Compositions and methods for treating diseases or conditions associated with progerin expression

EP4802072A1Pending Publication Date: 2026-09-09RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024805358
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-10-30
Filing Date
2024-10-30
Publication Date
2026-09-09

AI Technical Summary

Technical Problem

Current treatments lack effectiveness in addressing the premature aging and associated diseases caused by aberrant expression of the lamin A (LMNA) gene, leading to progerin expression.

Method used

The use of RNA interference-based products and methods targeting exon 12 of the LMNA or progerin mRNAs to inhibit or downregulate the expression of aberrant LMNA or progerin, utilizing microRNAs and delivery systems such as nanoparticles, viral vectors, and extracellular vesicles.

Benefits of technology

This approach effectively inhibits the expression of progerin, thereby ameliorating, delaying the progression of, and preventing premature aging and associated diseases, such as atherosclerosis, osteoporosis, and cardiovascular disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000020_0001
    Figure IMGF000020_0001
  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000022_0001
    Figure IMGF000022_0001
Patent Text Reader

Abstract

Products, methods, and uses for treating, ameliorating, delaying the progression ui, and / or preventing a disease or disorder associated with expression of an aberrant lamin A (LMNA) gene or progerin gene are provided. Such disease or disorder includes, but is not limited to, a laminopathy, progeroid syndrome, progeria, or aging disorder resulting from the aberrant expression of LMNA or progerin. In some instances, the progeria is Hutchinson- Gilford progeria syndrome (HOPS). In some instances, the disease or disorder associated with the expression of progerin is premature aging or natural aging including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. More particularly, disclosed herein are RNA interference-based products, methods, and uses for inhibiting or downregulating the expression of progerin. Even more particularly, the disclosure provides microRNA (miRNA) for inhibiting or downregulating the expression of progerin and methods of using said miRNA to inhibit or downregulate progerin expression in cells and / or in cells of a subject having a condition resulting from the expression of progerin including, but not limited to, HGPS or progeria, an HGPS-like condition affecting LMNA mutations that affect exon 11 splicing, or a condition resulting from the expression of progerin.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR TREATING DISEASES OR CONDITIONS ASSOCIATED WITH PROGERIN EXPRESSIONINCORPORATION BY REFERENCE OF THE SEQUENCE LISTING

[0001] This application contains, as a separate part of disclosure, a Sequence Listing in computer-readable form (Filename: 59642_SeqListing.xml; Size: 189,758 bytes; Created: September 23, 2024) which is incorporated by reference herein in its entirety.FIELD

[0002] This disclosure relates to the field of the treatment of disease associated with the aberrant expression of the lamin A (LMNA) gene resulting in the expression of progerin, which makes cells unstable and leads to symptoms associated with progeria’s premature aging process or the natural aging process. In some instances, the disease or disorder associated with the aberrant expression of LMNA or progerin includes, but is not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. More particularly, the disclosure provides RNA interference-based products, methods, and uses for treating, ameliorating, delaying the progression of, and / or preventing such disease or disorder associated with aberrant LMNA gene expression or progerin expression. Specifically, the disclosure provides products and methods for targeting exon 12 of the LMNA or progerin mRNAs. More specifically, the disclosure provides products and methods for inhibiting or downregulating the expression of the aberrant LMNA or progerin gene by targeting exon 12 of the LMNA gene or the progerin gene because Lamin A and progerin mRNAs share the same exon 12 sequence. Even more specifically, the disclosure provides microRNA (miRNA) for inhibiting or downregulating the expression of aberrant LMNA or progerin and methods of using said miRNA to inhibit or downregulate the resulting aberrant expression of LMNA or progerin expression in cells and / or in a subject demonstrating such aberrant expression of LMNA or progerin or at risk of demonstrating such aberrant expression of LMNA or progerin.BACKGROUND

[0003] Hutchinson-Gilford progeria syndrome (HGPS) or progeria, is a rare geneticcondition that occurs spontaneously and is characterized by premature aging and death, mainly because of myocardial infarction, stroke, or heart failure. HGPS is inherited in an autosomal dominant manner. HGPS is primarily caused by new, non-inherited mutations that occur in the LMNA gene, specifically in codon 608 of exon 11 , located on chromosome 1 (Eriksson et al., Nature, 2003. 423(6937): 293-8). The LMNA gene encodes two essential components known as lamin A (LA or LMNA) and lamin C (LC), which form part of the nuclear lamina. This complex molecular structure is located within the inner nuclear membrane (De Sandre-Giovannoli et al., Science, 2003. 300(5628): 2055). Recent studies have revealed the crucial role of the lamina in various cellular processes, including cell division, chromatin organization, DNA replication, nuclear shape, and transcription (Goldman et al., Genes Dev, 2002. 16(5): p. 533-47). In the typical form of HGPS, the heterozygous LMNA mutation involves a substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T; p.G608G). Remarkably, this mutation does not alter the encoded amino acids, but causes a new alternative splicing event, leading to the formation of a mRNA lacking 150 nucleotides (Gruenbaum et al., Nat Rev Mol Cell Biol, 2005. 6(1 ): 21-31 ). Consequently, this mRNA is translated into a modified protein known as "progerin”, which exhibits an in-frame deletion of 50 amino acids near the C terminus (Gruenbaum et al., supra).

[0004] LMNA is widely expressed in most differentiated cells and has a significant impact on both the structural integrity and functioning of the nucleus (Gruenbaum et al., supra). On the other hand, progerin is known to exert a dominant-negative effect on the nuclear function of cells expressing LMNA. Additionally, progerin may negatively impact crucial processes including cell division, DNA replication, and transcription (Rober et al., Development, 1989. 105(2): 365-78; Goldman et al., Proc Natl Acad Sci USA, 2004. 101 (24): 8963-8; Scaffidi et al., Nat Med, 2005. 11 (4): 440-5). The toxic progerin protein elicits pathology in multiple tissues, leading to phenotypes similar to physiologic aging (e.g., atherosclerosis, alopecia, and osteoporosis) (Hennekam et al. Am J Med Genet A, 2006. 140(23): 2603-24). Progerin is known to be associated with premature aging or natural aging or a disease or disorder including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. Currently, there are no approved treatments that slow progression of HGPS, but effective progerin-targeting therapies would dramatically improve patient quality of life for patients suffering from thedisease.

[0005] Since HGPS arises from the expression of progerin, the most direct route to a therapy involves inhibiting the expression of progerin by RNA interference (RNAi). Gene silencing by RNAi is one powerful approach to inhibit progerin expression. Historically, RNAi-based therapies have relied upon two major strategies to silence dominant disease genes: (1) delivery of siRNA oligonucleotide drugs to permissive target cells or tissues; or (2) gene therapy in which designed microRNA or shRNA expression cassettes are packaged within a viral vector and expressed intracellularly following delivery. RNAi is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases.

[0006] RNAi refers to post-transcriptional control of gene expression mediated by microRNAs (miRNAs), small (21 -25 nucleotides), noncoding RNAs that share sequence homology and base-pair with 3' untranslated regions of cognate messenger RNAs (mRNAs). The interaction between the miRNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs. The RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science + Business Media, LLC (2010). As an understanding of natural RNAi pathways has developed, researchers have designed artificial miRNAs for use in regulating expression of target genes for treating disease. As described in Section 7.4 of Duan, supra, artificial miRNAs can be transcribed from DNA expression cassettes. The miRNA sequence specific for a target gene is transcribed along with sequences required to direct processing of the miRNA in a cell. miRNAs can target various mRNAs to regulate their physiological activities. Therefore, miRNAs play an important role in various physiological and pathological processes, and so they now may be used as a powerful tool to treat different diseases efficiently.

[0007] Nanoparticles, tissue-specific peptides, tissue-specific aptamers, tissue-specific antibody conjugates, extracellular vesicles, exosomes, and vectors (including, but not limited to, viral vectors) are some of the many delivery systems which could be used to deliver miRNAs. Nanoparticles offer unprecedented opportunities for cell-specific, controlled delivery of miRNAs for therapeutic purposes (Sharon Wei Ling Lee et al., J. Control Release 2019 Nov 10; 313:80-95). Tissue-specific peptides, tissue-specific aptamers, and tissuespecific antibody conjugates are increasingly becoming relevant in gene delivery and in tissue-specific gene therapy (for example, see Tarvirdipour et al, Int J Mol Sci. 2021 Aug 23;22(16):9092. doi: 10.3390 / ijms22169092; Aaldering et al., RNA Biol. 2015 Apr 7;12(4):412-425. doi: 10.1080 / 15476286.2015.1017234; Malecova et al., Nucleic Acids Res.2023 May 24;51 (12):5901 -5910. doi: 10.1093 / nar / gkad415). Extracellular vesicles can be enriched with exogenous therapeutic miRNAs and used for treatment of diseases by targeting pathological recipient cells (Munir et al., Cells 2020 Oct; 9(10):2271). Exosomes are excellent carriers for miRNA with the advantages of low immunogenicity and low toxicity (Ohno et al., Methods Mol Biol. 2016:1448:261 -70. doi: 10.1007 / 978-1 -4939-3753-0_19). Viral vectors, such as adeno-associated virus (AAV), have been used to deliver miRNAs to muscle, neurons, the brain, or other target cells or tissues.

[0008] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hardy virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0009] There remains a need in the art for products and methods for treating diseases associated with aberrant LMNA expression or progerin expression, including diseases such as laminopathies, premature aging, progeria, HGPS, and natural aging.SUMMARY

[0010] The disclosure provides products, methods, and uses for inhibiting aberrant LMNA expression or progerin expression and for treating, ameliorating, delaying the progression of, and / or preventing premature aging, natural aging or a disease or disorder associated with the expression of progerin. Such diseases or disorders include, but are not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness,abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0011] The disclosure provides nucleic acids designed to inhibit mutant LMNA expression or progerin expression; nanoparticles, tissue-specific peptides, tissue-specific aptamers, tissue-specific antibody conjugates, extracellular vesicles, exosomes, and viral vectors comprising or conjugated to the nucleic acids, compositions comprising or conjugated to the nucleic acids and nanoparticles, tissue-specific peptides, tissue-specific aptamers, tissuespecific antibody conjugates, extracellular vesicles, exosomes, and viral vectors; methods for using these products for inhibiting and / or interfering with expression of the progerin gene in a cell, and methods for treating or ameliorating disease in a subject suffering from a disease resulting from aberrant expression of LMNA or the expression of progerin.

[0012] The disclosure provides a nucleic acid encoding a progerin-targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1-52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

[0013] The disclosure provides a nucleic acid comprising a promoter sequence and a nucleotide sequence encoding a progerin-targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1-52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

[0014] In some aspects, the promoter is any of LI6, LI7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 -alpha, or a tissue-specific promoter including, but not limited to, a muscle-specific promoter or a cardiac-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

[0015] The disclosure provides a vector comprising any of the nucleic acids of the disclosure. In some aspects, the vector is an adeno-associated virus (AAV). In some aspects, the AAV lacks rep and cap genes. In some aspects, the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). In some aspects, the AAV is AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66. In some aspects, the AAV is AAV9 or AAV6.

[0016] The disclosure provides a nanoparticle, extracellular vesicle, or exosome comprising any of the nucleic acids of the disclosure.

[0017] The disclosure provides a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody conjugated to any of the nucleic acids of the disclosure.

[0018] The disclosure provides a composition comprising any nucleic acid, any vector, any AAV, any nanoparticle, any extracellular vesicle, any exosome, any tissue-specific peptide, any tissue-specific aptamer, or any tissue-specific antibody conjugate of the disclosure, and a pharmaceutically acceptable carrier.

[0019] The disclosure provides a method of inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising contacting the cell with a nucleic acid encoding a LMNA / progerin-targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1 -52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

[0020] In some aspects, the nucleic acid further comprises a promoter. In some aspects, the promoter is any of LI6, LI7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 - alpha, or a tissue-specific promoter including, but not limited to, a muscle-specific promoter or a cardiac-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a- myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

[0021] In some aspects, the nucleic acid (or nucleic acids) is / are delivered in a vector. In some aspects, the vector is an AAV. In some aspects, the nucleic acid is delivered in a nanoparticle, extracellular vesicle, or exosome. In some aspects, the nucleic acid is delivered after being conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody. In some aspects, any of the nucleic acids, vectors, AAVs, nanoparticles, extracellular vesicles, exosomes, tissue-specific peptides, tissue-specific aptamers, or tissue-specific antibodies are present in a composition as disclosed herein.

[0022] The disclosure provides a method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of a nucleic acid encoding a progerin- targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1-52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

[0023] In some aspects of such method, the nucleic acid further comprises a promoter. In some aspects, the promoter is any of LI6, LI7, tRNA, H1 , CMV, minimal CMV, T7, EF1 - alpha, Minimal EF1 -alpha, or a tissue-specific promoter including, but not limited to, a muscle-specific promoter or a cardiac-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter isalpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

[0024] In some aspects, the nucleic acid (or nucleic acids) is delivered in a vector. In some aspects, the vector is an AAV, or rAAV. In some aspects, the nucleic acid is delivered in a nanoparticle, extracellular vesicle, or exosome. In some aspects, the nucleic acid is delivered after being conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody. In some aspects, any of the nucleic acids, vectors, AAV, or nanoparticles, extracellular vesicles, exosomes, tissue-specific peptides, tissue-specific aptamers, or tissue-specific antibodies are present in a composition comprising a pharmaceutically acceptable carrier.

[0025] In some aspects, the disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is Hutchinson-Gilford progeria syndrome (HGPS). In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0026] The disclosure also provides uses of a nucleic acid encoding a progerin-targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1-52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, thenucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208 for the preparation of a medicament for inhibiting expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell; for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder; or for the preparation of a medicament for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

[0027] In some aspects of such use, the nucleic acid further comprises a promoter. In some aspects, the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, T7, EF1 - alpha, Minimal EF1 -alpha, or a tissue-specific promoter including, but not limited to, a muscle-specific promoter or a cardiac-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

[0028] In some aspects, the nucleic acid (or nucleic acids) is delivered in a vector. In some aspects, the vector is an AAV. In some aspects, the AAV is a recombinant AAV (rAAV). In some aspects, the nucleic acid is delivered in a nanoparticle, extracellular vesicle, or exosome. In some aspects, the nucleic acid is delivered after being conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody. In some aspects, any of the nucleic acids, vectors, AAV, nanoparticles, extracellular vesicles, exosomes, tissue-specific peptides, tissue-specific aptamers, or tissue-specific antibody conjugates are present in a composition.

[0029] In some aspects, the disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0030] The disclosure also provides a formulation for intramuscular injection, subcutaneous injection, oral administration, subcutaneous, intradermal, or transdermal transport, injection into the blood stream, or for aerosol administration comprising a nucleic acid encoding a progerin-targeting microRNA (miRNA) comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1 -52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; and / or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

[0031] In some aspects, the nucleic acid further comprises a promoter. In some aspects, the promoter is any of LI6, LI7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 - alpha, or a tissue-specific promoter including, but not limited to, a muscle-specific promoter or a cardiac-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects,the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a- myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

[0032] In some aspects, the nucleic acid (or nucleic acids) is delivered in a vector. In some aspects, the vector is an AAV. In some aspects, the AAV is a rAAV. In some aspects, the nucleic acid is delivered in a nanoparticle, extracellular vesicle, or exosome. In some aspects, the nucleic acid is delivered after being conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody. In some aspects, any of the nucleic acids, vectors, AAV, nanoparticles, extracellular vesicles, exosomes, tissue-specific peptides, tissue-specific aptamers, or tissue-specific antibody conjugates are present in a composition. In some aspects, such composition is delivered to the subject.

[0033] In some aspects, the disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0034] The disclosure includes any nucleic acid, vector, AAV, nanoparticle, extracellular vesicle, exosome, tissue-specific peptide, tissue-specific aptamer, tissue-specific antibody, composition, or medicament of the disclosure wherein the nucleic acid, vector, AAV, nanoparticle, extracellular vesicle, exosome, tissue-specific peptide, tissue-specific aptamer, tissue-specific antibody, composition, or medicament is formulated for subcutaneous injection, intramuscular injection, intraperitoneal injection, intrathecal injection, oral administration, subcutaneous transport, intradermal transport, transdermal transport, injection into the blood stream, or aerosol administration.

[0035] Further aspects and advantages of the disclosure will be apparent to those ofordinary skill in the art from a review of the following detailed description, taken in conjunction with the drawings. It should be understood, however, that the detailed description (including the drawings and the specific examples), while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Fig. 1 A-D shows the methodology for screening of progerin-targeting miRNAs in HEK293 cells using a dual luciferase assay (DLA). Fig. 1 A provides a schematic showing the prelamin A and the mature Lamin A, Progerin and Lamin C mRNA isoforms after alternative splicing. The splicing represented in blue is due to the activation of a new cryptic splice donor site at position 1824 (c.1824C>T ; p.G608G) in exon 11 , leading to the formation of the Progerin mRNA isoform. Black bars on top of exon 12 represent the target sites of the progerin-targeting miRNAs of the disclosure. Fig. 1 B shows how a luciferase assay is used to screen for progerin silencing by miRNAs. Fig. 1 C shows dual luciferase assay (DLA) results after testing eighteen of the progerin-targeting miRNAs of the disclosure. These miRNAs showed reduction of progerin expression within the range of 18-60%. See Table 1 for specific sequences of these progerin-targeting miRNAs. Fig. 1 D shows dual luciferase assay (DLA) results after testing 36 of the Lamin A / progerin-targeting miRNAs of the disclosure. See Table 1 for specific sequences of these progerin-targeting miRNAs.Average knockdown is shown in Table 2. The symbol “*” shows statistical significance of knockdown when normalized to miGFP. *, p-value < 0.04; **, p-value < 0.005; ***, p-value = 0.0001 ; ****, p-value < 0.0001.

[0037] Fig. 2 (left panel) shows a Western blot of Lamin A and Lamin C 24 hours after HeLa cells were transfected with mi577-expressing or mi747-expressing plasmids at increasing doses (, i.e., 1 , 2 and 4 pg). GAPDH was used as a reference protein. The graph on the right panel shows percent Lamin A / C protein levels and represents the quantification of the Lamin A and Lamin C band intensities, and percent knockdown of Lamin A and Lamin C following normalization against the control (miGFP). Mi577 was able to knock down the expression of Lamin A by a maximum of 68% and that of Lamin C by a maximum of 36%. Mi747 was able to knock down the expression of Lamin A by a maximum of 29% and that of Lamin C by a maximum of 22%.DETAILED DESCRIPTION

[0038] The disclosure provides a novel strategy to accomplish the inhibition of progerin protein production because the expression of progerin is known to cause progeria and health problems, such as slowed growth, loss of fat tissue, hair loss, joint problems, dental problems, hearing loss, insulin resistance, cardiovascular disease, stroke, and death. Thus, in some aspects, the products and methods described herein are used in treating, ameliorating, delaying the progression of, and / or preventing progeria or Hutchinson-Gilford progeria syndrome (HGPS).

[0039] Progeria is caused by a change in one gene, the lamin A (LMNA) gene. The LMNA gene makes a protein that is needed to hold the nucleus of a cell together. When the LMNA gene has a change, a flawed LMNA protein called progerin is made. Progerin makes cells unstable and appears to lead to progeria's aging process. The changed gene that causes progeria is rarely passed down in families and, in most cases, the rare gene change that causes progeria happens by chance.

[0040] LMNA mutations in humans cause a variety of diseases including, but not limited to, various laminopathies, progeroid conditions, and progeria. A subset of LMNA mutations, including those causing progeria or HGPS, are located in 3’ or carboxyl terminal sequences unique to prelamin A (exons 11 and 12) and therefore have no effect on lamin C. HGPS is caused by exon 11 point mutations that enhance usage of a suboptimal splice donor site, resulting in aberrant mRNA splicing and the production of progerin, a mutant prelamin A protein containing an internal deletion of 50 amino acids near the C-terminus. This deletion eliminates the site for ZMPSTE24-mediated endoproteolytic cleavage, which would normally convert farnesyl-prelamin A to mature lamin A (LMNA). This leaves the intact premature LMNA bonded to the methylated carboxyl farnesyl group creating the defective protein, progerin, rather than the desired protein matured LMNA.

[0041] Approximately 90% of all HGPS cases are heterozygous for this deleterious single nucleotide polymorphism within exon 11 of the LMNA gene causing the post-translational modifications to produce progerin. The prelamin A mRNA encoding for lamin A and progerin proteins is formed of exons 1-10 in addition to the remaining sequence of exon 11 and exon 12. In the case of progerin, prelamin A alternative splicing with the presence of the cryptic splice site leads to a 150-nucleotide deletion in exon 11 . On the other hand, the prelamin A mRNA encoding for lamin C, after another alternative splicing event, is formed of exons 1 -10. Previous in vitro and in vivo studies showed that lamin A is dispensable and the presence of lamin C alone is enough to maintain the correct functioning of a cell, to theopposite of the absence of both lamin A and C [Fong, L.G., et al., Science. 311 :1621 -3, 2006; Fong, L.G., et al., J Clin Invest. 116:743-52, 2006; Osorio, F.G., et al., Sci Transl Med. 3:106ra107, 2011 ; Sullivan, T., et al., J Cell Biol. 147:913-20, 1999]. Therefore, the disclosure provides RNAi-based gene therapy which targets exon 12 and knocks down progerin and LMNA transcripts without affecting the expression of Lamin C. "HGPS-like" patients carrying other LMNA mutations affecting exon 11 splicing also produce progerin and / or other truncated prelamin A transcripts and / or protein isoforms (A35 and A90) and are likewise included as subjects for treatment using methods of the disclosure comprising the RNAi-based gene therapies (i.e., L / W / A-targeting or progerin-largelmg miRNAs of the disclosure).

[0042] The LMNA gene, also called the LMNA / C gene, is located at 1 q21 .2. The LMNA gene includes 12 exons and codes for at least four isoforms: two major (lamin A and lamin C) and two minor (lamin AA10 and lamin C2). These isoforms diverge in structure, function, expression pattern, and binding partners.

[0043] The LMNA gene encodes an approximately a 664 amino acid protein (“Lamin A”, “lamin A”, or “LMNA”) +with a molecular weight of 70 kDa (calculated 74,139 Da) and a pl of 7.0 (theoretical pl 7.4). Lamin A consists of a central rod domain flanked by hydrophobic N- and C-terminal domains. After farnesylation at the CAAX-box motif, the 18 most C-terminal amino acids of lamin-A are removed by proteolytic cleavage to generate the mature lamin-A protein; see UniProtKB - Q9UBX2 (LMNA HUMAN).

[0044] HGPS is primarily caused by new, non-inherited mutations that occur in the LMNA gene, specifically in codon 608 of exon 11 , located on chromosome 1 (Eriksson et al., Nature, 2003. 423(6937): 293-8). The mutation occurs in exon 11 that leads to a new alternative splicing of the pre-lamin A mRNA. The product of that alternative splicing gives rise to a new lamin A mRNA lacking 150 nucleotides at the end of exon 11 . This new mRNA encompasses, in addition to exons 1 -11 , exon 12 and encodes for the protein progerin. The disclosure comprises nucleic acids, compositions, and methods for targeting exon 12 to knock down progerin mRNA levels and thus prevent production of progerin protein.

[0045] In some aspects, the nucleic acid encoding exon 12 of human LMNA or progerin is set forth in the nucleotide sequence set forth in SEQ ID NO: 209. In various aspects, the methods of the disclosure also target isoforms and variants of the nucleotide sequence set forth in SEQ ID NO: 209. In some aspects, the variants comprise 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotidesequence set forth in SEQ ID NO: 209 In some aspects, the methods of the disclosure target isoforms and variants of nucleic acids comprising nucleotide sequences encoding an amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 209.

[0046] The sequence of exon 12 of progerin and Lamin A, the target region for miRNA of the disclosure, is the same and is provided in SEQ ID NO: 209:AGCCCCCAGAACTGCAGCATCATGTAATCTGGGACCTGCCAGGCAGGGGTGGGGGTG GAGGCTTCCTGCGTCCTCCTCACCTCATGCCCACCCCCTGCCCTGCACGTCATGGGAG GGGGCTTGAAGCCAAAGAAAAATAACCCTTTGGTTTTTTTCTTCTGTATTTTTTTTTCTAA GAGAAGTTATTTTCTACAGTGGTTTTATACTGAAGGAAAAACACAAGCAAAAAAAAAAAA AAGCATCTATCTCATCTATCTCAATCCTAATTTCTCCTCCCTTCCTTTTCCCTGCTTCCAG GAAACTCCACATCTGCCTTAAAACCAAAGAGGGCTTCCTCTAGAAGCCAAGGGAAAGG GGTGCTTTTATAGAGGCTAGCTTCTGCTTTTCTGCCCTGGCTGCTGCCCCCACCCCGG GGACCCTGTGACATGGTGCCTGAGAGGCAGGCATAGAGGCTTCTCCGCCAGCCTCCT CTGGACGGCAGGCTCACTGCCAGGCCAGCCTCCGAGAGGGAGAGAGAGAGAGAGAG GACAGCTTGAGCCGGGCCCCTGGGCTTGGCCTGCTGTGATTCCACTACACCTGGCTGA GGTTCCTCTGCCTGCCCCGCCCCCAGTCCCCACCCCTGCCCCCAGCCCCGGGGTGAG TCCATTCTCCCAGGTACCAGCTGCGCTTGCTTTTCTGTATTTTATTTAGACAAGAGATGG GAATGAGGTGGGAGGTGGAAGAAGGGAGAAGAAAGGTGAGTTTGAGCTGCCTTCCCT AGCTTTAGACCCTGGGTGGGCTCTGTGCAGTCACTGGAGGTTGAAGCCAAGTGGGGT GCTGGGAGGAGGGAGAGGGAGGTCACTGGAAAGGGGAGAGCCTGCTGGCACCCACC GTGGAGGAGGAAGGCAAGAGGGGGTGGAGGGGTGTGGCAGTGGTTTTGGCAAACGC TAAAGAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAAT ACACTAGTTGTTTCTA (SEQ ID NO: 209)

[0047] Lamins are the major components of the nuclear lamina, a network located between inner nuclear membrane and chromatin, which plays a fundamental role in the organization of the nuclear architecture in all human cells. Lamins A and C, which are alternatively spliced products of the A-type lamin gene (LMNA), are expressed in differentiated cells, whereas B-type lamins, arising from two different genes, are ubiquitous.

[0048] The LMNA gene is located on chromosome 1 q21 .2 loci and is composed of 12 exons. Exons 1-10 between Lamin A and Lamin C are identical; however, exons 11 and 12 are specific to Lamin A. The disclosure provides products and methods for treating mutations in the LMNA gene affecting exon 11 splicing or exon 12 which result in diseases such as progeria, Hutchinson-Gilford progeria syndrome (HGPS), other diseases whichresult in the production of progerin and / or other truncated Prelamin A transcript and / or protein isoforms (A35 and A90), and natural aging.

[0049] HGPS (OMIM: 176670) or progeria is a rare genetic disorder characterized by premature senescence, both clinically and in cell culture. HGPS was characterized by a predominant c.1824C>T mutation in the LMNA gene in 18 / 23 classical HGPS cases as well as two other mutations in two other HGPS patients. The c.1824C>T mutation turned out to affect splicing by creating a new splice donor site. Translation of the resulting mRNA produces a Lamin-A protein with an internal deletion (p.Val607_Gln656del) removing the internal proteolytic cleavage site which is used normally to remove the last 18 C-terminal amino acids to generate the mature Lamin A protein. Thus, the mutation causes the production of the progerin protein, a partially deleted form of nuclear LMNA.

[0050] Children affected by the mutation appear normal at birth, but within a year develop characteristic features of failure to thrive, delayed dentition, alopecia and sclerodermatous skin changes. On average, death occurs at an age of about 13 years although some young adults will live into their early 20s. Most patients die from progressive atherosclerosis of the coronary and cerebrovascular arteries. There are currently no great treatments for HGPS or progeria and the condition is always fatal. Various drugs are prescribed to slow down the progression of the disease or assist with symptoms of the disease, but nothing more is available to date.

[0051] In the typical form of HGPS or progeria, the heterozygous LMNA mutation involves a substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T; p.G608G). Remarkably, this mutation does not alter the encoded amino acids, but causes a new alternative splicing event, leading to the formation of a mRNA lacking 150 nucleotides. Consequently, this mRNA is translated into a modified protein known as "progerin”, which exhibits an in-frame deletion of 50 amino acids near the C terminus.

[0052] The disclosure provides microRNA, more specifically nucleic acids encoding microRNA (miRNA), targeting exon 12 of the LMNA or progerin gene (i.e., exon 12 of the mRNAs of both genes is the same) with the goal of downregulating or inhibiting expression of the aberrant LMNA or inhibiting the progerin protein. The disclosure provides nucleic acids encoding miRNA targeting progerin for inhibiting progerin protein expression. The disclosure provides nucleic acids comprising the RNA sequence targeted by the miRNA. The disclosure provides LMNA or progerin target sequences that the miRNA sequences of the disclosure are designed to target. The disclosure includes various nucleic acids comprising,consisting essentially of, or consisting of the various nucleotide sequences described herein. In some aspects, the nucleic acid comprises the nucleotide sequence. In some aspects, the nucleic acid consists essentially of the nucleotide sequence. In some aspects, the nucleic acid consists of the nucleotide sequence.

[0053] Exemplary nucleotide sequences used in miRNA targeting of exon 12 of LMNA or progerin described herein include, but are not limited to, those identified in Table 1 below.28335 / 596422022-057-02

[0054] Table 1 : Nucleic acids / Nucleotides of the disclosure.28335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-0228335 / 596422022-057-02

[0055] Exemplary nucleotide sequences are set out in Table 1 above. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 1 -208. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0056] In some aspects, the disclosure includes the use of RNA interference to downregulate or inhibit aberrant LMNA expression or progerin expression due to a mutation in exon 11 of the LMNA gene or progerin gene. RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by miRNAs. The miRNAs are small (about 21-25 nucleotides), noncoding RNAs that share sequence homology and base-pair with sequence target sites of cognate messenger RNAs (mRNAs). The interaction between the miRNAs and mRNAs directs cellular gene silencing machinery inducing mRNA decay and / or preventing mRNA translation into protein.

[0057] As an understanding of natural RNAi pathways has developed, researchers have designed artificial shRNAs and siRNAs for use in regulating expression of target genes fortreating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells, including short (or small) interfering RNA (siRNA), and short (or small) hairpin RNA (shRNA) and microRNA (miRNA), which constitute a similar class of vector- expressed triggers (Davidson et al., Nat. Rev. Genet. 12: 329-40, 2011 ; Harper, Arch. Neurol. 66:933-8, 2009). shRNA and miRNA are expressed in vivo from plasmid- or virusbased vectors and may thus achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active (Davidson et al., Methods Enzymol. 392:145-73, 2005). Importantly, this vector-expressed approach leverages the decades-long advancements already made in the muscle gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial shRNA or miRNA cassettes targeting disease genes-of- interest. Each miRNA described herein to bind to the target gene to inhibit the expression of the aberrant lamin A or progerin protein.

[0058] In some embodiments, therefore, the products and methods of the disclosure comprise microRNA (miRNA) or nucleic acids which encode miRNA. MicroRNAs (miRNAs) are a class of non-coding RNAs that play important roles in RNA silencing and in regulating gene expression. The majority of miRNAs are transcribed from DNA sequences into primary miRNAs and processed into precursor miRNAs, and finally mature miRNAs. In most cases, miRNAs interact with the 3' untranslated region (3' UTR) of target mRNAs to induce mRNA degradation and translational repression. However, interaction of miRNAs with other regions, including the 5' UTR, coding sequence, and gene promoters, have also been reported. Under certain conditions, miRNAs can also activate translation or regulate transcription. The interaction of miRNAs with their target genes is dynamic and dependent on many factors, such as subcellular location of miRNAs, the abundancy of miRNAs and target mRNAs, and the affinity of miRNA-mRNA interactions.

[0059] In some instances, miRNAs bind to a specific sequence at the 3' UTR of their target mRNAs to induce translational repression and mRNA deadenylation and decapping. miRNA binding sites have also been detected in other mRNA regions including the 5' UTR and coding sequence, as well as within promoter regions. The binding of miRNAs to 5' UTR and coding regions have silencing effects on gene expression while miRNA interaction with promoter region has been reported to induce transcription. In the instant disclosure, the miRNA are designed to bind to exon 12 of the LMNA or the progerin gene to inhibit or downregulate the expression of aberrant LMNA or progerin protein.

[0060] In various aspects, polymerase II promoters and polymerase III promoters are used. In some aspects, the promoter is a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alphamyosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), a tMCK promoter, a minimal MCK promoter, the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene (MLC250) promoter, cardiac troponin T (cTnT) promoter, an a-myosin heavy chain (a-MHC) promoter, or a desmin promoter.

[0061] In some aspects, U6 promoters are used and are referred to as U6 miRNAs. In some aspects, H1 promoters are used and are referred to as H1 miRNAs. Thus, in some aspects, LI6 miRNA or H1 miRNA are used to inhibit, knockdown, or interfere with LMNA gene expression or progerin gene expression by targeting exon 12 of each of these genes. As a result, protein production is downregulated or inhibited.

[0062] Traditional small / short hairpin RNA (shRNA) sequences are usually transcribed inside the cell nucleus from a vector containing a Pol III promoter, such as LI6. The endogenous LI6 promoter normally controls expression of the LI6 RNA, a small nuclear RNA (snRNA) involved in splicing, and has been well-characterized (Kunkel et al., Nature.322(6074): 73-7 (1986); Kunkel et al., Genes Dev. 2(2):196-204 (1988); Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)). In some aspects, the U6 or H1 promoter is used to control vector-based expression of shRNA molecules in mammalian cells (Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8 (2002); Paul et al., Nat. BiotechnoL 20(5):505-8 (2002); Medina et al., Curr. Opin. Mol. Ther. 1 :580-94 (1999)) because (1) the promoter is recognized by RNA polymerase III (poly III) and controls high-level, constitutive expression of shRNA; (2) the Pol III promoter possesses greater capacity than RNA polymerase II to synthesize shRNA of high yield (Boden et al., Nucleic Acids Res. 32:1154-8 (2004); Xia et al., Neurodegenerative Dis. 2:220-31 (2005)); (3) the Pol III promoters are consistent of compact sequence and simple terminator that are easy to handle (Medina et al. (1999) supra); and (2) the promoter is active in most mammalian cell types. In some aspects, the promoter is a type III Pol III promoter in that all elements required to control expression of the shRNA are located upstream of the transcription start site (Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)). The disclosure includes both murine and human U6 promoters. The shRNA containing the sense and antisense sequences from a target gene connected bya loop is transported from the nucleus into the cytoplasm where Dicer processes it into small / short interfering RNAs (siRNAs).

[0063] The disclosure includes a composition comprising any of the nucleic acids described herein with a carrier, diluent, excipient, or buffer. In some aspects, the composition comprises a combination of one or more of the nucleic acids described herein. In other words, in some aspects, the composition comprises a combination of miRNAs for use in inhibiting or downregulating the expression of progeria. Thus, in various aspects, any composition of the disclosure also comprises other ingredients, such as carriers, diluents, excipients, and / or adjuvants. Acceptable carriers, diluents, excipients, and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).

[0064] In some aspects, the nucleic acids are introduced into the cell via vectorized or non-vectorized delivery. Thus, in an embodiment, the disclosure includes non-vectorized delivery systems for a nucleic acid encoding the LMNA-targeting or progerin-targeting miRNAs. In some aspects, in this context, synthetic carriers able to form complexes with nucleic acids, and protect them from extra- and intracellular nucleases, are an alternative to viral vectors. In some aspects, such non-vectorized delivery includes the use of nanoparticles, extracellular vesicles, or exosomes comprising the nucleic acids of the disclosure. In some aspects, such nanoparticles include, but are not limited to, microcapsules, liposomes, and micelles. In some aspects, such non-vectorized delivery also includes the use of tissue-specific peptides, tissue-specific aptamers, or tissue-specific antibodies conjugated to the nucleic acid(s) of the disclosure. The disclosure also includes compositions or medicaments comprising any of the vectorized or non-vectorized constructs described herein alone or in combination.

[0065] In some embodiments, therefore, the disclosure includes a vector comprising any of the nucleic acids described herein, either alone or in combination. Thus, in some aspects, a combination of miRNAs can be used to more effectively inhibit the expression of progerin or aberrant LMNA. In some aspects, this may include a combination of multiple copies ofthe same miRNA. In some aspects, this may include a combination of different miRNAs all designed to target exon 12 of LMNA or progerin (i.e., a LMNA-targeting or progerin-targeting miRNA). Thus, embodiments of the disclosure utilize vectors (for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.

[0066] In some embodiments, the vectors are AAV vectors. In some aspects, the vectors are single stranded AAV vectors. In some aspects the AAV is recombinant AAV (rAAV). In some aspects, the rAAV lack rep and cap genes. In some aspects, rAAV are self- complementary (sc)AAV.

[0067] Thus, in some aspects, the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and / or AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and / or AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and / or AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and / or AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and / or AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and / or AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and / or AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and / or AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and / or AAV9 capsid proteins), AAV.rh74 (i.e., an AAV containing AAV.rh74 ITRs and / or AAV.rh74 capsid proteins), AAV.rh8 (i.e., an AAV containing AAV.rh8 ITRs and / or AAV.rh8 capsid proteins), AAV.rhI O (i.e., an AAV containing AAV.rhIO ITRs and / or AAV.rhI O capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and / or AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and / or AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 ITRs and / or AAV13 capsid proteins), AAV- anc80 (i.e., an AAV containing AAV-anc80 ITRs and / or AAV-anc80 capsid proteins), AAV- B1 (i.e., an AAV containing AAV-B1 ITRs and / or AAV-B1 capsid proteins), AAV.PHP.EB (i.e., an AAV containing AAV- PHP.EB ITRs and / or AAV- PHP.EB capsid proteins), or AAVv66 (i.e., an AAV containing AAVv66 ITRs and / or AAVv66 capsid proteins).

[0068] In some aspects, the disclosure utilizes adeno-associated virus (AAV) to deliver nucleic acids encoding the miRNA. AAV is a replication-deficient parvovirus, the singlestranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences ofthe genomes of the AAV serotypes are known. For example, the complete genome of AAV1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 {1983); the complete genome of AAV3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV4 is provided in GenBank Accession No. NC_001829; the AAV5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV7 and AAV8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV8); the AAV9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV10 genome is provided in Mol. Ther., 13(1 ): 67-76 (2006); the AAV11 genome is provided in Virology, 330(2): 375-383 (2004); the AAV12 genome is provided in J. Virol. 2008 Feb; 82(3): 1399-406; and the AAV13 genome is provided in J. Virol. 2008; 82: 8911 . Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka (Current Topics in Microbiology and Immunology, 158: 97-129 (1992)).

[0069] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation andintegration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56eto 65eC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.

[0070] In some embodiments, DNA plasmids of the disclosure are provided which comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV. PHP. EB, or AAVv66. In some aspects, the ITRs in the AAV are from a different AAV serotype. In some aspects, the AAV comprises an ITR or capsid protein which is from a different serotype, i.e., a different serotype than the rest of the vector. For example, in some aspects, AAV2 or AAV2-based ITRs are used in various AAV vectors, not only serotypes which are AAV2 or AAV2-based. In some aspects, various ITRs are interchangeable among the different serotypes of AAV. For example, in some aspects, AAV2 ITRs are interchangeable among the different serotypes of AAV. Thus, in some aspects, AAV2 ITRs are used in a different serotype of AAV vector including, but not limited to, for example, AAV9. In some aspects, AAV2 Rep helper genes are used.

[0071] In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV. PHP. EB, or AAVv66. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As notedabove, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0072] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking at least one progerin-targeted or aberrant LMNA-targeted polynucleotide or nucleotide sequence. In some embodiments, the polynucleotide is a miRNA or a polynucleotide encoding the miRNA. In some aspects, the miRNA is administered with other polynucleotide constructs targeting aberrant LMNA or progerin. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhl 0, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66. As set out herein above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0073] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking at least one progerin-targeted or aberrant LMNA-targeted polynucleotide or nucleotide sequence. In some embodiments, the polynucleotide is an miRNA or a polynucleotide encoding the miRNA. In some aspects, the miRNA is administered with other polynucleotide constructs targeting LMNA or progerin. In various aspects, the miRNA is expressed under various promoters including, but not limited to, such promoters as a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), a tMCK promoter, a minimal MCK promoter, the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene (MLC250) promoter, cardiac troponin T (cTnT) promoter, an a-myosin heavy chain (a-MHC) promoter, or a desmin promoter. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhl 0, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66. As set out herein above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0074] DNA plasmids of the disclosure comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV(e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66. In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0075] In some embodiments, packaging cells are provided. Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors

[0076] For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081 ), addition ofsynthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0077] In some embodiments, therefore, a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077- 2081 ), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy et al., 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0078] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbiol, and Immunol. 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol., 63:3822- 3828 (1989); U.S. Patent No. 5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Human Gene Therapy, 4:609-615 (1993); Clark et al., Gene Therapy, 3:1124-1132 (1996); U.S. Patent. No. 5,786,211 ; U.S. Patent No. 5,871 ,982; U.S. Patent. No. 6,258,595; and McCarty, Mol. Then, 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particularemphasis on those sections of the documents relating to rAAV production. The production and use of various types of rAAV are specifically contemplated and exemplified.Recombinant AAV ( / .e., infectious encapsidated rAAV particles) are thus provided herein. In some aspects, genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).

[0079] The disclosure thus provides in some embodiments packaging cells that produce infectious rAAV. In one embodiment, packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).

[0080] The rAAV, in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Then, 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98 / 09657.

[0081] In some embodiments, nanoparticles, extracellular vesicles, or exosomes comprising a nucleic acid of the disclosure are provided. Nanoparticles, extracellular vesicles, and exosomes are some of the many delivery systems which could be used to deliver miRNAs. Nanoparticles offer unprecedented opportunities for cell-specific, controlled delivery of miRNAs for therapeutic purposes (Sharon Wei Ling Lee et al., J. Control Release 2019 Nov 10; 313:80-95). Extracellular vesicles can be enriched with exogenous therapeutic miRNAs and used for treatment of diseases by targeting pathological recipient cells (Munir et al., Cells 2020 Oct; 9(10):2271 ). Exosomes are excellent carriers for miRNA with the advantages of low immunogenicity and low toxicity (Ohno et al., Methods Mol Biol. 2016:1448:261-70. doi: 10.1007 / 978-1 -4939-3753-0_19).

[0082] In some embodiments, tissue-specific peptides, tissue-specific aptamers, or tissuespecific antibodies conjugated to a nucleic acid of the disclosure are provided. Tissuespecific peptides, tissue-specific aptamers, and tissue-specific antibodies can be conjugated to the nucleic acid and used for delivery of the miRNA to the cells or to the cells of the subject. Tissue-specific peptides, tissue-specific aptamers, and tissue-specific antibodies areincreasingly becoming relevant in gene delivery and in tissue-specific gene therapy (for example, see Tarvirdipour et al, Int J Mol Sci. 2021 Aug 23;22(16):9092. doi: 10.3390 / ijms22169092; Aaldering et al., RNA Biol. 2015 Apr 7; 12(4):412-425. doi: 10.1080 / 15476286.2015.1017234; Malecova et al., Nucleic Acids Res. 2023 May 24;51 (12):5901— 5910. doi: 10.1093 / nar / gkad415).

[0083] In some embodiments, the disclosure provides a composition comprising a nucleic acid, vector, e.g., such as a viral vector, nanoparticle, extracellular vesicle, exosome, tissuespecific peptide, tissue-specific aptamer, or tissue-specific antibody of the disclosure. In various aspects, such composition also comprises a pharmaceutically acceptable carrier. In general, as used herein, "pharmaceutically acceptable carrier" means all aqueous and nonaqueous solutions, sterile solutions, solvents, buffers, e.g. phosphate buffered saline (PBS) solutions, water, suspensions, emulsions, such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media and coatings, which are compatible with pharmaceutical administration, in particular with parenteral administration. The use of such media and agents in pharmaceutical compositions is well known in the art, and the compositions comprising such carriers can be formulated by well-known conventional methods.

[0084] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0085] Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x106, about 1 x107, about 1 x108, about 1 x109, about 1 x1010, about 1 x1011, about 1 x1012, about 1 x1013to about 1 x1014or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) (e.g., 1 x107vg, 1 x108vg, 1 x109vg, 1 x1010vg, 1 x1011vg, 1 x1012vg, 1 x1013vg, and 1 x1014vg, respectively).

[0086] The disclosure provides methods of delivering or therapeutically administering a LMNA-targeting or progerin-targeting miRNA to a cell or to a subject comprising a mutation in the LMNA gene associated with the expression of progerin and the resulting disease condition, progeria or progeria-related condition.

[0087] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids comprising a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 1-52; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157- 208.

[0088] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids comprising a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157- 208.

[0089] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids comprising a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 1-52; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157- 208.

[0090] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence thatspecifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0091] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0092] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0093] In yet another aspect, the disclosure provides a method of decreasing expression of the aberrant LMNA gene or progerin gene, or decreasing expression of the aberrant LMNA protein or progerin protein in a cell or a subject, wherein the method comprises contacting the cell or the subject with any one or more nucleic acids comprising

[0094] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 80% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0095] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; anucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0096] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more nucleic acids comprising a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 1 -52; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 53-104; a nucleotide sequence comprising at least 95% identity to the sequence set forth in any one of SEQ ID NOs: 105-156; or a nucleotide sequence that specifically hybridizes to the LMNA / progerin target sequence set forth in any one of SEQ ID NOs:157-208.

[0097] In some aspects, the method comprises delivering the nucleic acids in one or more AAV vectors. In some aspects, the method comprises delivering the nucleic acids to the cell via non-vectorized delivery as described herein.

[0098] In some aspects, expression of the aberrant LMNA gene or progerin gene, or expression of the aberrant LMNA protein or progerin protein is decreased in a cell or in a subject by the methods provided herein by at least or about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or 100 percent.

[0099] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids encoding the aberrant LMNA-targ eting or progerin-targeting miRNA as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of progeria or HGPS, the administration is prophylactic. If the dose is administered after the development of progeria or HGPS, the administration is therapeutic. In embodiments of the disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the condition, such as progeria, or aging symptom associated with a defective LMNA gene or progerin gene, being treated, that slows or prevents progression of progeria (or HGPS) or other symptomassociated with an aberrant exon 12 LMNA or progerin gene, that slows or prevents progression of the progeria, that diminishes the extent of disease, that results in remission (partial or total) of the progeria, and / or that prolongs survival. In some aspects, the progeria is HGPS. In some aspects, an effective dose or therapeutically effective dose is a dose that alleviates or improves at least one of symptom of atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0100] Administration of an effective dose of any of the nucleic acids, albeit alone or within vectors, including but not limited to AAV, nanoparticles, extracellular vesicles, and exosomes, or conjugated to tissue-specific peptides, tissue-specific aptamers, or tissuespecific antibodies, or in any compositions comprising the nucleic acids, vectors, AAV, nanoparticles, extracellular vesicles, exosomes, or nucleic acids conjugated to tissuespecific peptides, tissue-specific aptamers, or tissue-specific antibodies may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, intraperitoneal, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, route(s) of administration and serotype(s) of AAV components of rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure may be chosen and / or matched by those skilled in the art taking into account the disease state being treated and the target cells / tissue(s), such as cells that express aberrant LMNA or progerin. In some aspects, the composition or medicament is formulated for intramuscular injection, oral administration, subcutaneous, intradermal, or transdermal transport, injection into the blood stream, or for aerosol administration. In some aspects, the route of administration is intramuscular. In some aspects, the route of administration is intravenous.

[0101] In some aspects, actual administration of rAAV may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal. Administration according to the disclosure includes, but is not limited to, injection into muscle, the bloodstream, the central nervous system, and / or directly into the brain or other organ. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as muscle. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared for oral administration, as injectable formulations, or as topical formulations to be delivered to the muscles by subcutaneous, intradermal, and / or transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The rAAV can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0102] For purposes of intramuscular injection, solutions in an adjuvant such as sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxpropylcellulose. A dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.

[0103] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. In some aspects, proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonicagents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0104] In some aspects, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient which protects the formulation from adverse conditions, such as those which occur during heating or freezing, and / or prolongs the stability or shelflife of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars, such as sucrose, lactose and mannose; sugar alcohols, such as mannitol; amino acids, such as glycine or glutamic acid; and proteins, such as human serum albumin or gelatin.

[0105] In some aspects, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance which is added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated puncture of the vial or container being used. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0106] The term "transduction" is used to refer to the administration / delivery of one or more of the LMNA-targeting or progerin-targeting constructs, e.g., LMNA-targeting or progerin-targeting miRNA or nucleic acid encoding LMNA-targeting or progerin-targeting miRNA, described herein to a recipient cell either in vivo or in vitro, via a replication-deficient rAAV of the disclosure resulting in decreased expression of progerin by the recipient cell.

[0107] In one aspect, transduction with rAAV is carried out in vitro. In one embodiment, desired target cells are removed from the subject, transduced with rAAV and reintroduced into the subject. Alternatively, syngeneic or xenogeneic cells can be used where those cells will not generate an inappropriate immune response in the subject.

[0108] Suitable methods for the transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells are transduced in vitro by combining rAAV with cells, e.g., in appropriate media, and screening for those cells harboring the DNA of interest using conventional techniques such as Southern blots and / or PCR, or by using selectable markers. Transduced cells can then be formulated into pharmaceutical compositions, and the composition introduced into the subject by various techniques, such as by intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into smooth and cardiac muscle, using e.g., a catheter.

[0109] The disclosure provides methods of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) or effective amount of the nucleic acid, e.g., DNA that encodes microRNA or packages the mature microRNA sequence or is conjugated to the mature microRNA sequence designed to downregulate or inhibit the expression of the aberrant LMNA gene or progerin gene (and the resulting expression of the aberrant LMNA or progerin protein) to a cell or to a subject in need thereof, including administering an effective dose of the nucleic acid in a vector (including but not limited to rAAV), in a nanoparticle, in an extracellular vesicle, in an exosome, conjugated to a tissue-specific peptide, conjugated to a tissue-specific aptamer, conjugated to a tissuespecific antibody, or in a composition.

[0110] If the dose is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose (or multiple doses) that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival. Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of the nucleic acids described herein to a subject in need thereof. Thus, in some aspects, the effective dose is therefore a therapeutically effective dose. In some aspects, “effective dose” or “effective amount” are used interchangeably.

[0111] In some embodiments, the dose or effective dose of rAAV administered is about 1 .0x1010vg / kg to about 1 .0x1016vg / kg. In some aspects, 1 .0x1010vg / kg is also designated 1.0 E10 vg / kg, which is simply an alternative way of indicating the scientific notation. Likewise, 1011is equivalent to E11 , and the like. In some aspects, the dose of rAAV administered is about 1.0x1011vg / kg to about 1.0x1015vg / kg. In some aspects the dose of rAAV is about 1 .0x1010vg / kg, about 2.0x1010vg / kg, about 3.0x1010vg / kg, about 4.0x1010vg / kg, about 5.0x1010vg / kg, about 6.0x1010vg / kg, about 7.0x1010vg / kg, about 8.0x1010vg / kg, about 9.0x1010about 1.0x1011vg / kg, about 2.0x1011vg / kg, about 3.0x1011vg / kg, about 4.0x1011vg / kg, about 5.0x1011vg / kg, about 6.0x1011vg / kg, about 7.0x1011vg / kg, about 8.0x1011vg / kg, about 9.0x1011vg / kg, about 1 .0x1012vg / kg, about 2.0x1012vg / kg, about 3.0x1012vg / kg, about 4.0x1012vg / kg, about 5.0x1012vg / kg, about 6.0x1012vg / kg, about 7.0x1012vg / kg, about 8.0x1012vg / kg, about 9.0x1012vg / kg, about 1 .0x1013vg / kg,about 2.0x1013vg / kg, about 3.0x1013vg / kg, about 4.0x1013vg / kg, about 5.0x1013vg / kg, about 6.0x1013vg / kg, about 7.0x1013vg / kg, about 8.0x1013vg / kg, about 9.0x1013vg / kg, about 1 .0x1014vg / kg, about 2.0x1014vg / kg, about 3.0x1014vg / kg, about 4.0x1014vg / kg, about 5.0x1014vg / kg, about 6.0x1014vg / kg, about 7.0x1014vg / kg, about 8.0x1014vg / kg, about 9.0x1014vg / kg, about 1 .0x1015vg / kg, about 2.0x1015vg / kg, about 3.0x1015vg / kg, about 4.0x1015vg / kg, about 5.0x1015vg / kg, about 6.0x1015vg / kg, about 7.0x1015vg / kg, about 8.0x1015vg / kg, about 9.0x1015vg / kg, or about 1 .0x1016vg / kg.

[0112] In some aspects, the dose is about 1 .0x1011vg / kg to about 1 .0x1015vg / kg. In some aspects, the dose is about 1 .0x1013vg / kg to about 5.0x1013vg / kg. In some aspects, the dose is about 2.0x1013vg / kg to about 4.0x1013vg / kg. In some aspects, the dose is about 3.0x1013vg / kg.

[0113] In some aspects, an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.

[0114] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. Transduction of cells with an rAAV of the disclosure results in sustained expression of LMNA-targeting or progerin-targeting miRNA sequence. The disclosure thus provides rAAV and methods of administering / delivering rAAV which express LMNA-targeting or progerin-targeting miRNA in the cell(s) in vitro or in vivo in a subject. In some aspects, the subject is a mammal. In some aspects, the mammal is a human. These methods include transducing cells and tissues (including, but not limited to, tissues such as muscle) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements. The term “transduction” is used to refer to, as an example, the administration / delivery of a nucleic acid comprising a nucleotide sequence encoding a LMNA-targeting or progerin-targeting miRNA to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the decreased expression or inhibition of expression of aberrant LMNA or progerin by the target cell.

[0115] The in vivo methods comprise the step of administering an effective dose (or therapeutically effective dose), or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human subject) in need thereof. Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subjectin need thereof. If the dose or doses is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival.

[0116] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease or disorder such as progeria, premature aging, natural aging or a condition associated with the aberrant expression of LMNA or progerin (for example, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation) due to a mutation in exon 11 . In various aspects, such progeria is HGPS.

[0117] In persons known to have mutation in exon 11 of the LMNA or progerin gene associated with progeria, the methods of the disclosure, in various aspects, are methods of preventing disease and they are carried out before the onset of disease. In other various aspects, the methods of the disclosure are carried out after diagnosis and, therefore, are methods of treating or ameliorating disease.

[0118] "Treating" includes ameliorating or inhibiting one or more symptoms of premature aging or natural aging or a condition, disease or disorder associated with the aberrant expression of LMNA or progerin including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0119] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the products and methods disclosed herein for decreasing the expression of the LMNA gene and protein or the progerin gene and protein and treating diseases or disorders associated with a mutation of exon 11 of the LMNA geneor progerin gene, such as progeria. Outcome measures include, but are not limited to, reduction or elimination of aberrant LMNA RNA or progerin mRNA or aberrant LMNA or progerin protein in affected tissues. The lack of expression of progerin and / or the downregulation of expression of progerin in the cell is detected by measuring the level of progerin protein by methods known in the art including, but not limited to, RT-PCR, QRT- PCR, RNAscope, Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV to determine the improvement.

[0120] In some embodiments, the level of progerin gene expression or progerin protein expression in a cell of the subject is decreased after administration of the nucleic acid encoding the progerin-targeting miRNA or the vector, e.g., rAAV, or nanoparticle, extracellular vesicle, or exosome comprising the nucleic acid encoding the LMNA-targ eting or progerin-targeting miRNA, or after administration of the nucleic acid encoding the progerin-targeting miRNA conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody, or a composition comprising any of the same, as compared to the level of progerin gene expression or protein expression before administration of the nucleic acid encoding the LMNA / progerin-targeting miRNA or the vector, e.g., rAAV, or nanoparticle, extracellular vesicle, or exosome, or the nucleic acid encoding the LMNA / progerin-targeting miRNA conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody, or a composition comprising any of the same. In some aspects, expression of progerin is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%. In various aspects, improved growth, improved weight gain, improved joint mobility, improved increase in body fat, improved hair growth (i.e., decreased alopecia), improved cardiovascular health (such as decreased atherosclerosis or decreased arterial plaque), improved vision (i.e., decrease in cataract development), improved muscle strength, improved muscle function, improved mobility and stamina, or increased lifespan show an improvement by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.

[0121] In some aspects, a positive therapeutic outcome for treatment with the methods of the disclosure is a reduction in growth failure, a reduction in wrinkled skin, a reduction inbalding or alopecia, a reduction in stiffness in joints, a reduction in arthritis, a reduction in tough skin, a reduction in the loss of body fat, a reduction in osteoporosis, a reduction in craniofacial abnormalities associated with progeria, a reduction in plaque buildup in the arteries, and / or increased lifespan after administration of the treatment comprising the progerin-targeted miRNA(s) as compared to the conditions in the patient before administration of the treatment comprising the progerin-targeted miRNA(s). In some aspects, such positive therapeutic outcome shows an improvement of at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100% compared to control or with respect to the subject’s condition prior to treatment.

[0122] Combination therapies are also contemplated by the disclosure. Combination as used herein includes simultaneous treatment or sequential treatments. Combinations of methods of the disclosure with standard medical treatments (e.g., lonafarnib, statins, glucocorticoids, corticosteroids and / or non-steroidal anti-inflammatory drugs) or with other inhibitory RNA constructs are specifically contemplated, as are combinations with other therapies such as those disclosed in International Publication No. WO 2013 / 016352, which is incorporated by reference herein in its entirety.

[0123] In some aspects, the disclosure provides an additional therapeutic agent, such as various small molecule compounds and compositions comprising such small molecule compounds for downregulating aberrant LMNA or progerin in the treatment of progeria, or HGPS, or in a condition associated with the aberrant expression of LMNA due to a mutation in exon 11 . In some aspects, Lonafarnib is administered as an additional therapeutic agent in combination with one or more LMNA or progerin miRNA of the disclosure. Lonafarnib, sold under the brand name ZOKINVY®, is a medication used to reduce the risk of death due to HGPS and for the treatment of certain processing-deficient progeroid laminopathies in people one year of age and older.

[0124] In some aspects, lonafarnib, statins, glucocorticoids, corticosteroids and / or nonsteroidal anti-inflammatory drugs are administered as additional therapeutic agents. In some aspects, a glucocorticoid is administered as an additional therapeutic agent in combination with one or more LMNA or progerin miRNA of the disclosure. All types of glucocorticoids are included for use in the combination therapies disclosed herein. Such glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort,beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.

[0125] Other combination therapies included in the disclosure are the LMNA-targeting or progerin-targeting miRNAs, as described herein, in combination with other miRNAs, or in combination with U7-snRNA-based gene therapy, a small molecule inhibitor of aberrant LMNA or progerin expression, oligonucleotides to inhibit aberrant LMNA or progerin through RNAi or RNAse H or exon skipping mechanisms, U7-snRNA plus a theoretical CRISPR- based gene therapy approach.

[0126] Administration of an effective dose of a nucleic acid including, but not limited to, a nucleic acid conjugated to a tissue-specific peptide, or tissue-specific aptamer or tissuespecific antibody, or a nucleic acid in a vector including, but not limited to, a viral vector, or a nucleic acid in a nanoparticle (for example, a lipid nanoparticle, micelle, or the like), extracellular vesicle, exosome or composition of the disclosure is, in various aspects, by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, in various aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various aspects, an effective dose is delivered by a combination of routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.

[0127] In particular, actual administration of delivery vehicle (such as rAAV) may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simplyresuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the affected cells and tissues by transdermal transport. Numerous formulations for intramuscular injection, subcutaneous injection, and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0128] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.

[0129] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0130] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, asrequired, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0131] The disclosure also provides a kit comprising a nucleic acid (including a nucleic acid conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody), vector, nanoparticle, extracellular vesicle, exosome, or composition of the disclosure or produced according to a process of the disclosure. In the context of the disclosure, the term "kit" means two or more components, one of which corresponds to a nucleic acid (including a nucleic acid conjugated to a tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody), vector, nanoparticle, extracellular vesicle, exosome, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise. A kit, therefore, in various aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.

[0132] The kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above). The kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and / or means for diluting the nucleic acid, vector, or composition.

[0133] In some aspects, the kit comprises a label and / or instructions that describes use of the reagents provided in the kit. The kits also optionally comprise catheters, syringes or other delivering devices for the delivery of one or more of the compositions used in the methods described herein.

[0134] The disclosure also provides kits for a single dose of administration unit or for multiple doses. In some embodiments, the disclosure provides kits containing singlechambered and multi-chambered pre-filled syringes.

[0135] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated,even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed with "a" or "an," it should be understood that these terms mean "one or more" unless context unambiguously requires a more restricted meaning.

[0136] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the disclosure.

[0137] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term."

[0138] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 10 includes 10.

[0139] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having."

[0140] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0141] In each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms.

[0142] It should be understood that this disclosure is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particularembodiments only, and is not intended to limit the scope of the subject matter of the disclosure, which is defined solely by the claims.

[0143] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0144] A better understanding of the disclosure and of its advantages will be obtained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.EXAMPLES

[0145] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.Example 1 Materials and Methods

[0146] Study Design. The objective of the study was to explore new strategies for the treatment of progeria resulting from expression of the progerin protein resulting from a mutation at the 3’ terminus (e.g., exons 11-12) of the Lamin A (LMNA) gene. In this study, a novel strategy was developed to direct RNAi against exon 12 of the LMNA gene or the progerin gene since exon 12 of both genes shares identity. MicroRNAs (miRNAs) were artificially designed to specifically target and knockdown the Progerin mRNA isoform of the Lamin A / C gene (LMNA). In this approach the Lamin A (LMNA) isoform is also knocked down, but the Lamin C mRNA isoform is left intact.

[0147] Sequence Generation and Cloning. Fifty-two artificial miRNAs were designed for use in this study to target the exon 12 sequence of Progerin and Lamin A using methods generally described by Saad et al. (Nat Common. 12:7128, 2021) and Wallace et al. (Mol Ther Methods Clin Dev, 2018. 8: 121 -130). Exon 12 was chosen for targeting in this disclosure because the sequence is unique to both Progerin and Lamin A sequences. Bytargeting exon 12, the goal was to knock down Progerin and Lamin A expression and leave intact the expression of Lamin C.

[0148] All miRNAs were cloned into the mir-30 based / U6 construct as previously described [Saad, N.Y., et al., Nat Commun. 12:7128, 2021 ; Wallace et al., Mol. Ther. 20:1417-23 (2012)]. The miRNA constructs used in this study were cloned or are being cloned into an expression plasmid downstream of an RNA polymerase III class of promoters (U6 or H1 promoters).

[0149] HEK293 Cell Culture. HEK293 cells were grown using DMEM (Gibco) medium supplemented with 20% FBS (Corning), 1% L-glutamine (Gibco) and 1% Penicillinstreptomycin (Gibco). Transfected cells were grown in the same DMEM medium but lacking Penicillin-Streptomycin.

[0150] Dual Luciferase Assay. This assay was performed as previously described by Saad et al. (Nat Commun. 12:7128, 2021 ) and Wallace et al. (Mol. Ther. Methods Clin. Dev. 8: 121-30 (2018)) and following the dual-luciferase reporter assay system (Promega) protocol. All plasmid constructs had the psiCheck2 dual luciferase reporter plasmid (Promega) as backbone that contains separate Ren ilia and Firefly luciferase genes, where the former contains the various target sequences used in the experiments of the disclosure, and the latter serves as a transfection normalizer (control). All LMNA, progerin encoding sequence and control sequences were cloned downstream of the Ren ilia luciferase stop codon, serving as a 3’UTR. HEK293 cells were pre-plated 24h before transfection. Cells were then co-transfected with the luciferase target gene reporter and individual microRNA expression plasmids in an increasing luciferase target gene reporter:miRNA molar ratio using Lipofectamine 2000 (Invitrogen). Luciferase activity was measured 24h after transfection. LMNA / progerin gene silencing was determined as previously described (Saad, N.Y., et al., Nat Commun. 12:7128, 2021 ; Wallace et al., Mol. Ther. Methods Clin. Dev. 8: 121-30 (2018)). Quadruplicate data were averaged per experiment, and individual experiments were performed 3-4 times. Results were reported as the average ratio of Renilla to Firefly luciferase activity ± SEM for all combined experiments.

[0151] HeLa Cell Culture. HeLa cells naturally expressing Lamin A and C proteins were transfected with mi577-expressing or mi747-expressing plasmids at increasing doses (1 , 2 and 4 pg). A plasmid encoding a control miRNA (miGFP) was also transfected in HeLa cells. 24 hours post-transfection, total proteins were prepared and loaded on a western blot gene to determine Lamin A and C levels. GAPDH was used as a reference protein and was blotted using the mAb anti-GAPDH antibody, clone 6C5 (MAB374). To blot for Lamin A andC, the anti-Lamin A / C Antibody, clone 2E8.2 was used. The graph on the right panel shows percent Lamin A / C protein levels and represents the quantification of the Lamin A and the Lamin C band intensities, and percent knockdown of Lamin A and Lamin C following normalization against the control (miGFP).

[0152] Statistics. For functional, physiological and molecular analysis, ANOVA is used to test multiple comparisons across a data set. Analyses are carried out in triplicate or quadruplicate within a single experiment, whenever possible. Data from western blots is quantified by scanning densitometry. Differences are evaluated by fold-change with significance assessed using ANOVA. p < 0.05 will show statistical significance.Example 2Knockdown Efficiency of the Progerin-Targeting miRNAs in HEK293 Cells

[0153] Using a miRNA shuttle predictor version 1 .0 (Wallace et al., Mol. Ther. Methods Clin. Dev., 2018 8:121 -130), 52 miRNAs were designed to target exon 12 of the progerin gene (Fig. 1 A). These miRNAs were tested for gene silencing using an in vitro progerin- customized dual luciferase assay (DLA) (Saad et al., Nat Commun, 2021. 12(1): 7128). This experiment required two sets of plasmids: (1) U6 promoter-driven miRNA expression constructs; and (2) luciferase plasmids containing Progerin sequences, as well as a separate Firefly luciferase reporter to serve as transfection control (Fig. 1 B). Thus, HEK293 cells were co-transfected with a U6t6. miRNA expressing plasmid and a dual luciferase expressing plasmid (psicheck2) encoding the Renilla luciferase-Progerin mRNA fusion. The psicheck2 plasmid also encodes a Firefly luciferase used to normalize the Renilla luciferase signal (Fig. 1 B). Renilla and Firefly luciferase activity were measured following co-transfection. If progerin expression is silenced by the miRNAs, the Ren illa:Firef ly ratio is reduced compared to non-targeting controls (miGFP). All tested miRNA reduced luciferase expression and activity (Fig. 1 C), indicating progerin target engagement. None of the tested miRNAs had target sites against the two luciferases. The reduction in Renilla / Firef ly ratio below one is indicative of miRNA-induced knock-down.

[0154] The 18 progerin-targeting miRNAs shown in Fig. 1 C showed an initial inhibition efficiency within the range of about 18-60%. Of these 18 miRNAs, mi577 showed the greatest inhibition efficiency of progerin expression to date with 60% reduction in luciferase activity, but additional testing is in progress to determine inhibition efficiency of all constructs both in vitro and in vivo.

[0155] Subsequent testing for a larger group of miRNAs was carried out to analyze progerin inhibition. A dual-luciferase assay was used to further test progerin inhibitionefficiency of 36 lamin A / progerin-targeting miRNAs (Fig. 1 D). Average percent knockdown of progerin expression is shown in Table 2 below. The symbol “*” shows statistical significance of knockdown when normalized to miGFP. *, p-value < 0.04; **, p-value < 0.005; ***, p-value = 0.0001 ; ****, p-value < 0.0001 . Italicized miRNAs showed higher expression compared to the control (miGFP). Bold miRNAs showed knockdown of progerin expression. Eleven miRNAs as follows: mi327, mi365, mi366, mi577, mi733, mi747, mi849, mi850, mi996, mi997, and mi999, showed statistically significant knockdown (One-way ANOVA, Dunnett test, N=3-6 independent replicates). This data represents data shown in Figure 1 D.

[0156] Table 2. Average percent knockdown of the progerin miRNAs normalized to a control (miGFP).

[0157] The data in Table 2 was generated by calculating the percent difference between the Ren illa / Firef ly ratio of each miRNA and that of the miGFP and by using the ordinary oneway ANOVA with Dunnett test of N=3-6 independent replicates as statistical analysis.Example 3Knockdown Efficiency of the Progerin-Targeting miRNAs in HeLa Cells Expressing Lamin A and Lamin C

[0158] Knockdown efficiency of the progerin-targeting miRNAs of the disclosure was tested using HeLa cells expressing Lamin A and Lamin C. Fig. 2 (left panel) shows a Western blot of Lamin A and Lamin C 24 hours after HeLa cells were transfected with mi577-expressing or mi747-expressing plasmids at increasing doses (i.e., 1 , 2 and 4 pg). GAPDH was used as a reference protein. The graph on the right panel shows percent Lamin A / C protein levels and represents the quantification of the Lamin A and the Lamin C band intensities, and percent knockdown of Lamin A and Lamin C following normalization against the control (miGFP).

[0159] / W / 577was able to knockdown the expression of Lamin A by a maximum of 68% and that of Lamin C by a maximum of 36%. / W / 747was able to knockdown the expression of Lamin A by a maximum of 29% and that of Lamin C by a maximum of 22%.Example 4Knockdown Efficiency of the Progerin-Targeting miRNAs in HEK293 Cells Overexpressing Progerin

[0160] Knockdown efficiency of the progerin-targeting miRNAs of the disclosure is further tested using HEK293 cells overexpressing progerin. GFP-progerin protein fusions are overexpressed in HEK293 cells and changes in the nuclear envelop morphology of the cells is measured. This experiment takes advantage of the dominant negative effect of progerinon the function and morphology of the cell’s nuclear membrane to test the therapeutic efficacy of the progerin-targeting miRNAs of the disclosure. Progerin-expressing cells have their nuclear membrane morphology significantly altered compared to normal cells. Cells expressing progerin often exhibit an abnormal nuclear shape. The nuclear envelope, which consists of the inner and outer nuclear membranes, typically forms a continuous, smooth, and spherical structure in normal cells. In contrast, progerin-expressing cells frequently display nuclear abnormalities such as lobulation, invaginations, and irregular contours. The nuclei may appear misshapen or elongated. In addition, the structural alterations in the nuclear membrane compromise the integrity of the nucleus, resulting in the leakage of nuclear contents into the cytoplasm, which may contribute to the cellular dysfunction observed in HGPS. The distorted nuclear membrane and associated changes can also lead to increased DNA damage and cellular stress in progerin-expressing cells. This stress contributes to the accelerated aging phenotype seen in individuals with HGPS.

[0161] Thus, HEK293 cells are transfected with increasing amount of GFP-progerin protein fusion expressing plasmid to determine the minimum amount of miRNA required for nuclear morphology to become affected. Due to the fusion of GFP to progerin, the nuclear membrane is able to be observed using fluorescence microscopy. GFP-progerin and miRNA expressing plasmids are co-transfected to observe the efficiency of the miRNA in reverting the nuclear membrane morphology to a normal state. The miRNA expressing plasmid also co-expresses mCherry, to allow to determine which cells expressing the GFP-progerin fusion were successfully transfected with the miRNA.

[0162] The percentage of misshapen nuclei is then quantified using Imaged, an open source image processing program designed for scientific multidimensional images, to analyze 9 non-overlapping sections of a 96-well plate well selected using an InCell analyzer (Bidault et al., Cells, 2020. 9(5)). The experiment is repeated and the percentage of nuclei with reduced thread-like ProMyelocytic Leukemia Nuclear Bodies (PML-NBs) in which ubiquitinylated progerin is sequestered is quantified (Harhouri et al., EMBO Mol Med, 2017. 9(9):1294-1313). Digital droplet PCR (ddPCR) and Western blot analyses also are carried out to quantify the reduction of progerin levels in cells co-transfected with the progerin- targeting miRNAs of the disclosure (N=3 independent replicates).

[0163] The progerin-targeting miRNAs are able to reduce progerin levels in cells in vitro.Example 5 Knockdown Efficiency of the Progerin-Targeting miRNAs in Patient-Derived Fibroblasts

[0164] Patient-derived fibroblasts are transduced following transduction of AAV6 encoding the progerin-targeting miRNAs. AAV6 is a good serotype to effectively transduce fibroblasts in vitro. Alternatively, patient-derived fibroblasts are transduced following electroporation using the 4D-nucleofector kit and core unit. Progerin-targeting miRNAs are transduced in HGPS patient-derived and healthy control-derived fibroblasts (acquired from the Progeria Research Foundation’s (PRF’s) Cell and Tissue Bank) and the expression of lamin A and progerin is examined using ddPCR and Western blot analysis.

[0165] To assess the effect of transduced miRNAs, the percent of nuclei with reduced thread-like PML-NBs, the percent of Ser139-phosphorylated histone variant H2A (y-H2AX)- positive nuclei, and the expression of DNA-dependent protein kinase catalytic subunit (DNA- PKC) are quantified (Bidault et al., Cells, 2020. 9(5); Urushihara et al., Biochem. Biophys. Res. Commun, 2012. 429(3-4): 131-6). y-H2A.X is a marker of the DNA Damage Response (DDR). Because HGPS fibroblasts are known to express senescence-associated - galactosidase (Goldman et al., Proc Natl Acad Sci U S A, 2004. 101 (24): 8963-8), the number of HGPS fibroblasts positive for senescence-associated p-galactosidase activity compared to control fibroblasts is quantified using flow cytometry (Chen et al., Aging Cell, 2017. 16(4): 870-887). Senescence is also quantified using the Beta-Gio Assay kit (Promega) (Harhouri et al., Cells, 2016. 5(3)) and the reduction of lamin A and progerin expression is measured with ddPCR and Western blot analysis.

[0166] The progerin-targeting miRNAs are able to reduce progerin levels in cells in vitro.Example 6 Progerin-Targeting miRNA Toxicity Testing

[0167] To test in vitro toxicity, progerin-targeting miRNAs and control scr miRNA are transfected in control fibroblasts. RNA-seq transcriptomic analysis is carried out to look at off-target effect and assess extent of differential gene expression. Transcriptomic analysis on small RNAs is carried out to assess miRNA processing and effect of miRNA expression on the expression of endogenous miRNAs.

[0168] To test for in vivo toxicity, a toxicity study is carried out following local intramuscular injection of progerin-targeting miRNAs and scr miRNA similar to methods previously reported (Wallace et al., Mol Ther Methods Clin Dev, 2018. 8: 121 -130; Saad et al., Nat Commun, 2021 . 12(1 ): 7128). A low (1 E+11 vg), a medium (5E+11 vg) and a high(2E+12 vg) total dose of self-complementary (sc) AAV6.Progerin-targeting miRNAs and control miRNA (AAV6.scr_miRNA) are injected into the tibialis anterior (TA) muscle and into the contralateral TA muscle, and muscle histopathology is assessed at 8-week endpoint (N=6 mice, 3 males and 3 females each). An observational qualitative assessment is performed following Hematoxylin and Eosin (H&E) staining of muscle cryosections by looking for muscle degeneration and regeneration characterized by the presence of centrally nucleated myofibers. Muscle inflammation, characterized by the infiltration of mononuclear cells, is also examined.

[0169] A toxicity study following tail vein systemic intravenous injection (i.v. injection) of low (3E+13 vg / kg) and high (3E+14 vg / kg) doses of scAAV9.Progerin-targeting miRNAs into 8-week-old C57BL / 6J mice is also carried out. The AAV. miRNA injected animals are compared to control animals (saline injected and untreated animals) (n=6 mice, 3 males and 3 females each). Nine months post-injection, a comprehensive necropsy and assessment of hematology, blood chemistry, and immune markers is carried out at the OSU Veterinary Pathology Core. A complete blinded post-mortem comparative pathology assessment is carried out. ddPCR is carried out to quantify AAV vector genome (vg) levels and to confirm expression of progerin-targeting miRNAs in injected TA and in tissues of systemically injected mice.Example 7 Progerin-Targeting miRNA Decrease Progerin Expression In Vivo

[0170] The therapeutic efficacy of the progerin-targeting miRNAs are tested in an acute AAV.Progerin-based LmnaLCS / LCSmouse model (Osorio et al., Sci Transl Med, 201 1. 3(106): 106ra107). This mouse model of human accelerated aging expresses human progerin as mouse skeletal muscle is injected with an AAV. Progerin vector. This mouse model is best used for short-term in vivo screening of progerin-targeting therapeutics such as the progerin- targeting miRNAs of the disclosure. The LmnaLCS / LCSmouse model was created by a knock- in strategy involving a mutant allele encoding lamin C alone. This allele carries a floxed neo cassette just downstream of the polyadenylation site of lamin C and the G609G mutation in exon 1 1 (Lamin C-Stop). LmnaLCS / LCShomozygous mice are indistinguishable from their wildtype littermates and do not show any detectable differences in growth or longevity up to 50 weeks of age. When crossed with a Cre-deleter mouse strain, the LmnaG609G knock-in allele, expressing lamin C, lamin A, and progerin is obtained. By transiently expressing progerin via AAV in skeletal muscles of LmnaLCS / LCSmice, muscle damage is triggered.

[0171] TA muscles of 8-week-old LmnaLCS / LCSmice are injected with 3E+08, 3E+09, 3E+10 and 3E+11 AAV6.AcGFP.P2A.progerin and the contralateral TA is injected with saline (n = 16, 8 males and 8 females). Muscle histopathology is examined at 2-, 4-, 6- and 8-week endpoints.

[0172] In the AAV.Progerin expressing vector, progerin is fused to a monomeric Aequorea coerulescens GFP (AcGFP) and a P2A peptide that allows immediate cleavage of AcGFP and progerin proteins. The monomeric AcGFP confers greater tissue penetration and spectral separation from autofluorescence than dimeric eGFP. The co-expression of AcGFP with progerin allows for the assessment of transduction efficiency of AAV vectors in injected muscles. To evaluate basic morphology and mitochondria distribution, tissue is stained with H&E and Engel trichrome. To evaluate the distribution of mitochondria and sarcoplasmic network, tissue is stained with nicotinamide-adenine-dinucleotide tetrazolium- reductase (NADH-TR). To evaluate distribution and activity of mitochondria, tissue is stained to examine the expression of succinate-dehydrogenase (SDH) and cytochrome oxidase (COX).

[0173] To assess the therapeutic efficacy of progerin-targeting miRNAs, AAV6. AcGFP. P2A.Progerin is co-injected with AAV6.U6. Progerin-targeting miRNA at a 1 :10 ratio into the TA muscle of the mice. This co-injection is compared to the control co-injection of AAV6. AcGFP. P2A.Progerin and AAV6.scr_miRNA negative control into the contralateral TA muscle for two endpoints with 16 mice (8 males and 8 females) for each endpoint. The minimum dose chosen is that at which muscle damage, as characterized by appearance of centrally nucleated myofibers, fiber atrophy, vacuolization and mitochondrial damage, is observed.

[0174] Reduced levels of progerin mRNA are observed in muscles of mice treated with the progerin-targeting miRNA compared to the levels of progerin mRNA in muscles of untreated mice.Example 8 Progerin-Targeting miRNA Decrease Progerin Expression In Vivo in a Humanized Mouse Model

[0175] The therapeutic efficacy of the progerin-targeting miRNAs is tested in another progerin mouse model, the LmnaG608G / G608Gmouse model (C57BL / 6- Tg(LMNA*G608G)HCIns / J) HGPS mice (Varga et al., Proc Natl Acad Sci USA, 2006. 103(9): 3250-5; Gordon et al., GeneReviews((R)), M.P. Adam, et al., Editors. 1993: Seattle (WA);Gordon et al., Circulation, 2014. 130(1): 27-34). This humanized mouse model expresses human progerin and therefore allows for quicker translation of this therapy to the clinic.

[0176] To determine the effect of injection route and timing on in vivo gene silencing, short- and long-term therapeutic efficacy of the progerin-targeting miRNAs is tested in these mice by retro-orbital injection of P3 (3-day-old) and P14 (2-week-old) mice and by intraperitoneal injection of P14 mice at 6-week and 6-month endpoints, respectively, as previously described (Koblan et al., Nature, 2021. 589(7843): p. 608-614).

[0177] Various cohorts: i) C57BL / 6 wild-type mice and ii) untreated, iii) saline injected, iv) AAV9.U6. Progerin-targeting miRNA candidate one, v) AAV9.U6. Progerin-targeting miRNA candidate two, vi) AAV9.U6. Progerin-targeting miRNA candidate three and vii) AAV9.U6.scr_miRNA control injected HGPS mice are used for comparison to assess functional outcome measures including, but not limited to, such things as strength (i.e., by open-field, hanging wire and rotarod tests), body weight, and longevity.

[0178] Histological and molecular outcomes are examined in aorta, heart, skeletal muscles (Tibialis anterior, Quadriceps, Gastrocnemius and Triceps)), liver, kidney, spleen, lungs, visceral fat, white adipose tissue (WAT), skin and bone at various time periods. Additionally, a longevity study is carried out to assess lifespan over 1 ,5-year duration using new cohorts of mice of the same groups following same injection routes and using same doses.

[0179] Reduced levels of progerin mRNA are observed in cells and tissues of mice treated with the progerin-targeting miRNA compared to the levels in cells and tissues of untreated mice.Example 9Progerin-targeted miRNA Decrease Progerin RNA Expression in Cells and Tissues

[0180] AAV comprising the progerin-targeted miRNA constructs of the disclosure are injected intramuscularly (IM) or intravenously (IV) into patients suffering from or at risk of suffering from progeria. Prior to treatment and after 4, 8, 12, 16, 20, 24, 28, 32, 3640, 44, 48, and 52 weeks, the expression level of progerin-targeted miRNA in cells and tissue of the patients is measured in biopsied tissue by qRT-PCR, RNAscope, or ddPCR.

[0181] Reduced levels of progerin mRNA are observed in cells and tissues of patients treated with AAV comprising the progerin-targeted miRNA constructs of the disclosure compared to the levels of progerin mRNA in cells and tissues of the same patients prior to treatment. Improvement in progeroid disease symptoms is also observed.

[0182] Treatment improves one or more of premature aging or natural aging or a condition, disease or disorder associated with the aberrant expression of LMNA or progerin including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0183] The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.

[0184] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise” and variations such as “comprises” and “comprising” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0185] Throughout the specification, where compositions are described as including components or materials, it is contemplated that the compositions can also consist essentially of, or consist of, any combination of the recited components or materials, unless described otherwise. Likewise, where methods are described as including particular steps, it is contemplated that the methods can also consist essentially of, or consist of, any combination of the recited steps, unless described otherwise. The invention illustratively disclosed herein suitably may be practiced in the absence of any element or step which is not specifically disclosed herein.

[0186] The practice of a method disclosed herein, and individual steps thereof, can be performed manually and / or with the aid of or automation provided by electronic equipment. Although processes have been described with reference to particular embodiments, a person of ordinary skill in the art will readily appreciate that other ways of performing the acts associated with the methods may be used. For example, the order of various of the steps may be changed without departing from the scope or spirit of the method, unless described otherwise. In addition, some of the individual steps can be combined, omitted, or further subdivided into additional steps.

[0187] All patents, publications and references cited herein are hereby fully incorporated by reference. In case of conflict between the present disclosure and incorporated patents, publications and references, the present disclosure should control.

Claims

CLAIMS\Ne claim:1 . A nucleic acid comprising:(a) a nucleotide sequence that encodes a primary lamin A / progerin-targeting microRNA (miRNA), the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 1-52;(b) a nucleotide sequence that encodes a primary lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 1 -52;(c) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising at least 90% identity to the sequence set forth in any one of SEQ ID NOs: 53-104;(d) a nucleotide sequence that encodes a mature lamin A / progerin-targeting miRNA, the nucleotide sequence comprising the sequence set forth in any one of SEQ ID NOs: 53-104;(e) a nucleotide sequence that encodes the lamin A / progerin-targeting miRNA sequence set forth in any one of SEQ ID NOs: 105-156; or(f) a nucleotide sequence that specifically hybridizes to the lamin A / progerin target sequence set forth in any one of SEQ ID NOs: 157-208.

2. The nucleic acid of claim 1 further comprising a promoter sequence.

3. The nucleic acid of claim 2, wherein the promoter is any of LI6, LI7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 -alpha, or a tissue-specific promoter.

4. The nucleic acid of claim 2 or 3, wherein the promoter is LI6, H1 , a muscle-specific promoter, or a cardiac-specific promoter.

5. The nucleic acid of claim 4, wherein:(a) the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancerpromoter (MHCK7), or CK1 ; and / or(b) the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a- MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1.

6. A vector comprising the nucleic acid of any one of claims 1 -5.

7. The vector of claim 7, wherein the vector is an adeno-associated virus (AAV).

8. The adeno-associated virus of claim 7, wherein the virus lacks rep and cap genes.

9. The adeno-associated virus of claim 7 or 8, wherein the virus is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).

10. The adeno-associated virus of any one of claims 7-9, wherein the virus is AAV1 ,AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhW, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV.PHP.EB, or AAVv66.11 . The adeno-associated virus of any one of claims 7-10, wherein the virus is AAV9.

12. A nanoparticle, extracellular vesicle, or exosome comprising the nucleic acid of any one of claims 1-5.

13. A tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody conjugated to the nucleic acid of any one of claims 1 -5.

14. A composition comprising(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12; or(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and a pharmaceutically acceptable carrier.

15. A method of inhibiting and / or inhibiting the expression of an aberrant lamin A (LMNA)Zprogerin gene in a cell comprising contacting the cell with(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12;(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and / or(f) the composition of claim 14.

16. A method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12;(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and / or(f) the composition of claim 14.

17. The method of claim 16, wherein the disease or disorder associated with an aberrant lamin A (LMNA)Zprogerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

18. The method of claim 17, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

19. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12;(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and / or(f) the composition of claim 14 for the preparation of a medicament for inhibiting expression of an aberrant lamin A (LMNA)Zprogerin gene in a cell.

20. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12;(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and / or(f) the composition of claim 14 for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA)Zprogerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

21. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of claim 6;(c) the adeno-associated virus of any one of claims 7-11 ;(d) the nanoparticle, extracellular vesicle, or exosome of claim 12;(e) the tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13; and / or(f) the composition of claim 14 for the preparation of a medicament for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

22. The use of claim 20 or 21 , wherein the disease or disorder associated with an aberrant lamin A (LMNA)Zprogerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

23. The use of claim 22, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

24. The(a) nucleic acid of any one of claims 1 -5;(b) vector of claim 6;(c) adeno-associated virus of any one of claims 7-11 ;(d) nanoparticle, extracellular vesicle, or exosome of claim 12;(e) tissue-specific peptide, tissue-specific aptamer, or tissue-specific antibody of claim 13;(f) composition of claim 14;(g) method of any one of claims 15-18; or(h) use of any one of claims 19-23, wherein the nucleic acid, vector, AAV, nanoparticle, extracellular vesicle, exosome, tissuespecific peptide, tissue-specific aptamer, tissue-specific antibody, composition, or medicament is formulated for subcutaneous injection, intramuscular injection, intraperitoneal injection, intrathecal injection, oral administration, subcutaneous transport, intradermal transport, transdermal transport, injection into the blood stream, or aerosol administration.