3'-utr with improved translation efficiency, a synthetic nucleic acid molecule comprising the same, and a vaccine or therapeutic composition comprising the same

Abstract

The present invention relates to a synthetic nucleic acid molecule comprising 3'-UTR polynucleotide with improved translation efficiency and a vaccine composition comprising the same, and more particularly to a synthetic nucleic acid molecule comprising 3'-UTR with improved translation efficiency manufactured by inclusion of specific motif and a codon-optimized signal sequence and an antigen encoding sequence, and a vaccine composition comprising the same. The synthetic nucleic acid molecule according to the present invention comprises a 3'-UTR polynucleotide with improved translation efficiency, which can effectively induce the expression of an antigenic polypeptide, which is useful for vaccine development because it can be expected to increase immunogenicity as a vaccine.

Description

3'-UTR WITH IMPROVED TRANSLATION EFFICIENCY, A SYNTHETIC NUCLEIC ACID MOLECULE COMPRISING THE SAME, AND A VACCINE OR THERAPEUTIC COMPOSITION COMPRISING THE SAME

[0001] The present invention relates to a synthetic nucleic acid molecule comprising 3'-UTR polynucleotide with improved translation efficiency and a vaccine / therapeutic composition comprising the same, and more particularly to 3'-UTR polynucleotide with improved translation efficiency manufactured by inclusion of specific motif, a synthetic nucleic acid molecule comprising the same and a vaccine / therapeutic composition comprising the synthetic nucleic acid molecule.

[0002]

[0003] The untranslated regions (UTRs) within mRNAs have been reported to play a pivotal role in the regulation of both mRNA stability and mRNA translation. In addition to translation initiation, elongation, and termination, UTRs have been shown to influence mRNA stabilization and intracellular distribution through their interactions with RNA-binding proteins (Jackson RJ, et al., Nat Rev Mol Cell Biol. Vol. 11(2), pp. 113-127, 2010). Depending on the specific motif within the UTR, it can either enhance or decrease mRNA turnover (Barrett LW, et al., Cell Mol Life Sci. Vol. 69(21), pp. 3613-34, 2012). In addition, data on mRNA half-lives and corresponding UTR sequences have been published ('t Hoen PA, et al., Nucleic Acids Res. Vol. 39(2), pp. 556-566, 2012).

[0004] The UTR is the section of the mRNA molecule that is upstream of the start codon and downstream of the stop codon of mRNA, i.e., the untranslated sequence. These regions are transcribed along with the coding region, so they are present in mature mRNA and are therefore exons. The UTR located upstream of the start codon of mRNA is called the 5'-UTR, and once transcribed, it holds the so-called Kozak sequence, especially in addition to the sequence corresponding to the (residual 3') part of the promoter.

[0005] A Kozak consensus sequence, Kozak consensus, or Kozak sequence is known to occur in eukaryotic mRNA and has a common (gcc)gccRccAUGG. The Kozak consensus sequence plays a key role in the initiation of the translation process. The sequence is named after Marilyn Kozak, who led to its importance. This sequence within the mRNA molecule is recognized by the ribosome at the translation start site, from which the protein is encoded by the mRNA molecule. The ribosome requires this sequence or its possible variants to initiate translation.

[0006] The sequence is identified by the notation (gcc)gccRccAUGG, which summarizes the data analyzed by Kozak from a very diverse set of sources (about 699 in total), as shown below: lower-case letters denote the most common bases in positions where the base may nevertheless vary; upper-case letters denote highly conserved bases, i.e., the "AUGG" sequence is constant or rarely, if ever, changes; "R" denotes that a purine (adenine or guanine) is always observed at this position (with adenine being more frequent according to Kozak); the sequence in parentheses ((gcc)) is of uncertain significance.

[0007] While many means and methods have been disclosed for increasing the stability of mRNA, reducing immunogenic responses triggered by mRNA administered to a cell or organism, and increasing expression efficiency (i.e., transcription and / or translation efficiency) (US 10080809, US 2018-0353618, US 2019-0144883), there is still a need for improvement, particularly with respect to additional or alternative means for increasing expression efficiency (i.e, transcription and / or translation efficiency), and this is because expression efficiency is an essential parameter for anticipated medical applications, as it determines, for example, the dosing and dosing interval of mRNA drugs, and ultimately the bioavailability of the end product, i.e., the peptide or protein being encoded. At the same time, there continues to be a need to further reduce the cost of manufacturing mRNA drugs, increase the yield of mRNA molecules produced, and increase the available space within the mRNA molecules produced for the actual transgene, i.e., the coding region that encodes for the desired polypeptide.

[0008] Meanwhile, gene vaccines began to be developed when it was reported that DNA and RNA encoding a target gene could be directly injected into an animal, the target gene would be expressed in the living animal, and the animal would be immunized by this expression (Wolff JA et al. Science, 247:1465-8, 1990).

[0009] Gene vaccination allows for the generation of a desired immune response to selected antigens, such as characteristic components of the surface of bacteria, viral particles, tumor antigens, etc. In general, vaccination is one of the pivotal achievements of modern medicine. However, effective vaccines are currently only available for a limited number of diseases. Therefore, infectious diseases that cannot be prevented by vaccination still affect millions of people every year.

[0010] In gene therapy or gene vaccination, DNA and RNA can be used as nucleic acid molecules for gene delivery, with DNA being known to be relatively stable and easier to handle compared to RNA. However, in the case of DNA, there is a potential risk if the DNA-fragment administered into the patient's genome is inserted in an unwanted location, causing damage to the gene. In addition, unwanted anti-DNA antibodies may be present, and another problem is that the expression level of the peptide or protein expressed by DNA administration and its subsequent transcription / translation is limited. The presence or absence of specific transcription factors that regulate DNA transcription has a major impact on the level of expression of the administered DNA, and in the absence of specific transcription factors, sufficient amounts of RNA are not produced by DNA transcription and, consequently, the level of peptides or proteins that are translated and produced is limited.

[0011] On the other hand, when RNA is used as a tool for gene delivery, it does not require transcription and can synthesize proteins directly in the cytoplasm without the need to enter the nucleus like DNA, so there is no risk of getting stuck in the cell's chromosomes and causing unwanted gene damage. It also has a shorter half-life compared to DNA, so it does not induce long-term genetic modifications (Sayour EJ, et al., J Immunother Cancer Vol. 3, 13, 2015). Typical RNA vaccines are only activated for a short period of time once delivered into the cell to express the target protein and are destroyed by enzymatic reactions within a few days, leaving behind a specific immune response to the expressed target antigen (protein).

[0012] In addition, when using RNA as a tool for gene delivery, it only needs to cross the cell membrane to work, rather than the nuclear membrane, so it can be used in smaller amounts than DNA to express the same amount of target protein as DNA. In addition, RNA has immunoprotective properties of its own, meaning that it can be administered in smaller doses than DNA to produce the same immune effect. By using RNA instead of DNA for gene vaccination, the risk of unwanted genomic integration and the generation of anti-DNA antibodies is minimized or avoided. However, RNA is considered to be a fairly unstable molecular species that can be readily degraded by ubiquitous RNases.

[0013] Although many advances have been made over the past few years, efficient methods for mRNA vaccination that can trigger an adaptive immune response, where premature degradation of antigens or inefficient translation of mRNA due to inefficient release of mRNA from cells remains a challenge in the art. Furthermore, there is an urgent need to reduce the dose of mRNA vaccines to reduce potential safety concerns and to make the vaccine affordable in the third world.

[0014] When it comes to delivering nucleic acids to cause desired reactions in biological systems, there are many challenges. Nucleic acid-based therapeutics, such as vaccines, hold tremendous promise, but to realize this, there is still a need to better deliver nucleic acids to the appropriate sites within a cell or organism.

[0015] However, the use of nucleic acids for therapeutic and preventive purposes currently faces two challenges. First, free RNA is vulnerable to nucleases in plasma. Second, free RNA has limited ability to access intracellular compartments where the relevant translational machinery resides. Lipid nanoparticles formed from cationic lipids and other lipid components such as neutral lipids, cholesterol, PEGs, pegylated lipids, and oligonucleotides are being tried to block the degradation of RNA in plasma and promote cellular uptake of nucleic acids.

[0016] Accordingly, the inventors of the present invention have made good faith efforts to solve the above problems and to develop synthetic nucleic acid molecules comprising 3'-UTRs with improved translation efficiency and stability, and have found that 3'-UTRs with improved translation efficiency and synthetic nucleic acid molecules comprising the same have superior performance as vaccines, and have completed the present invention.

[0017]

[0018] The above information in this Background Art is intended solely to enhance the understanding of the background of the present invention and may not include information that constitutes prior art known to one having ordinary skill in the art.

[0019]

[0020] [SUMMARY OF THE INVENTION]

[0021] It is an object of the present invention to provide 3'-UTR polynucleotide with improved translation efficiency.

[0022] It is another object of the present invention to provide a synthetic nucleic acid molecule comprising 3'-UTR polynucleotide with improved translation efficiency.

[0023] It is another object of the present invention is to provide a composition for a gene therapy or a vaccine composition comprising a synthetic nucleic acid molecule.

[0024]

[0025] To accomplish the above objectives, the present invention provides an isolated 3'-untranslated region (UTR) polynucleotide comprising a sequence represented by a nucleic acid sequence according to Formula (I):

[0026] Formula (I):

[0027] UUAAUUAA{[Nx]CUCGAGCUAUUCGGCUAUGACUGGGC}yAAGCUU,

[0028] wherein N means A, G, C, or U, x means an integer of 20 to 200, and y means an integer of 1 to 10.

[0029] The present invention also provides a synthetic nucleic acid molecule comprising, in 5' to 3' order, a) a 5'-CAP structure; b) a 5'-untranslated region (5'-UTR); c) one or more coding regions; d) the 3'-UTR polynucleotide; and e) a poly(A) tail or poly(A) tail-like sequence comprising 10 to 1000 adenines (A).

[0030] The present invention also provides a composition for a gene therapy or a vaccine composition comprising the synthetic nucleic acid molecule.

[0031]

[0032] FIG. 1 is a schematic illustration of how the 3'-UTR region is derived. After obtaining a pDNA library with a diversity of at least 1x106, an IVT mRNA library was synthesized and intravenously injected into mice using LNPs as a drug delivery system (DDS). The SELEX method was then used to derive the 3'-UTR sequence with improved mRNA stability. The first cycle was to amplify the 3'-UTR sequence from liver tissue 12 hours after injection of mRNA / LNPs and re-library the pDNA. Libraries were obtained at 24, 48, and 72 hours using the same method as before for NGS analysis. The top ranked 3'-UTR sequences that are predicted to have improved stability were validated through in vitro / in vivo experiments.

[0033] FIG. 2 is a graph showing the results of an intracellular 3'-UTR sequence validation experiment. NGS analysis confirmed the luciferase activity of the top 30 ranked genes 18 and 48 hours after mRNA transfection with lipofectamine p3000 into HEK293, Huh7, and AML12 cells. mRNA sequences equivalent to that of the control group, human alpha globin 3'-UTR, were obtained.

[0034] FIG. 3 shows the results of the 3'-UTR sequence validation experiment in mice. Candidate sequences 3'-UTR_#1, #4, #5, #7, #8, #9, #11, #14, #15 and #28 confirmed with equivalent translation efficiency compared to human alpha-globin in cellular experiments, were validated in mice. In these experiments, human alpha globin and BioNTech's 3'-UTR sequences were used as control. When measuring translation efficiency persistence based on AUC, equivalent or greater translation efficiency for 3'-UTR_#15 was observed compared to the control.

[0035] FIG. 4 shows the results of a mouse experiment to validate the dimer 3'-UTR sequence. Candidate sequences in the form of dimers of 3'-UTR_#15 and #1, #7, #9 and #14 were evaluated. When measuring translation efficiency persistence based on AUC, equivalent or greater translation efficiency for 3'-UTR_#15, #15+#1, #15+#9, #15+#14, #15+#15, #1+#15, #7+#15, and #14+#15 were observed compared to BioNTech 3'-UTR control.

[0036] FIG. 5 shows the results of a validation experiment in FXR mRNA of the 3'-UTR candidate sequence. 3'-UTR_#15, #15+#14, #15+#9, #15+#15 were applied as 3'-UTRs in FXR mRNA and FXR protein was validated using SDS page Western blot method. Superior protein expression was observed in #15, #15+#15 compared to the control group, FXR mRNA with human alpha globin and BioNTech 3'-UTR.

[0037]

[0038] [DETAILED DESCRIPTION OF THE INVENTION AND PREFERRED EMBODIMENTS OF THE INVENTION]

[0039] Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by those skilled in the art. In general, the nomenclature used herein is well known and in common use in the art.

[0040]

[0041] In the present invention, it was sought to determine that an mRNA construct comprising 3'-UTR with improved translation efficiency and stability can be used to express an antigenic protein with higher efficiency than wild-type mRNA.

[0042] In other words, in one example of the present invention, it has been found that the expression efficiency of antigenic protein is dramatically improved by utilizing a synthetic nucleic acid molecule comprising 3'-UTR polynucleotide with improved translation efficiency.

[0043]

[0044] Thus, in one aspect, the present invention relates to an isolated 3'-untranslated region (UTR) polynucleotide comprising a sequence represented by a nucleic acid sequence according to Formula (I):

[0045] Formula (I):

[0046] UUAAUUAA{[Nx]CUCGAGCUAUUCGGCUAUGACUGGGC}yAAGCUU,

[0047] wherein N means A, G, C, or U, x means an integer of 20 to 200, and y means an integer of 1 to 10.

[0048] Wherein x may be an integer of 20 to 200, preferably 25 to 150, more preferably 30 to 100, most preferably 35 to 80, but is not limited thereto.

[0049] Wherein y may be an integer of at least 1, preferably an integer of 1 to 10, more preferably an integer of 1 to 5, most preferably an integer of 1 to 3, but is not limited thereto.

[0050]

[0051] In the present invention, the Formula (I) may be any one of the sequences selected from the group consisting of SEQ ID NOs: 1 to 40, but is not limited thereto.

[0052]

[0053]

[0054]

[0055] In the present invention, the 3'-UTR polynucleotide according to the present invention can be defined as a monomer if y in Formula (I) is 1, a dimer if it is 2, or a multimer if it is 3 or more, and includes all of the above monomers, dimers, or multimers.

[0056] The dimer or multimer may be a homodimer or homomultimer if the Nx of Formula (I) are the same, or a heterodimer or heteromultimer if the Nx are different.

[0057] For example, a homodimer of the 3'-UTR polynucleotide according to the present invention may be in the form of Formula (I), wherein y is 2 and Nx all comprises the portion of Nx of SEQ ID NO: 15 (see SEQ ID NO: 34),

[0058] a heterodimer may be in the form of Formula (I), wherein y is 2 and Nx comprises a portion of Nx of SEQ ID NO: 14 and a portion of Nx of SEQ ID NO: 15, respectively (see SEQ ID NO: 35), and

[0059] a heteromultimer may be in the form of Formula (I), wherein y is 3 and Nx has a form that a portion of Nx of SEQ ID NO: 9 is positioned between two portions of Nx of SEQ ID NO: 15 (see SEQ ID NO: 40), but is not limited thereto.

[0060] Furthermore, the dimer or monomer of the isolated 3'-UTR polynucleotide may be directly linked, or may be linked via a spacer.

[0061]

[0062] In the present invention, the terms 3'-UTR polynucleotide, 3'-untranslated region and 3'-UTR region are used interchangeably, and the terms 5'-UTR polynucleotide, 5'-untranslated region and 5'-UTR region are used interchangeably.

[0063]

[0064] In the present invention, the term "3'-UTR" typically refers to a portion of mRNA located between the protein coding region of the mRNA (i.e., open reading frame, coding region) and the poly(A) sequence. The 3'-UTR of the mRNA is not translated into an amino acid sequence. 3'-UTR sequences are typically encoded by genes that are transcribed into their respective mRNAs during gene expression. This genomic sequence is first transcribed into an immature mRNA comprising selective introns. Immature mRNA is then further processed into mature mRNA during maturation. This maturation includes steps such as 5'-capping, splicing of immature mRNAs with selective intron excision, modification of the 3' end, such as polyadenylation of the 3' end of immature mRNAs, and selective endo- or exonuclease cleavage.

[0065] In the present invention, the 3'-UTR corresponds to a sequence of mature mRNA located 3' to the stop codon of the protein coding region, preferably 3' just flanking the stop codon of the protein coding region, and extending to the 5' side of the poly(A) sequence, preferably 5' just flanking the poly(A) sequence. The term "corresponding" means that the 3'-UTR sequence may be an RNA sequence, as in the mRNA sequence used to define the 3'-UTR sequence, or a DNA sequence corresponding to such an RNA sequence.

[0066] In the present invention, the 3'-UTR may be any one of the sequences selected from the group consisting of SEQ ID NOs: 1 to 40, and more preferably any one of the sequences selected from the group consisting of SEQ ID NOs: 1, 4, 5, 7 to 9, 11, 14, 15, 28, 31 to 35, 37 and 38, but is not limited thereto.

[0067]

[0068] In another aspect, the present invention relates to a synthetic nucleic acid molecule comprising the 3'-UTR. Specifically, the present invention relates to a synthetic nucleic acid molecule comprising, in 5' to 3' order,

[0069] a) a 5'-CAP structure;

[0070] b) a 5'-untranslated region (5'-UTR);

[0071] c) one or more coding regions;

[0072] d) the 3'-UTR polynucleotide; and

[0073] e) a poly(A) tail or poly(A) tail-like sequence comprising 10 to 1000 adenines (A).

[0074]

[0075] In the present invention, the term "synthetic nucleic acid molecule" is used interchangeably with mRNA construct and refers to a construct comprising mRNA encoding a desired coding region for expression thereof, in the form of a construct that is administered in the body.

[0076]

[0077] The 5'-CAP of natural mRNA accompanies nucleus export, increasing mRNA stability, and is bound to mRNA cap-binding protein (CBP), which results in mRNA stability in the cellular and translational processes through the assembly of poly(A)-binding protein and CBP to form a mature cyclic mRNA species. The cap further aids in the removal of introns proximal to the 5' end during mRNA splicing.

[0078] In the present invention, 5'-CAP is typically a modified nucleotide (CAP analog), in particular a guanine nucleotide added to the 5' end of an mRNA molecule. Preferably, the 5'-CAP is added using a 5'-5'-triphosphate linkage (also named m7GpppN). Additional examples of 5'-CAP structure include glyceryl, inverted deoxy abasic residues (moieties), 4',5' methylenenucleotides, 1-(beta-D-erythrofuranosyl) nucleotides, 4'-thio nucleotides, carbocyclic nucleotides, 1,5-unhydroxyhexitol nucleotides, L-nucleotides, alpha-nucleotides, modified base nucleotides, threo-pentofuranosyl nucleotides, acyclic 3',4'-seco nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic 3,5-dihydroxypentyl nucleotides, 3'-3'-inverted nucleotide moieties, 3'-3'-inverted abasic moieties, 3'-2'-inverted nucleotide moieties, 3'-2'-inverted abasic moieties, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodithioate, and bridging or non-bridging methylphosphonate moieties.

[0079] These modified 5'-CAP structures can be used to modify the mRNA sequence of the synthetic nucleic acid molecule of the present invention.

[0080] Additional modified 5'-CAP structures that can be used in the present invention include CAP1 (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), CAP2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), CAP3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), CAP4 (additional methylation of ribose on the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse CAP analog), modified ARCA (e.g. phosphothioate modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0081] In the present invention, the 5'-CAP structure may be formed from chemical RNA synthesis or in vitro transcription of RNA using a cCAP analog (co-transcriptional capping), or alternatively, the CAP structure may be formed in vitro using a capping enzyme (e.g., a commercially available capping kit).

[0082] In the present invention, a CAP analog refers to a non-polymerizable di-nucleotide having a CAP function that, when introduced to the 5' end of an RNA molecule, promotes translation or localization, and / or prevents degradation of the RNA molecule. "Non-polymerizable" means that CAP analogs do not have a 5' triphosphate and are therefore bound only at the 5' end and cannot be extended in the 3' direction by template-dependent RNA polymerase.

[0083] CAP analogs may include m7GpppA, m7GpppAmpG, and an unmethylated CAP analog; and a chemical structure selected from the group consisting of a dimethylated CAP analog, a trimethylated CAP analog (e.g., m2,2,7GpppA), a dimethylated symmetric CAP analog (e.g., m7Gpppm7A), or an anti-inverted CAP analog (e.g., ARCA; m7,2'OmeGpppA, m7,2'dGpppA, m7,3'OmeGpppA, m7,3'dGpppA, and tetraphosphate derivatives thereof), but are not limited thereto.

[0084] Additional CAP analogs have been previously described (US 7,074,596, WO 2008 / 016473, WO 2008 / 157688, WO 2009 / 149253, WO 2011 / 015347, and WO 2013 / 059475).

[0085] In the present invention, it may be selected from the group consisting of, but not limited to, the 5’-CAP m7GpppAmpG, m7GpppApG and m7,3’OmeApppG.

[0086]

[0087] In the present invention, the term "UTR" refers to an "untranslated region" located upstream (5') and / or downstream (3') of a coding region of a nucleic acid molecule described herein, and thus typically flanking the coding region. Therefore, the term "UTR" generally includes the 3' untranslated region ("3'-UTR") and the 5'-untranslated region ("5'-UTR"). UTR typically includes or may consist of nucleic acid sequences that are not translated into proteins. Typically, UTR includes a "regulatory element".

[0088] The term "regulatory element" refers to a nucleic acid sequence having gene regulatory activity, expression of a transcribable nucleic acid sequence operably linked (cis or trans) to it, and in particular the ability to affect transcription or translation. The term includes a promoter, an enhancer, an internal ribosome entry site (IRES), an intron, a leader, a transcription termination signal, such as a polyadenylation signal and a poly-U sequence, and other expression regulatory elements. Regulatory element can act constitutively or in a time- and / or cell-specific manner. Optionally, a regulatory element can function through the interaction (e.g., recruitment and binding) of regulatory proteins that can regulate (induce, enhance, reduce, discard, or prevent) expression, particularly transcription of a gene.

[0089] The UTR is preferably "operably linked" to a coding region, i.e., arranged in a functional relationship, in such a way as to control (i.e., mediate or regulate, preferably enhance) the expression of the coding sequence.

[0090]

[0091] In the present invention, the 5'-UTRs may be derived from, but not limited to, the following nucleic acid sequences:

[0092] Globin, such as α- or β-globin (e.g., xenopus, mouse, rabbit, or human globin); Kozak sequence; CYBA (e.g., human cytochrome b-245 α polypeptide); albumin (e.g., human albumin7); HSD17B4 (hydroxysteroid (17-β) dehydrogenase); virus (e.g., tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), hepatitis virus (e.g., hepatitis B virus), sindbis virus, or PAV barley yellow dwarf virus); heat shock protein (e.g., hsp70); translation initiation factor (e.g., elF4G); glucose transporter (e.g., human glucose transporter 1 (hGL UT1)); actin (e.g., human a or D actin); GAPDH; tubulin; histone; citric acid cycle enzyme; topoisomerase (e.g., 5′UTR of TOP gene lacking the 5′ TOP motif (oligopyrimidine tract)); ribosomal protein Large 32 (L32); ribosomal protein (e.g., human or mouse ribosomal protein, e.g., rps9); ATP synthase (e.g., ATP5A1 or the β subunit of mitochondrial H+-ATP synthase); growth hormone (e.g., bovine (bGH) or human (hGH)); elongation factor (e.g., elongation factor 1 al (EEF1A1)); manganese superoxide dismutase (MnSOD); myocyte enhancer factor 2A (MEF2A); β-F1-ATPase, creatine kinase, myoglobin, granulocyte colony-stimulating factor (G-CSF); collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1)); ribophorin (e.g., ribophorin I (RPNI)); low-density lipoprotein receptor-related protein (e.g., LRP1); cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (CaIr); procollagen-lysine, 2-oxoglutarate 5-deoxygenase 1 (Plod1); and nucleobindin (e.g., Nucb1).

[0093]

[0094] In the present invention, the term "5'-UTR" refers to a portion of a nucleic acid molecule, which is located 5' (i.e., "upstream") of the open reading frame, which is not translated into a protein. In the context of the present invention, the 5'-UTR begins at the transcription start site and terminates one nucleotide prior to the start codon of the open reading frame.

[0095] 5'-UTR can comprise elements that regulate gene expression, so-called "regulatory elements". These regulatory elements can be, for example, ribosome binding sites. The 5'-UTR can be modified by post-transcriptional modifications, for example by the addition of a 5'-CAP. Therefore, the 5’-UTR preferably corresponds to a nucleic acid sequence located between the 5'-CAP and the start codon, in particular a sequence of mature mRNA, and more specifically a nucleotide located 3' to the 5'-CAP, preferably a nucleotide located 3' just after the 5'-CAP, to a nucleotide located 5' to the start codon (transcription start site) of the protein coding sequence, preferably a nucleotide located 5' to the start codon (transcription start site) of the protein coding sequence, and more preferably a nucleotide located 5' just before the start codon (transcription start site) of the protein coding sequence.

[0096] The nucleotide located 3' just to the 5'-CAP of a mature mRNA typically corresponds to the transcription initiation site. The 5' UTR typically has a length of less than 500, 400, 300, 250 or 200 nucleotides. In some examples, it can range in length of 10, 20, 30 or 40 or more nucleotides, preferably 10 or 50 or less nucleotides.

[0097] In the present invention, the 5'-UTR is more preferably selected from the group consisting of, but not limited to, a β-globin 5'-UTR; a 5'-UTR comprising a Kozak sequence; a cytochrome b-245 α polypeptide (CYBA) 5'-UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5'-UTR; a tobacco etch virus (TEV) 5'-UTR; a Venezuelan equine encephalitis virus (VEEV) 5'-UTR; Y proximal open reading frame of rubella virus (RV) RNA encoding a non-structural protein; dengue virus (DENV) 5'-UTR; heat shock protein 70 (Hsp70) 5'-UTR; eIF4G 5'-UTR; GLUT1 5'-UTR; functional fragments thereof and combinations thereof.

[0098] In one example of the present invention, the 5'-UTR may be the sequence represented by SEQ ID NO: 41, but is not limited thereto.

[0099]

[0100] In the present invention, the synthetic nucleic acid molecule may comprise a region encoding a signal peptide, i.e., a polynucleotide encoding it, between b) a 5'-untranslated region (5'-UTR) and c) one or more coding regions.

[0101] The signal peptide may be derived from an antigenic polypeptide, immunoglobulin E (IgE), or tissue plasminogen activator (tPA), but is not limited thereto.

[0102] In the present invention, the polynucleotide encoding the signal peptide may be codon optimized.

[0103]

[0104] In the present invention, the coding region may encode one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins and fragments, variants or derivatives of the proteins.

[0105] In the present invention, the region encoding the above proteins is preferably, but not exclusively, a polynucleotide encoding the proteins.

[0106] Exemplarily, the antigenic protein may be one or more selected from the group consisting of, but not limited to, tumor antigens, pathogenic antigens, autoantigens, alloantigens, and allergenic antigens.

[0107]

[0108] In the present invention, the term "tumor antigen" refers to an antigenic (poly-) peptide or protein derived from or associated with a (preferably malignant) tumor or cancer disease. The terms "cancer" and "tumor" as used herein are used interchangeably to refer to neoplasms characterized by the uncontrolled and usually rapid proliferation of cells that tend to invade surrounding tissues and metastasize to distant body parts. This term includes benign and malignant neoplasms. Malignant tumors are typically characterized by anaplasia, invasion, and metastasis, while benign malignancies do not typically have these characteristics. The terms "cancer" and "tumor" refer specifically to cancers of the blood and lymphatic systems, as well as neoplasms characterized by tumor growth. A "tumor antigen" is typically derived from a tumor / cancer cell, preferably a mammalian tumor / cancer cell, and may be located in or on the interior or surface of a tumor cell or tumor, e.g., a systemic or solid tumor, derived from a mammal, preferably a human. "Tumor antigen" generally includes tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs are usually due to tumor-specific mutations and are specifically expressed by tumor cells. The more common TAAs are typically presented by both tumor and "normal" (healthy, non-tumor) cells.

[0109] In the present invention, the tumor antigen may be a protein or nucleic acid sequence associated with a tumor, wherein each nucleic acid sequence encodes a different peptide or protein; and wherein the at least one nucleic acid sequence is selected from the group consisting of 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, alpha-5-beta-1-integrin, alpha-5-beta-6-integrin, alpha-actinin-4 / m, alpha-methylacyl-coenzyme A racemase, A T-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, beta-catenin / m, BING-4, BRCA1 / m, BRCA2 / m, CA 1 5-3 / CA 27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m, CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactosin-like protein, collage XXIII, COX-2, CT-9 / BRD6, Cten, cyclin B1, Cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTUD2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST-2, hepsin, Her2 / neu, HERVK-MEL, HLA-A*0201 - R1 7I, HLA-A1 1 / m, HLA-A2 / m, HNE, homeobox NKX3.1, HOM-TES-14 / SCP-1, HOM-TES- 85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1 R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, Kallikrein-2, Kallikrein-4, i67, KIAA0205, KIAA0205 / m, KK-LC- 1, K-Ras / m, LAGE-A1, ldlr-fut, mage-a1, mage-a2, mage-a3, mage-a4, mage-a6, mage-a9, mage-a10, mage-a12, mage-b1, mage-b2, mage-b3, mage-b4, mage-b5, mage-b6, mage-b10, mage-b1 6, mage-b1 7, mage-c1, mage-c2, mage-c3, mage-d1, maged2, mage-d4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-H I, MAGEL2, mammaglobin A, MART-1 / Melan-A, MART-2, MART-2 / m, matrix protein 22, MC1 R, M-CSF, ME 1 / m, mesothelin, MG50 / PXDN, MMP1 1, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, myosin class l / m, NA88-A, N-acetylglucosaminyltransferase-V, neo-PAP, neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESOB, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS- 9 / m, osteocalcin, osteopontin, pi 5, p190 minor bcr-abl, p53, p53 / m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1 -kinase, Pin-1, Pml / PARalpha, POTE, PRAME, PRDX5 / m, prostein, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD1 68, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2 / m, Sp1 7, SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, Survivin, Survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGF-beta, TGF-betaRII, TGM-4, TPI / m, TRAG- 3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2 / FLK-1, WT1, and an immunoglobulin genotype of lymphocytic haematocytes or a T cell receptor genotype of lymphocytic haematocytes, or may encode an isotype, fragment, variant, or derivative of any of the foregoing tumor antigens.

[0110] In the present invention, the tumor antigens may be selected from the group consisting of, but not limited to, NYESO-1, HER-2 / neu, MAGE-1, Tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, Survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, Mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1.

[0111]

[0112] In the present invention, the pathogenic antigens may be selected from the group consisting of bacterial, viral, fungal and protozoal antigens.

[0113] In the present invention, the pathogenic antigens may be selected from influenza virus, respiratory syncytial virus (RSV), coronavirus, herpes simplex virus (HSV), human papillomavirus (HPV), human immunodeficiency virus (HIV), plasmodium, staphylococcus aureus, dengue virus, trachoma chlamydiae, cytomegalovirus (CMV), hepatitis B virus (HBV), mycobacterium tuberculosis, rabies virus, yellow fever virus, or any homolog, isotype, fragment, variant, or derivative thereof.

[0114] In the present invention, the antigenic polypeptide or immunogenic protein thereof is an influenza virus antigenic polypeptide, which is at least one selected from the group consisting of, but not limited to, a defined antigenic subdomain of hemagglutinin (HA), a.k.a. HA1, HA2, or a combination of HA1 and HA2, and neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (M1), matrix protein 2 (M2), non-structural protein 1 (NS1), and non-structural protein 2 (NS2).

[0115] In the present invention, the influenza virus antigenic polypeptide may be influenza hemagglutinin 1 (HA1), hemagglutinin 2 (HA2), or an immunogenic fragment of HA1 or HA2, but is not limited thereto.

[0116] In the present invention, the influenza antigenic polypeptide or immunogenic protein thereof may be derived from an influenza virus strain selected from the group consisting of influenza B Yamagata, influenza B Victoria, and influenza A H3N2, and more preferably may be an HA protein derived from each strain, but is not limited thereto.

[0117] In the present invention, the influenza antigenic polypeptide or polynucleotide encoding an immunogenic protein thereof may be codon optimized.

[0118]

[0119] In the present invention, the synthetic nucleic acid molecule further comprises a poly(A) tail or poly(A) tail-like sequence. In further examples, the terminal groups on the poly(A) tail may be incorporated for stabilization. In another example, the poly(A) tail comprises a des-3' hydroxyl tail.

[0120] During RNA processing, long chains of adenine nucleotides (poly(A) tails) can be added to polynucleotides, such as mRNA molecules, to increase their stability. Immediately after transcription, the 3' end of the transcriptome can be cleaved to free the 3' hydroxyl. Next, poly(A) polymerase adds a chain of adenine nucleotides to the RNA. A process called polyadenylation adds a poly(A) tail, which can be, for example, about 80 to about 250 residues length (including about 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues length). Poly(A) tails can also be added after the construct has flowed out of the nucleus.

[0121] According to the present invention, the terminal groups on the poly(A) tail may be incorporated for stabilization. The polynucleotides of the present invention may comprise a des-3' hydroxyl tail. They may also comprise structural moieties such as those taught by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the full text of which is hereby incorporated herein by reference) or 2'-O-methyl modifications.

[0122] The unique poly(A) tail length provides a predetermined advantage for the polynucleotides of the present invention. In general, the length of the poly(A) tail, if present, is greater than 30 nucleotides in length. In other examples, the poly-A tail is greater than 35 nucleotides in length (e.g., at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and greater than 3,000 nucleotides).

[0123] In some examples, the polynucleotide or region thereof comprises about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 100 to 1,500, 100 to 2,000, 100 to 2,500, 100 to 3,000, 500 to 750, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 2,500, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 2,500, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 3,000, 2,000 to 2,500, and 2,500 to 3,000).

[0124] In some examples, the poly(A) tail is designed for the length of the entire polynucleotide or for the length of a specific region of the polynucleotide. This design can be based on the length of the coding region, the length of a specific feature or region, or the length of the ultimate product expressed from the polynucleotide.

[0125] In this regard, the poly(A) tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% larger in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotide to which it belongs. In this regard, the poly(A) tail may be the total length of the construct, the total length of the construct area or the construct - at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the poly(A) tail. Additionally, engineered binding sites and conjugation of polynucleotides to poly(A) binding proteins can enhance expression.

[0126] Additionally, multiple distinct polynucleotides can be linked together via a poly(A) binding protein (PABP) via the 3'-end using a nucleotide modified at the 3'-end of the poly(A) tail. Transfection experiment can be performed in appropriate cell lines, and protein production can be tested by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and 7 days post-transfection.

[0127] In some examples, the polynucleotides of the present invention are designed to comprise a polyA-G quartet region. The G-quartet is a cyclic hydrogen bond of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this experiment, the G-quartet is incorporated into the end of the poly(A) tail. The obtained polynucleotides are tested for stability, protein production, and other parameters including half-life at various time points. It was found that the poly-A-G quartet results in protein production from mRNA equivalent to at least 75% of what can be achieved with a poly-A tail of 120 nucleotides alone.

[0128] In the present invention, the poly(A) tail-like sequence may be any nucleic acid sequence capable of performing the function of a poly(A) tail, preferably characterized by one or more nucleotides other than adenine selected from the group consisting of uracil (U), cytosine (C) and guanine (G) are inserted between the plurality of adenines or at the end of the poly(A) tail, but not limited thereto.

[0129]

[0130] In the present invention, the synthetic nucleic acid molecule may comprise one or more backbone-modified, sugar-modified, or base-modified nucleic acids, but are not limited thereto.

[0131]

[0132] Backbone Modifications

[0133] The phosphate backbone can be further modified at modified nucleosides and nucleotides, which can be incorporated into modified mRNA compounds comprising mRNA sequences as described herein. The phosphate group of the backbone can be modified by replacing one or more of the oxygen atoms with other substituents. In addition, modified nucleosides and nucleotides can comprise the complete replacement of an unmodified phosphate moiety with a modified phosphate described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioate has both non-linked oxygen groups replaced by sulfur.

[0134] Phosphate linkers can also be modified by substitution of the linking oxygen with nitrogen (crosslinked phosphoroamidates), sulfur (crosslinked phosphorothioates), and carbon (crosslinked methylene-phosphonates).

[0135]

[0136] Sugar Modifications

[0137] Modified nucleosides and nucleotides that may be incorporated into a modified mRNA compound comprising an mRNA sequence as described herein may be modified at a sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxyl group modifications include alkoxy or allyloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH2O)nCH2CH2OR; "locked" nucleic acid (LNA) in which a 2' hydroxyl is attached to the 4' carbon of the same ribose sugar, e.g., by methylene cross-linking; and an amino group (-O-amino, wherein the amino group, e.g., NRR, may be alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy, but are not limited thereto.

[0138] The "deoxy" modification may comprise hydrogen, or amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or an amino group may be attached to the sugar via a linker, wherein the linker comprises at least one of the atoms C, N, and O.

[0139] The sugar group may also contain one or more carbons having an opposite stereochemical arrangement compared to the corresponding carbons in ribose. Thus, the modified mRNA may comprise nucleotides containing arabinose, for example, as a sugar.

[0140]

[0141] Base Modifications

[0142] Modified nucleosides and nucleotides that may be incorporated into a modified mRNA compound comprising an mRNA sequence as described herein may be further modified at the nucleobase moiety. Examples of nucleobases found in mRNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified at the major groove face. In some examples, the major groove chemical modification can include an amino group, a thiol group, an alkyl group, or a halo group.

[0143] In a particularly preferred example of the present invention, the nucleotide analogs / modifications are preferably 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcitidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocitidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, or a base modification selected from puromycin-5'-triphosphate, or xanthosine-5'-triphosphate.

[0144] Particularly preferred are nucleotides for base modifications selected from the group consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate.

[0145] In some examples, the modified nucleoside includes 5-pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-methoxyuridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudoridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydrosuccinimidine, 2-thio-dihydrouridine, 2-thio-dihydrosuccinimidine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-succinimidine, and 4-methoxy-2-thio-succinimidine.

[0146] In some examples, the modified nucleoside includes 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-l-methyl-pseudoisocytidine.

[0147] In other examples, the modified nucleoside includes 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentyladenosine, N6-(cis-hydroxyisopentyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.

[0148] In other examples, the modified nucleoside includes inosine, 1-methyl-inosine, weosine, webutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0149] In some examples, the nucleotide may be modified at the major groove face and may include replacement of the hydrogen at C-5 of the uracil with a methyl or halo group. In certain examples, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine.

[0150] In an additional specific example, the modified mRNA may comprise nucleoside modifications selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, and 7-deaza-adenosine.

[0151]

[0152] In the present invention, the synthetic nucleic acid molecule may be RNA.

[0153] In the present invention, the RNA may be selected from the group consisting of, but not limited to, mRNA, viral RNA, self-replicating RNA, and replicon RNA.

[0154]

[0155] In another aspect, the present invention relates to a vaccine composition comprising the synthetic nucleic acid molecule.

[0156] In the present invention, a "vaccine" is understood to be a prophylactic or therapeutic substance that typically provides at least one antigen, preferably an antigenic peptide or protein. "Provided with at least an antigen" means, for example, that the vaccine comprises an antigen or that the vaccine comprises, for example, a molecule encoding an antigen. Thus, it is particularly envisaged that the vaccine of the present invention comprises at least one synthetic nucleic acid (RNA) molecule encoding at least one antigenic (poly-)peptide or protein as defined herein, which may be derived from, for example, tumor antigens, bacterial, viral, fungal or protozoal antigens, autoantigens, allergens, or alloantigens, and which, when expressed and presented to the immune system, preferably induces an immune response to the respective antigen. However, a synthetic nucleic acid (RNA) molecule encoding the non-antigenic (poly-)peptide or protein of interest can also be used in the vaccine of the present invention.

[0157]

[0158] In the present invention, the synthetic nucleic acid molecule of the vaccine composition may be complexed with one or more lipids to form lipid nanoparticles or liposomes.

[0159] The lipid nanoparticles may comprise, but not limited to, cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids.

[0160] In the present invention, the synthetic nucleic acid molecule may be provided in a complexed form, i.e., complexed or associated with one or more (poly-)cationic compounds, preferably (poly-)cationic polymers, (poly-)cationic peptides or proteins, e.g., protamines, (poly-)cationic polysaccharides and / or (poly-)cationic lipids. As used in this context, the term "complexed" or "associated" refers to an intrinsically stable combination of at least one synthetic nucleic acid (RNA) molecule with one or more compounds in a larger complex or assembly without covalent bonds.

[0161]

[0162] Lipids

[0163] According to a preferred example, the mRNA construct of the present invention is complexed or associated with lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles or liposomes. Thus, in some examples, the synthetic nucleic acid (RNA) molecule of the present invention can be provided in the form of lipid-based formulations, in particular liposomes and / or lipid nanoparticles comprising the synthetic nucleic acid (RNA) molecule.

[0164]

[0165] Lipid Nanoparticles

[0166] According to some preferred examples, the mRNA construct of the present invention is complexed or associated with lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles.

[0167] Preferably, the lipid nanoparticles (LNPs) may comprise: (a) at least one mRNA complex of the present invention, (b) a cationic lipid, (c) an aggregation reducing agent (e.g., a polyethylene glycol (PEG) lipid or PEG-modified lipid), (d) optionally a non-cationic lipid (e.g., a neutral lipid), and (e) optionally, a sterol.

[0168] In some examples, the LNP comprises, in addition to the at least one mRNA construct of the present invention, (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, e.g., cholesterol; and a PEG-lipid at a molar ratio of about 20-60% cationic lipids: 5-25% neutral lipids: 25-55% sterols; 0.5-15% PEG-lipids.

[0169] In some examples, the mRNA construct of the present invention can be formulated as aminoalcohol lipidoids. Amino alcohol lipidoids that can be used in the present invention can be prepared by the methods described in U.S. Patent No. 8,450,298, the full text of which is incorporated herein by reference.

[0170]

[0171] Liposomes

[0172] In some examples, the mRNA construct of the present invention is formulated into liposomes. Cationic lipid-based liposomes can form complexes with negatively charged nucleic acids (e.g., RNA) through electrostatic interactions, which can offer biocompatibility, low toxicity, and the potential for large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed through the phagocytosis pathway and the nucleic acid is subsequently released from the endosome / carrier into the cytoplasm. Liposomes have long been recognized as drug delivery vehicles due to their excellent biocompatibility, as they are essentially analogs of biological membranes and can be prepared from both natural and synthetic phospholipids.

[0173] Liposomes are typically composed of a lipid bilayer, which can consist of cationic, anionic, or neutral (phosphorus) lipids and cholesterol surrounding an aqueous core. Both the lipid bilayer and the aqueous space can comprise hydrophobic or hydrophilic compounds, respectively. Liposomes can have one or more lipid membranes. Liposomes can have a single layer, referred to as unilamellar, or multi layers, referred to as multilamellar.

[0174] In vivo, liposome properties and behavior can be modified by adding hydrophilic polymeric coatings, such as polyethylene glycol (PEG), to the liposome surface to provide steric stability. Liposomes can also be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to their surface or to the ends of attached PEG chains.

[0175] Liposomes typically exist as spherical vesicles and can range in size of 20 nm to a few microns. Liposomes can be of different sizes, such as, but not limited to, multilamellar vesicles (MLVs), which can be hundreds of nanometers in diameter and comprise a series of concentric bilayers separated by a narrow aqueous compartment; small unicellular vesicles (SUVs), which can be smaller than 50 nm in diameter; and large unilamellar vesicles (LUVs), which can be between 50 and 500 nm in diameter. Liposome designs can include, but are not limited to, opsonins or ligands to improve liposome attachment to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes can have low or high pH to enhance the delivery of pharmaceutical formulations.

[0176]

[0177] In the present invention, the vaccine composition may further comprise one or more adjuvants or activators.

[0178] In the broadest sense, an "adjuvant" or "adjuvant ingredient" is typically a pharmacologic and / or immunologic agent that can modify, e.g., enhance, the effectiveness of another active agent, e.g., a therapeutic or vaccine. In this regard, an "adjuvant" can be understood as any compound suitable to support the administration and delivery of a vaccine composition of the present invention. Specifically, the adjuvant may preferably enhance the immunostimulatory properties of the vaccine to be added. Furthermore, such adjuvant can initiate or increase immune responses of the innate immune system, i.e., non-specific immune responses, without being bound to it.

[0179] “Adjuvant" typically does not trigger an adaptive immune response. So far, "adjuvant" are not qualified as an antigen. That is, when administered, the vaccine of the present invention initiates an adaptive immune response due to an antigenic peptide or protein, typically encoded by at least one coding sequence of a synthetic nucleic acid (RNA) molecule contained in the vaccine.

[0180] Suitable adjuvants may be selected from any adjuvants known to one skilled in the art and suitable in the present case, i.e., one that aids in the induction of an immune response in a mammal, and may include, but are not limited to, TDM, MDP, muramyl dipeptide, pluronic, vitiligo solution, aluminum hydroxide, ADJUMERTM (polyphosphazene); aluminum phosphate gel; glucan from algae; algamulin; aluminum hydroxide gel (vitiligo); high protein-absorbing aluminum hydroxide gel; low viscosity aluminum hydroxide gel; AF or SPT (emulsion of squalane (5%), Tween 80 (0.2%), fluoronic L121 (1.25%), phosphate-buffered saline, pH 7.4); AVRIDINETM(propandiamine); a group of substances corresponding to pathogen-associated molecular pattern (PAMP), which react to a pathogen recognition receptor (PRR); CpG DNA; lipoprotein; flagella; poly I:C; saponin; squalene; tricaprin; 3D-MPL; or detoxified lipooligosaccharide (dLOS).

[0181]

[0182] The present invention will now be described in more detail with reference to the following examples. These examples are for the purpose of illustrating the invention only, and it will be apparent to one of ordinary skill in the art that the scope of the invention is not to be construed as limited by these examples.

[0183]

[0184] Example 1: Preparation of mRNA construct

[0185] Example 1-1: Preparation of mRNA sequences

[0186] To derive sequences that improve mRNA translation efficiency and intracellular stability, 3'-UTR library plasmid DNA (pDNA) with at least 1x106diversity (Table 1).

[0187]

[0188]

[0189]

[0190] The 5'-UTR sequence (SEQ ID NO: 41), ORF sequence (SEQ ID NO: 42), and control 3'-UTR are shown in Table 2 below.

[0191]

[0192]

[0193] The structure of the mRNA construct for translation efficiency analysis is shown in Table 3 below.

[0194]

[0195] Meanwhile, a paper published by BioNTech reported that dimer 3'-UTR with high translation efficiency persistence can further improve translation efficiency persistence by attaching 3'-UTR in a dimer form (AGO von Niessen, et al, Mol Ther. vol10; 27(4): pp. 824-836, 2019). Therefore, additional 3'-UTR candidate sequences in dimer and trimer form were prepared using 3'-UTR_#1, 3'-UTR_#4, 3'-UTR_#5, 3'-UTR_#7, 3'-UTR_#8, 3'-UTR_#9, 3'-UTR_#11, 3'-UTR_#14, 3'-UTR_#15, and 3'-UTR_#28 (Table 4).

[0196]

[0197]

[0198] Example 1-2: mRNA synthesis and purification

[0199] The prepared library pDNA was used as anin vitrotranscription (IVT) template for mRNA synthesis, and mRNA with a diversity of at least 1x106was synthesized through IVT synthesis and purified using an oligo-dT column.

[0200] Specifically, IVT was performed under the conditions in Table 5, and then upon completion of the reaction, template DNA was removed by treating 1U of Dnase I per 1 μg of DNA and reacting at 37℃ for 15-30 min, and the IVT product was purified by the manufacturer's method using Invitrogen's MEGAclearTMKit (Austin, Tex.).

[0201]

[0202] Example 1-3: Preparation of mRNA-LNP Complex

[0203] The synthesized library mRNA was encapsulated in lipid nanoparticles (LNPs) for administration to mice.

[0204] Ionic lipids, phospholipids, cholesterol, and PEG-lipid conjugates were dissolved in ethanol in a molar ratio of 50:10:38.5:1.5 and mixed in a 1:3 volume ratio with citrate buffer (pH 4, 50 mM) in which mRNA was dissolved. MC3 (MedChemExpress, USA) was used as the ionic lipid, DSPC (Avanti Polar Lipids, USA) as the phospholipid, cholesterol (Sigma Aldrich, USA) and 1-2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000) (Avanti Polar Lipids, USA) as the PEG-lipid conjugate.

[0205] For the generation of lipid nanoparticles (LNPs), NanoAssemblr IgniteTM(Precision Nanosystems, Inc., Canada) was used to mix ionic lipids and mRNA to be at a nitrogen-to-phosphate ratio (N / P ratio) of 4 at a total flow rate (TFR) of 12 mL / min. The prepared lipid nanoparticles were prepared using Amicon Ultra Centrifugal Filter, MWCO 10 kDa (Millipore, USA) for ethanol removal, buffer exchange and concentration, and 1X DPBS (Thermo Scientific, USA) for dilution, concentration and exchange. For cryopreservation, a final 300 mM sucrose solution was added as a cryoprotectant and stored frozen (-80℃).

[0206]

[0207] Example 2: Verification of the performance of mRNA construct via intracellular experiments

[0208] In Example 1-3, an mRNA-LNP complex was administered to mice and subjected toin vivoselection process based on a systematic evolution of ligands by exponential enrichment (SELEX) (samples were obtained 12, 24, 48, and 72 hours post-administration), resulting in sequences with improved intracellular stability based on next generation sequencing (NGS) results (FIG. 1).

[0209] To validate the obtained mRNA sequences, each mRNA was subjected to IVT synthesis / oligo-dT purification to obtain mRNA candidates, and the translation efficiency of the obtained mRNA candidates was compared with the mRNA sequence comprising the 3'-UTR of human-alpha globin from Moderna as a control.

[0210] Comparison of luciferase activity after transfection of mRNA with lipofectamine p3000 transfection reagent in HEK293T, Huh7, and AML12 cells confirmed a number of sequences (3'-UTR_#1, #4, #5, #7, #8, #9, #11, #14, #15, and #28) that were equivalent to the translation efficiency of human alpha globin(A) (FIG. 2).

[0211]

[0212] Example 3: Confirmation of mRNA construct performance via animal experiments

[0213] 3'-UTR_#1, #4, #5, #7, #8, #9, #11, #14, #15, and #28 candidates in which high translation efficiency had been observed in Example 2 were selected to determine if high translation efficiency was also observed in mice. The luciferase expression profile of each candidate mRNA was determined and analyzed using an in vivo imaging system (IVIS) to visualize and quantify the activity. Firefly luciferase mRNA comprising BioNTech's 3'-UTR, AES-mtRNR1, which has excellent translation efficiency persistence, was included as a control to compare translation efficiency in mouse experiments.

[0214] First, for efficient in vivo delivery, the synthesized candidate mRNA was formulated into LNPs (MC3) and diluted with PBS to a dosage concentration based on the concentration reflecting encapsulation efficiency. The dilution volume was adjusted to 200 μL, which is the mouse intravenous (IV) administration volume. At 6, 24, 48, 72, and 144 hours after administration, 100 μL of luciferin substrate (30 mg / mL) was administered intraperitoneally, followed by 10 minutes of respiratory anesthesia with Ifran Liquid for inhalation (isoflurane) for 5 minutes. The luminescence was then visualized with an IVIS Luminar XR instrument and quantified with living image software to measure the area under curve (AUC).

[0215] The results showed that the mRNA candidate comprising the 3'-UTR_#15# candidate sequence was more than equivalent in translation efficiency (based on Area Under the Curve (AUC)) to the human alpha globin control and the BioNTech control (FIG. 3).

[0216] The translation efficiency of dimer 3’-UTR was checked and it was observed that 3'-UTR_#15+#1, #15+#9, #15+#14, #15+#15, #1+#15, #7+#15, and #14+#15, etc. were superior to BioNTech 3'-UTR (FIG. 4).

[0217] In order to keep the 3'-UTR length similar to BioNTech, the #15+#9+#15 candidate sequence in trimer form was checked as another experimental group, and it was observed that the translation efficiency was equivalent to BioNTech 3'-UTR.

[0218]

[0219] Example 4: Further validation of the performance of mRNA construct via intracellular experiments

[0220] To validate the superiority of the 3'-UTR sequence in another target protein, it was applied to Farnesoid X receptor (FXR) mRNA. Candidate sequences 3'-UTR_#15, #15+#14, #15+#9, and #15+#15 were applied as the 3'-UTR of FXR mRNA to create IVT templates as described in Example 1 for mRNA synthesis and oligo-dT purification. The obtained FXR mRNA was tested for protein translation efficiency in HEK293T and Huh7 cells. After mRNA transfection with lipofectamine p3000 in cells, protein expression was confirmed by SDS page western blot using cell extracts 24 hours later.

[0221] As a result, it was found that the protein expression was higher than the control, as shown in FIG. 5.

[0222]

[0223] The 3'-UTR polynucleotide according to the present invention is useful for various RNA-based applications, e.g., vaccines, in vivo / ex vivo gene therapy, etc., as they can effectively induce expression of the target protein due to improved translation efficiency.

[0224]

[0225] While the foregoing has described in detail certain aspects of the present invention, it will be apparent to one of ordinary skill in the art that these specific descriptions are merely preferred embodiments and are not intended to limit the scope of the invention. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

[0226]

[0227] Attached as an electronic file.

Claims

1.An isolated 3'-untranslated region (UTR) polynucleotide consisting of a sequence represented by a nucleic acid sequence according to Formula (I):Formula (I):UUAAUUAA{[Nx]CUCGAGCUAUUCGGCUAUGACUGGGC}yAAGCUU,wherein N means A, G, C, or U, x means an integer of 20 to 200, and y means an integer of 1 to 10.2.The isolated 3'-UTR polynucleotide according to claim 1, wherein x is an integer of 35 to 80.3.The isolated 3'-UTR polynucleotide according to claim 1, which is one of the sequences selected from the group consisting of SEQ ID NOs: 1 to 40.4.The isolated 3'-UTR polynucleotide according to claim 3, which is any one of the sequences selected from the group consisting of SEQ ID NOs: 1, 4, 5, 7 to 9, 11, 14, 15, 28, 31 to 35, 37, and 38.5.A synthetic nucleic acid molecule comprising, in 5' to 3' order,a) 5'-CAP structure;b) 5’-untranslated region (5'-UTR);c) one or more coding regions;d) the 3'-UTR polynucleotide according to claim 1; ande) a poly(A) tail or poly(A) tail-like sequence consisting of 10 to 1000 adenine(A) residues.6.The synthetic nucleic acid molecule according to claim 5, wherein the 5'-CAP structure is selected from the group consisting of m7GpppAmpG, m7GpppApG and m7,3’OmeApppG.7.The synthetic nucleic acid molecule according to claim 5, wherein the 5'-UTR is selected from the group consisting of an α-globin or β-globin 5'-UTR; a 5'-UTR comprising a Kozak sequence; a cytochrome b-245 α polypeptide (CYBA) 5'-UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5'-UTR; a tobacco etch virus (TEV) 5'-UTR; a Venezuelan equine encephalitis virus (VEEV) 5'-UTR; Y proximal open reading frame of rubella virus (RV) RNA encoding a non-structural protein; dengue virus (DENV) 5'-UTR; heat shock protein 70 (Hsp70) 5'-UTR; eIF4G 5'-UTR; GLUT1 5'-UTR; functional fragments thereof and combinations thereof.8.The synthetic nucleic acid molecule according to claim 5, further comprising a sequence encoding a signal peptide between b) a 5'-untranslated region (5'-UTR) and c) one or more coding regions.9.The synthetic nucleic acid molecule according to claim 8, wherein the signal peptide is derived from an antigenic polypeptide, immunoglobulin E (IgE), or tissue plasminogen activator (tPA).10.The synthetic nucleic acid molecule according to claim 9, wherein the polynucleotide encoding the signal peptide is codon optimized.11.The synthetic nucleic acid molecule according to claim 5, wherein the coding region encodes one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins and fragments, variants or derivatives of the proteins.12.The synthetic nucleic acid molecule according to claim 11, wherein the antigenic protein is one or more selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, alloantigens, and allergenic antigens.13.The synthetic nucleic acid molecule according to claim 12, wherein the tumor antigens are selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, Tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, Survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, Mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1.14.The synthetic nucleic acid molecule according to claim 12, wherein the pathogenic antigens are selected from the group consisting of bacterial, viral, fungal and protozoal antigens.15.The synthetic nucleic acid molecule according to claim 5, wherein in the poly(A) tail-like sequence, one or more nucleotides other than adenine selected from the group consisting of uracil (U), cytosine (C) and guanine (G) are inserted between the plurality of adenines or at the end of the poly(A) tail.16.The synthetic nucleic acid molecule according to claim 5, wherein the synthetic nucleic acid molecule comprises one or more backbone-modified, sugar-modified, or base-modified nucleic acids.17.The synthetic nucleic acid molecule according to claim 5, wherein the synthetic nucleic acid molecule is RNA.18.The synthetic nucleic acid molecule according to claim 17, wherein the RNA is selected from the group consisting of mRNA, viral RNA, self-replicating RNA, and replicon RNA.19.A vaccine composition comprising the synthetic nucleic acid molecule according to any one of claims 5 to 18.20.The vaccine composition according to claim 19, wherein the synthetic nucleic acid molecule is complexed with one or more lipids to form lipid nanoparticles or liposomes.21.The vaccine composition according to claim 20, wherein the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids.22.The vaccine composition according to claim 19, wherein the vaccine composition further comprises one or more adjuvants or activators.

Images