g., moieties other than ribose or deoxyribose moieties found in naturally occurring oligonucleotides, (iii) modified nucleobases, e.g., bases other than those found in naturally occurring oligonucleotides, or (iv) any combination of the foregoing. In some embodiments, the ASO is chosen from ASOs that do not have a phosphorus atom in the internucleotide linkage (backbone). In some embodiments, the ASO has a phosphorodiamidate or phosphorothioate modified internucleotide linkage (backbone).
[0040] The term “morpholino” is used herein to refer to a nucleotide that contains a morpholinyl ring instead of a ribose.
[0041] The term “morpholino-based ASO” is used herein to refer to an ASO with at least one nucleotide containing a morpholinyl ring instead of a ribose.
[0042] The term “stereo-controlled” is used herein to describe when a nucleotide and / or an oligonucleotide is designed or selected to have a particular stereochemistry. In some embodiments, the nucleobase portion of a nucleotide or oligonucleotide, including any and all non-natural modifications, is stereo-controlled. In some embodiments, the nucleoside portion of a nucleotide or oligonucleotide, including any and all non-natural modifications, is stereo-controlled. In some embodiments, the internucleotide linkage portion of a nucleotide or oligonucleotide, including any and all non-natural modifications, is stereo-controlled. In some embodiments, a nucleotide may comprise one or a combination of these stereo- controlled portions. In some embodiments, an oligonucleotide may comprise a combination of nucleotides that comprise a combination of stereo-controlled nucleotides. In some embodiments, an oligonucleotide may comprise a combination of nucleotides that are stereo-controlled and not stereo-controlled. In some embodiments, the proportion of stereo-controlled nucleotides ranges from 10%- 100%, such as 15%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 50%- 90%, 50%-95%, 60%-100%, 60%-90%, 60%-95%, 70%-100%, 70%-90%, 70%- 95%, 80-100%, 80%-90%, 80%-95%, 90-100%, 90%-95%, 90%-96%, 90%-97%, 90%-98%, 90%-99%, 95%-98%, 95%-99%, 95-100%, 50%-90%, or 5%, 10%, 20%, Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, of nucleotides.
[0043] When applied to nucleotides, the term “stereopure” is used herein to describe when at least 90% of nucleotides in an oligonucleotide are stereo-controlled. In some embodiments, the proportion of stereo-controlled nucleotides in a stereopure ASO ranges from 90-100%, 95-100%, 90%-95%, 90%-96%, 90%-97%, 90%-98%, 90%- 99%, 95%-98%, 95%-99%, or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, of nucleotides. In some embodiments, all or a portion of nucleotides within an oligonucleotide are stereo-controlled so that they are stereopure in the same way, i.e., all or a portion of the nucleotides are stereo-controlled, and they are designed or selected to have the same stereochemistry. In some embodiments, all or a portion of nucleotides within an oligonucleotide are stereo-controlled so that they are not stereopure in the same way, i.e., all or a portion of the nucleotides are stereo- controlled, but they are designed or selected to have different stereochemistry. When applied to the internucleotide linkage portion of an oligonucleotide, the term “stereopure” is used to describe when at least 90% of the internucleotide linkages are stereo-controlled. In some embodiments, the proportion of stereo-controlled internucleotide linkages in a stereopure ASO ranges from 90-100%, 95-100%, 90%- 95%, 90%-96%, 90%-97%, 90%-98%, 90%-99%, 95%-98%, 95%-99%, or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, of internucleotide linkages. In some embodiments, all or a portion of internucleotide linkages within an oligonucleotide are stereo-controlled so that they are stereopure in the same way, i.e., all or a portion of the internucleotide linkages are stereo-controlled, and they are designed or selected to have the same stereochemistry. In some embodiments, all or a portion of internucleotide linkages within an oligonucleotide are stereo-controlled so that they are not stereopure in the same way, i.e., all or a portion of the internucleotide linkages are stereo-controlled, but they are designed or selected to have different stereochemistry. In some embodiments, the internucleotide linkages are phosphorodiamidate linkages. In some embodiments, the internucleotide linkages are phosphorothioate linkages. In some embodiments, the phosphorothioate Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 linkages comprise P-chiral linkages in an Sp or Rp configuration. Sp and Rp configurations of an exemplary phosphorothioate linkage are shown below:
[0044] Stereochemistry for (Rp, Sp) and phosphodiester (PO) internucleotide linkages is illustrated as the following: Stereochemistry for Rp, Sp, and PO internucleotide linkages is also illustrated as follows: S = Sp, R = Rp, O = phosphodiester.
[0045] For example, the stereochemistry of the internucleotide linkages of MOE-296 can be shown using either of the following illustrations:
[0047] 5'-CCGAAAGAAGTATGAACC-3' (SEQ ID NO:252); Stereopattern: SSSOSSRSSSRSSOSSS.
[0048] When applied to nucleotides, the term “stereorandom” is used herein to describe when the nucleotides in an oligonucleotide are not stereo-controlled. When applied to internucleotide linkages, the term “stereorandom” is used herein to describe when the internucleotide linkages in an oligonucleotide are not stereo- controlled. In some embodiments, the internucleotide linkages are phosphorodiamidate linkages. In some embodiments, the internucleotide linkages are phosphorothioate linkages.
[0049] The term “complementary” is used herein to describe when the corresponding positions of at least two nucleotide sequences are occupied by nucleotides which can hydrogen bond with each other.
[0050] The term “hybridize” is used herein to describe the binding of two complementary nucleotide sequences, forming one double stranded molecule. When a sufficient number of corresponding nucleotides in two sequences can hydrogen Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 bond with each other, i.e., they are sufficiently complementary, they may form a stable hybrid. It is understood in the art that 100% complementarity is not necessary for an ASO to hybridize with a target sequence.
[0051] The term “sufficient complementarity” is used herein to indicate a level of complementarity sufficient to permit an ASO to bind to its target sequence and form a stable hybrid. In some embodiments, the complementarity of the ASO and the target sequence is at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70%.
[0052] The term “sequence similarity” is used herein to express the similarity of two ASOs. Sequence similarity is expressed as a percentage of nucleotides shared between two ASOs. It is understood that identical sequences have 100% sequence similarity.
[0053] The terms “target region” and “target sequence” are used interchangeably herein to designate a nucleotide sequence to which an ASO will hybridize under physiological conditions. It is not necessary for the ASO and the target region to be 100% complementary, so long as there is sufficient complementarity for the ASO to hybridize to the target sequence and form a stable hybrid. The ASO may hybridize to all or a portion of the target sequence.
[0054] The terms “treat,” “treating,” or “treatment” are used herein to refer to ameliorating a disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). The terms also refer to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. The terms also refer to modulating the disease or disorder, either physically (e.g., through stabilization of a discernible symptom), physiologically, (e.g., through stabilization of a physical parameter), or both.
[0055] The terms “prevent,” “preventing,” or “prevention” are used herein to refer to inhibiting or delaying the onset of a disease or disorder.
[0056] The term “therapeutically effective amount” is used herein to refer to the amount of a therapeutic agent or composition effective in prevention or treatment of a disorder or disease. In some embodiments, this includes an amount of a Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 therapeutic agent or composition effective in the prevention or treatment of a neurodegenerative disease.
[0057] The term “pharmaceutically acceptable” is used herein to refer to a molecular entity or composition that is pharmaceutically useful and not biologically or otherwise undesirable.
[0058] The term “carrier” is used herein to refer to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
[0059] The term “excipient” as used herein refers to any ingredient in a pharmaceutical composition other than the active ingredient.
[0060] As used herein, “skipping efficiency” of an oligonucleotide is calculated using the following formula: and is represented on a scale of 0 to 100, wherein 100 represents 100% skipping of CD33 Exon-2. “Skipping efficiency” of an oligonucleotide as used herein is experimentally determined using one of three Standard Exon-Skipping Efficiency Assays depending on the type of antisense oligonucleotide. For antisense oligonucleotides comprising methoxyethyl ribose oligomers, the Standard Exon- Skipping Efficiency Assay for MOE ASOs defined below is used.
[0061] The Standard Exon-Skipping Efficiency Assay for MOE ASOs includes using mouse bone-marrow derived macrophages (mBMDM) cells that were cultured and maintained using appropriate media suggested in the vendor protocols (Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum). The Assay is performed in 96 well plate format, seeding about 30,000 cells per well and treating with the MOE ASO at appropriate concentrations without additional transfection reagents. Cells are incubated at 37°C in a cell culture incubator for 48 hours before isolating the total RNA. Total RNA is isolated and cDNA is synthesized per vendor protocol, then Taqman gene expression assays are used to quantify Exon-2 skipped CD33 (Forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO:207); Reverse Primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO:208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO:209)) and un-skipped CD33 (Forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO:210) or TTCGGATGGAGAGAGGAAGTA (SEQ ID NO:291); Reverse Primer: Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 GTGCCAGGGATGAGGATTT (SEQ ID NO:211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO:212)) mRNA transcripts. Mouse house-keeping gene HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) expression is used to normalize the target transcript expressions.
[0062] Unless otherwise defined, all other scientific and technical terms have the same meaning as commonly understood to one of ordinary skill in the art. Such scientific and technical terms are explained in the literature, for example: J. Sambrook, E. F. Fritsch, and T Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press (1989); Martin, Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co (1990); Glover, DNA Cloning: A Practical Approach, Volumes I and II, MRL Press, Ltd. (1985); and Ausubel, F et al., Current Protocols in Molecular Biology, Greene Publishing Associates / Wiley Intersciences (2002). Detailed Description
[0063] Disclosed herein are novel ASOs. In some embodiments, the ASOs are directed to a target sequence in the CD33 pre-mRNA. In some embodiments, the ASOs are complementary to all or a portion of a target sequence in the CD33 pre- mRNA, represented in SEQ ID NO:1 (5′-GGGCAGGTGA GTGGCTGTGG GGAGAGGGGT TGTCGGGCTG GGCCGAGCTG ACCCTCGTTT CCCCACAGGG GCCCTGGCTA TGGATCCAAA TTTCTGGCTG CAAGTGCAGG AGTCAGTGAC GGTACAGGAG GGTTTGTGCG TCCTCGTGCC CTGCACTTTC TTCCATCCCA TACCCTACTA CGACAAGAAC TCCCCAGTTC ATGGTTACTG GTTCCGGGAA GGAGCCATTA TATCCAGGGA CTCTCCAGTG GCCACAAACA AGCTAGATCA AGAAGTACAG GAGGAGACTC AGGGCAGATT CCGCCTCCTT GGGGATCCCA GTAGGAACAA CTGCTCCCTG AGCATCGTAG ACGCCAGGAG GAGGGATAAT GGTTCATACT TCTTTCGGAT GGAGAGAGGA AGTACCAAAT ACAGTTACAA ATCTCCCCAG CTCTCTGTGC ATGTGACAGG TGAGGCACAG GCTTCAGAAG TGGCCGCAAG GGAAGTTCAT GGGTACTGCA GGGCAGGGCT GGGATGGGAC CCTGGTACTG-3′). SEQ ID NO:1 includes Exon-2 and portions of the bordering introns of the CD33 gene. This target sequence is involved in Exon-2 skipping, which also occurs when CD33 mRNA includes the rs3865444-A SNP. When this Exon-2 skipping occurs, pre-mRNA containing the SNP is spliced so that Exon-2 is not included in the final transcript. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0064] In some embodiments, the ASO comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE- 308 (SEQ ID NO:12). In some embodiments, the ASO is selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12). The sequences of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12) are shown in Table 1 below. As one of ordinary skill in the art would appreciate, each ASO disclosed in Table 1 may be in a free acid form or may be a pharmaceutically acceptable salt. Table 1
[0065] Each ASO shown in Table 1 is a methoxyethyl ribose oligomer (MOE) comprising 2′-O-methoxyethyl (2’-O-MOE) modified ribonucleotides, one or more phosphorothioate internucleotide linkages, and a hydroxyl group at the 5’ end.
[0066] In some embodiments, the ASO is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutically acceptable salt is an alkali metal salt. In some embodiments, the pharmaceutically acceptable salt is an alkaline earth metal salt. Non-limiting examples of pharmaceutically acceptable salts include a sodium salt, a calcium salt, a magnesium salt, a potassium salt, an aluminum salt, an arginine salt, a benzathine salt, a chloroprocaine salt, a choline salt, a diethanolamine salt, an ethanolamine salt, an ethylenediamine salt, a lysine salt, a histidine salt, a lithium salt, a meglumine salt, a procaine salt, a triethylamine salt, and a zinc salt. In some embodiments, the ASO is a sodium salt. In some embodiments, the ASO is a calcium salt. In some embodiments, the ASO is a magnesium salt. In some embodiments, the ASO is a potassium salt. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0067] In some embodiments, the ASO shares sequence similarity with one or more of the ASOs disclosed in Table 1. In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-296 (SEQ ID NO: 252). In some embodiments, the ASO is MOE-296 (SEQ ID NO: 252). In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-296 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt). In some embodiments, the ASO is MOE-296 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt).
[0068] In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-305 (SEQ ID NO: 252). In some embodiments, the ASO is MOE-305 (SEQ ID NO: 252). In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-305 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt). In some embodiments, the ASO is MOE-305 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt).
[0069] In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-307 (SEQ ID NO: 252). In some embodiments, the ASO is MOE-307 (SEQ ID Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 NO: 252). In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-307 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt). In some embodiments, the ASO is MOE-307 (SEQ ID NO: 252) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt).
[0070] In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-308 (SEQ ID NO: 12). In some embodiments, the ASO is MOE-308 (SEQ ID NO: 12). In some embodiments, the ASO shares at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70% sequence similarity with MOE-308 (SEQ ID NO: 12) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt). In some embodiments, the ASO is MOE-308 (SEQ ID NO: 12) and is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt).
[0071] In some embodiments, the ASO has a CD33 Exon-2 skipping efficiency of at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% according to a Standard Exon- Skipping Efficiency Assay for MOE ASOs. In some embodiments, the ASO has a CD33 Exon-2 skipping efficiency in a range of 25% to 99%, 30% to 99%, 35% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, or 90% to 99% according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs. In some embodiments, the ASO has a CD33 Exon-2 skipping efficiency of 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs.
[0072] In some embodiments, the ASO is sufficiently complementary to a portion of SEQ ID NO:1 to form a stable hybrid. In some embodiments, the ASO is sufficiently Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 complementary to an 18- to 30-nucleotide target sequence in the CD33 pre-RNA to form a stable hybrid. In some embodiments, the ASO is sufficiently complementary to an 18-nucleotide target sequence to form a stable hybrid. In some embodiments, the ASO is sufficiently complementary to a 20-nucleotide target sequence to form a stable hybrid.
[0073] In some embodiments, the ASO is 18-30 nucleotides long, 18-25 nucleotides long, 18-20 nucleotides long, 20-30 nucleotides long, 20-25 nucleotides long, 21-30 nucleotides long, 21-25 nucleotides long, or 25-30 nucleotides long. In some embodiments, the ASO is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long.
[0074] In some embodiments, one or more thymine nucleobases of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE- 308 (SEQ ID NO:12) may be replaced by a uracil.
[0075] In some embodiments, the nucleotides within a given ASO are stereo- controlled. In some embodiments, one or more nucleotides within a given ASO are stereo-controlled so as to make the ASO stereopure. In some embodiments a given ASO is a combination of stereo-controlled and stereorandom nucleotides.
[0076] In some embodiments, the proportion of stereo-controlled nucleotides in the ASO is in a range from 10%-100%, 15%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 50%-90%, 50%-95%, 60%-100%, 60%-90%, 60%-95%, 70%-100%, 70%-90%, 70%-95%, 80-100%, 80%-90%, 80%-95%, 90-100%, 90%-95%, 90%- 96%, 90%-97%, 90%-98%, 90%-99%, 95%-98%, 95%-99%, 95-100%, 50%-90%, or 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0077] In some embodiments, the proportion of Sp internucleotide linkages in the ASO is at least 80%, 85%, 90%, 95%, 98%, or 99%. In some embodiments, the proportion of Sp internucleotide linkages in the ASO is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0078] In some embodiments, the proportion of Rp internucleotide linkages in the ASO is at least 80%, 85%, 90%, 95%, 98%, or 99%. In some embodiments, the proportion of Rp internucleotide linkages in the ASO is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 Manufacturing Antisense Oligonucleotides
[0079] The antisense molecules used in accordance with this disclosure may be made through well-known techniques of solid phase synthesis. Equipment for such synthesis is available from several sources including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No.4,458,066.
[0080] Any other methods for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides, such as phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl-phosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al., Tetrahedron Letters, 22:1859- 1862 (1981).
[0081] In some embodiments, the ASOs are synthesized in a way so that all nucleotides of the ASO are stereopure.
[0082] In some embodiments, the ASOs are synthesized in vitro and do not include antisense compositions of biological origin. In some embodiments, the ASOs may also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example, liposomes, lipids, receptor targeted molecules for assisting in uptake, distribution and / or absorption. Methods of Inducing Exon-2 Skipping During pre-mRNA Splicing
[0083] In some embodiments, the ASOs are used to induce Exon-2 skipping during processing of CD33 pre-mRNA. In some embodiments, at least one ASO disclosed herein is used to induce Exon-2 skipping in CD33 pre-mRNA during pre-mRNA splicing. In some embodiments, the at least one ASO is introduced into a cell, wherein the at least one ASO is complementary to all or a portion of SEQ ID NO:1, wherein the ASO hybridizes to a target region of the CD33 gene, and wherein the ASO induces Exon-2 skipping during pre-mRNA splicing of the CD33 gene. In some embodiments, the ASO administered to induce Exon-2 skipping during pre-mRNA splicing comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12). In some embodiments, the ASO administered to induce Exon-2 skipping during pre-mRNA splicing is selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE- Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12). In some embodiments, the ASO is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt).
[0084] In some embodiments, an ASO can be introduced by transfection along with one or more transfection agents. In some embodiments, excipients or transfection agents are capable of forming complexes, nanoparticles, micelles, vesicles, and / or liposomes that help deliver each ASO complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection agents include LipofectAMINE™ 2000 (Invitrogen), Endo- Porter peptide, polyethylenimine (PEI; ExGen500 (MBI Fermentas)), or derivatives thereof, or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphils (SAINT- 18), Lipofectin™, DOTAP and / or viral capsid proteins that are capable of self- assembly into particles that can be used when delivering an ASO to a cell. Their high transfection potential is combined with an expected low to moderate toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity. Therapeutic Methods
[0085] Disclosed herein are methods of treating a subject having a neurodegenerative disease comprising administering at least one ASO disclosed herein. In some embodiments, the methods comprise administering a therapeutically effective amount of at least one ASO disclosed herein. In some embodiments, the methods comprise administering a therapeutically effective amount of at least one ASO that hybridizes to all or a portion of SEQ ID NO:1. In some embodiments, the methods comprise administering a therapeutically effective amount of at least one ASO comprising all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12). In some embodiments, the methods comprise administering a therapeutically effective amount of at least one ASO selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12). In some embodiments the ASO is a pharmaceutically acceptable salt (e.g., a sodium salt, a calcium salt, a magnesium salt, a potassium salt). Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0086] In some embodiments, the neurodegenerative disease is characterized by a mutation in the CD33 gene. In some embodiments, the neurodegenerative disease is characterized by an aberrant microglial phenotype. In some embodiments, the neurodegenerative disease is Alzheimer’s Disease, microfibromialgia, or multiple sclerosis.
[0087] In some embodiments, the ASO administered to a subject having a neurodegenerative disease may be administered in a pharmaceutical composition. In some embodiments, the amount of ASO administered in a pharmaceutical composition may be dependent on the subject being treated, the subject’s weight, the manner of administration, and the judgment of the prescribing physician. For example, in some embodiments, a dosing schedule may involve the daily or semi- daily administration of the pharmaceutical composition at a perceived dosage of about 1 µg to about 1000 mg. In some embodiments, intermittent administration, such as on a weekly, monthly, quarterly, or yearly basis, of a dose of the pharmaceutical composition may be employed. In accordance with standard dosing regimens, in some embodiments, physicians will readily determine optimum dosages and will be able to readily modify administration to achieve such dosages.
[0088] A therapeutically effective amount of a compound or composition disclosed herein can be measured by the therapeutic effectiveness of the compound. In some embodiments, the dosages, however, may be varied depending upon the requirements of the patient, the severity of the condition being treated, and the compound being used. In some embodiments, the therapeutically effective amount of a disclosed compound is sufficient to establish a maximal plasma concentration. In some embodiments, preliminary doses as, for example, determined according to animal tests, and the scaling of dosages for human administration is performed according to art-accepted practices.
[0089] In some embodiments, toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. In some embodiments, compositions that exhibit large therapeutic indices are desirable. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0090] In some embodiments, data obtained from cell culture assays or animal studies can be used in formulating a range of dosages for use in humans. In some embodiments, therapeutically effective dosages achieved in one animal model may be converted for use in another animal, including humans, using conversion factors known in the art (see, e.g., Freireich et al., Cancer Chemother. Reports 50(4):219244 (1966).
[0091] The ASOs herein may be administered in a pharmaceutical composition comprising therapeutically effective amounts of an ASO together with pharmaceutically acceptable excipients, diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. In some embodiments, such compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH, and ionic strength, and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking substances (e.g., lactose, mannitol). In some embodiments, the material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. In some embodiments, Hyaluronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and / or rate of in vivo clearance of the present ASOs and derivatives. In some embodiments, the compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form. Administration
[0092] In some embodiments, a pharmaceutical composition comprising an ASO and a pharmaceutically acceptable carrier or excipient may be prepared for administration according to techniques well known in the pharmaceutical industry. In some embodiments, such techniques include combining the ASO with the carrier and / or excipient(s) into association in a unit dosage form.
[0093] In some embodiments, compositions suitable for oral administration may be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of a compound of the present disclosure as powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. In some embodiments, such formulations may be prepared by any suitable method which includes the step of Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 bringing into association at least one embodiment of the present disclosure as the active compound and at least one carrier or excipient (which may constitute one or more accessory ingredients). In some embodiments, the at least one carrier is acceptable in the sense of being compatible with the other ingredients of the formulation and is not deleterious to the recipient. In some embodiments, the carrier may be a solid or a liquid, or both, and may be formulated with at least one compound described herein as the active compound in a unit-dose formulation, for example, a tablet, which may contain from about 0.05% to about 95% by weight of the at least one active compound. In some embodiments, other pharmacologically active substances may also be present including other compounds. In some embodiments, the formulations of the present disclosure may be prepared by any of the well-known techniques of pharmacy consisting essentially of admixing the components.
[0094] For solid compositions, in some embodiments, conventional nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like. In some embodiments, liquid pharmacologically administrable compositions can, for example, be prepared by, for example, dissolving or dispersing, at least one active compound of the present disclosure as described herein and optional pharmaceutical adjuvants in an excipient, such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form a solution or suspension. In general, in some embodiments, suitable formulations may be prepared by uniformly and intimately admixing the at least one active compound of the present disclosure with a liquid or finely divided solid carrier, or both, and then, if desired, shaping the product. For example, in some embodiments, a tablet may be prepared by compressing or molding a powder or granules of at least one embodiment of the present disclosure, which may be optionally combined with one or more accessory ingredients. In some embodiments, compressed tablets may be prepared by compressing, in a suitable machine, at least one embodiment of the present disclosure in a free-flowing form, such as a powder or granules, which may be optionally mixed with a binder, lubricant, inert diluent and / or surface active / dispersing agent(s). In some embodiments, molded tablets may be made by molding, in a suitable machine, where the powdered form of at Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 least one embodiment of the present disclosure is moistened with an inert liquid diluent.
[0095] In some embodiments, formulations suitable for buccal (sub-lingual) administration include lozenges comprising at least one embodiment of the present disclosure in a flavored base, for example, sucrose and acacia or tragacanth, and pastilles comprising the at least one compound in an inert base such as gelatin and glycerin or sucrose and acacia.
[0096] In some embodiments, formulations suitable for parenteral administration comprise sterile aqueous preparations of at least one embodiment of the present disclosure, which are approximately isotonic with the blood and / or cerebrospinal fluid (CSF) of the intended recipient. In some embodiments, these preparations are administered intravenously, although administration may also be effected by subcutaneous, intramuscular, intraperitoneal, intracerebroventricular, intrathecal, or intradermal injection. In some embodiments, these preparations are administered via osmotic pump. In some embodiments, such preparations may conveniently be prepared by admixing at least one embodiment described herein with water and rendering the resulting solution sterile and isotonic with the blood and / or CSF of the intended recipient. In some embodiments, injectable compositions according to the present disclosure may contain from about 0.1 to about 10% w / w of the active compound. In some embodiments, injectable compositions according to the present disclosure may contain from about 0.1 to about 5% w / w of the active compound.
[0097] In some embodiments, formulations suitable for rectal administration are presented as unit-dose suppositories. In some embodiments, these may be prepared by admixing at least one embodiment as described herein with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
[0098] In some embodiments, formulations suitable for topical application to the skin may take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. In some embodiments, carriers and excipients which may be used include Vaseline, lanoline, polyethylene glycols, alcohols, and combinations of two or more thereof. In some embodiments, the ASO is generally present at a concentration of from about 0.1% to about 15% w / w of the composition, for example, from about 0.5 to about 2%.
[0099] In some embodiments, formulations may be suitable for intranasal administration. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 EXAMPLES
[0100] The following Examples serve to more fully describe the invention. They are meant for illustrative purposes and are not meant to limit the invention in any way. Abbreviations
[0101] ASO: antisense oligonucleotide
[0102] DNA: deoxyribonucleic acid
[0103] cDNA: complementary deoxyribonucleic acid
[0104] RNA: ribonucleic acid
[0105] mRNA: messenger ribonucleic acid
[0106] MOE: methoxyethyl
[0107] LOAD: late onset Alzheimer’s Disease
[0108] SNP: single nucleotide polymorphism
[0109] PNA: peptide nucleic acid
[0110] DOTAP: 1,2 dioleoyl 3 trimethylammoniopropane
[0111] PEI: polyethylenimine
[0112] PEC: polyethylenimine copolymers
[0113] HRMS: high resolution mass spectrometry
[0114] MW: molecular weight
[0115] SP: stereopure
[0116] UPLC: ultra performance liquid chromatography
[0117] MS: mass spectrometry
[0118] DCM: dichloromethane
[0119] DMB: 2,4-dimethoxybenzyl
[0120] DIPEA: N,N-diisopropylethylamine
[0121] TFA: trifluoroacetic acid
[0122] THF: tetrahydrofuran
[0123] RT: room temperature
[0124] H: hour
[0125] Min: minute
[0126] EA or EtOAc: ethyl acetate
[0127] HPRT1: hypoxanthine phosphoribosyltransferase 1
[0128] NTC: non-targeting control
[0129] WP: well plate Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0130] CE: 2-cyanoethyl
[0131] Trt: trityl
[0132] IPr: isopropyl
[0133] Sar: Sarcosine
[0134] ESI-TOF-MS: electrospray ionization – time-of-flight mass spectrometry Example 1: Preparation of stereopure 2’-O-MOE phosphorothioate oligonucleotides Protected 2’-O-MOE-3’-OH Monomers
[0135] (Compound 1) 2,2-diethoxy-1-methylpyrrolidine: A mixture of NMP (100 mL, 1039.008 mmol) and dimethyl sulfate (99 mL, 1039.008 mmol) was stirred and heated to 80°C (sand bath) overnight, then allowed to cool to rt. After cooling, the homogeneous liquid was washed with ether (2 X 100 mL) and the residual solvent was removed in vacuo. The obtained residue was dissolved in CH2Cl2 (400 mL), dried over anhydrous MgSO4, filtered, washed with CH2Cl2 (100 mL) and concentrated under reduced pressure to give 5-methoxy-1-methyl-3,4-dihydro-2H- pyrrol-1-ium as a brown color viscous liquid (solidified at -20oC storage);1H NMR (400 MHz, CDCl3) δ 4.35 - 4.40 (m, 3 H), 3.98 - 4.05 (m, 2 H), 3.69 - 3.73 (m, 3 H), 3.31 - 3.38 (m, 2 H), 3.19 - 3.22 (m, 3 H), 2.37 - 2.48 (m, 2 H).
[0136] The crude product (obtained above) was added to a solution of sodium ethanolate (370 g, 1142.909 mmol, 21% sodium ethoxide in ethanol) at 50 to 55 °C over 1 hour by cannula or dropping funnel under N2 atmosphere. After stirring at the same temperature for 3 hours, the reaction was cooled to room temperature. The precipitated white solid was filtered and washed with ethanol (50 mL), and the filtrate was concentrated (maintained water-bath temperature ~30oC). Fractional distillation of crude residue under house vacuum at 55 - 65oC gave 2,2-diethoxy-1- methylpyrrolidine (115 g, 66 % yield) as a pale yellow or colorless liquid. The pure product was stored at -20 °C;1H NMR (400 MHz, CDCl3) δ 3.44 - 3.60 (m, 4 H), 2.83 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 - 2.91 (m, 3 H), 2.33 - 2.40 (m, 4 H), 1.90 - 1.98 (m, 2 H), 1.72 - 1.87 (m, 2 H), 1.15 - 1.22 (m, 6 H). General Procedure 1: Pya (N-methylpyrrolidine) protection of 2’-O-MOE G, A, and
[0137] (Compound 2-1) 9-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-2-(1-methylpyrrolidin-2-ylidene)amino)-1,9- dihydro-6H-purin-6-one:
[0138] 2-amino-9-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-1,9-dihydro-6H-purin-6-one (13.8 g, 40.431 mmol) was chased under vacuum with anhydrous pyridine (100 mL) two times. To the concentrated residue was added anhydrous pyridine (114 mL, 1418.073 mmol) followed by 2,2-diethoxy-1-methylpyrrolidine (14.01 g, 80.862 mmol) slowly at room temperature. The reaction was stirred at room temperature overnight, changing from a white turbid solution to a brown clear solution. Water (0.1 mL / 6 mmol) was added, and the mixture was concentrated under vacuum, then chased with pyridine and MeCN 3 times. To the resulting residue were added pyridine (105 mL, 1298.197 mmol) and 1-[chloro-(4-methoxyphenyl)-phenylmethyl]-4-methoxybenzene (15.62 g, 46.108 mmol) at room temperature. After stirring at rt overnight, the reaction mixture was worked up with saturated NaHCO3 (150 mL) and EtOAc (300 mL X 2), and the residue was purified by silica-gel column chromatography (100 g Star Silica, EtOAc / Hept 30 to 100% then EtOAc / MeOH 0 to 30%) to give Compound 2-1 as a foamy solid in 77% yield;1H NMR (400 MHz, CDCl3) δ 9.28 - 9.36 (m, 1 H), 7.67 - 7.72 (m, 1 H), 7.32 - 7.39 (m, 2 H), 7.16 - 7.28 (m, 6 H), 7.08 - 7.16 (m, 1 H), 6.69 - 6.78 (m, 4 H), 5.92 - 5.96 (m, 1 H), 4.29 - 4.37 (m, 2 H), 4.11 - 4.17 (m, 1 H), 3.74 - 3.82 (m, 1 H), 3.68 - 3.73 (m, 7 H), 3.55 - 3.63 (m, 1 H), 3.45 - 3.52 (m, 1 H), 3.34 - Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 3.41 (m, 3 H), 3.25 - 3.33 (m, 5 H), 3.01 - 3.09 (m, 2 H), 2.92 - 2.96 (m, 3 H), 1.90 - 2.00 (m, 2 H); MS (ESI, m / z) calculated for [C39H44N5O8 + H+] 725.33 found 725.4.
[0139] (Compound 2-2) (2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-1- methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-ol:
[0140] Prepared according to general procedure 1, foamy solid, 89% yield;1H NMR (400 MHz, DMSO-d6) δ 8.36 (d, J = 8.0 Hz, 2H), 7.40 – 7.31 (m, 2H), 7.29 – 7.16 (m, 7H), 6.87 – 6.77 (m, 4H), 6.07 (d, J = 4.8 Hz, 1H), 5.18 (d, J = 6.0 Hz, 1H), 4.69 (t, J = 5.2 Hz, 1H), 4.44 (q, J = 5.2 Hz, 1H), 4.11 – 4.05 (m, 1H), 3.76-3.71 (m, 7H), 3.62 (dt, J = 11.2, 4.8 Hz, 1H), 3.49 (t, J = 7.2 Hz, 2H), 3.42 (t, J = 4.8 Hz, 2H), 3.23 (d, J = 4.8 Hz, 2H), 3.14 (s, 3H), 3.04 (s, 3H), 2.85 (t, J = 8.0 Hz, 2H), 2.02-1.93 (m, 2H); MS (ESI, m / z) calculated for [C39H44N6O7 + H+] 709.33 found 709.20.
[0141] (Compound 2-3) 1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(1-methylpyrrolidin-2- ylidene)amino)pyrimidin-2(1H)-one: Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0142] Prepared according to general procedure 1, 87% yield; foamy solid;1H NMR (400 MHz, CDCl3) δ 7.77 - 7.81 (m, 1 H), 7.46 - 7.51 (m, 2 H), 7.34 - 7.41 (m, 4 H), 7.27 - 7.33 (m, 2 H), 7.20 - 7.27 (m, 1 H), 6.82 - 6.88 (m, 4 H), 5.99 - 6.04 (m, 1 H), 4.34 - 4.43 (m, 1 H), 4.25 - 4.33 (m, 1 H), 4.08 - 4.15 (m, 1 H), 3.99 - 4.05 (m, 1 H), 3.90 - 3.99 (m, 1 H), 3.74 - 3.83 (m, 6 H), 3.54 - 3.64 (m, 3 H), 3.42 - 3.50 (m, 3 H), 3.42 (s, 3 H), 3.29 - 3.34 (m, 1 H), 3.07 - 3.29 (m, 2 H), 3.03 - 3.07 (m, 3 H), 2.00 - 2.11 (m, 2 H), 1.53 - 1.58 (m, 3 H); MS (ESI, m / z) calculated for [C39H44N6O8+ H+] 699.33 found 699.25. Pivaloylmethyl (POM) protection of T:
[0143] (Compound 2-4) (3-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)- yl)methyl pivalate:
[0144] Step 1: To 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (14.2 g, 44.893 mmol) in pyridine (99 mL, 1228.96 mmol) was added 1-[chloro-(4- methoxyphenyl)-phenylmethyl]-4-methoxybenzene (18.25 g, 53.871 mmol) at room temperature. Upon completion, as monitored by UPLC-MS, saturated NaHCO3 (80 mL) was added to the mixture, extracted with EtOAc (200 mL X 2), and purified by silica-gel column chromatography (100 g, Star silica, EtOAc / Hept 10 to 100%) to give 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy- 3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (25 g, 40.408 mmol) in 90% yield.
[0145] 1H NMR (400 MHz, DMSO-d6) δ 11.37 (s, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.6 Hz, 2H), 7.35 – 7.21 (m, 8H), 6.90 (d, J = 8.8 Hz, 4H), 5.85 (d, J = 4.8 Hz, 1H), 5.12 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 (d, J = 6.0 Hz, 1H), 4.23 (q, J = 5.2 Hz, 1H), 4.09 (t, J = 4.8 Hz, 1H), 4.02-3.95 (m, 1H), 3.79 – 3.67 (m, 8H), 3.48 (t, J = 4.7 Hz, 2H), 3.26-3.20 (m, 5H), 1.40 (s, 3H).
[0146] Step 2: To an aqueous solution of Na2CO3 (242 mL, 121.225 mmol) were added 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4- hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)- dione (25 g, 40.408 mmol) in DCM (250 mL, 3885.69 mmol), Tetrabutylammoniumhydrogensulfate (5.49 g, 16.163 mmol), and chloromethyl pivalate (7.30 g, 48.49 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 h. Some starting material remained unreacted by UPLC- Mass analysis, thus, 700 mg of chloromethyl pivalate was added at room temperature. After stirring at rt for another 2 days, the mixture was worked up with saturated NaHCO3 (50 mL) and extracted with EtOAc (100 mL X 3), and purified by a column chromatography (100 g snap, EtOAc / Hept 10 to 60%) to give (3- ((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-3-(2- methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)- yl)methyl pivalate (23 g, 31.4 mmol, 78 % yield) along with recovered starting material (3.25 g).
[0147] 1H NMR (400 MHz, DMSO-d6) δ 7.62 (s, 1H), 7.40 (d, J = 7.6 Hz, 2H), 7.36 – 7.20 (m, 7H), 6.90 (d, J = 8.8 Hz, 4H), 5.89 (d, J = 4.8 Hz, 1H), 5.84 – 5.73 (m, 2H), 5.17 (d, J = 6.0 Hz, 1H), 4.26 (q, J = 5.6 Hz, 1H), 4.12 (t, J = 4.8 Hz, 1H), 4.02-3.98 (m, 1H), 3.78-3.70 (m, 8H), 3.51-3.40 (m, 2H), 3.28-3.20 (m, 5H), 1.44 (s, 3H), 1.10 (s, 9H); MS (ESI, m / z) calculated for [C40H48N2O11 + Na+] 755.32 found 755.1. 2’-O-MOE-3’-PSI Activated Monomers General Procedure 2: PSI activation
[0148] (Compound 3-1) (3-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)- Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate:
[0149] (2S,3aS,6R,7aS)-3a-methyl-2-((perfluorophenyl)thio)-6-(prop-1-en-2- yl)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide (3.70 g, 8.29 mmol) ((-)-PSI reagent) and (3-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)- 4-hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6- dihydropyrimidin-1(2H)-yl)methyl pivalate (4.50 g, 6.141 mmol) were dissolved in THF (20.47 mL, 6.141 mmol) and acetonitrile (20.47 mL, 6.141 mmol), and the solution was cooled in an ice bath. To the mixture was added DBU (1.203 mL, 7.983 mmol) and it was stirred at 0 °C until the reaction was completed (0.5~2 h) as monitored by UPLC-MS. The reaction mixture was diluted by EtOAc, was washed with saturated NaH2PO4 (aq.) solution, then saturated NaHCO3 (aq.), dried over Na2SO4, and purified by silica gel chromatography (50 g Star, Hept: EtOAc gradient to 70% to give 3-1 as a white solid (5.3 g, 88% yield).
[0150] 1H NMR (400 MHz, CD3CN) δ ppm 7.46 - 7.54 (3 H, m), 7.33 - 7.39 (6 H, m), 7.26 - 7.32 (1 H, m), 6.91 (4 H, d, J=8.75 Hz), 5.97 (1 H, d, J=6.38 Hz), 5.86 - 5.93 (2 H, m), 5.45 - 5.52 (1 H, m), 5.02 (1 H, s), 4.93 (1 H, s), 4.45 - 4.54 (2 H, m), 4.26 (1 H, d, J=2.88 Hz), 3.77 - 3.84 (8 H, m), 3.47 - 3.62 (2 H, m), 3.42 (1 H, dd, J=11.01, 2.88 Hz), 3.29 - 3.33 (1 H, m), 3.28 (3 H, s), 2.64 (1 H, br s), 2.25 - 2.32 (1 H, m), 2.12 - 2.14 (3 H, m), 2.07 (1 H, br dd, J=13.70, 4.44 Hz), 1.99 - 1.99 (1 H, m), 1.81 - 1.95 (2 H, m), 1.80 (3 H, s), 1.69 (3 H, s), 1.44 (3 H, s), 1.18 (9 H, s);31P NMR (162 MHz, CD3CN) δ ppm 101.69; MS (ESI, m / z) calculated for [C50H63N2O12PS2 + Na+] 1001.35 found 1001.4. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0151] (Compound 3-2) (2R,3aS,6R,7aS)-2-(((2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1- methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-yl)oxy)-3a-methyl- 6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide:
[0152] Prepared according to general procedure 2 with (-)-PSI reagent, 78% yield; foamy solid;1H NMR (400 MHz, CDCl3) δ 8.40 - 8.46 (m, 1 H), 8.00 - 8.03 (m, 1 H), 7.36 - 7.41 (m, 2 H), 7.24 - 7.30 (m, 4 H), 7.17 - 7.22 (m, 2 H), 7.08 - 7.16 (m, 1 H), 6.69 - 6.78 (m, 4 H), 6.05 (d, J=7.5 Hz, 1 H), 5.45 - 5.59 (m, 1 H), 5.04 (dd, J=7.5, 4.7 Hz, 1 H), 4.95 (s, 1 H), 4.78 - 4.93 (m, 1 H), 4.50 (dt, J=12.6, 3.3 Hz, 1 H), 4.27 - 4.33 (m, 1 H), 3.59 - 3.79 (m, 10 H), 3.31 - 3.46 (m, 5 H), 3.10 - 3.15 (m, 3 H), 3.06 - 3.10 (m, 3 H), 2.83 - 2.97 (m, 2 H), 2.47 - 2.54 (m, 1 H), 2.16 - 2.24 (m, 1 H), 2.03 - 2.13 (m, 1 H), 1.94 - 2.03 (m, 2 H), 1.74 - 1.94 (m, 4 H), 1.66 - 1.69 (m, 3 H), 1.60 - 1.65 (m, 3 H); 13C NMR (101 MHz, CDCl3) δ 166.9, 160.9, 158.6, 158.5, 152.8, 151.6, 144.8, 144.5, 140.1, 135.6, 135.6, 130.2, 130.1, 128.2, 128.0, 126.9, 126.6, 113.3, 112.2, 86.8, 85.4, 85.4, 83.6, 83.5, 80.1, 80.0, 77.3, 76.9, 72.3, 70.6, 68.0, 65.7, 63.0, 58.9, 55.2, 51.6, 38.9, 33.7, 33.7, 32.0, 30.1, 27.8, 27.6, 25.6, 23.5, 22.7, 21.8, 19.7;31P NMR (162 MHz, CDCl3) δ 101.34; MS (ESI, m / z) calculated for [C49H59N6O8PS2 + H+] 955.36 found 956.3.
[0153] (Compound 3-3) 1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)- 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methyl-4-((1-methylpyrrolidin-2- ylidene)amino)pyrimidin-2(1H)-one:
[0154] Prepared according to general procedure 2 with (-)-PSI reagent, foamy solid, 70% yield;1H NMR (400 MHz, CD3CN) δ ppm 7.59 (1 H, s), 7.50 (2 H, d, J=7.38 Hz), 7.32 - 7.41 (6 H, m), 7.25 - 7.31 (1 H, m), 6.90 (4 H, d, J=8.63 Hz), 5.99 (1 H, d, J=5.00 Hz), 5.44 (1 H, dt, J=12.98, 5.02 Hz), 5.02 (1 H, s), 4.93 (1 H, s), 4.47 (1 H, Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 dt, J=12.73, 3.20 Hz), 4.34 (1 H, t, J=5.07 Hz), 4.22 - 4.28 (1 H, m), 3.86 - 3.94 (1 H, m), 3.79 (6 H, s), 3.44 - 3.61 (4 H, m), 3.33 - 3.41 (3 H, m), 3.30 (3 H, s), 3.05 - 3.09 (1 H, m), 3.04 (3 H, s), 2.76 (1 H, s), 2.64 (1 H, br s), 2.20 - 2.30 (2 H, m), 2.01 - 2.09 (3 H, m), 1.99 - 1.99 (2 H, m), 1.81 - 1.92 (1 H, m), 1.80 (3 H, s), 1.68 (3 H, s), 1.55 (3 H, s);31P NMR (162 MHz, CD3CN) δ ppm 101.51; MS (ESI, m / z) calculated for [C49H61N4O9PS2 + H+] 945.36 found 945.4. methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)- 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-2-((-1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H- purin-6-one:
[0156] Prepared according to general procedure 2 with (-)-PSI reagent, foamy solid, 80% yield;1H NMR (400 MHz, CD3CN) δ ppm 9.18 (1 H, br s), 7.74 (1 H, s), 7.43 (2 H, d, J=7.38 Hz), 7.22 - 7.33 (7 H, m), 6.85 (4 H, dd, J=9.01, 2.63 Hz), 5.89 (1 H, d, J=5.50 Hz), 5.48 (1 H, dt, J=13.54, 4.80 Hz), 4.98 (1 H, s), 4.92 (1 H, s), 4.85 (1 H, t, J=5.38 Hz), 4.50 (1 H, dt, J=12.69, 3.22 Hz), 4.23 (1 H, q, J=4.09 Hz), 3.79 (6 H, s), 3.67 - 3.77 (2 H, m), 3.43 - 3.51 (4 H, m), 3.32 (2 H, qd, J=10.94, 4.06 Hz), 3.21 (3 H, s), 3.03 (3 H, s), 2.99 - 3.02 (1 H, m), 2.63 (1 H, br s), 2.27 (1 H, br d, J=13.13 Hz), 2.12 - 2.15 (1 H, m), 2.01 - 2.06 (1 H, m), 1.99 - 1.99 (4 H, m), 1.79 - 1.93 (2 H, m), 1.77 (3 H, s), 1.68 (3 H, s);31P NMR (162 MHz, CD3CN) δ ppm 101.36; MS (ESI, m / z) calculated for [C49H59N6O9PS2 + H+] 971.35 found 971.4. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0157] (Compound 3-5) 9-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)- 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-2-((1-methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H- purin-6-one:
[0158] Prepared according to general procedure 2 with (+)-PSI reagent, white foamy solid;1H NMR (400 MHz, CD3CN, 296 K) δ (ppm) = 9.56 (br s, 1H), 7.74 (s, 1H), 7.44 (d, J = 7.5 Hz, 2H), 7.34 - 7.28 (m, 6H), 7.28 - 7.21 (m, 1H), 6.86 (dd, J = 2.4, 8.9 Hz, 4H), 5.89 (d, J = 6.4 Hz, 1H), 5.44 - 5.36 (m, 1H), 4.99 (s, 1H), 4.89 (s, 1H), 4.78 (t, J = 5.8 Hz, 1H), 4.45 (td, J = 3.0, 12.7 Hz, 1H), 4.27 (q, J = 3.9 Hz, 1H), 3.78 (s, 6H), 3.75 - 3.70 (m, 1H), 3.67 - 3.57 (m, 1H), 3.47 - 3.40 (m, 2H), 3.39 - 3.32 (m, 4H), 3.12 (s, 3H), 3.09 - 2.92 (m, 5H), 2.63 (br s, 1H), 2.30 - 2.15 (m, 2H), 2.04 (br dd, J = 4.0, 12.9 Hz, 1H), 2.00 - 1.90 (m, 4H), 1.82 (br s, 1H), 1.79 - 1.75 (m, 3H), 1.68 (s, 3H);13C NMR (101 MHz, CD3CN, 298 K) δ (ppm) = 170.8, 160.1, 159.3, 158.3, 152.1, 147.2, 146.2, 137.9, 136.9, 136.9, 131.5, 131.4, 129.4, 129.3, 128.3, 114.5, 112.4, 87.9, 87.6, 87.3, 83.5, 83.4, 81.8, 78.2, 78.1, 73.1, 72.3, 66.4, 64.4, 59.4, 56.3, 52.4, 40.2, 34.9, 34.8, 32.5, 32.4, 28.7, 28.6, 24.2, 23.2, 22.3, 20.8;31P NMR (162 MHz, CD3CN) δ 101.9; MS (ESI, m / z) calculated for [C49H59N6O9PS2 + H+] 971.35 found 971.1.
[0159] (Compound 3-6) 1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)- Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1-methylpyrrolidin-2- ylidene)amino)pyrimidin-2(1H)-one: Prepared according to general procedure 2 with (+)-PSI reagent, white foamy solid;1H NMR (400 MHz, CD3CN, 296 K) δ (ppm) = 7.57 (s, 1H), 7.50 (d, J = 7.5 Hz, 2H), 7.40 - 7.31 (m, 6H), 7.31 - 7.23 (m, 1H), 6.90 (d, J = 8.9 Hz, 4H), 6.05 (d, J = 5.8 Hz, 1H), 5.49 - 5.40 (m, 1H), 4.99 (s, 1H), 4.88 (s, 1H), 4.43 (td, J = 3.1, 12.6 Hz, 1H), 4.34 (t, J = 5.4 Hz, 1H), 4.26 (br d, J = 3.4 Hz, 1H), 3.85 - 3.72 (m, 8H), 3.54 - 3.45 (m, 4H), 3.38 (d, J = 2.8 Hz, 2H), 3.26 (s, 3H), 3.11 - 3.05 (m, 2H), 3.03 (s, 4H), 2.62 (br s, 1H), 2.22 (br d, J = 12.3 Hz, 1H), 2.13 - 2.01 (m, 3H), 2.01 - 1.92 (m, 2H), 1.92 - 1.79 (m, 2H), 1.76 (s, 3H), 1.68 (s, 3H), 1.56 (s, 3H);13C NMR (101 MHz, CD3CN, 298 K) δ (ppm) = 172.6, 170.0, 160.2, 147.2, 146.1, 138.4, 137.0, 136.8, 131.5, 131.5, 129.5, 129.4, 128.4, 114.6, 112.5, 88.7, 88.2, 87.8, 82.9, 82.9, 82.3, 82.2, 77.7, 77.6, 73.3, 71.8, 66.7, 63.9, 59.5, 56.3, 52.5, 40.2, 34.9, 34.8, 32.4, 31.8, 28.7, 28.6, 24.2, 23.2, 22.3, 20.8;31P NMR (162 MHz, CD3CN) δ 101.8; MS (ESI, m / z) calculated for [C49H61N4O9PS2 + H+] 945.36 found 946.5.
[0160] (Compound 3-7) (2S,3aR,6S,7aR)-2-(((2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1- methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3-yl)oxy)-3a-methyl- 6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide:
[0161] Prepared according to general procedure 2 with (+)-PSI reagent, white foamy solid;1H NMR (400 MHz, CD3CN, 296 K) δ (ppm) = 8.35 (s, 1H), 8.06 (s, 1H), 7.47 (d, J = 7.4 Hz, 2H), 7.34 (dd, J = 1.6, 8.8 Hz, 4H), 7.30 (s, 2H), 7.26 - 7.19 (m, 1H), 6.85 (d, J = 8.9 Hz, 4H), 6.01 (d, J = 6.6 Hz, 1H), 5.60 - 5.53 (m, 1H), 5.10 (t, J = 5.7 Hz, 1H), 4.99 (s, 1H), 4.91 (s, 1H), 4.49 (td, J = 3.0, 12.6 Hz, 1H), 4.41 - 4.32 (m, 1H), 3.78 (s, 6H), 3.77 - 3.71 (m, 1H), 3.67 (br t, J = 6.4 Hz, 2H), 3.65 - 3.57 (m, 1H), 3.52 (t, J = 7.1 Hz, 2H), 3.45 (br d, J = 4.5 Hz, 1H), 3.40 - 3.34 (m, 3H), 3.09 (s, 3H), Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 3.07 (s, 3H), 2.93 (t, J = 7.9 Hz, 2H), 2.64 (br s, 1H), 2.27 (br d, J = 13.4 Hz, 1H), 2.18 - 2.06 (m, 1H), 2.06 - 2.01 (m, 2H), 2.00 - 1.86 (m, 1H), 1.78 (s, 3H), 1.70 (s, 3H);13C NMR (101 MHz, CD3CN, 297 K) δ (ppm) = 168.5, 162.1, 160.1, 153.5, 152.6, 147.2, 146.3, 142.2, 137.0, 131.5, 131.5, 129.4, 129.2, 129.2, 128.3, 128.0, 114.5, 112.5, 87.8, 87.7, 87.6, 83.9, 83.8, 80.8, 80.8, 78.4, 78.4, 72.9, 72.1, 68.7, 66.6, 64.2, 59.3, 56.3, 52.5, 40.2, 34.9, 34.8, 32.4, 31.3, 28.7, 28.6, 26.6, 24.2, 23.2, 22.3, 20.8;31P NMR (162 MHz, CD3CN) δ 101.7; MS (ESI, m / z) calculated for [C49H59N6O8PS2 + H+] 955.36 found 956.6.
[0162] (Compound 3-8) (3-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)- 3a-methyl-6-(prop-1-en-2-yl)-2-sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2,6-dioxo-3,6-dihydropyrimidin-1(2H)-yl)methyl pivalate:
[0163] Prepared according to general procedure 2 with (+)-PSI reagent, foamy solid;1H NMR (400 MHz, CD3CN) δ ppm 7.53 (1 H, s), 7.48 (2 H, d, J=7.63 Hz), 7.33 - 7.39 (6 H, m), 7.26 - 7.32 (1 H, m), 6.92 (4 H, d, J=8.76 Hz), 6.01 (1 H, d, J=6.88 Hz), 5.86 - 5.92 (2 H, m), 5.45 (1 H, ddd, J=11.60, 4.78, 2.75 Hz), 5.01 (1 H, s), 4.90 (1 H, s), 4.44 - 4.49 (2 H, m), 4.29 (1 H, br d, J=2.63 Hz), 3.80 (6 H, s), 3.76 - 3.79 (1 H, m), 3.32 - 3.54 (4 H, m), 3.23 (3 H, s), 2.60 - 2.66 (1 H, m), 2.24 (2 H, br d, J=12.76 Hz), 2.07 (1 H, br dd, J=13.01, 3.75 Hz), 1.99 - 2.01 (2 H, m), 1.80 - 1.92 (2 H, m), 1.78 (3 H, s), 1.68 (3 H, s), 1.46 (3 H, s), 1.18 (9 H, s);31P NMR (162 MHz, CD3CN) δ ppm 102.18; MS (ESI, m / z) calculated for [C50H63N2O12PS2 + Na+] 1001.35 found 1001.1. General Procedure 3: PO-PSI monomer from PS-PSI monomer Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0164] (Compound 4-1) N-(9-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)- 3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-6-oxo-6,9-dihydro-1H-purin-2-yl)isobutyramide:
[0165] To N-(9-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3- (2-methoxyethoxy)-4-(((2S,3aR,6S,7aR)-3a-methyl-6-(prop-1-en-2-yl)-2- sulfidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-6- oxo-6,9-dihydro-1H-purin-2-yl)isobutyramide (1 g, 1.042 mmol) in MeCN (15.00 mL, 15 vol) was added SeO2 (1.0 eq.,0.116 g, 1.042 mmol) in ice-bath. Additional SeO2 (0.116 g, 1.042 mmol) was added at 0 °C until the reaction was completed at 0°C. Total 3 equivalents of SeO2 were used. Upon completion as monitored by UPLC-MS, the mixture was filtered over celite and dry SiO2 (EtOAc / THF). The filtrate was washed with saturated NaHCO3 (10 mL), dried over Na2SO4, filtered (dry SiO2) and concentrated. The residue was purified by silica-gel column chromatography (50g, Hept / EtOAc, 20 to 100 then EtOAc / THF 0 to 100%) to give Compound 4-1 (0.55 g, 56% yield). MS (ESI, m / z) calculated for [C48H58N5O11PS - H+] 942.36 found 942.53. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0166] (Compound 4-2) N-(1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)- 3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methyl-2-oxo-1,2-dihydropyrimidin-4-yl)benzamide:
[0167] Prepared according to general procedure 3, white foamy solid; 59% yield;31P NMR (162 MHz, acetonitrile-d3) δ 40.36; MS (ESI, m / z) calculated for [C51H58N3O11PS + H+] 952.35 found 952.35.
[0168] (Compound 4-3) 1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((2R,3aS,6R,7aS)- 3a-methyl-2-oxido-6-(prop-1-en-2-yl)hexahydrobenzo[d][1,3,2]oxathiaphosphol-2- yl)oxy)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione:
[0169] Prepared according to general procedure 3, white foamy solid; 46% yield;31P NMR (162 MHz, acetonitrile-d3) δ 40.42; MS (ESI, m / z) calculated for [C44H53N2O11PS + Na+] 871.30 found 871.28. PO-PSI reagent from cyclohexyl epoxide: Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0170] (Compound 5) rac-2-((4- bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide:
[0171] A solution of triethylamine bis(4-bromophenyl) phosphorotetrathioate (50.0 g, 87.2 mmol) and cyclohexene oxide (13.2 mL, 131 mmol) in chloroform (175 mL) was treated with dibutyl phosphate (16.2 mL, 87.2 mmol) and dichloroacetic acid (10.8 mL, 131 mmol). After stirring at room temperature for 15 hours, the mixture was concentrated in vacuo. The residue was diluted with water (125 mL) and n-heptane (125 mL), cooled with an ice bath, and stirred at 0oC for 2 hours. The resulting precipitate was filtered and washed subsequently with water (100 mL) and n-heptane (125 mL). The filter cake was dissolved in CH2Cl2 (200 mL) and the aqueous layer was removed. The organic layer was concentrated in vacuo to ca.50 mL and treated with n-heptane (75 mL). The mixture was stirred at room temperature for 20 min and concentrated in vacuo to ca.50 mL. The resulting precipitate was filtered, washed with n-heptane (20 mL), and dried over N2 purge for 2 hours to give the title compound (30.1 g, 91%).
[0172] 1H NMR (400 MHz, CDCl3, 296 K) (a 1:2 mixture of diastereomers) δ (ppm) = 7.58 - 7.51 (m, 8H), 7.47 - 7.41 (m, 4H), 4.04 (dt, J = 3.9, 10.7 Hz, 1H), 3.65 - 3.56 (m, 4H), 2.27 - 2.12 (m, 6H), 1.89 (m, 3H), 1.81 (m, 3H), 1.75 - 1.58 (m, 3H), 1.49 - 1.25 (m, 8H), 1.23 - 1.16 (m, 1H), 1.07 - 0.86 (m, 1H);31P NMR (162 MHz, CDCl3, 296 K) δ (ppm) = 107.01 (s, 1P), 103.23 (s, 2P); MS (ESI) m / z: [M+H]+calcd for C12H15BrOPS3380.91; Found 380.84.
[0173] (Compound 6) rac-2-((4- bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide:
[0174] A solution of (3aR,7aR)-2-((4- bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-sulfide (10.0 g, 26.2 mmol) in CH2Cl2 (170 mL) was treated with SeO2 (2.91 g, 26.2 mmol) and stirred at room temperature for 2 hours. Additional SeO2 (2.91 g, 26.2 mmol) was added and stirring was continued at rt for an additional 19 hours. The reaction mixture was Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 filtered through a dry silica gel pad and rinsed with CH2Cl2. The filtrate was washed with 10% NaH2PO4 (70.0 mL), dried over MgSO4 and concentrated in vacuo. The residue was treated with n-heptane (46 mL) and the resulting slurry was stirred at room temperature for 20 minutes. The precipitate was filtered, washed with n- heptane (20 mL) and dried over N2 purge to give the title compound (6.18 g, 64.5%).
[0175] 1H NMR (400 MHz, CDCl3, 296 K) (ca.1:2 mixture of two diastereomers) δ (ppm) = 7.58 - 7.48 (m, 12H), 4.10 (dt, J = 4.1, 10.8 Hz, 1H), 3.60 (dt, J = 3.6, 10.8 Hz, 2H), 3.37 (dt, J = 3.9, 10.8 Hz, 2H), 2.43 - 2.36 (m, 1H), 2.25 - 2.07 (m, 5H), 1.98 - 1.83 (m, 4H), 1.83 - 1.73 (m, 3H), 1.63 - 1.48 (m, 3H), 1.46 - 1.23 (m, 8H), 1.11 - 0.99 (m, 1H);31P NMR (162 MHz, CDCl3, 297 K) δ (ppm) = 62.54 (s, 1P), 56.98 (s, 2P); MS (ESI) m / z: [M+H]+calcd for C12H15BrO2PS2364.94; Found 364.97. General Procedure 4: PO-PSI monomer
[0176] (Compound 7-1) 1-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((3aR,7aR)-2- oxidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-5- methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one:
[0177] 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4- hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1- methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one (4.30 g, 6.15 mmol) and (3aR,7aR)-2-((4-bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2- oxide (3.15 g, 8.62 mmol) were azeotroped three times with acetonitrile (43 mL). The residue was dissolved in acetonitrile (43 mL), cooled to 0oC, and treated with DBU (1.6 mL, 8.3 mmol). The mixture was stirred at 0oC for 2 hours, quenched with saturated NaH2PO4 (40 mL), and diluted with ethyl acetate (50 mL). The organic layer was separated, and the aqueous layer was extracted twice with ethyl acetate (50 mL). The organic layers were combined, washed with sat. NaHCO3 (20 mL), dried over MgSO4, and concentrated in vacuo. The residue was purified by silica gel column chromatography (ethyl acetate in n-heptane = 17% to 100% and then THF in Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 ethyl acetate = 0% to 100%) to give the title compound (3.07 g, 57.1%) as a foaming solid.
[0178] MS (ESI) m / z: [M+H]+calcd for C45H56N4O10PS 875.3; Found 875.1.
[0179] (Compound 7-2) (3aR,7aR)-2-(((2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(6-(((E)-1- methylpyrrolidin-2-ylidene)amino)-9H-purin-9-yl)tetrahydrofuran-3- yl)oxy)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide:
[0180] (2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2- methoxyethoxy)-5-(6-(((E)-1-methylpyrrolidin-2-ylidene)amino)-9H-purin-9- yl)tetrahydrofuran-3-ol (2.70 g, 3.81 mmol) and (3aR,7aR)-2-((4- bromophenyl)thio)hexahydrobenzo[d][1,3,2]oxathiaphosphole 2-oxide (1.95 g, 5.33 mmol) were azeotroped three times with acetonitrile (25.4 mL) in the rotary evaporator. The residue was dissolved in acetonitrile (25.4 mL), cooled to 0oC, and treated with DBU (0.78 mL, 5.1 mmol). The mixture was stirred at 0oC for 2 hours, quenched with saturated NaH2PO4 (30 mL), and diluted with ethyl acetate (30 mL). The organic layer was separated, and the aqueous layer was extracted twice with ethyl acetate (30 mL). The organic layers were combined, washed with saturated NaHCO3 (20 mL), dried over MgSO4, and concentrated in vacuo. The residue was purified by column chromatography (ethyl acetate in n-heptane = 17% to 100%, and then THF in ethyl acetate = 0% to 100%) to give the title compound (2.10 g, 62.3%) as a foamy solid.
[0181] MS (ESI) m / z: [M+H]+calcd for C45H54N6O9PS 884.33 Found 884.45. Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0182] (Compound 7-3) 9-((2R,3R,4R,5R)-5-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-methoxyethoxy)-4-(((3aR,7aR)-2- oxidohexahydrobenzo[d][1,3,2]oxathiaphosphol-2-yl)oxy)tetrahydrofuran-2-yl)-2-((1- methylpyrrolidin-2-ylidene)amino)-1,9-dihydro-6H-purin-6-one:
[0183] Prepared according to general procedure 4, a white foamy solid; 80% yield; MS (ESI, m / z) calculated for [C45H53N6O10PS + H+] 901.33 found 901.1. General Procedure 5: Synthesis of Monomer Succinates
[0184] To the protected nucleoside (1.0 eq.) and succinic anhydride (1.5 eq.) were added DCM (8 vol) and Et3N (3.0 eq.) at room temperature. The mixture was stirred overnight at room temperature. To the mixture was added phosphate buffer (pH 7, 6 vol) and extracted with DCM (8 vol) 3 times. Then the organic layers were concentrated and purified by a column chromatography (Heptane / EtOAc, 10 to 100%). (5-methyl-C-MOE succinate): Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0185] (Compound 8) 4-(((2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(5-methyl-4-(((E)-1- methylpyrrolidin-2-ylidene)amino)-2-oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)- 4-oxobutanoic acid:
[0186] To 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4- hydroxy-3-(2-methoxyethoxy)tetrahydrofuran-2-yl)-5-methyl-4-(((E)-1- methylpyrrolidin-2-ylidene)amino)pyrimidin-2(1H)-one (5 g, 7.155 mmol) and succinic anhydride (1.074 g, 10.732 mmol) in DCM (40.0 mL, 621.71 mmol) was added Et3N (2.99 mL, 21.465 mmol) at room temperature. The mixture was stirred overnight at room temperature. To the mixture was added phosphate buffer (pH 7, 30 mL) and extracted with DCM (50 mL X 3). Then the organic layers were concentrated and purified by a column chromatography (Hept / EtOAc, 10 to 100%) to give 4- (((2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2- methoxyethoxy)-5-(5-methyl-4-(((E)-1-methylpyrrolidin-2-ylidene)amino)-2- oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)-4-oxobutanoic acid (4.92 g, 6.16 mmol, 86 % yield).
[0187] 1H NMR (400 MHz, CD3CN) δ ppm 7.59 (1 H, s), 7.47 (2 H, d, J=7.50 Hz), 7.31 - 7.39 (6 H, m), 7.24 - 7.31 (1 H, m), 6.91 (4 H, d, J=8.63 Hz), 6.04 (1 H, d, J=5.25 Hz), 5.35 (1 H, t, J=5.13 Hz), 4.35 (1 H, t, J=5.32 Hz), 4.14 - 4.25 (1 H, m), 3.79 (6 H, s), 3.74 - 3.78 (1 H, m), 3.66 (1 H, dt, J=11.44, 4.28 Hz), 3.44 - 3.52 (4 H, m), 3.33 - 3.40 (2 H, m), 3.26 (3 H, s), 3.05 - 3.11 (2 H, m), 3.04 (3 H, s), 2.50 - 2.65 (4 H, m), 2.00 - 2.08 (2 H, m), 1.99 (1 H, s), 1.61 (3 H, s); MS (ESI, m / z) Calculated for [C43H50N4O11+H+] 799.35; Found 799.9. General Procedure 6: Solid Phase Synthesis of Stereo-controlled PS MOE ASO
[0188] A general procedure for automated solid-phase synthesis of stereo-controlled PS-oligonucleotides was modified from the reported procedures in Knouse et al., “Unlocking P(V): Reagents for chiral phosphorothioate synthesis,” Science 2018, 361 (6408), 1234-1238; and Huang et al., “A P(V) platform for oligonucleotide synthesis,” Science 2021, 373 (6560), 1265-1270. Automated Solid-Phase Oligonucleotide Synthesis: Part 1. Loading to Resin: Preparation of 1mer Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0189] TentaGel S-NH2 (AC354610050, ACROS Organics, loading 0.2 to 0.3 mmol / g) (4 g, ~ 1 mmol) was placed in a 50 mL solid phase reaction flask and washed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3). To the resin were added N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-methylglycine (3.11 g, 10.00 mmol) in DMF (5.00 mL) and ((3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)oxy)tri(pyrrolidin- 1-yl)phosphonium hexafluorophosphate(V) (5.21 g, 10.00 mmol) in DMF (5 mL) followed by N-4-methylmorpholine (2199 mL, 20.00 mmol) at room temperature. It was shaken at 400 rpms. After 24 hours, the liquid was drained and the resin was rinsed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3). To the resin was added premixed pyridine (4.85 mL, 60.00 mmol) and Ac2O (0.944 mL, 10.00 mmol) at room temperature. After 3 minutes, the solution was drained and premixed pyridine (4.85 mL, 60.00 mmol) and Ac2O (0.944 mL, 10.00 mmol) were added at room temperature. After 3 minutes, the liquid was drained and the resin was washed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3).
[0190] Then, the resin was treated with 30 mL of 20% piperidine in DMF and the solution was collected after 3 minutes. This process was repeated 5 times and the resin was washed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3). A solution of 20% piperidine in DMF was added to the collected solution to make 300 mL in a volumetric flask. An aliquot of this solution was diluted 10-fold with 20% piperidine in DMF and the UV absorbance of the piperidine–fulvene adduct was measured (λ = 301 nm, ε = 7800 M-1cm-1, A = 2.41) to give 230 µmol / g as an estimated loading.
[0191] The resin was washed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3). To the resin was added 4-(((2R,3R,4R,5R)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)-5-(5-methyl-4-(((E)-1- methylpyrrolidin-2-ylidene)amino)-2-oxopyrimidin-1(2H)-yl)tetrahydrofuran-3-yl)oxy)- 4-oxobutanoic acid (1.5 eq., 1.198 g, 1.5 mmol)) in DMF (5 mL) followed by ((3H- [1,2,3]Triazolo[4,5-b]pyridin-3-yl)oxy)tri(pyrrolidin-1-yl)phosphonium Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 hexafluorophosphate(V) (1.7 eq., 0.886 g, 1.7 mmol) in DMF (5 mL) and N-4- Methylmorpholine (2 eq.0.258 g, 2 mmol). The mixture was shaken at room temperature for 3 days and washed with DMF (10 mL X 3), DCM (10 mL X 3) and DMF (10 mL X 3).
[0192] The resin was washed with DMF (10 mL X 3), DCM (10 mL X 3). It was treated for 2 minutes with 3% dichloroacetic acid (DCA) in DCM (20 mL) followed by DCM (20 mL) washing to remove the DMTr group. The process was repeated (> 5 times) until no color was observed. Then the resin was washed with DCM (10 mL X 3), DMF (10 mL X 3) and MeCN (10 mL X 3).
[0193] The combined deprotection solutions were diluted with 3% DCA in DCM. The UV absorbance of the DMTr cation was measured (λ = 410 nm, ε = 30,400 M-1cm-1) to quantify the loading (0.2 mmol / g). Part 2. Automated synthesis on K & A H-8-SE Oligo Synthesizer
[0194] The prepared 5′-O-DMTr-nucleotide-loaded TentaGel-SAR (20 μmol, 200 μmol / g) was packed in an empty 6 mL syringe column (Biocomma Limited, Cat# RSSC-6) and washed with MeCN. The stereopure oligonucleotides were synthesized on K &A H-8-SE Oligo Synthesizer following the cycles shown in Table 2 using stereopure PSI monomers and PO-PSI monomers. As shown in the schemes below: Sp phosphorothioate linkage was obtained using Rp-PSI-monomers that were prepared from (-)-PSI reagent; Rp phosphorothioate linkage was obtained using Sp-PSI-monomers that were synthesized from (+)-PSI, and PO internucleotide linkages were obtained using PO-PSI monomers.
[0002] Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0195] Monomers in the synthesis of Sp, Rp phosphorothioate and PO (phosphodiester) internucleotide linkages. Table 2. Protocol for automated solid phase synthesis of MOE PS oligonucleotides Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 *Base wash solution: MeCN / 2,6-lutidine / DBU = 20 / 2 / 1 (v / v / v) **Coupling: monomer (0.2 mmol) in MeCN (2 mL, 0.1 M) and base solution [2,6- lutidine 1.1 mL (1 M), DBU 0.5 mL (0.3 M), MeCN 10 mL] (0.9 mL) (>10 eq. DBU and >40 eq.2,6-utidine) was transferred to the column. It was shaken for 16 hours, drained and washed, and conversion was analyzed by RP HPLC-Mass after cleavage from a bit of resin (28% NH4OH / EtOH / NH4OAc (9 / 2 / 1, v / v / w), 65°C, 4 hours). >95% conversion was achieved while lower conversions were observed either without 2,6-lutidine or shorter reaction time: no 2,6-lutidine, DBU (15 eq.): ~50% conversion or Monomer (10 eq.), 2,6-lutidine (50 eq.), DBU (15 eq.), 8h: ~80% conversion.
[0196] Analytical HPLC Method 1-RP HPLC-Mass: Column: Acquity UPLC BEH C18 1.7 µm 2.1x50 mm (Part Number: 186002350); Solvents: Buffer A (10 mM ammonium bicarbonate in water), Buffer B (100 mM ammonium bicarbonate / MeOH / MeCN = 10 / 10 / 80); temperature: 60°C; Flow rate: 0.8 mL / min; Gradient: 5 ~ 99% B gradient (6 min). Part 3. Cleavage from Resin and Deprotection:
[0197] After completion of the last cycle (DMTr-On), the resin in cleavage solution (28% NH4OH / NH4OAc / EtOH (10 / 1 / 1, ~1 mL / 1 µmol) was heated at 65°C for 2 days in a closed bottle. It was cooled to room temperature, filtered, and then concentrated. The failed sequences were removed and DMTr group was deprotected by the below C18 cartridge protocol. The collected fractions were concentrated and purified by an Ion-Pairing Reverse-Phase (IR-RP) HPLC. C18 column protocol: Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0198] Sep-Pak cartridge [Waters, Sep-Pak Vac 35cc (10 g) C18 Cartridge] was equilibrated with MeOH (2 CV), MeCN (2 CV) followed by 2 N Et3NHOAc (2 column volumes (CV)). The crude sample in 0.1 N Et3NHOAc was loaded on a cartridge. The cartridge was washed with 2 N NaCl / MeCN (5 / 1, v / v) to elute truncated sequences, and 3% TFA in water (150 mL), then water (50 mL). The crude DMTr-off PS-oligonucleotide was eluted with 50 mL of acetonitrile–water (1:1, v / v) containing 0.5% of 28% NH4OH. The solution containing crude DMTr-off oligonucleotide was dried under vacuum. The weight was measured by Nanodrop (RNA-40) and31P NMR was taken. It was analyzed by RP-HPLC, IEX-HPLC and UPLC / MS.
[0199] Analytical HPLC Method 2-Ion-pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (2.5 µm, 150 x 2.1 mm); Temperature: 60°C; Flow rate: 1 mL / minute; Detection wavelength: 260 nm; Solvents: buffer A: 100 mM HFIP / 8.6 mM Et3N (H2O), buffer B:100% MeOH; Gradient: 5% to 30% B gradient (15 minutes).
[0200] Analytical HPLC Method 3-Ion-pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (300Å, 2.5 µm, 150 x 2.1 mm); Temperature: 60°C, Flow rate: 0.5 mL / minute; Detection wavelength: 260 nm; Solvents: Buffer A: 100 mM n- C6H13NH3OAc (H2O / MeCN 9 / 1) Buffer B: 100 mM C6H13NH3OAc (H2O / MeCN 1 / 1); Gradient: 80% to 100% B gradient (15 minutes).
[0201] Analytical HPLC Method 4-Ion-pairing RP HPLC-Mass: Column: XBridge Premier BEH C18 (300Å, 2.5 µm, 150 x 2.1 mm); Temperature: 60°C, Flow rate: 0.5 mL / min. Detection wavelength: 260 nm; Solvents: buffer A: 10 mM n- Hexylamine / 50mM HFIP in water, buffer B: MeCN; Gradient: 23 ~ 28% Buffer B gradient (15 minutes). Part 4. HPLC purification and desalting:
[0202] The crude material after SepPak treatment was purified by an ion-pairing RP HPLC by the following methods using sterile water (WFI from Baxter, VWR cat. 68000-955).
[0203] Preparative HPLC Method 1: Column: XBridge Prep C18 OBD Prep (10 µm, 19 x 250 mm); Flow rate: 30 mL / minute. Detection wavelength: 260 nm; Solvents: buffer A: 8.6 mM TEA / 100 mM HFIP in water, Buffer B: MeOH; Gradient: 10~37% Buffer B gradient (30 minute). Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0204] Preparative HPLC Method 2: Column: Xbridge BEH C18 (10 µm, 10 x 250mm); Flow rate: 14 mL / minute. Detection wavelength: 260 nm; Solvents: buffer A: 100 mM C6H13NH3OAc (H2O / MeCN 9 / 1), Buffer B: 100 mM C6H13NH3OAc (H2O / MeCN 1 / 1); Gradient: 50% to 75% gradient (26 min)
[0205] Preparative HPLC Method 3: Column: XBridge C18 OBD Prep (300 Å, 5 µm, 19x250 mm); Flow rate: 30 mL / minute; Detection wavelength: 260 nm; Solvents: buffer A: 10 mM HA / 50 mM HFIP in water, Buffer B: MeCN; Gradient: 23 ~ 28% Buffer B gradient (30 minutes).
[0206] The fractions containing the desired compound were concentrated and dissolved with 0.2 N NaCl in EtOH / water (1 / 4). The resulting solution was desalted by membrane filtration by using a 3000 MW cut-off (3K centrifugal membrane tube, Amicon Ultra-15, Ultracel-3K (3400 rpm, 45 minutes) (cat.UFC900396 from Sigma- Aldrich) or Macrosep Devices (cat. MAP003C38) from PALL, 3400 rpm, 40 minutes, 15 mL WFI X 3). The final desalted solution was filtered (0.2 micron sterile syringe filter). The absorbance of the diluted solution was measured at 260 nm on a Nanodrop UV-Vis spectrophotometer to give a yield (7 ~ 15% yield) and endotoxin level was confirmed to be less than 0.06 EU / mg by a kinetic chromogenic LAL method (Charles River, Endosafe®nexgen-PTS). Part 5. Tm measurement with reverse complementary RNA and NMR
[0207] Tm measurement device: Shimadzu UV-2700 UV-Vis Spectrophotometer
[0208] Protocol 1: ASO samples were prepared at a concentration of 400 µM using deionized water. IDT’s reverse complementary RNA (rcRNA) was dissolved to 400 µM using UltraPure Distilled water.10 µL aliquots of each stock solution were diluted to 1 mL using ultra pure distilled water, and their actual concentrations were measured by UV-Vis Spectrophotomer. Test samples (500 µL) were prepared containing 4.0 µM ASO with 4.0 µM rcRNA in buffer (100 mM NaCl, 10 mM Na phosphate pH 7.0 with 0.1 mM EDTA). Test samples were incubated in a 1 mL cuvette and heated from 15 ^C to 105 ^C at 0.5 ^C / minute. UV absorbance increase due to strand melting was monitored at 260 nm. Prior to the experiment, the samples were melted and reannealed by heating from 25 ^C to 95 ^C at 5 ^C / minute and Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 cooling to starting temperatures to ensure complete annealing. Shimadzu Tm Analysis software was used to calculate the Tm (curve inflection point: 50% melting) using the derivative function.
[0209] Protocol 2: ASO samples were prepared at a concentration of 200 µM using PBS and then followed the same procedure as protocol 1 with adjusted amount.
[0210] 31P NMR (162 MHz) was taken in stock phosphate buffer (100 mM, pD = 7.4) that was prepared with 135.5 mg of K2DPO4and 31.2 mg of KD2PO4in 10 mL D2O after C18 purification and deprotection of DMTr. See Evstigneev et al., “Hexamer oligonucleotide topology and assembly under solution phase NMR and theoretical modeling scrutiny,” Biopolymers 2010, 93 (12), 1023-1038. Exemplary Compounds
[0211] All nucleotides are 2’-O-MOE unless specified and “C” represents 5’-Methyl cytosine.
[0212] Compound MOE-296: 5'-CCGAAAGAAGTATGAACC-3' (SEQ ID NO:252); Stereopattern: SSSOSSRSSSRSSOSSS.
[0213]
[0214] Purified by Preparative HPLC Method 3: C234H335N76O121P17S15 MW = 7154.38 with a theoretical value of m / z 1787.59 as the [M-4H]4-ion using the most abundant natural isotopes, was detected by low resolution mass spectrometry at m / z 1787.56; Tm = 61.3°C by Protocol 2. Monoisotopic Mass Calcd 7151.37; Found: 7151.42 (deconvoluted HRMS spectrum).
[0215] 31P NMR (162 MHz) δ ppm 58.26, 58.20, 57.84, 57.65, 57.49, 57.40, 57.16, 56.97, 0.33
[0003] Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 7122.43 with a theoretical value of m / z 1779.50 as the [M-4H]4-ion using the most abundant natural isotopes, was detected by low resolution mass spectrometry at m / z 1779.42; Tm = 61.4°C by Protocol 2. Monoisotopic Mass Calcd 7119.42; Found: 7119.47 (deconvoluted HRMS spectrum).
[0219] 31P NMR (162 MHz) δ ppm 55.54, 55.49, 55.72, 55.26, 55.14, 55.11, 54.98, - 1.02, -1.06, -1.14, -1.47 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0222] Purified by Preparative HPLC Method 3: C234H335N76O121P17S15 MW = 7154.38 with a theoretical value of m / z 1787.59 as the [M-4H]4-ion using the most abundant natural isotopes, was detected by low resolution mass spectrometry at m / z 1788.19; Tm = 59.0°C by Protocol 2. Monoisotopic Mass Calcd 7151.37; Found: 7151.40 (deconvoluted HRMS spectrum).
[0223] 31P NMR (162 MHz) δ ppm 56.03, 55.84, 55.70, 55.56, 55.45, 55.27, 55.24, 55.11, 54.95, -1.10, -1.20 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304
[0225]
[0226] Purified by Preparative HPLC Method 3: C260H372N83O135P19S17 Mw = 7950.51 with a theoretical value of m / z 1986.62 as the [M-4H]4-ion using the most abundant natural isotopes, was detected by low resolution mass spectrometry at m / z 1986.92; Tm = 58.5°C by Protocol 1. Monoisotopic Mass Calcd 7948.51; Found: 7948.56 (deconvoluted HRMS spectrum).
[0227] 31P NMR (162 MHz) δ ppm 55.91, 55.76, 55.52, 55.20, 55.10, 54.99, 54.89, - 0.99, -1.05, -1.09 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 Example 2: In vitro assay to assess skipping efficiency of phosphorothioate (PS) oligonucleotides in mouse BMDMs
[0228] In this Example, the in vitro activities of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 were evaluated in primary mouse BMDMs isolated from transgenic hCD33 mice.
[0229] Freshly isolated mouse BMDM cells were cultured and maintained using appropriate media (Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum) plus recombinant murine CSF. The Assay was performed in 96 well plate format, seeding about 30,000 cells per well and treating with the ASO at a concentration of 0.16 µM, 0.312 µM, 0.625 µM, 1.25 µM, 2.5 µM, 5 µM, 10 µM and 20 µM without addition of lipofectamine. Cells were incubated at 37°C in a cell culture incubator for 48 hours before isolating the total RNA. Total RNA was isolated and cDNA was synthesized per vendor protocol, then Taqman gene expression assays were used to quantify Exon-2: skipped CD33 (Forward primer: Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 CGCTGCTGCTACTGCTG (SEQ ID NO:207); Reverse Primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO:208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO:209)) and un-skipped CD33 (Forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO:210); Reverse Primer: GTGCCAGGGATGAGGATTT (SEQ ID NO:211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO:212)) mRNA transcripts. Mouse house-keeping gene HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) expressions were used to normalize the target transcript expressions. Non-targeting (NTC) MOE sequence CCTTCCCTGAAGGTTCCTCC (SEQ ID NO: 257) was used (Mullick et al. (2011) J. Lipid Res.52, 885).
[0230] The in vitro Exon-2 skipping efficiencies (%) (also referred to as D2 skipping %) as a function of ASO concentration (µm) for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in mBMDM cells are shown in FIG.1. The average Exon-2 skipping efficiencies for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 and the NTC control are shown in Table 3. Table 3 Example 3: In vitro assay to assess skipping efficiency of phosphorothioate (PS) oligonucleotides in human Induced Pluripotent Stem Cell-derived microglia (iPSC microglia)
[0231] In this Example, the in vitro activities of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 were evaluated using the Exon-Skipping Efficiency Assay Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 for MOE ASOs with human induced pluripotent stem cell-derived microglia (iPSC- derived microglia).
[0232] For this Exon-Skipping Efficiency Assay for MOE ASOs, human iPSC-derived microglia (iMG) cells that were purchased from BrainXell Therapeutics (Cat# BX- 0900) were used. Frozen iMG cells were thawed and cultured for experimental plating according to vendor protocol (https: / / static1.squarespace.com / static / 5936c50fbe6594d92e8321a2 / t / 5ebb14fbeb8e 7c0525a511d6 / 1589318907610 / BrainXell+Cryopreserved+Human+Microglia+- +Protocol+v1.2.pdf).
[0233] The Assay was performed in 96 well plate format, seeding 20,000 cells per well 24 hours before wells were treated with one of Compounds MOE-296, MOE- 305, MOE-307, and MOE-308. Cells were then treated with the MOE ASOs without additional transfection reagents at desired concentrations on the second day. Cells were incubated at 37°C in a cell culture incubator with 5% CO2 for 48 hours before isolating the total RNA. Total RNA was isolated and cDNA was synthesized per vendor protocol, then Taqman gene expression assays were used to quantify Exon-2 skipped CD33 (Forward primer: CGCTGCTGCTACTGCTG (SEQ ID NO:207); Reverse Primer: TTCTAGAGTGCCAGGGATGA (SEQ ID NO:208); and probe: TGTGGGCAGACTTGACCCACAG (SEQ ID NO:209) and un-skipped CD33 (Forward primer: GGATGGAGAGAGGAAGTA (SEQ ID NO:210) or TTCGGATGGAGAGAGGAAGTA (SEQ ID NO:291); Reverse Primer: GTGCCAGGGATGAGGATTT (SEQ ID NO:211); and probe: TGCATGTGACAGACTTGACCCACA (SEQ ID NO:212)) mRNA transcripts. Mouse house-keeping gene HPRT1 (Assay ID: Hs02800695_m1; ThermoFisher Scientific) expression was used to normalize the target transcript expressions.
[0234] The in vitro Exon-2 skipping efficiencies (%) as a function of ASO concentration (µM) for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in human iMG cells are shown in FIG.2. In FIG.2, Exon-2 skipping efficiency is shown as a function of Log (ASO concentration (µM)) for Compounds MOE-296 and MOE- 305 (left) and Compounds MOE-307 and MOE-308 (right). The average Exon-2 skipping efficiencies for Compounds MOE-296, MOE-305, MOE-307, and MOE-308 and the NTC control are shown in Table 4. Table 4 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 Example 4: In vivo studies in hCD33 mice
[0235] In this Example, the in vivo activities of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 were evaluated in transgenic hCD33 mice with a 30, 100 and 300 µg ICV dose at 30 days and 90 days. hCD33 Mouse Model
[0236] Humanized CD33 mouse models were used to study CD33 Exon-2 skipping ASOs in vivo. CRISPR / Cas9 mediated gene editing was used to replace murine CD33 with human genomic CD33, including the signal peptide. Murine 3’ and 5’ untranslated regions were retained. For the in vivo assays, mixed gender cohorts of human CD33 mouse lines on a C57BL / 6 background were used. Mice were 12-24 weeks old at the time of dosing.
[0237] ASOs were administered as solution in PBS via intracerebroventricular (ICV) injection into the right lateral ventricle in a 10 µL bolus injection on day 1. Mice were necropsied 30 days or 90 days after the injection. At necropsy, mice were transcardially perfused with PBS under avertin anesthesia. Brains were rapidly removed from the skull, and the cortex and hippocampus were dissected from the injected hemisphere for use in exon skipping evaluation. Target Engagement by qPCR
[0238] For RNA isolation, frozen tissue was added with 9X volume of Trizol and homogenized for 3 minutes using Qiagen TissueLyser.500 µL of the Trizol lysate was transferred to a 1 mL deep well plate.100 µL of chloroform was added to each sample, shaken vigorously, and centrifuged at 4000xg for 5 minutes. The Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 supernatant (250 µL) was transferred to the binding plate from SV96 total RNA extraction kit (Promega) and RNA was extracted per the same protocol. Total RNA was isolated and cDNA was synthesized per SV96 protocol (Promega), then Taqman gene expression assays were used to quantify Exon-2 skipped CD33 mRNA transcripts. Mouse house-keeping gene HPRT1 expression was used to normalize the target transcript expressions.
[0239] The data can be expressed as the amount (%) of Exon2 skipped CD33 mRNA in vivo relative to PBS control. The in vivo Exon-2 skipping efficiencies (%) of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 after 30 days and 90 days in hCD33 mice with 30 µg, 100 µg and 300 µg doses are shown in FIGS.3, 4, 54, and 6 respectively. Hybridization ELISA for determining concentration of ASOs in brain tissues
[0240] ASO concentrations were quantified in mouse cortex and hippocampus using a hybridization-based immunoassay method (HELISA). Two single-stranded DNA oligonucleotides with complementary sequences to MOE-296, MOE-305, MOE-307, and MOE-308 were designed as Detection probe: TCTTTCGGAT / 3’-Bio (TCTTTCGGAT (SEQ ID NO:258)); and Capture probe: 5’-DigN / GGTTCATACT (GGTTCATACT (SEQ ID NO: 259))(Integrated DNA Technologies, Coralville, IA).
[0241] Tissues were lysed in RIPA buffer, 1:10 (Thermo Fisher Scientific, Waltham, MA) and were diluted in hybridization buffer (1:100, 1M NaCl in TE-Buffer and 0.1%Tween20). MOE-296, MOE-305, MOE-307, and MOE-308 were spiked in diluted tissue homogenate to prepare standard curves and quality control (QC) samples.35 μL of diluted samples, standards and QCs were transferred to a 96-well PCR plate.35 μL of detection probe solution (100 nM in hybridization buffer) was added to the PCR plate containing standards and samples. Sample and detection probe were hybridized on a thermal cycler under the following conditions: 95 °C for 10 minutes, 37 °C for 60 minutes, and a final hold at 4 °C.
[0242] MSD Gold 96-well Streptavidin SECTOR plate (Meso Scale Diagnostics, LLC., Rockville, MD) was blocked with 150 µL of Casein in TBS blocker (Thermo Fisher Scientific, Waltham, MA) at room temperature for 1.5 hours. After washing, 25 Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 µL of capture probe (200 nM in hybridization buffer) was added to the MSD plate and incubated at 37 °C, 300 rpm for 1 hour. After the wash step, 25 µL of samples, standards and QCs were transferred to an MSD plate in duplicate and were incubated at 37 °C for 1 hour on a shaking platform (300 rpm). The plate was then washed 3 times and incubated for 1 hour with 50 μL of 1 μg / mL ruthenium labeled anti-digoxygenin antibody in Casein in TBS Blocking Buffer and 0.05% Tween20.
[0243] After the final wash, 150 μL of 2X MSD Read Buffer T (Meso Scale Diagnostics, LLC., Rockville, MD) was added and the plate was read on an MSD Sector S 600 instrument (Meso Scale Diagnostics, LLC., Rockville, MD). A nonlinear regression analysis was performed to calculate the concentrations of reference compound from the signal intensities via interpolation from a calibration curve using 4-parameter logistic (4PL) model (weighting factor = 1 / Y2) in Discovery Workbench 4.012.1 (Meso Scale Diagnostics, LLC., Rockville, MD).
[0244] Pharmacokinetic (PK) data (ASO concentration) and PK / PD correlation for ICV-administered Compounds MOE-296, MOE-305, MOE-307, and MOE-308 in hCD33 mice are shown in FIGS.7, 8, 9, and 10 respectively. Example 5: In vivo studies in hCD335XFAD mice
[0245] In this Example, the in vivo activity of Compound MOE-307 was evaluated in transgenic 5XFAD hCD33 mice with a single 300 µg ICV dose and a 60-day qPCR readout.
[0246] Mouse model generation: 5XFAD hCD33 mice were generated by crossing the humanized CD33 mouse model described in Example 4 with the 5XFAD mouse model (doi: 10.1523 / JNEUROSCI.1202-06.2006). The 5XFAD mouse model overexpresses human amyloid beta precursor protein with three familial Alzheimer’s disease (FAD) mutations (Swedish (K670N, M671L), Florida (I716V), and London (V717I)) and human presenilin 1 containing two FAD mutations (M146L and L286V).
[0247] Target engagement by qPCR: The in vivo skipping activity of Compound MOE-307 after 60 days in 5XFAD hCD33 mice with a 300 µg dose was obtained according to the protocol described in Example 4. NTC-4 (Scrambled non-target Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 control ASO: GATATCACGCGGACAAAA with stereorandom all PS bonds (SEQ ID NO: 300) was used as a control. The in vivo Exon-2 skipping efficiencies of Compound MOE-307 and two controls (PBS and NTC-4) are shown in FIG.11. Example 6: In vivo safety studies in WT mice
[0248] Tolerability of Compounds MOE-296, MOE-305, MOE-307, and MOE-308 was evaluated in WT mice (C57BL / 6) with 700 µg total dose of each compound (administered as 2 x 350 µg on day 0 and day 4). Histopathological evaluation of brain cross-sections conducted after 60-day exposure did not reveal any changes compared to vehicle-treated and non-targeting ASO treated groups.
[0249] The concentration of NF-L (neurofilaments, light subunit) in CSF (cerebrospinal fluid) collected at day 60 was evaluated as a marker of potential toxicity. Non-targeting (NTC) MOE sequence CCTTCCCTGAAGGTTCCTCC (SEQ ID NO: 257) was used as a comparison.
[0250] FIG.12 shows the NF-L measurements in the CSF of vehicle-treated, NTC- treated, and compound-treated mice. As shown in FIG.12, there were no significant changes in NF-L induced by Compounds MOE-296, MOE-305, MOE-307, and MOE-308 compared to the vehicle-treated and NTC-treated groups. The corresponding PK (compound exposure in hippocampus and cortex 60 days after 2x350 µg ICV administered dose) is also shown in FIG.12.
[0251] Neurofilament light chain (NF-L) levels were measured from mouse CSF samples using a Simple Plex Mouse NF-L Cartridge (R&D Systems catalog # SPCKA-MP-003168) in the Ella automated ELISA system.3 µL of CSF was added to 57 µL of diluent, 50 µL of this sample was loaded onto the cartridge. The assay was run using the manufacturer's protocol. NF-L level in the CSF is a marker of axonal damage used to assess neurodegeneration (https: / / doi.org / 10.1038 / s41467-021- 23620-z).
Claims
Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 What is claimed is:
1. An antisense oligonucleotide comprising all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12), wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
2. An antisense oligonucleotide selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12), wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
3. The antisense oligonucleotide of any one of claims 1-2, wherein the antisense oligonucleotide is MOE-296 (SEQ ID NO:252).
4. The antisense oligonucleotide of any one of claims 1-2, wherein the antisense oligonucleotide is MOE-305 (SEQ ID NO:252).
5. The antisense oligonucleotide of any one of claims 1-2, wherein the antisense oligonucleotide is MOE-307 (SEQ ID NO:252).
6. The antisense oligonucleotide of any one of claims 1-2, wherein the antisense oligonucleotide is MOE-308 (SEQ ID NO:12).
7. The antisense oligonucleotide of any one of claims 1-6, wherein the antisense oligonucleotide is a sodium salt.
8. The antisense oligonucleotide of any one of claims 1-6, wherein the antisense oligonucleotide is a calcium salt.
9. The antisense oligonucleotide of any one of claims 1-6, wherein the antisense oligonucleotide is a magnesium salt.Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 10. The antisense oligonucleotide of any one of claims 1-6, wherein the antisense oligonucleotide is a potassium salt.
11. The antisense oligonucleotide of any one of claims 1-10, wherein the antisense oligonucleotide has a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs.
12. A composition comprising the antisense oligonucleotide of any one of claims 1- 11 and optionally a pharmaceutically acceptable carrier or excipient.
13. A method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing an antisense oligonucleotide into a cell, wherein the antisense oligonucleotide comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12), and wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt. .
14. A method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing an antisense oligonucleotide into a cell, wherein the antisense oligonucleotide is selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12), and wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
15. The method of any one of claims 13-14, wherein the cell is an animal cell.
16. The method of claim 15, wherein the cell is a human cell.
17. A method of treating a subject having a neurodegenerative disease comprising administering to said subject a therapeutically effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises all or a portion of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and / or MOE-308 (SEQ ID NO:12), and wherein the antisensePrivileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
18. A method of treating a subject having a neurodegenerative disease comprising administering to said subject a therapeutically effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide is selected from the group consisting of MOE-296 (SEQ ID NO:252), MOE-305 (SEQ ID NO:252), MOE-307 (SEQ ID NO:252), and MOE-308 (SEQ ID NO:12), and wherein the antisense oligonucleotide is a pharmaceutically acceptable sodium salt, calcium salt, magnesium salt, or potassium salt.
19. The method of any one of claims 17-18, wherein the subject is a human subject.
20. The method of any one of claims 17-19, wherein the neurodegenerative disease is Alzheimer’s Disease.
21. The method of any one of claims 13-20, wherein the antisense oligonucleotide is MOE-296 (SEQ ID NO:252).
22. The method of any one of claims 13-20, wherein the antisense oligonucleotide is MOE-305 (SEQ ID NO:252).
23. The method of any one of claims 13-20, wherein the antisense oligonucleotide is MOE-307 (SEQ ID NO:252).
24. The method of any one of claims 13-20, wherein the antisense oligonucleotide is MOE-308 (SEQ ID NO:12).
25. The method of any one of claims 13-24, wherein the antisense oligonucleotide is a sodium salt.
26. The method of any one of claims 13-24, wherein the antisense oligonucleotide is a calcium salt.Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 27. The method of any one of claims 13-24, wherein the antisense oligonucleotide is a magnesium salt.
28. The method of any one of claims 13-24, wherein the antisense oligonucleotide is a potassium salt.
29. The method of any one of claims 13-28, wherein the antisense oligonucleotide has a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs.
30. The method of any one of claims 13-29, wherein the antisense oligonucleotide further comprises a pharmaceutically acceptable carrier or excipient.
31. An antisense oligonucleotide according to claim 1 for use in a method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing into a cell the antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide hybridizes to a target region of the CD33 gene and induces Exon-2 skipping during pre-mRNA splicing of the CD33 gene.
32. An antisense oligonucleotide according to claim 2 for use in a method of inducing Exon-2 skipping in the CD33 gene during pre-mRNA splicing, comprising introducing into a cell the antisense oligonucleotide of claim 2, wherein the antisense oligonucleotide hybridizes to a target region of the CD33 gene and induces Exon-2 skipping during pre-mRNA splicing of the CD33 gene.
33. The antisense oligonucleotide of any one of claims 31-32, wherein the cell is an animal cell.
34. The antisense oligonucleotide of claim 33, wherein the cell is a human cell.
35. An antisense oligonucleotide according to claim 1 for use in a method of treating a subject having a neurodegenerative disease, comprising administering to said subject a therapeutically effective amount of the antisense oligonucleotide of claim 1.Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 36. An antisense oligonucleotide according to claim 2 for use in a method of treating a subject having a neurodegenerative disease, comprising administering to said subject a therapeutically effective amount of the antisense oligonucleotide of claim 2.
37. The antisense oligonucleotide of any one of claims 35-36, wherein the subject is a human subject.
38. The antisense oligonucleotide of any one of claims 35-37, wherein the neurodegenerative disease is Alzheimer’s Disease.
39. The antisense oligonucleotide of any one of claims 31-38, wherein the antisense oligonucleotide is MOE-296 (SEQ ID NO:252).
40. The antisense oligonucleotide of any one of claims 31-38, wherein the antisense oligonucleotide is MOE-305 (SEQ ID NO:252).
41. The antisense oligonucleotide of any one of claims 31-38, wherein the antisense oligonucleotide is MOE-307 (SEQ ID NO:252).
42. The antisense oligonucleotide of any one of claims 31-38, wherein the antisense oligonucleotide is MOE-308 (SEQ ID NO:12).
43. The antisense oligonucleotide of any one of claims 31-42, wherein the antisense oligonucleotide is a sodium salt.
44. The antisense oligonucleotide of any one of claims 31-42, wherein the antisense oligonucleotide is a calcium salt.
45. The antisense oligonucleotide of any one of claims 31-42, wherein the antisense oligonucleotide is a magnesium salt.
46. The antisense oligonucleotide of any one of claims 31-42, wherein the antisense oligonucleotide is a potassium salt.Privileged & Confidential - Draft Application Attorney Docket No.: 08061.0059- 00304 47. The antisense oligonucleotide of any one of claims 31-46, wherein the antisense oligonucleotide has a CD33 Exon-2 skipping efficiency of 30% or greater according to a Standard Exon-Skipping Efficiency Assay for MOE ASOs.
48. The antisense oligonucleotide of any one of claims 31-47, wherein the antisense oligonucleotide further comprises a pharmaceutically acceptable carrier or excipient.