Redirection of aav capsids for central nervous system targeting
Patent Information
- Application Number
- EP2024809143
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-27
- Filing Date
- 2024-11-01
- Publication Date
- 2026-09-09
AI Technical Summary
Current targeted delivery of payloads, such as using recombinant adeno-associated viruses (rAAVs), faces challenges including a lack of specific targeting moieties for delivering payloads to target cells or tissues with reduced non-specific delivery, and poor potency of delivery vectors.
The development of rAAV particles with variant AAV capsids containing peptide insertions, specifically designed to target central nervous system (CNS) cells and tissues, enhancing the specificity and potency of payload delivery.
The use of rAAV particles with variant AAV capsids significantly improves the specificity and potency of payload delivery to CNS cells and tissues, potentially leading to more effective clinical outcomes.
Smart Images

Figure US2024054147_08052025_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 2011256-2476 (P1844PCT) REDIRECTION OF AAV CAPSIDS FOR CENTRAL NERVOUS SYSTEM TARGETING CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to and the benefit of U.S. Provisional Patent Application No.63 / 547,054, filed on November 2, 2023, U.S. Provisional Patent Application No.63 / 547,667 filed on November 7, 2023, and U.S. Provisional Patent Application No. 63 / 570,546 filed on March 27, 2024, the entire contents of each of which are hereby incorporated by reference in their entirety. BACKGROUND
[0002] Targeted delivery of payloads (e.g., using recombinant adeno-associated viruses) to cells or tissues for treating and / or preventing diseases remains a challenge. SUMMARY
[0003] The present disclosure identifies certain challenges with existing targeted delivery of payloads. For example, the present disclosure identifies that a lack of targeting moieties that can specifically deliver payloads to a target cell or tissue with decreased non-specific delivery to other cells or tissues is a key challenge. Another challenge identified by the present disclosure is the poor potency associated with delivery vectors, e.g., recombinant adeno-associated virus vectors. In some embodiments, improving the potency of delivery vectors could be beneficial in obtaining clinically relevant outcomes.
[0004] Among other things, the present disclosure provides technologies that can address certain limitations identified in existing targeted delivery of payloads. The technologies provided herein are particularly useful for specifically delivering payloads to a target cell or tissue (e.g., a central nervous system (CNS) cell and / or tissue). In some embodiments, by specifically delivering payloads to a target cell or tissue, technologies provided here can also increase the potency of a payload.
[0005] The present disclosure encompasses peptides comprising CNS-targeting moieties (e.g., moieties targeting a CNS cell and / or tissue). Also disclosed herein are recombinant adeno- associated virus (rAAV) particles comprising a variant AAV capsid comprising a targeting moiety, e.g., a CNS-targeting moiety disclosed herein. In some embodiments, a targeting moiety, Page 1 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) e.g., a CNS-targeting moiety in a variant AAV capsid is also referred to as a “peptide insertion.” In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, (e.g., in a variant AAV capsid), provides CNS-cell and / or tissue tropism. In some embodiments, rAAV particles comprising a variant capsid having a peptide insertion disclosed herein bind to and / or recognize a target on a cell, e.g., a CNS cell and / or a cell in a CNS tissue. Also disclosed herein are compositions comprising rAAV particles disclosed herein, and uses of the same.
[0006] In some embodiments, the present disclosure provides recombinant adeno- associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) a peptide insertion comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3and X4are independently any amino acid, and X5is Y, W or F; and (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., of an AAV9 capsid protein), and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, a peptide insertion comprises a sequence provided in Table 2 or Table 4. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 14 (IPQGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 18 (KGGQVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 24 (NNQGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 47 (TQHGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of TTMGVYI (SEQ ID NO: 75).
[0007] In some embodiments, the present disclosure provides recombinant adeno- associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) a peptide insertion consists of the sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; and (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., of an AAV9 capsid protein), and (b) a heterologous nucleic acid comprising a Page 2 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) nucleotide sequence encoding a payload. In some embodiments, a peptide insertion consists of a sequence provided in Table 2 or Table 4. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of sequence of SEQ ID NO: 14 (IPQGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 18 (KGGQVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 24 (NNQGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 47 (TQHGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of TTMGVYI (SEQ ID NO: 75).
[0008] In some embodiments, the present disclosure provides recombinant adeno- associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) a peptide insertion comprises a sequence provided in Table 1 or Table 3; and (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., of an AAV9 capsid protein), and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, a peptide insertion comprises a sequence provided in Table 1. In some embodiments, a peptide insertion comprises a sequence provided in Table 3. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 4 (AYALPKG). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of TTMGVYI (SEQ ID NO: 75).
[0009] In some embodiments, the present disclosure provides recombinant adeno- associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) a peptide insertion consists of a sequence provided in Table 1 or Table 3; and (ii) a peptide insertion site is in a variable region of the parental AAV capsid protein (e.g., of an AAV9 capsid protein), and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, a peptide insertion consists of a sequence provided in Table 1. In some embodiments, a peptide insertion consists of a sequence Page 3 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) provided in Table 3. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 4 (AYALPKG). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of TTMGVYI (SEQ ID NO: 75).
[0010] In some embodiments, the present disclosure provides recombinant adeno- associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) a peptide insertion comprises at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in any one of Table 1, Table 2, Table 3 or Table 4; and (ii) a peptide insertion site is in a variable region of the parental AAV capsid protein (e.g., of an AAV9 capsid protein), and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, a peptide insertion comprises at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in Table 1. In some embodiments, a peptide insertion comprises at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in Table 2. In some embodiments, a peptide insertion comprises at least 4, at least 5, or at least 6 contiguous amino acids of a sequence a sequence provided in Table 3. In some embodiments, a peptide insertion comprises at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in Table 4.
[0011] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a peptide insertion site is located between two adjacent amino acids in a variable region of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0012] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a peptide insertion site is located between two non-adjacent amino acids in a variable region of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0013] In some embodiments, a parental AAV capsid protein comprises an AAV9 capsid protein, an AAV1 capsid protein, an AAV2 capsid protein, an AAV3B capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVhu68 capsid protein, or an AAVrh10 capsid protein. Page 4 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0014] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0015] In some embodiments, a peptide insertion is in VR-VIII of a parental AAV capsid protein (e.g., an AAV9 capsid protein). In some embodiments, a parental AAV capsid protein is chosen from an AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of an AAV9 capsid protein or the corresponding positions in a capsid protein (e.g., a VP1, VP2 or VP3) of another parental AAV capsid protein e.g., an AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein.
[0016] In some embodiments, a parental AAV capsid protein is an AAV9 capsid protein and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0017] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a variant AAV capsid protein comprises: (1) a peptide insertion comprising a consensus sequence of SEQ ID NO: 1, and (2) one or more sequences of a VP, e.g., aVP1, VP2, or VP3, of an AAV9 capsid protein.
[0018] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a variant AAV capsid protein comprises: (1) a peptide insertion comprising a sequence provided in Table 1, and (2) one or more sequences of a VP, e.g., a VP1, VP2, or VP3, of an AAV9 capsid protein.
[0019] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a variant AAV capsid protein comprises: (1) a peptide insertion comprising a sequence provided in Table 2, and (2) one or more sequences of a VP, e.g., a VP1, VP2, or VP3, of an AAV9 capsid protein. Page 5 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0020] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a variant AAV capsid protein comprises: (1) a peptide insertion comprising a sequence provided in Table 3, and (2) one or more sequences of a VP, e.g., a VP1, VP2, or VP3, of an AAV9 capsid protein.
[0021] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a variant AAV capsid protein comprises: (1) a peptide insertion comprising a sequence provided in Table 4, and (2) one or more sequences of a VP, e.g., a VP1, VP2, or VP3, of an AAV9 capsid protein.
[0022] In some embodiments, a peptide insertion is in VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion comprises a sequence of TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion is a sequence of TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0023] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a peptide insertion of a heterologous peptide replaces a contiguous stretch of amino acids of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0024] In some embodiments of a rAAV particle disclosed herein or a variant AAV capsid protein disclosed herein, a peptide insertion of a heterologous peptide does not replace a contiguous stretch of amino acids of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0025] This disclosure further provides a targeting moiety, e.g., a CNS-targeting moiety, conjugated or fused to a payload. In some embodiments, a targeting moiety, e.g., a CNS- targeting moiety, comprises a peptide sequence provided in any one of Tables 1-4. In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is part of (e.g., incorporated into) a vector, e.g., a viral vector or a non-viral vector. In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, encapsidates a payload, e.g., as described herein. In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is tethered to a payload, e.g., as described Page 6 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) herein. In some embodiments, a peptide insertion in a targeting moiety disclosed herein comprises a sequence of TTMGVYI (SEQ ID NO: 75).
[0026] Also disclosed herein is an isolated nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein as disclosed herein or a targeting moiety, e.g., a CNS- targeting moiety, fused to a payload.
[0027] Further disclosed herein is an isolated cell transduced with an rAAV particle disclosed herein. Also disclosed herein is a cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein as disclosed herein.
[0028] This disclosure also provides a composition comprising a targeting moiety, e.g., a CNS-targeting moiety, and a payload, wherein the targeting moiety, e.g., a CNS-targeting moiety, comprises a peptide sequence provided in any one of Tables 1-4.
[0029] Further provided herein is a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) a peptide insertion comprise a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0030] This disclosure provides a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) a peptide insertion comprise a sequence provided in any one of Tables 1-4; and (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., an AAV9 capsid protein). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of TTMGVYI (SEQ ID NO: 75).
[0031] This disclosure provides a variant AAV capsid protein, wherein a variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) a peptide insertion comprise a sequence of at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in any one of Table 1, Table 2, Table 3, or Table 4; and (ii) a peptide insertion site is in a variable region (VR) of a parental AAV capsid protein (e.g., an AAV9 capsid protein). Page 7 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0032] In some embodiments, a peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR- V, VR-VI, VR-VII, VR-VIII or VR-IX of a parental AAV capsid protein (e.g., an AAV9 capsid protein). In some embodiments, a peptide insertion is in VR-VIII of a parental AAV capsid protein (e.g., an AAV9 capsid protein).
[0033] In some embodiments, a parental AAV capsid protein is an AAV9 capsid protein and the VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0034] Also provided herein is a composition comprising a targeting moiety, e.g., a CNS- targeting moiety, and a payload, wherein a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3and X4are independently any amino acid, and X5is Y, W or F. In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence provided in Table 2 or Table 4. In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of SEQ ID NO: 14 (IPQGVYI). In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of SEQ ID NO: 18 (KGGQVYI). In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of SEQ ID NO: 24 (NNQGVYI). In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of SEQ ID NO: 47 (TQHGVYI).
[0035] Also provided herein is a composition comprising a targeting moiety, e.g., a CNS- targeting moiety, and a payload, wherein a targeting moiety, e.g., a CNS-targeting moiety, comprises a peptide comprising a sequence provided in any one of Tables 1-4. In some embodiments, a peptide insertion in a targeting moiety, e.g., a CNS-targeting moiety, comprises a sequence of TTMGVYI (SEQ ID NO: 75).
[0036] Further provided herein is a composition comprising a targeting moiety, e.g., a CNS-targeting moiety, and a payload, wherein a targeting moiety, e.g., a CNS-targeting moiety, comprises a peptide comprising a sequence of at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in any one of Table 1, Table 2, Table 3, or Table 4.
[0037] In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is conjugated or fused to a payload. Page 8 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0038] In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is inserted into a viral protein, e.g., an AAV capsid protein.
[0039] In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is part of, e.g., incorporated into, a vector.
[0040] In some embodiments, a targeting moiety, e.g., a CNS-targeting moiety, is not part of a vector.
[0041] This disclosure further provides a pharmaceutical composition comprising: (a) a rAAV particle disclosed herein; and (b) a pharmaceutically acceptable excipient.
[0042] Also provided herein is a method of delivering a payload to a CNS cell and / or tissue, comprising administering a pharmaceutical composition disclosed herein to a CNS cell and / or tissue.
[0043] In some embodiments, a CNS cell and / or tissue is in vitro.
[0044] In some embodiments, a CNS cell and / or tissue is in vivo.
[0045] In some embodiments, a CNS cell and / or tissue is from a subject that has, or has been determined to have, a CNS disorder.
[0046] In some embodiments, a CNS cell or tissue is chosen from: a CNS epithelial cell, a nerve cell, a CNS connective tissue cell, a stem cell, a progenitor cell, a CNS immune cell, a spinal cord cell, a cell that lines one or more brain ventricles, a nerve support cell, a glial cell, a fat cell, a meninges cell, or a combination thereof.
[0047] In some embodiments, a CNS cell comprises a CNS epithelial cell. In some embodiments, a CNS epithelial cell comprises a cell that lines one or more brain ventricles.
[0048] In some embodiments, a CNS cell comprises a nerve cell (neuron). In some embodiments, a neuron comprises a unipolar neuron, a bipolar neuron, a pseudounipolar neuron, a multipolar neuron, or combinations thereof. In some embodiments, a neuron is a motor neuron, a sensory neuron, an interneuron, an excitatory neuron, an inhibitor neuron, a sympathetic neuron, a parasympathetic neuron, or combinations thereof. In some embodiments, a neuron comprises a pyramidal neuron, a dopaminergic neuron, a cholinergic neuron, an adrenergic Page 9 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) neuron, a GABAergic neuron, a glutamatergic neuron, a serotonergic neuron, a purinergic neuron, a histaminergic neuron, a lower motor neuron, or combinations thereof.
[0049] In some embodiments, a nerve cell (neuron) comprises nerve support cells. In some embodiments, nerve support cells comprise glial cells. In some embodiments, glial cells comprise astrocytes, microglial cells, ependymal cells, oligodendrocytes, Schwann cells, or combinations thereof.
[0050] In some embodiments, a CNS cell comprises a CNS connective tissue cell. In some embodiments, a CNS connective tissue cell comprises fat cells or meninges cells, or both.
[0051] In some embodiments, a CNS cell comprises a stem cell or progenitor cell. In some embodiments, a stem cell comprises a neural stem cell.
[0052] In some embodiments, a CNS cell comprises a cell that lines one or more brain ventricles.
[0053] In some embodiments, a CNS cell comprises a meninges cell.
[0054] In some embodiments, a CNS cell comprises a fat cell.
[0055] In some embodiments, a CNS tissue comprises tissue found in: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord.
[0056] In some embodiments, CNS tissue comprises tissue found in a frontal cortex, a parietal cortex, an occipital cortex, a temporal cortex or combinations thereof.
[0057] In some embodiments of any of the AAV particles comprising a variant AAV capsid, compositions comprising a rAAV particle, or methods of using the same disclosed herein, a variant AAV capsid confers increased infectivity and / or transduction of a central nervous system (CNS) cell and / or tissue compared to the infectivity and / or transduction of the CNS cell and / or tissue by a control AAV particle comprising a corresponding parental AAV capsid protein.
[0058] In some embodiments, a rAAV particle comprising a variant AAV capsid protein confers at least 1.5-fold, at least 2-fold, 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least Page 10 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, or at least 70-fold increased infectivity and / or transduction of a CNS cell compared to the infectivity and / or transduction of the CNS cell by a control AAV particle comprising the corresponding parental AAV capsid protein.
[0059] In some embodiments, a rAAV particle comprising a variant AAV capsid protein confers about 1.5-fold, about 2-fold, 2.5-fold, about 3-fold, about 4-fold, about 5-fold, about 6- fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, or about 70-fold increased infectivity and / or transduction of a CNS cell or tissue compared to infectivity and / or transduction of a CNS cell or tissue by a control AAV particle comprising a corresponding parental AAV capsid protein.
[0060] In some embodiments of any of the variant AAV capsids, AAV particles comprising a variant AAV capsid, compositions comprising a variant AAV capsid, or methods of using the same, a variant AAV capsid comprises one or more modifications to an amino acid sequence flanking a peptide insertion. In some embodiments, one or more modifications are within about 10 amino acids upstream or downstream of the location of a peptide insertion site, e.g., within about 5 amino acids upstream or downstream of the location of the peptide insertion site.
[0061] In some embodiments, one or more modifications comprises an insertion, deletion, mutation, or combinations thereof.
[0062] In some embodiments of a rAAV particle, a variant AAV capsid protein, a composition, or a method disclosed herein, one or more modifications are located in a variable region of parental AAV capsid protein. In some embodiments, a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, one or more modifications are located in an AAV9 capsid protein variable region, e.g., VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX, or any combination thereof.
[0063] In some embodiments, one or more modifications are located in: VR-VIII of a VP1, VP2, or VP3 of an AAV9 capsid protein. Page 11 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0064] In some embodiments, a variant AAV capsid protein further comprises one or more modifications to an amino acid sequence that is at or near a glycan binding region. In some embodiments, one or more modifications reduces glycan binding. In some embodiments, a glycan is galactose. By way of example, glycan binding residues of an AAV9 capsid protein include, but are not limited to: (a) amino acids 271 and 272 of a VP1, VP2 or VP3; (b) amino acid 446 of a VP1, VP2 or VP3; (c) amino acid 470 of a VP1, VP2 or VP3; (d) amino acids 501 to 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2 or VP3; or (e) amino acids 489 and 545 of a VP1, VP2 or VP3. Based on the exemplary glycan binding domains and / or residues provided herein for an AAV9 capsid protein, those with knowledge in the pertinent field would be able to readily ascertain the corresponding glycan binding domain and / or residues in a different parental AAV capsid protein.
[0065] In some embodiments of a rAAV particle, a variant AAV capsid protein, a composition, or a method disclosed herein, one or more modifications is at a glycan binding domain of a parental AAV capsid protein. In some embodiments, a parental AAV capsid protein is an AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein. In some embodiments, a parental AAV capsid protein is an AAV9 capsid protein.
[0066] In some embodiments, one or more modifications is at or between amino acids: (a) 271 and 272 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (b) 446 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (c) 470 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (e) 489 and 545 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (f) 591 and 621 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; or (g) any combination or all of (a)-(f) Page 12 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0067] In some embodiments of a rAAV particle, a variant AAV capsid protein, a composition, or a method disclosed herein, one or more modifications is at or between amino acids: (a) 271 and 272 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (b) 446 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (c) 470 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2 or VP3 of an AAV9 capsid protein; (e) 489 and 545 of VP1of a VP1, VP2 or VP3 of an AAV9 capsid protein; (f) 591 and 621 of a VP1, VP2 or VP3 of an AAV9 capsid protein; or (g) any combination or all of (a)-(f)..
[0068] In some embodiments of any of the variant AAV capsids, AAV particles comprising a variant AAV capsid, compositions comprising a variant AAV capsid, or methods of using the same, a variant AAV capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity relative to a parental AAV capsid protein.
[0069] In some embodiments, percent identity is determined by comparing the sequence of a variant AAV capsid protein without a peptide insertion, with a parental AAV capsid protein.
[0070] In some embodiments, a variant AAV capsid protein and a parental AAV capsid protein have 100% identity when: (a) a peptide insertion in a variant AAV capsid protein is not taken into account in the sequence comparison; and (b) a variant AAV capsid protein does not have one or more modifications other than a peptide insertion.
[0071] In some embodiments, a variant AAV capsid protein and a parental AAV capsid protein have less than 100% identity when: (a) a peptide insertion in a variant AAV capsid protein is not taken into account in the sequence comparison; and (b) a variant AAV capsid protein comprises one or more modifications other than a peptide insertion.
[0072] In some embodiments, a parental AAV capsid protein is an AAV9 capsid protein of SEQ ID NO: 2001.
[0073] In some embodiments, a parental AAV capsid protein is an AAV1 capsid protein of SEQ ID NO: 2002.
[0074] In some embodiments, a parental AAV capsid protein is an AAV2 capsid protein of SEQ ID NO: 2003. Page 13 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0075] In some embodiments, a parental AAV capsid protein is an AAV3B capsid protein of SEQ ID NO: 2010.
[0076] In some embodiments, a parental AAV capsid protein is an AAV4 capsid protein of SEQ ID NO: 2051.
[0077] In some embodiments, a parental AAV capsid protein is an AAV5 capsid protein of SEQ ID NO: 2004.
[0078] In some embodiments, a parental AAV capsid protein is an AAV6 capsid protein of SEQ ID NO: 2005.
[0079] In some embodiments, a parental AAV capsid protein is an AAV8 capsid protein of SEQ ID NO: 2006.
[0080] In some embodiments, a parental AAV capsid protein is an AAV7 capsid protein of SEQ ID NO: 2052.
[0081] In some embodiments, a parental AAV capsid protein is an AAV8 capsid protein of SEQ ID NO: 2006.
[0082] In some embodiments, a parental AAV capsid protein is an AAV10 capsid protein of SEQ ID NO: 2053.
[0083] In some embodiments, a parental AAV capsid protein is an AAV11 capsid protein of SEQ ID NO: 2054.
[0084] In some embodiments, a parental AAV capsid protein is an AAV12 capsid protein of SEQ ID NO: 2055.
[0085] In some embodiments, a parental AAV capsid protein is an AAV13 capsid protein of SEQ ID NO: 2056.
[0086] In some embodiments, a parental AAV capsid protein is an AAVhu68 capsid protein of SEQ ID NO: 2057.
[0087] In some embodiments, a parental AAV capsid protein is an AAVrh10 capsid protein of SEQ ID NO: 2057. Page 14 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0088] In some embodiments of any of the AAV particles comprising a variant AAV capsid, compositions comprising a rAAV particle, or methods of using the same disclosed herein, a payload is or comprises a polypeptide that is encoded by a nucleic acid sequence within a rAAV particle.
[0089] In some embodiments, a polypeptide is or comprises a CRISPR-Cas protein, or a variant or fragment thereof. In some embodiments, a CRISPR-Cas protein is chosen from : a Type II, Type V or Type VI CRISPR-Cas protein (e.g., a Cas9 protein), a Cas12a protein, a Cas12b protein, a Cas12c protein, a Cas12d protein, a Cas12e protein, a Cas12f protein, a Cas12g protein, a Cas12h protein, a Cas12i protein, a Cas13a protein, a Cas13b protein or a variant or fragment of any of the foregoing. In some embodiments, the payload also comprises a guide RNA, gRNA, sgRNA, or crRNA / tracrRNA that interacts with the CRISPR-Cas protein. In some embodiments a CRISPR-Cas protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain. In some embodiments a CRISPR-Cas protein is a nuclease. In some embodiment a CRISPR-Cas protein is a nickase and only cleaves one strand of a target nucleic acid molecule. In some embodiment a CRISPR-Cas protein is inactivated and binds to but does not cleave a target nucleic acid molecule.
[0090] In some embodiments, a polypeptide is or comprises a Zinc finger protein, or a variant or fragment thereof. In some embodiments, a Zinc finger protein is chosen from: a Zinc finger nuclease, an artificial restriction enzyme fusion protein, a sequence-targeted zinc-finger DNA-binding unit optionally fused with a nuclease domain (e.g., Fok1 nuclease domain), or a variant or fragment or any combination of any of the foregoing. In some embodiments a Zinc finger protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain.
[0091] In some embodiments, a polypeptide is or comprises a Transcription Activator- Like Effector (TAL) protein, or a variant or fragment thereof. In some embodiments, a TAL comprises: a TAL effector DNA binding domain (e.g., a TAL effector DNA binding domain isolated from Xanthomonas spp.), a Transcription Activator-Like Effector Nuclease (TALEN), e.g., a TAL effector DNA binding domain fused with a nuclease domain (e.g., Fok1 nuclease domain), or a variant or fragment or any combination of any of the foregoing. In some Page 15 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) embodiments a TAL protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain.
[0092] In some embodiments, a polypeptide is or comprises a base editor, or a variant or fragment thereof. In some embodiments, a base editor comprises a deaminase, an adenosine deaminase enzyme (ABE), a cytosine deaminase enzyme (CBE), an APOBEC1, an APOBEC3A, an APOBEC3G, an evoAPOBEC, a BE4-YE1, a CDA1, an activation-induced cytidine deaminase (AID), a mutant TadA, an adenosine deaminases (TadA*), an E. coli tRNA-specific adenosine deaminase (TadA), a deaminase associated with a DNA binding domain monomer, a base editing enzyme that is RNA guided, a DNA glycosylase inhibitor, one or more DNA glycosylase inhibitor domains, a 5-methylcytosine deaminase, a cytidine deaminase domain, an adenine deaminase domain, an adenosine base editor (ABE), a Target-ACEmax, a synchronous programmable adenine and cytosine editor (SPACE), an A&C-BEmax., a circularly permuted base editor, an adenosine deaminase enzyme (ADAR), a RNA editing for programmable adenosine to inosine replacement (REPAIR), a leveraging endogenous ADAR for programmable editing of RNA (LEAPER) or a variant or fragment or combination of any of the foregoing. In some embodiments, the payload also comprises a guide RNA, gRNA, sgRNA, or crRNA / tracrNA that interacts with the base editor.
[0093] In some embodiments, a polypeptide is or comprises a prime editor, or a variant or fragment thereof, or a system comprising the same. In some embodiments, a prime editor and / or system comprising the same comprises: a reverse transcriptase, a prime editing enzyme, an editing enzyme that includes a reverse transcriptase domain, an Avian Myeloblastosis Virus (AMV) Reverse Transcriptase, a Murine Leukemia Virus (MLV) Reverse Transcriptase, a HIV- 1 reverse transcriptase, a bacterial reverse transcriptase, a reverse transcriptase associated with a DNA binding domain and / or protein, a reverse transcriptase fused to a DNA binding domain that is a catalytically impaired nuclease domain (e.g., a nickase), a prime editing 1 system (PE1), a prime editing 2 system (PE2), a prime editing 3 system (PE3), a prime editing 3b system (PE3b) or a variant or fragment or any combination of any of the foregoing. In some embodiments, the payload also comprises a prime editing gRNA (pegRNA) or an extended sgRNA that interacts with the prime editor. Page 16 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0094] In some embodiments, a polypeptide is or comprises a meganuclease, or a variant or fragment thereof. In some embodiments, a meganuclease is chosen from: a homing endonuclease, a LAGLIDADG family meganuclease, a GIYYIG family meganuclease, a His- Cyst box family meganuclease, or HNH family endonuclease, an I-SeeI, an I-CeuI, a PI-PspI, a PI-SceI, an I-SceIV, an I-CsmI, an I-PanI, an I-SceII, an I-PpoI, an I-SceIII, an I-CreI, an I-TevI, an I-TevII an I-TevIII or a variant or fragment or any combinations of any of the foregoing.
[0095] In some embodiments, a polypeptide is associated with a CNS disorder.
[0096] In some embodiments, a CNS disorder is a result of a genetic abnormality.
[0097] In some embodiments, a CNS disorder is a not a result of a genetic abnormality.
[0098] In some embodiments, a CNS disorder is chosen from: Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy), or combinations thereof.
[0099] In some embodiments, a polypeptide is an enzyme.
[0100] In some embodiments, a polypeptide is an antibody.
[0101] In some embodiments, a polypeptide is a secreted protein.
[0102] In some embodiments of any of the rAAV particles comprising a variant AAV capsid, compositions comprising a rAAV particle, or methods of using the same disclosed herein, a payload is or comprises an RNA molecule that is encoded by a nucleic acid sequence within a rAAV particle. In some embodiments, an RNA molecule is or comprises an siRNA, a miRNA, a gRNA, an antisense RNA, a circular RNA, an snRNA or an aptamer.
[0103] In some embodiments, an RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with a CNS disorder.
[0104] In some embodiments of any of the rAAV particles comprising a variant AAV capsid, compositions comprising a rAAV particle, or methods of using the same disclosed Page 17 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) herein, a payload is or comprises a DNA molecule. In some embodiments, a DNA molecule is or comprises a nucleic acid sequence of up to about 5,100 nt in length, e.g., up to about 5,000 nt, up to about 4,900, up to about 4,800, up to about 4,700, up to about 4,600, up to about 4,500, up to about 4,400, etc.
[0105] In some embodiments, a CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay- Sachs, Spinal Muscular Atrophy, Alzheimer’s disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy), or combinations thereof.
[0106] In some embodiments of any of the rAAV particles comprising a variant AAV capsid, compositions comprising a rAAV particle, or methods of using the same disclosed herein, a nucleotide sequence encoding a payload is operably linked to a promoter.
[0107] In some embodiments, a promoter is a CNS promoter or a variant or a fragment thereof. In some embodiments, a CNS promoter is chosen from: a GFAP promoter, a SYN1 promoter, a NSE / RU5’ promoter, a neuroactive peptide cholecystokinin (CCK) promoter, a myelin basic promoter (MBP), a human myelin associated glycoprotein promoter, a phosphate- activated glutaminase (PAG) promoter, a vesicular glutamate transporter (vGLUT) promoter, a glutamic acid decarboxylase (GAD) promoter, Camk2a promoter, TH (tyrosine hydroxylase) promoter, Hb9 promoter, CNP promoter, NES (nestin) promoter, Tub1a promoter, SST (somatostatin) promoter, MeCP2 promoter, or combinations thereof.
[0108] In some embodiments, a promoter is or comprises a chicken beta actin hybrid (CBh) promoter or a variant or a fragment thereof.
[0109] In some embodiments, a promoter is or comprises a hSyn1 promoter or a variant or a fragment thereof.
[0110] In some embodiments, a promoter is or comprises a GFAP promoter or a variant or a fragment thereof. Page 18 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0111] In some embodiments of any of the methods of using a pharmaceutical composition comprising a rAAV particle comprising a variant AAV capsid protein disclosed herein, a pharmaceutical composition is administered via a route of administration chosen from: intravenous, intraarterial, intracoronary, intraparenchymal, subpial, intrathecal, intraocular, intracerebroventricular (ICV), intracisternal magna (ICM), or intramuscular.
[0112] In some embodiments, a subject is a human.
[0113] Also provided herein is a method of treating a subject having a CNS disorder and / or ameliorating a symptom of a CNS disorder in a subject, the method comprising administering to the subject a pharmaceutical composition disclosed herein.
[0114] In some embodiments, a CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay- Sachs, Spinal Muscular Atrophy, Alzheimer’s disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy), or combinations thereof.
[0115] As would be understood by one with ordinary skill in the art, a peptide sequence disclosed herein, e.g., a peptide disclosed in any one of Tables 1-3, can be used as a targeting moiety, e.g., a CNS targeting moiety, to deliver a payload. In some embodiments, a targeting moiety, e.g., a CNS targeting moiety, can be conjugated or fused to a payload. In some embodiments, a targeting moiety, e.g., a CNS targeting moiety, is inserted in a viral protein, e.g., an AAV capsid.
[0116] Other features, objects, and advantages of the present invention are apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments of the present invention, is given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description. Page 19 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) BRIEF DESCRIPTION OF THE DRAWING
[0117] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings(s) will be provided by the Office upon request and payment of the necessary fee.
[0118] The Figures described below, which together make up the Drawing, are for illustration purposes only, not for limitation
[0119] FIG.1 is a dot plot showing results from a Round 2 in vivo screen to identify variant AAV capsid proteins with an insertion at VR-VIII of AAV9 that show enhanced CNS transduction in non-human primates (NHP) compared to WT AAV9.
[0120] FIGS.2A-2D show the results of Round 3 screening using the recovered capsid pool from the Round 2 screen with a ubiquitous promoter (CBh) or CNS specific promoters (GFAP or hSyn1). FIG.2A compares CNS transduction results between variant AAV capsid proteins identified in Round 2 and Round 3. FIGS.2B-2D show enhanced CNS transduction results of variant AAV capsid proteins identified in Round 3 compared to WT AAV9 with expression driven by a CBh promoter (FIG.2B), a hSyn1 promoter (FIG.2C), and a GFAP promoter (FIG.2D). “X” in FIGS.2B-2D mark capsids with the X1X2X3X4VX5I (SEQ ID NO: 1) motif inserted between positions 588 and 589 of VP1.
[0121] FIG.3 shows CNS transduction and transgene expression in non-human primates intravenously administered AAV9 particles or an AAV particle comprising an exemplary variant AAV9 capsid protein with the TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) inserted between positions 588 and 589 of VP1, or an AAV particle comprising an exemplary variant AAV9 capsid protein with the PQPGTMR peptide (SEQ ID NO: 67; capsid variant 2) inserted between positions 588 and 589 of VP1. Each capsid was packaged with a CAG-driven FLAG- tagged mCherry transgene. FIG.3 is a dot plot showing mRNA expression of the mCherry transgene in the frontal cortex of animals administered the respective AAV particles.
[0122] FIGS.4A-4F show CNS transduction and transgene expression in non-human primates intravenously administered AAV9 particles or an AAV particle comprising an exemplary variant AAV9 capsid protein with the TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) inserted between positions 588 and 589 of VP1. Each capsid was packaged with a CAG-driven FLAG-tagged mCherry transgene. FIG.4A is a dot plot showing vector genome Page 20 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) biodistribution in CNS tissues and the liver of animals administered the respective AAV particles. FIG.4B is a dot plot showing mRNA expression of the mCherry transgene in CNS tissues and the liver of animals administered the respective AAV particles. LH stands for left hemisphere. SC stands for spinal cord. FIGS.4C-4D show the results of immunohistochemistry (IHC) staining in black and white (FIG.4D) and greyscale (FIG.4C), of CNS tissue for mCherry of animals administered the respective AAV particles. FIGS.4E-4F show the results of immunohistochemistry (IHC) staining, in black and white (FIG.4F) and greyscale (FIG.4E), of the frontal cortex and thalamus for mCherry of animals administered the respective AAV particles.
[0123] FIGs 5A-5E show CNS transduction and transgene expression in non-human primates intravenously administered AAV9 particles or an AAV particle comprising an exemplary variant AAV9 capsid protein with the TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) inserted between positions 588 and 589 of VP1 as measured by an immunofluorescence (IF) assay with staining of mCherry marking respective AAV particles and NeuN expressing neurons (dual IF). Each capsid was packaged with a CAG-driven FLAG- tagged mCherry transgene. FIG.5A shows the results of an immunofluorescence assay on cerebral cortex sections. FIG.5B shows the results of an immunofluorescence assay on thalamus sections. FIG.5C shows the results of an immunofluorescence assay on cerebellum sections. FIG.5D is a bar graph showing a quantification of neuronal transduction efficiency based on dual IF staining as described above. FIG.5E is a bar graph showing a quantification of non- neuronal transduction efficiency based on IF staining as described above.
[0124] FIGs.6A-6C show manufacturing process yield and purity for an AAV particle comprising an exemplary variant AAV9 capsid protein with the TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) inserted between positions 588 and 589 of VP1 and for AAV9 particles. FIG.6A shows volumetric yields; FIG.6B shows individual downstream manufacturing process yields; and FIG.6C shows purity of the manufacturing process yields of AAV9 capsid protein with the TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) and AAV9 particles, as measured by Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis (SDS PAGE) for VP1, VP2, and VP3 proteins. Page 21 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) DEFINITIONS
[0125] In this application, unless otherwise clear from context, (i) the term “a” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising” and “including” may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; and (iv) the terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (v) where ranges are provided, endpoints are included.
[0126] 5’ and 3’: The terms “5’” and “3’” are relative terms to define a spatial relationship or directionality between two or more segment of a nucleic acid sequence. Thus, 3’ of a nucleic acid indicates a segment of the nucleic acid that is downstream of another segment, while 5’ indicates a segment of the nucleic acid that is upstream of another segment. For example, 3’ may indicate that a segment is in the 3’ half of the nucleic acid sequence or even at the 3’ end of the nucleic acid sequence. Similarly, 5’ may indicate that a segment is in the 5’ half of the nucleic acid sequence or even at the 5’ end of the nucleic acid sequence. Unless indicated otherwise, the directionality of a nucleic acid will be in the 5’ to 3’ direction of translation.
[0127] About or approximately: As used herein, the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
[0128] Adeno-associated virus (AAV): As used herein, the terms “Adeno-associated virus” and “AAV” refer to viral particles, in whole or in part, of the family Parvoviridae and the genus Dependoparvovirus. AAV is a small replication-defective, nonenveloped virus. AAV includes, but is not limited to, AAV serotype 1, AAV serotype 2, AAV serotype 3 (including serotypes 3A and 3B), AAV serotype 4, AAV serotype 5, AAV serotype 6, AAV serotype 7, AAV serotype 8, AAV serotype 9, AAV serotype 10, AAV serotype 11, AAV serotype 12, AAV serotype 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, non-human primate AAV, e.g., from rhesus monkeys, and any variant of any of the foregoing. Wild-type AAV is replication deficient and requires co-infection of cells Page 22 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) by a helper virus, e.g., adenovirus, herpes, or vaccinia virus, e.g., an Ad2 or Ad5 virus, or supplementation of helper viral genes, in order to replicate.
[0129] Ad2 helper: As used herein, the term “Ad2 helper” refers to the Adenovirus serotype 2 (Ad2) helper virus (e.g., wildtype or recombinantly engineered Ad2 helper virus) and various Ad2 helper genes and / or Ad2 helper polypeptides or nucleic acids, including, but not limited, to E1a, E1b, E2a, E4Orf6, VA RNA, and any variant or fragment of any of the foregoing. In some embodiments, an Ad2 helper vector (e.g., plasmid) encodes Ad2 helper polypeptides or nucleic acids (e.g., one, two, three, or four of E1 (e.g., E1a and / or E1b), E2a, E4, or VA RNA) necessary to generate functional rAAV particles. In certain embodiments, the Ad2 helper vector is transfected into an E1 complementing cell line (e.g., HEK293). The nucleotide sequence of an Ad2 helper vector and Ad2 helper virus genes can be derived from the Adenovirus 2 genome (GenBank Accession No. J01917.1).
[0130] Ad5 helper: As used herein, the term “Ad5 helper” refers to the Adenovirus serotype 5 (Ad5) helper virus (e.g., wildtype or recombinantly engineered Ad5 helper virus) and various Ad5 helper genes and / or Ad5 helper polypeptides or nucleic acids, including, but not limited, to E1a, E1b, E2a, E4Orf6, and / or VA RNA. In some embodiments, an Ad5 helper vector (e.g., plasmid) encodes Ad5 helper polypeptides or nucleic acids (e.g., one, two, three, or four of E1 (e.g., E1a and / or E1b), E2a, E4, or VA RNA) necessary to generation functional rAAV particles. In certain embodiments, the Ad5 helper vector is transfected into an E1 complementing cell line (e.g., HEK293). The nucleotide sequence of an Ad5 helper vector and Ad5 helper genes can be derived from the Adenovirus 5 genome (GenBank Accession No. AY601635).
[0131] Administration: As used herein, the term “administration” refers to the administration of a composition comprising rAAV particles as described herein to a subject. Administration may be by any appropriate route. For example, in some embodiments, administration may be local or systemic administration (e.g., to a mammal, e.g., to a human, e.g., a patient). A composition of the disclosure may be administered by injection or infusion by any route. For example, a composition may be administered by retinal, subretinal, intravitreal, suprachoroidal, intraspinal, intracisternal magna, or intrathecal injection or infusion. Additional exemplary routes of administration may include, but are not limited to, bronchial (e.g., bronchial instillation), buccal, enteral, intradermal, intra-arterial, intradermal, intragastric, intramedullary, Page 23 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., intratracheal instillation), transdermal, vaginal, and intravitreal.
[0132] Bioreactor: The term “bioreactor,” as used herein, refers to any vessel used for the growth of a cell culture (e.g., a mammalian cell culture). The bioreactor can be of any size and / or any shape so long as it is useful for culturing a cell culture (e.g., a mammalian cell culture).
[0133] Cap polypeptide: As used herein, the term “Cap polypeptide” refers to the structural proteins that form a functional AAV capsid, which can in turn package DNA and infect or transduce a target cell. In some embodiments, a Cap polypeptide comprises a variant AAV capsid as disclosed herein. In some embodiments, Cap polypeptides will comprise all of the AAV capsid subunits, but less than all of the capsid subunits may be present as long as a functional capsid is produced. In some embodiments, the nucleic acid sequence encoding Cap polypeptides will be present on a single vector (e.g., plasmid). In some embodiments, the Cap polypeptide comprises an AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 Cap polypeptide, or a variant of any of the foregoing. AAV capsid genes and proteins have been described in, e.g., Knipe DM. et al., (2001) Fields Virology 6(1), which is hereby incorporated by reference in its entirety.
[0134] Cell Density: As used herein, the term “cell density” refers to that number of cells present in a given volume of medium or the number of cells present in a given surface area. For example, cell density may be represented as viable cells (vc) / cm2of culture medium or vc / mL.
[0135] Corresponding to: As used herein, the term “corresponding to” may be used to designate the position or identity of a structural element in a compound or composition through comparison with an appropriate reference compound or composition. For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) may be identified as “corresponding to” a residue in an appropriate reference polymer. For example, those of skill in the art appreciate that residues in a provided polypeptide or polynucleotide sequence are often designated (e.g., numbered or labeled) according to the scheme of a related reference sequence (even if, e.g., such designation does not reflect literal numbering of the provided sequence). By way of illustration, if a Page 24 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) reference sequence includes a particular amino acid motif at positions 100-110, and a second related sequence includes the same motif at positions 110-120, the motif positions of the second related sequence can be said to “correspond to” positions 100-110 of the reference sequence. Those of skill in the art appreciate that corresponding positions can be readily identified, e.g., by alignment of sequences, and that such alignment is commonly accomplished by any of a variety of known tools, strategies, and / or algorithms, including without limitation software programs such as, for example, BLAST, CS-BLAST, CUDASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, Hhpred / Hhsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE. Two sequences can be identified as corresponding if they are identical or if they share substantial identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) over a length of (e.g., at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500 or more) units (e.g., nucleotides or amino acids).
[0136] Culture: As used herein, the terms “culture” and “cell culture” refer to a cell population (e.g., a eukaryotic cell population) that is suspended in or covered by a medium under conditions suitable to survival and / or growth of the cell population. As will be clear to those of ordinary skill in the art, these terms can also refer to the combination comprising the cell population and the medium.
[0137] Fragment: As used herein, the terms “fragment” or “portion” refers to a structure that includes a discrete portion of the whole, but lacks one or more moieties found in the whole structure. In some embodiments, a fragment consists of such a discrete portion. In some embodiments, a fragment consists of or comprises a characteristic structural element or moiety found in the whole. In some embodiments, a nucleotide fragment comprises or consists of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more monomeric units (e.g., nucleic acids) as found in the whole nucleotide. In some embodiments, a nucleotide fragment comprises or consists of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, Page 25 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more of the monomeric units (e.g., residues) found in the whole nucleotide. The whole material or entity may in some embodiments be referred to as the “parent” of the whole.
[0138] Gene: As used herein, the term “gene” refers to a DNA sequence that codes for a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (i.e., a sequence that encodes a particular product). In some embodiments, a gene includes a non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, a gene may include one or more regulatory elements that, for example, may control or effect one or more aspects of gene expression (e.g., inducible expression, etc.).
[0139] Gene therapy: As used herein, the term “gene therapy” refers to insertion or deletion of specific genomic DNA sequences to treat or prevent a disorder or condition for which such therapy is sought. In some embodiments, the insertion or deletion of genomic DNA sequences occurs in specific cells (e.g., target cells). Target cells may be from a mammal and / or may be cells in a mammalian subject. Mammals include but are not limited to humans, dogs, cats, cows, sheep, pigs, llamas, etc. In some embodiments, heterologous DNA is transferred to target cells. The heterologous DNA may be introduced into the selected target cells in a manner such that the heterologous DNA is expressed and a therapeutic product encoded thereby is produced. Additionally or alternatively, the heterologous DNA may in some manner mediate expression of DNA that encodes the therapeutic product, or it may encode a product, such as a polypeptide or RNA that in some manner mediates or modulates, directly or indirectly, expression of a therapeutic product. Genetic therapy may also be used to deliver nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by the mammal or the cell in which it is introduced. The heterologous DNA encoding the therapeutic product may be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof. Genetic therapy may also involve delivery of an inhibitor or repressor or other modulator of gene expression. Such an inhibitor or repressor or other modulator can be a polypeptide, peptide, or nucleic acid (e.g., DNA or RNA). Gene therapy may include in vivo or ex vivo techniques. In some embodiments, viral and non-viral based gene transfer methods can be used to introduce a nucleic acid encoding a polypeptide of interest or to introduce a therapeutic nucleic acid into mammalian cells or target Page 26 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as poloxamers or liposomes. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson WF., (1992) Science 256(5058): pp.808-813; Miller AD., (1992) Nature 357(6378): pp.455-460; Feuerbach FJ. Et al., (1996) Kidney Int.49(6): pp.1791-1794; Urnov FD. Et al., (2010) Nat. Rev Genet.11(9): pp.636-646; and Collins M. et al., (2015) Proc Biol Sci.282(1821), each of which is hereby incorporated by reference in its entirety.
[0140] Host Cell: As used herein, the term “host cell” refers to a cell into which exogenous DNA (recombinant or otherwise) has been introduced. Persons of skill upon reading this disclosure will understand that such terms refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein. In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any of the Kingdoms of life that are suitable for expressing an exogenous DNA (e.g., a recombinant nucleic acid sequence).
[0141] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, Page 27 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
[0142] Improve, increase, inhibit, or reduce: As used herein the terms “improve”, “increase,” “inhibit,” “reduce,” or grammatical equivalents thereof, indicate values that are relative to a baseline or other reference measurement. In some embodiments, an appropriate reference measurement may be or comprise a measurement in a particular system (e.g., in a single sample, e.g., of a culture medium) under otherwise comparable conditions absent presence of (e.g., prior to and / or after) a particular agent or treatment, or in presence of an appropriate comparable reference agent. In some embodiments, an appropriate reference measurement may be or comprise a measurement in a comparable system known or expected to respond in a particular way, in presence of the relevant agent or treatment.
[0143] Medium: As used herein, the terms “medium,” “culture medium,” and “growth medium” refer to a solution comprising nutrients to nourish cells (e.g., growing cells, e.g., eukaryotic cells). Typically, these solutions provide essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by the cell for survival and / or minimal growth. The solution can also comprise components that enhance survival and / or growth above the minimal rate, including hormones and growth factors. The solution can be formulated to a pI and concentration of one or more salts that are optimal for cellular survival and / or proliferation. For example, the medium can also be a “defined medium” or “chemically defined medium,” e.g., a serum-free medium that contains no proteins, hydrolysates, or components of unknown composition. Defined media are free of animal-derived components Page 28 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) and all components have a known chemical structure. One of skill in the art understands a defined medium can comprise recombinant polypeptides, for example, but not limited to, hormones, cytokines, interleukins, and / or other signaling molecules.
[0144] CNS targeting moiety: The phrase “CNS targeting moiety” as used herein refers to a peptide which is effective in targeting a central nervous system (CNS) cell and / or tissue, e.g., a cell or tissue that is present in the brain, spinal cord, or CNS system. In some embodiments, a CNS-targeting moiety can target a CNS cell or tissue by: (i) contacting a CNS cell or tissue (e.g., binding to one or more receptors expressed on a CNS cell or tissue); (ii) contacting a cell in contact with a CNS cell or tissue (e.g., binding to one or more receptors expressed on a cell in contact with a CNS cell or tissue); (iii) delivering a payload to a CNS cell or tissue; or (iv) any combination of (i)-(iii). In some embodiments, a CNS cell or tissue comprises: a CNS epithelial cell, a nerve cell, a CNS connective tissue cell, a stem cell, a progenitor cell, a CNS immune cell, a spinal cord cell, a cell that lines one or more brain ventricles, a nerve support cell, a glial cell, a fat cell, a meninges cell, or a combination thereof. In some embodiments, a CNS tissue comprises a tissue found in a: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of a brain and / or spinal cord. In some embodiments, a CNS targeting moiety can be conjugated or fused to a payload. In some embodiments, a CNS targeting moiety can be incorporated into a vector, e.g., a viral vector or a non-viral vector. In some embodiments, a CNS targeting moiety can be inserted in an AAV capsid to form a variant AAV capsid as disclosed
[0145] Nucleic acid: The term “nucleic acid” includes any nucleotides, analogs thereof, and polymers thereof. The term “polynucleotide” as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecules and, thus, include double- and single- stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to, methylated, protected and / or capped nucleotides or polynucleotides. The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo- deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified Page 29 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus-atom bridges (also referred to herein as “internucleotide linkages”). The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified phosphorus atom bridges. Examples include, and are not limited to, nucleic acids containing ribose moieties, the nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. In some embodiments, the prefix poly- refers to a nucleic acid containing 2 to about 10,000, 2 to about 50,000, or 2 to about 100,000 nucleotide monomer units. In some embodiments, the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units. In accordance with the methods and compositions described herein, in some embodiments, an RNA comprises a short hairpin RNA (shRNA), small interfering RNA (siRNA), mRNA, snRNA, CRISPR / Cas guide RNA, microRNA (miRNA), and / or a precursor thereof.
[0146] Payload: As used herein, the term “payload” refers to a nucleic acid sequence of interest (e.g., comprising a sequence that encodes a target payload, such as a target polypeptide or RNA) that is desired to be introduced into a cell, tissue, organ, organism, and / or system comprising cells. A target payload can be a heterologous protein with a therapeutic purpose, e.g., an enzyme or antibody. The target payload can be a heterologous nucleic acid with a therapeutic purpose, e.g., an miRNA, siRNA, shRNA, mRNA, snRNA, or CRISPR / Cas guide RNA, or a precursor thereof. One of skill in the art will recognize that the target payload can be selected from any heterologous protein or nucleic acid of interest. As used herein, “encode” or “encodes” means directs the expression of or processed into. For example, as used herein, a nucleic acid encodes a polypeptide sequence if it directs the expression of that polypeptide sequence. As another example, as used herein, a nucleic acid precursor (e.g., a pri-miRNA or pre-miRNA) encodes a further processed version of the nucleic acid (e.g., mature miRNA) if it is processed into the further processed version.
[0147] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to a composition comprising rAAV particles that is suitable for administration to a human or animal subject. In some embodiments, a pharmaceutical composition comprises an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount Page 30 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) appropriate for administration in a therapeutic regimen. In some embodiments, a therapeutic regimen comprises one or more doses administered according to a schedule that has been determined to achieve a desired therapeutic effect when administered to a subject or population in need thereof (e.g., by a statistically significant probability). A pharmaceutical composition may be specially formulated for administration in solid or liquid form. In some embodiments, a pharmaceutical composition is formulated for administration by parenteral administration, such as by subcutaneous, intramuscular, intravenous or epidural injection. In some embodiments, a pharmaceutical composition is formulated as a sterile solution or suspension, e.g., in a sustained- release formulation. Pharmaceutical compositions of the disclosure may be formulated for administration by injection or infusion (e.g., subcutaneous, intramuscular, intravenous or epidural injection or infusion). For example, compositions may be formulated for administration by retinal, subretinal, intravitreal, suprachoroidal, intraspinal intracisternal magna, or intrathecal injection or infusion. In some embodiments, a pharmaceutical composition is intended and suitable for administration to a human subject. In some embodiments, a pharmaceutical composition is substantially free of contaminants (e.g., sterile and substantially pyrogen-free). Formulations of the pharmaceutical compositions may include, but are not limited to, formulations for oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets (e.g., targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; topical application, such as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
[0148] Polypeptide: The term “polypeptide”, as used herein, generally has its art- recognized meaning of a polymer of at least three amino acids. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional fragments (e.g., fragments retaining at least one activity) of such complete polypeptides. Moreover, those of ordinary skill in the art understand that protein sequences generally tolerate some substitution without destroying activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and further usually including at least one region of Page 31 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99% in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term “polypeptide” as used herein. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
[0149] Recombinant: As used herein, the term “recombinant” is intended to refer to polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and / or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and / or direct expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof; and / or polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and / or otherwise generating a nucleic acid that encodes and / or directs expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof. In some embodiments, one or more of such selected sequence elements is found in nature. In some embodiments, one or more of such selected sequence elements is designed in silico. In some embodiments, one or more such selected sequence elements results from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.).
[0150] Recombinant AAV (rAAV) particle: A “recombinant AAV particle”, or “rAAV particle,” as used herein, refers to an infectious, replication-defective viral particle comprising an AAV protein shell encapsulating a payload that is flanked on both sides by ITRs. An AAV particle is produced in a suitable host cell (e.g., a HEK293 cell). For example, the host cell is Page 32 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) transfected with at least one vector encoding one or more helper polypeptides and nucleic acids (e.g., Ad2 helper polypeptides and nucleic acids), at least one Rep polypeptide, at least one Cap polypeptide, and at least one payload (e.g., for polypeptide expression or a therapeutic nucleic acid), such that the host cell is capable of producing the Rep and Cap polypeptides necessary for packing the rAAV particle. rAAV particles may be used for subsequent gene delivery.
[0151] Rep polypeptide: The term “Rep polypeptide”, as used herein, refers to the AAV non-structural proteins that mediate AAV replication for the production of AAV particles. The AAV replication genes and proteins have been described in, e.g., Knipe 2001, which is hereby incorporated by reference in its entirety.
[0152] Seeding: The term “seeding” as used herein refers to the process of providing a cell culture to a vessel (e.g., a bioreactor or culture flask). For example, the process of providing a cell culture may include propagation of the cells in another bioreactor or vessel before providing to the bioreactor or other vessel. The cells have been frozen and thawed immediately prior to providing them to the bioreactor or vessel. The term “seeding” refers to providing any number of cells, including a single cell.
[0153] Subject: As used herein, the term “subject” refers to an organism, for example, a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, a laboratory animal, a mouse, a rat, a hamster, a gerbil, a cat, a dog). In some embodiments, a human subject is an adult, adolescent, or pediatric subject. In some embodiments, a subject is suffering from a disease, disorder or condition, e.g., a disease, disorder or condition that can be treated as provided herein, e.g., a neurological disease or disorder or a cancer or a tumor listed herein. In some embodiments, a subject is susceptible to a disease, disorder, or condition; in some embodiments, a susceptible subject is predisposed to and / or shows an increased risk (as compared to the average risk observed in a reference subject or population) of developing the disease, disorder or condition. In some embodiments, a subject displays one or more symptoms of a disease, disorder or condition. In some embodiments, a subject does not display a particular symptom (e.g., clinical manifestation of disease) or characteristic of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered. Page 33 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0154] Titer: As used herein, the term “titer” refers to the quantity of virus in a given volume. Titer, for example, can be expressed as viral genome copies (vg) per given volume or plaque forming units (pfu) per given volume. In some embodiments, titer can be expressed as number of capsids per given volume.
[0155] Transfection: As used herein, the term “transfection” refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g., mRNA) molecules, into cells, such as eukaryotic cells (e.g., mammalian cells). For example, transfection can include vector-based transfection, viral-based transfection, electroporation, lipofection (e.g., with cationic lipids and / or liposomes), calcium phosphate precipitation, nanoparticle-based transfection, and / or transfection based on cationic polymers (e.g., DEAE-dextran or polyethylenimine). In some embodiments, viral-based transfection is also referred to herein as transduction.
[0156] Treating: As used herein, the term “treating” refers to providing treatment, e.g., providing any type of medical or surgical management of a subject. The treatment can be provided in order to reverse, alleviate, inhibit the progression of, prevent or reduce the likelihood of a disease, disorder, or condition, or in order to reverse, alleviate, inhibit or prevent the progression of, prevent or reduce the likelihood of one or more symptoms or manifestations of a disease, disorder or condition. “Prevent” refers to causing a disease, disorder, condition, or symptom or manifestation of such not to occur for at least a period of time in at least some individuals. Treating can include administering an agent to the subject following the development of one or more symptoms or manifestations indicative of a condition, disease, or disorder, e.g., in order to reverse, alleviate, reduce the severity of, and / or inhibit or prevent the progression of the condition and / or to reverse, alleviate, reduce the severity of, and / or inhibit or one or more symptoms or manifestations of the condition. A composition comprising rAAV particles of the disclosure can be administered to a subject who has developed a disorder or is at increased risk of developing such a disorder relative to a member of the general population. A composition of the disclosure can be administered prophylactically or before development of any symptom or manifestation of the condition. Typically, in this case, the subject will be at risk of developing the condition.
[0157] Variant: As used herein in the context of molecules, e.g., nucleic acids or polypeptides, the term “variant” refers to a molecule that shows significant structural identity with a reference molecule but differs structurally from the reference molecule, e.g., in the Page 34 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) presence or absence or in the level of one or more chemical moieties as compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. In general, whether a particular molecule is properly considered to be a “variant” of a reference molecule is based on its degree of structural identity with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs in at least one aspect from the reference molecule. To give but a few examples, a polypeptide may have a characteristic sequence element that comprises a plurality of amino acids having designated positions relative to one another in linear or three-dimensional space and / or contributing to a particular structural motif and / or biological function; a nucleic acid may have a characteristic sequence element that comprises a plurality of nucleotide residues having designated positions relative to on another in linear or three-dimensional space. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., that are attached to the polypeptide or nucleic acid backbone). In some embodiments, a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some embodiments, a reference polypeptide or nucleic acid has one or more biological activities. In some embodiments, a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid shows a reduced level of one or more biological activities as compared to the reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered to be a “variant” of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference but for a small number of sequence alterations at particular positions. Typically, fewer than about 20%, Page 35 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residues as compared to a reference. Often, a variant polypeptide or nucleic acid comprises a very small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1) number of substituted, inserted, or deleted, functional residues (i.e., residues that participate in a particular biological activity) relative to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises not more than about 5, about 4, about 3, about 2, or about 1 addition or deletion, and, in some embodiments, comprises no additions or deletions, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and commonly fewer than about 5, about 4, about 3, or about 2 additions or deletions as compared to the reference. In some embodiments, a reference polypeptide or nucleic acid is one found in nature.
[0158] Vector: As used herein, the term “vector” refers to a molecule comprising a nucleic acid molecule, where the vector is capable of transporting the nucleic acid molecule into a cell. By way of non-limiting example, one type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be packaged into a viral capsid and can be transferred into another cell and / or organism. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “expression vectors.”
[0159] Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing Page 36 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., See, e.g., Sambrook J. et al., (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press 2ndedition, which is incorporated herein by reference in its entirety.
[0160] VP: As used herein, the term “VP” refers to an AAV VP1 capsid protein, an AAV VP2 capsid protein, an AAV VP3 capsid protein, or variants or fragments or combinations of any of the foregoing. The term “capsid protein” is used interchangeably herein with VP. The numbering used herein in describing exemplary locations of peptide insertions in VP1, VP2 or VP3 are used relative to AAV VP1 numbering. For example, VP1, VP2 and VP3 of the AAV9 capsid protein correspond to amino acids 1 to 736 of VP1, amino acids 138 to 736 of VP1 and amino acids 203 to 736 of VP1, respectively. Thus, reference to a peptide insertion between positions 588 and 589 in an AAV capsid variant refers to positions 588 and 589 in VP1, VP2 or VP3 relative to VP1 numbering. Those with knowledge in the pertinent field would be able to readily ascertain the corresponding position in VP2 and VP3, e.g., by comparing the sequences of VP1, VP2 and VP3 of the parental AAV capsid proteins using methods known in the field such as sequence alignment. In some embodiments, a VP capsid protein is a VP1 capsid protein. In some embodiments, a VP capsid protein is a VP2 capsid protein. In some embodiments, a VP capsid protein is a VP3 capsid protein. In some embodiments, a VP protein comprises a peptide insertion disclosed herein.
[0161] Variant AAV capsid protein: As used herein, the term “variant AAV capsid protein” refers to a VP capsid protein (e.g., a VP1, VP2, or VP3) comprising a peptide insertion relative to a corresponding parental AAV capsid protein (e.g., a parental VP1, VP2, or VP3). DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0162] The present disclosure provides, inter alia, improved recombinant adeno- associated virus (rAAV) particles that can be used for targeting cells or tissue, e.g., CNS cells and / or tissue. Safe and efficient therapeutic payload delivery to a CNS cell and / or tissue remains a major challenge in gene therapy. Recombinant adeno-associated viruses (rAAVs) have emerged as some of the most promising vectors for in vivo gene therapy, and are currently under clinical evaluation for a number of disorders including CNS disorders. However, naturally Page 37 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) occurring AAV capsids sub-optimally target CNS cells or tissue, and require extremely high doses to achieve minimum effective transgene expression. This poses daunting manufacturing challenges as well as safety concerns.
[0163] The present disclosure is based, in part, on the discovery that AAV CNS cell and / or tissue tropism can be obtained by inserting a short peptide into an AAV capsid to direct said AAV capsid to a CNS cell and / or tissue. In some embodiments, rAAV particles comprising a variant capsid having a peptide insertion disclosed herein bind to and / or recognize a target on a CNS cell and / or tissue. Without wishing to be bound by any particular theory, in some embodiments, rAAV particles comprising a variant capsid comprising a peptide insertion disclosed herein can enhance vector attachment, internalization, and / or payload expression in a CNS cell and / or tissue. AAV9
[0164] Adeno-associated viruses (AAVs) are small, nonenveloped, single-stranded DNA (ssDNA) viruses that belong to the Parvoviridae family. At least twelve distinct AAV serotypes have been identified from human and nonhuman primate sources (see DiMattia M.A. et al., (2012) J. Virology 86(12): pp.6947-6958, the entire contents of which is hereby incorporated by reference) (hereinafter “DiMattia 2012”). AAV9 is one of the human AAV serotypes that has enhanced transduction efficiency in cardiac and skeletal muscle, liver tissue, pancreatic tissue, and the eye compared to other serotypes (DiMattia 2012).
[0165] The AAV wild-type genome contains at least three genes, rep, cap and X (Büning H. et al., (2019) Molecular Therapy: Methods & Clinical Development vol.12 pages 248-265). The cap gene encodes for viral proteins VP1, VP2, and VP3, and assembly-activating protein (AAP). All three VP proteins are capsid monomers.
[0166] Transcription of the cap gene results in two messenger RNA: a messenger RNA which encodes VP1 and a messenger RNA which encodes VP2 and VP3 (as described in Warrington KH et al., (2004) Journal of Virology volume 78(12) pages 6595-6609). VP1, VP2, and VP3 are present at ratios of 1:1:10, respectively. The VP3 region is observed in all capsid structures of AAV serotypes that have been studied (DiMattia 2012). Page 38 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0167] VP proteins comprise beta strands, alpha helical regions, and structurally variable regions (VRs) in the surface loops which connect the beta strands. Without wishing to be bound by any particular theory, it is believed that differences in sequence and / or conformations of VRs contribute to the variability in cellular tropism, differences in tissue transduction efficiently, and / or antigenic reactivity among different AAV serotypes. In some embodiments, differences in VR sequence and / or structure among different AAV serotypes allow for differential recognition of cell surface glycans and / or tissue specific protein or lipid receptor interaction for internalization.
[0168] Wild type AAV9 (WT AAV9) has nine variable regions VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX (DiMattia 2012, see also Table 3 therein). AAV9 VR-I encompasses amino acid positions 262-269. AAV VR-II encompasses amino acid positions 327-332 and has a role, e.g., in genome packaging. AAV9 VR-III encompasses amino acid positions 382-386. AAV9 VR-IV encompasses amino acid positions 452-460 and has a role, e.g., in liver transduction and / or a delayed blood clearance phenotype. AAV9 VR-V encompasses amino acid positions 488-505 and has a role, e.g., in LamR receptor binding, liver and / or muscle-specific transduction, and / or a delayed blood clearance phenotype. AAV9 VR-VI encompasses amino acid positions 527-539 and has a role, e.g., in LamR receptor binding, and / or a delayed blood clearance phenotype. AAV9 VR-VII encompasses amino acid positions 545-558 and has a role, e.g., in liver transduction and / or delayed blood clearance phenotype. AAV9 VR- VIII encompasses amino acid positions 581-593 and has a role, e.g., in LamR receptor binding and / or transduction. AAV9 VR-IX encompasses amino acid positions 704-714 and has a role, e.g., in heart tropism, melanoma tropism and / or altered tropism.
[0169] In some embodiments, a rAAV particle disclosed herein is a recombinant AAV (rAAV) particle. In some embodiments, a rAAV particle comprises a variant AAV9 capsid protein comprising a peptide insertion disclosed herein. In some embodiments, a peptide insertion is in any one or all or a combination of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX of a parental AAV capsid protein.
[0170] In some embodiments, a parental AAV capsid protein comprises the sequence of a wildtype AAV capsid protein, or a sequence having at least 95% identity to the sequence of a wildtype AAV capsid protein, or a sequence having no more than 20 mutations (e.g., Page 39 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) substitutions) as compared to the sequence of a wildtype AAV capsid protein. In some embodiments, a parental AAV capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to the sequence of a wildtype AAV capsid protein. In some embodiments, a parental AAV capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to the sequence of a wildtype AAV capsid protein.
[0171] In some embodiments, a parental AAV capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to the sequence of a wildtype AAV capsid protein and one or more mutations, e.g., as disclosed herein.
[0172] In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3, or any combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0173] In some embodiments, a parental AAV capsid protein is other than an AAV9 capsid protein and comprises one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) at a position of VP1, VP2 or VP3 corresponding to position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein.
[0174] In some embodiments, one or more mutations comprises a mutation to an amino acid sequence that is at or near a glycan binding region. In some embodiments, one or more mutations reduces glycan binding. In some embodiments, a glycan is galactose. Page 40 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0175] In some embodiments, one or more modifications is at or between amino acids: (a) 271 and 272 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (b) 446 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (c) 470 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (e) 489 and 545 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (f) 591 and 621 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; or (g) any combination or all of (a)-(f).
[0176] In some embodiments, one or more mutations comprises a mutation at positions: (a) 271 and 272 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (b) 446 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (c) 470 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2 or VP3 of an AAV9 capsid protein; (e) 489 and 545 of a VP1, VP2, or VP3 of an AAV9 capsid protein; (f) 591 and 621 of a VP1, VP2 or VP3 of an AAV9 capsid protein; or (g) any combination or all of (a)-(f).
[0177] In some embodiments, a parental AAV capsid protein comprises an AAV9 capsid protein, an AAV1 capsid protein, an AAV2 capsid protein, an AAV3B capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVhu68 capsid protein, or an AAVrh10 capsid protein.
[0178] In some embodiments, a parental AAV capsid protein comprises: an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises: the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at Page 41 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001.
[0179] In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein.
[0180] In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alter a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. Exemplary mutations including liver de-targeting mutations are disclosed in Pulicherla N. et al., (2011) Molecular Therapy volume 19, pages 1070-1078, the entire contents of which are hereby incorporated by reference.
[0181] In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1of an AAV9 capsid protein or the corresponding position in a VP2 or VP3, or any combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de- targeting mutation) comprises a mutation at position 503, e.g., a W503R mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 595, e.g., a W595C mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 457, e.g., a N457H mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 574, e.g., a T574S mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 592, Page 42 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) e.g., a Q592L mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 498, e.g., a N498Y or an N498I mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 602, e.g., a L602F mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 468, e.g., a P468T mutation. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 500, e.g., a E500D mutation.
[0182] In some embodiments, one or more mutations comprises a mutation to an amino acid sequence that is at or near a glycan binding region. In some embodiments, one or more mutations reduces glycan binding. In some embodiments, a glycan is galactose.
[0183] In some embodiments, one or more modifications is at or between amino acids: (a) 271 and 272 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (b) 446 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (c) 470 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (e) 489 and 545 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (f) 591 and 621 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; or (g) any combination or all of (a)-(f).
[0184] In some embodiments, one or more mutations comprises a mutation at positions: (a) 271 and 272 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (b) 446 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (c) 470 of a VP1, VP2 or VP3 of an AAV9 capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2 or VP3 of an AAV9 capsid protein; (e) 489 and 545 of a VP1, VP2 or VP3 of an Page 43 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) AAV9 capsid protein; (f) 591 and 621 of a VP1, VP2 or VP3 of an AAV9 capsid protein; or (g) any combination or all of (a)-(f).
[0185] In some embodiments, a parental AAV capsid protein comprises: an AAV1 capsid protein. In some embodiments, an AAV1 capsid protein sequence is provided in SEQ ID NO: 2002.
[0186] In some embodiments, a parental AAV capsid protein comprises: an AAV2 capsid protein. In some embodiments, an AAV2 capsid protein sequence is provided in SEQ ID NO: 2003.
[0187] In some embodiments, a parental AAV capsid protein comprises: an AAV3B capsid protein. In some embodiments, an AAV3B capsid protein sequence is provided in SEQ ID NO: 2010.
[0188] In some embodiments, a parental AAV capsid protein comprises an AAV4 capsid protein. In some embodiments, an AAV4 capsid protein sequence is provided in SEQ ID NO: 2051.
[0189] In some embodiments, a parental AAV capsid protein comprises: an AAV5 capsid protein. In some embodiments, an AAV5 capsid protein sequence is provided in SEQ ID NO: 2004.
[0190] In some embodiments, a parental AAV capsid protein comprises: an AAV6 capsid protein. In some embodiments, an AAV6 capsid protein sequence is provided in SEQ ID NO: 2005.
[0191] In some embodiments, a parental AAV capsid protein comprises an AAV7 capsid protein. In some embodiments, an AAV7 capsid protein sequence is provided in SEQ ID NO: 2052.
[0192] In some embodiments, a parental AAV capsid protein comprises: an AAV8 capsid protein. In some embodiments, an AAV8 capsid protein sequence is provided in SEQ ID NO: 2006. Page 44 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0193] In some embodiments, a parental AAV capsid protein comprises an AAV10 capsid protein. In some embodiments, an AAV10 capsid protein sequence is provided in SEQ ID NO: 2053.
[0194] In some embodiments, a parental AAV capsid protein comprises an AAV11 capsid protein. In some embodiments, an AAV11 capsid protein sequence is provided in SEQ ID NO: 2054.
[0195] In some embodiments, a parental AAV capsid protein comprises an AAV12 capsid protein. In some embodiments, an AAV12 capsid protein sequence is provided in SEQ ID NO: 2055.
[0196] In some embodiments, a parental AAV capsid protein comprises an AAV13 capsid protein. In some embodiments, an AAV13 capsid protein sequence is provided in SEQ ID NO: 2056.
[0197] In some embodiments, a parental AAV capsid protein comprises an AAVhu68 capsid protein. In some embodiments, an AAVhu68 capsid protein sequence is provided in SEQ ID NO: 2057.
[0198] In some embodiments, a parental AAV capsid protein comprises an AAVrh10 capsid protein. In some embodiments, an AAVrh10 capsid protein sequence is provided in SEQ ID NO: 2058.
[0199] In some embodiments, a peptide insertion is in VR-I of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0200] In some embodiments, a peptide insertion is in VR-II of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0201] In some embodiments, a peptide insertion is in VR-III of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10. Page 45 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0202] In some embodiments, a peptide insertion is in VR-IV of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0203] In some embodiments, a peptide insertion is in VR-V of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0204] In some embodiments, a peptide insertion is in VR-VI of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0205] In some embodiments, a peptide insertion is in VR-VII of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0206] In some embodiments, a peptide insertion is in VR-VIII of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0207] In some embodiments, a peptide insertion is in VR-IX of a parental AAV capsid protein, e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.
[0208] In some embodiments, a parental AAV capsid protein is chosen from an AAV9, AAV1, AAV2, AAV3B, AAV5, AAV6 or AAV8 capsid protein, and VR-VIII comprises amino acids 580 to 601 of a VP1, VP2 or VP3 of an AAV9 capsid protein or the corresponding positions in the capsid proteins of another parental AAV capsid protein, e.g., an AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10capsid protein.
[0209] In some embodiments, a parental AAV capsid protein is an AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of a VP1, VP2 or VP3 of an AAV9 capsid protein.
[0210] In some embodiments, a peptide insertion is in a VP (e.g., VP1, VP2, and / or VP3) of a parental AAV capsid protein. Page 46 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0211] In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of a VP1, VP2 or VP3 of a parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).
[0212] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1, VP2 or VP3 of an AAV9 capsid protein.
[0213] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1 and VP2 of an AAV9 capsid protein.
[0214] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1 and VP3 of an AAV9 capsid protein.
[0215] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP2 and VP3 of an AAV9 capsid protein.
[0216] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1, VP2 and VP3 of an AAV9 capsid protein.
[0217] In some embodiments, a peptide insertion site is located between two adjacent amino acids in VR-VIII of a parental AAV capsid protein.
[0218] In some embodiments, a peptide insertion site is located between two non- adjacent amino acids in VR-VIII of a parental AAV capsid protein.
[0219] In some embodiments, insertion of a heterologous peptide replaces a contiguous stretch of amino acids of a parental AAV capsid protein.
[0220] In some embodiments, insertion of a heterologous peptide does not replace a contiguous stretch of amino acids of a parental AAV capsid protein.
[0221] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV9 capsid protein, e.g., as compared to a WT AAV9 capsid protein. In some embodiments, an AAV9 WT capsid protein sequence is provided in SEQ ID NO: 2001. In some embodiments, a variant AAV9 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV9 capsid protein. Page 47 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0222] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV1 capsid protein, e.g., as compared to a WT AAV1 capsid protein. In some embodiments, an AAV1 WT capsid protein is provided in SEQ ID NO: 2002. In some embodiments, a variant AAV1 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV1 capsid.
[0223] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV2 capsid protein, e.g., as compared to a WT AAV2 capsid protein. In some embodiments, an AAV2 WT capsid protein is provided in SEQ ID NO: 2003. In some embodiments, a variant AAV2 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV2 capsid protein.
[0224] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV3B capsid protein, e.g., as compared to a WT AAV3B capsid protein. In some embodiments, an AAV3B WT capsid protein is provided in SEQ ID NO: 2010. In some embodiments, a variant AAV3B capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV3B capsid protein.
[0225] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV5 capsid protein, e.g., as compared to a WT AAV5 capsid protein. In some embodiments, an AAV5 WT capsid protein is provided in SEQ ID NO: 2004. In some embodiments, a variant AAV5 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV5 capsid protein.
[0226] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV6 capsid protein, e.g., as compared to a WT AAV6 capsid protein. In some embodiments, an AAV6 WT capsid protein is provided in SEQ ID NO: 2005. In some embodiments, a variant AAV6 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV6 capsid protein. Page 48 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0227] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV8 capsid protein, e.g., as compared to a WT AAV8 capsid protein. In some embodiments, an AAV8 WT capsid protein is provided in SEQ ID NO: 2006. In some embodiments, a variant AAV8 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV8 capsid protein.
[0228] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV4 capsid protein, e.g., as compared to a WT AAV4 capsid protein. In some embodiments, an AAV4 WT capsid protein is provided in SEQ ID NO: 2051. In some embodiments, a variant AAV4 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV4 capsid protein.
[0229] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV7 capsid protein, e.g., as compared to a WT AAV7 capsid protein. In some embodiments, an AAV7 WT capsid protein is provided in SEQ ID NO: 2052. In some embodiments, a variant AAV7 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV7 capsid protein.
[0230] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV10 capsid protein, e.g., as compared to a WT AAV10 capsid protein. In some embodiments, an AAV10 WT capsid protein is provided in SEQ ID NO: 2053. In some embodiments, a variant AAV10 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV10 capsid protein.
[0231] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV11 capsid protein, e.g., as compared to a WT AAV11 capsid protein. In some embodiments, an AAV11 WT capsid protein is provided in SEQ ID NO: 2054. In some embodiments, a variant AAV11 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV11 capsid protein. Page 49 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0232] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV12 capsid protein, e.g., as compared to a WT AAV12 capsid protein. In some embodiments, an AAV12 WT capsid protein is provided in SEQ ID NO: 2055. In some embodiments, a variant AAV12 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV12 capsid protein.
[0233] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV13 capsid protein, e.g., as compared to a WT AAV13 capsid protein. In some embodiments, an AAV13 WT capsid protein is provided in SEQ ID NO: 2056. In some embodiments, a variant AAV13 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAV13 capsid protein.
[0234] In some embodiments, a rAAV particle disclosed herein comprises a variant AAVhu68 capsid protein, e.g., as compared to a WT AAVhu68 capsid protein. In some embodiments, an AAVhu68 WT capsid protein is provided in SEQ ID NO: 2057. In some embodiments, a variant AAVhu68 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAVhu68 capsid protein.
[0235] In some embodiments, a rAAV particle disclosed herein comprises a variant AAVrh10 capsid protein, e.g., as compared to a WT AAVrh10 capsid protein. In some embodiments, an AAVrh10 WT capsid protein is provided in SEQ ID NO: 2058. In some embodiments, a variant AAVrh10 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity relative to a WT AAVrh10 capsid protein.
[0236] Additional modifications to an AAV9 capsid protein (not including peptide insertions disclosed herein) are possible including, for example, variants disclosed in International Patent Application WO 2003 / 052052 filed on November 12, 2002, the entire contents of which are hereby incorporated by reference. In some embodiments, a rAAV particle disclosed herein comprises a variant AAV9 capsid comprising a peptide insertion disclosed herein and one or more AAV9 capsid modifications disclosed in WO 2003 / 052052. Page 50 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0237] Several other reports disclose modifications to an AAV9 capsid protein, including: Pulicherla N. et al., (2011) Mol Ther.19(6): pp.1070–1078; Wang D. et al., (2018) Mol Ther Methods Clin Dev. (9): pp.234-246; Adachi K. et al., (2014) Nat. Comm. (5): art. 3075; or Bell CL. et al., (2012) J Virol.86(13): pp.7326–7333, the entire contents each of which are hereby incorporated by reference. In some embodiments, a rAAV particle disclosed herein comprises a variant AAV9 capsid comprising a peptide insertion disclosed herein and one or more AAV9 capsid modifications disclosed in any of the reports referenced herein. Variant AAV9 capsid proteins with peptide insertion
[0238] Among other things, disclosed herein, are AAV9 capsid protein variants having one or more peptide insertions, e.g., as disclosed herein.
[0239] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV9 capsid protein comprising a peptide insertion disclosed herein.
[0240] In some embodiments, a peptide insertion is in any one or all or a combination of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX of an AAV9 capsid protein.
[0241] In some embodiments, a peptide insertion is in VR-I of an AAV9 capsid protein.
[0242] In some embodiments, a peptide insertion is in VR-II of an AAV9 capsid protein.
[0243] In some embodiments, a peptide insertion is in VR-III of an AAV9 capsid protein.
[0244] In some embodiments, a peptide insertion is in VR-IV of an AAV9 capsid protein.
[0245] In some embodiments, a peptide insertion is in VR-V of an AAV9 capsid protein.
[0246] In some embodiments, a peptide insertion is in VR-VI of an AAV9 capsid protein.
[0247] In some embodiments, a peptide insertion is in VR-VII of an AAV9 capsid protein. Page 51 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0248] In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein.
[0249] In some embodiments, VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 580 to 601 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 580-585, amino acids 585-590, amino acids 590-595, or amino acids 595-601 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 580-581, between amino acids 581-582, between amino acids 582- 583, between amino acids 583-584, between amino acids 584-585, between amino acids 585- 586, between amino acids 586-587, between amino acids 587-588, between amino acids 588- 589, between amino acids 589-590, between amino acids 590-591, between amino acids 591- 592, between amino acids 592-593, between amino acids 593-594, between amino acids 594- 595, between amino acids 595-596, between amino acids 596-597, between amino acids 597- 598, between amino acids 598-599, between amino acids 599-600, or between amino acids 600- 601 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0250] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1 of an AAV9 capsid protein. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP2 of an AAV9 capsid protein. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP3 of an AAV9 capsid protein.
[0251] In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1 and VP2 of an AAV9 capsid protein In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP2 and VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1 and VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of a VP1, VP2 and VP3 of an AAV9 capsid protein. Page 52 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0252] In some embodiments, a peptide insertion site is located between two adjacent amino acids in VR-VIII of an AAV9 capsid protein.
[0253] In some embodiments, a peptide insertion site is located between two non- adjacent amino acids in VR-VIII of an AAV9 capsid protein.
[0254] In some embodiments, a peptide insertion is in VR-IX of an AAV9 capsid protein.
[0255] In some embodiments, a peptide insertion is in VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0256] In some embodiments, insertion of a heterologous peptide replaces a contiguous stretch of amino acids of a parental AAV capsid protein, e.g., an AAV9 parental capsid protein.
[0257] In some embodiments, insertion of a heterologous peptide does not replace a contiguous stretch of amino acids of a parental AAV capsid protein, e.g., an AAV9 parental capsid protein.
[0258] In some embodiments, a recombinant AAV particle (rAAV) disclosed herein comprises a variant AAV9 capsid protein comprising a peptide insertion disclosed herein, and one or more sequences of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0259] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide provided in any one of Tables 1-3. In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising any one of the peptides provided in Table 1. In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising any one of the peptides provided in Table 2. In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising any one of the peptides provided in Table 3.
[0260] In some embodiments, a rAAV particle disclosed herein comprises: (1) a variant AAV9 capsid protein comprising any one of the peptides provided in any one of Tables 1-3; and (2) one or more sequences of a VP (e.g., VP1, VP2, and / or VP3) of an AAV9 capsid protein. In some embodiments, a rAAV particle disclosed herein comprises: (1) a variant AAV9 capsid protein comprising any one of the peptides provided in Table 1; and (2) one or more sequences Page 53 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) of a VP (e.g., VP1, VP2, and / or VP3) of an AAV9 capsid protein. In some embodiments, a rAAV particle disclosed herein comprises: (1) a variant AAV9 capsid protein comprising any one of the peptides provided in Table 2; and (2) one or more sequences of a VP (e.g., VP1, VP2, and / or VP3) of an AAV9 capsid protein. In some embodiments, a rAAV particle disclosed herein comprises: (1) a variant AAV9 capsid protein comprising any one of the peptides provided in Table 3; and (2) one or more sequences of a VP (e.g., VP1, VP2, and / or VP3) of an AAV9 capsid protein.
[0261] In some embodiments, a rAAV particle disclosed herein comprising a variant AAV (e.g., AAV9) capsid protein comprising a peptide provided in any one of Tables 1-3 has an at least 1.5 fold enhanced CNS transduction compared to a rAAV particle comprising a corresponding parental AAV (e.g., AAV9) capsid protein, e.g., without a peptide insertion.
[0262] In some embodiments, a rAAV particle disclosed herein comprising a variant AAV (e.g., AAV9) capsid protein comprising a peptide provided in any one of Tables 1-3 can be useful for CNS-targeting, e.g., targeting a rAAV particle comprising a variant AAV (e.g., AAV9) capsid protein to a CNS cell and / or tissue.
[0263] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein does not comprise an additional sequence N-terminal of a peptide sequence provided in any one of Tables 1-4.
[0264] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein does not comprise an additional sequence C-terminal of a peptide sequence provided in any one of Tables 1-4.
[0265] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein does not comprise an additional sequence N-terminal and C-terminal of a peptide sequence provided in any one of Tables 1-4.
[0266] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises an additional sequence (e.g., 1, 2, 3, 4, or 5 amino acids) N-terminal of a peptide sequence provided in any one of Tables 1-4. Page 54 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0267] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises an additional sequence (e.g., 1, 2, 3, 4, or 5 amino acids) C-terminal of a peptide sequence provided in any one of Tables 1-4.
[0268] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises an additional sequence (e.g., 1, 2, 3, 4, or 5 amino acids) N-terminal and C-terminal of a peptide sequence provided in any one of Tables 1-4. Table 1: Exemplary peptide insertions in VR-VIII Enhanced Enhanced Enhanced Sum of transduction transduction transduction promoters nPage 55 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Enhanced Enhanced Enhanced Sum of transduction transduction transduction promoters nPage 56 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0269] For Tables 1 and 2, “1” in the third, fourth, and fifth columns indicate peptides inserted in AAV9 VR-VIII that had enhanced transduction of NHP CNS cells as compared to WT AAV9, with the specified promoters. Marking of “0” indicates the absence of enhanced transduction of NHP CNS cells as compared to WT AAV9, with the specified promoters. For the different promoters, all peptides with a “1” in Table 1 when inserted in AAV9 VR-VIII had a fold-transduction of >2.94 fold in NHP CNS cells as compared to transduction of NHP CNS cells with WT AAV9. Table 3: Additional exemplary peptide insertions in VR-VIII Peptide SEQ ID NO TQHGVYI 47
[0270] For all of thenserted in VR-VIII of AAV9, a more than 5-fold enhanced CNS transduction compared to parental AAV9 was observed. Page 57 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0271] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 75 (TTMGVYI).
[0272] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 75 (TTMGVYI).
[0273] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 47 (TQHGVYI).
[0274] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 47 (TQHGVYI).
[0275] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 72 (RNGAVFI).
[0276] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 72 (RNGAVFI).
[0277] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 61 (KREGIFI).
[0278] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 61 (KREGIFI).
[0279] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 69 (QSLPTVL).
[0280] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 69 (QSLPTVL).
[0281] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 76 (VITSGLK).
[0282] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 76 (VITSGLK).
[0283] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 73 (TLVDNMR). Page 58 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0284] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 73 (TLVDNMR).
[0285] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 63 (NNAGVYI).
[0286] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 63 (NNAGVYI).
[0287] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 66 (PPVGVSR).
[0288] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 66 (PPVGVSR).
[0289] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 65 (PHVVAPV).
[0290] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 65 (PHVVAPV).
[0291] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 60 (KQMPPGL).
[0292] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 60 (KQMPPGL).
[0293] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 58 (IMVSTVR).
[0294] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 58 (IMVSTVR).
[0295] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 68 (QLTVEPK).
[0296] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 68 (QLTVEPK). Page 59 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0297] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 67 (PQPGTMR).
[0298] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 67 (PQPGTMR).
[0299] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 71 (RGGVVYI).
[0300] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 71 (RGGVVYI).
[0301] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 62 (NMHGVYI).
[0302] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 62 (NMHGVYI).
[0303] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 70 (RGGQVFI).
[0304] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 70 (RGGQVFI).
[0305] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 64 (NQMGVFI).
[0306] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 64 (NQMGVFI).
[0307] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 18 (KGGQVYI).
[0308] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 18 (KGGQVYI).
[0309] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 24 (NNQGVYI). Page 60 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0310] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 24 (NNQGVYI).
[0311] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 44 (TNHGVYI).
[0312] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 44 (TNHGVYI).
[0313] In some embodiments, a peptide insertion is in VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, a peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0314] In some embodiments, a peptide insertion comprises a sequence of TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0315] In some embodiments, a peptide insertion consists of the sequence of TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein.
[0316] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3and X4 are independently any amino acid, and X5 is Y, W or F. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77), wherein X1, X2, X3and X4are independently any amino acid. In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78), wherein X1, X2, X3 and X4 are independently any amino acid.
[0317] In some embodiments, a peptide insertion comprises a sequence provided in Table 2 or Table 4. Table 2: Exemplary peptides encompassed by SEQ ID NO: 1 Peptide SEQ ID NO12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Peptide SEQ ID NO
[0318] In some emb ant AAV capsid proteindisclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1is I, K, N, T, or R; and X2, X3and X4are independently any amino acid.
[0319] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X2is P, G, N, Q, M or T; and X1, X3and X4are independently any amino acid.
[0320] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X3 is Q, G, H, A or M; and X1, X2 and X4 are independently any amino acid.
[0321] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X4 is G, Q, A, or V; and X1, X2 and X3 are independently any amino acid.
[0322] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI Page 62 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) (SEQ ID NO: 78) where X1is I, K, N, T, or R; X2is P, G, N, Q, M or T; and X3and X4are independently any amino acid.
[0323] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, T, or R; X2 is any amino acid; X3 is Q, G, H, A or M; and X4 is any amino acid.
[0324] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, T, or R; X2 and X3 are independently any amino acid; and X4is G, Q, A, or V.
[0325] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is any amino acid; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4is any amino acid.
[0326] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1and X2are independently any amino acid; X3is Q, G, H, A or M; and X4 is G, Q, A, or V.
[0327] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1is I, K, N, T, or R; X2is P, G, N, Q, M or T; X3is Q, G, H, A or M; and X4 is any amino acid.
[0328] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, T, or R; X2 is P, G, N, Q, M or T; X3 is any amino acid; and X4 is G, Q, A, or V.
[0329] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI Page 63 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) (SEQ ID NO: 78) where X1is I, K, N, T, or R; X2is any amino acid; X3is Q, G, H, A or M; and X4 is G, Q, A, or V.
[0330] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is any amino acid; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4 is G, Q, A, or V.
[0331] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, T, or R; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4is G, Q, A, or V.
[0332] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 14 (IPQGVYI).
[0333] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 14 (IPQGVYI).
[0334] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 18 (KGGQVYI).
[0335] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 18 (KGGQVYI).
[0336] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 24 (NNQGVYI).
[0337] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 24 (NNQGVYI).
[0338] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 44 (TNHGVYI).
[0339] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 47 (TQHGVYI). Page 64 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0340] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: SEQ ID NO: 47 (TQHGVYI).
[0341] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 72 (RNGAVFI).
[0342] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 72 (RNGAVFI).
[0343] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 63 (NNAGVYI).
[0344] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 63 (NNAGVYI).
[0345] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 71 (RGGVVYI).
[0346] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 71 (RGGVVYI).
[0347] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 62 (NMHGVYI).
[0348] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 62 (NMHGVYI).
[0349] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 70 (RGGQVFI).
[0350] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 70 (RGGQVFI).
[0351] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 64 (NQMGVFI).
[0352] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 64 (NQMGVFI). Page 65 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0353] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 75 (TTMGVYI).
[0354] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 75 (TTMGVYI). Table 4: Certain exemplary peptides encompassed by SEQ ID NO: 1 Peptide SEQ Enhanced Enhanced Enhanced Sum of ID NO transduction transduction transduction promoters ndisclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1is I, K, N, or T; and X2, X3 and X4 are independently any amino acid.
[0356] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X2is P, G, N, or Q; and X1, X3 and X4 are independently any amino acid.
[0357] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X3is Q, G or H; and X1, X2 and X4 are independently any amino acid.
[0358] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X4is G or Q; and X1, X2and X3are independently any amino acid.
[0359] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, or T; X2is P, G, N, or Q; and X3and X4are independently any amino acid. Page 66 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0360] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, or T; X2 is any amino acid; X3 is Q, G or H; and X4 is any amino acid.
[0361] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, or T; X2 and X3 are independently any amino acid; and X4 is G or Q.
[0362] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is any amino acid; X2 is P, G, N, or Q; X3 is Q, G or H; and X4 is any amino acid.
[0363] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1and X2are independently any amino acid; X3 is Q, G or H; and X4 is G or Q.
[0364] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) X1is I, K, N, or T; X2 is P, G, N, or Q; X3 is Q, G or H; and X4 is any amino acid.
[0365] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) X1is I, K, N, or T; X2 is any amino acid; X3 is Q, G or H; and X4 is G or Q.
[0366] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) X1is I, K, N, or T; X2is P, G, N, or Q; X3is any amino acid; and X4is G or Q.
[0367] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is any amino acid; X2is P, G, N, or Q; X3is Q, G or H; and X4is G or Q.
[0368] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78) where X1 is I, K, N, or T; X2is P, G, N, or Q; X3is Q, G or H; and X4is G or Q. Page 67 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0369] In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein comprises a sequence of SEQ ID NO: 4 (AYALPKG). In some embodiments, a peptide insertion in a variant AAV capsid protein disclosed herein consists of a sequence of SEQ ID NO: 4 (AYALPKG).
[0370] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV9 capsid comprising a peptide insertion disclosed in any one of Tables 1-3 and one or more modifications to an amino acid sequence flanking the peptide insertion site. In some embodiments, one or more modifications are within about 10, e.g., within about 5 amino acids upstream or downstream of the location of the peptide insertion site.
[0371] In some embodiments, one or more modifications comprises an insertion, deletion, mutation, or a combination thereof.
[0372] In some embodiments, a variant AAV capsid protein further comprises one or more modifications to an amino acid sequence that is at or near a glycan binding region. In some embodiments, one or more modifications reduces glycan binding. In some embodiments, a glycan is galactose.
[0373] In some embodiments, one or more modifications is at or between amino acids: (a) 271 and 272 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (b) 446 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (c) 470 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (e) 489 and 545 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; (f) 591 and 621 of a VP1, VP2, or VP3 of an AAV9 capsid protein or a corresponding position in a capsid protein of another parental AAV capsid protein; or (g) any combination or all of (a)-(f). Page 68 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Exemplary capsid variants with peptide insertions in VR-VIII
[0374] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises any one of the peptide insertions disclosed herein; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein.
[0375] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a peptide insertion provided in Table 1; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to Page 69 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0376] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a peptide insertion provided in Table 2; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to Page 70 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0377] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a peptide insertion provided in Table 3; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to Page 71 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0378] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3and X4are independently any amino acid, and X5is Y, W or F; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR- VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a Page 72 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0379] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a sequence of X1X2X3X4V[Y / F]I (SEQ ID NO: 77), wherein X1, X2, X3 and X4 are independently any amino acid; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In Page 73 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0380] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a sequence of X1X2X3X4VYI (SEQ ID NO: 78), wherein X1, X2, X3 and X4 are independently any amino acid; (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In Page 74 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation.
[0381] In some embodiments, a rAAV particle disclosed herein comprises a variant AAV capsid protein comprising a peptide insertion relative to a parental AAV capsid protein. In some embodiments, (1) a peptide insertion comprises a sequence of TTMGVYI (SEQ ID NO: 1551); (2) a peptide insertion site is in a VR-VIII of a parental AAV capsid protein; and (3) a parental AAV capsid protein comprises an AAV9 capsid protein. In some embodiments, a peptide insertion consists of the sequence of TTMGVYI (SEQ ID NO: 1551). In some embodiments, a peptide insertion is in VR-VIII of an AAV9 capsid protein. In some embodiments, a VR-VIII of an AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2 or VP3. In some embodiments, a peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of an AAV9 capsid protein. In some embodiments, an AAV9 capsid protein comprises the sequence of a wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity to SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) as compared to SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, an AAV9 capsid protein comprises a sequence having at least 95% identity (e.g., at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 99.5% identity) to SEQ Page 75 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) ID NO: 2001, and one or more mutations, e.g., as disclosed herein. In some embodiments, one or more mutations comprises a mutation that alters a binding profile of a parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein comprises a mutation that reduces binding to one or more tissues such as liver tissue, e.g., a liver-detargeting mutation. In some embodiments, one or more mutations that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a mutation at position 503, 595, 457, 574, 592, 498, 602, 468, or 500 of a VP1 of an AAV9 capsid protein or the corresponding position in a VP2 or VP3 protein or a combination thereof. In some embodiments, a mutation that alters a binding profile of a parental AAV capsid protein (e.g., a liver de-targeting mutation) comprises a W503R mutation. Characterization of variant AAV capsid proteins
[0382] A variant AAV capsid protein disclosed herein can have enhanced CNS-tropism. In some embodiments, a variant AAV capsid protein can be present in a rAAV particle. In some embodiments, a rAAV particle comprising a variant AAV capsid protein disclosed herein is characterized in that when administered to a cell or tissue or subject, a variant AAV capsid protein confers increased infectivity and / or transduction of a CNS cell or tissue compared to infectivity and / or transduction of a CNS cell or tissue by a control AAV particle comprising a corresponding parental AAV capsid protein.
[0383] In some embodiments, a CNS cell comprises a CNS connective tissue cell. In some embodiments, a CNS connective tissue cell comprises fat cells or meninges cells, or both. In some embodiments, a CNS cell comprises a stem cell or progenitor cell. In some embodiments, a stem cell comprises a neural stem cell. In some embodiments, a CNS cell comprises a cell that lines one or more brain ventricles. In some embodiments, a CNS cell comprises a meninges cell. In some embodiments, a CNS cell comprises a fat cell.
[0384] In some embodiments, a CNS tissue comprises tissue found in: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord. In some Page 76 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) embodiments, CNS tissue comprises tissue found in a frontal cortex, a parietal cortex, an occipital cortex, a temporal cortex or combinations thereof.
[0385] In some embodiments, a rAAV particle comprising a variant AAV capsid protein confers at least 1.5-fold, at least 2-fold, 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, or at least 70-fold increased infectivity and / or transduction of a CNS cell or tissue compared to infectivity and / or transduction of a CNS cell or tissue by a control AAV particle comprising a corresponding parental AAV capsid protein.
[0386] In some embodiments, a rAAV particle comprising a variant AAV capsid protein confers about 1.5-fold, about 2-fold, 2.5-fold, about 3-fold, about 4-fold, about 5-fold, about 6- fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, or about 70-fold increased infectivity and / or transduction of a CNS cell or tissue compared to infectivity and / or transduction of a CNS cell or tissue by a control AAV particle comprising a corresponding parental AAV capsid protein.
[0387] In some embodiments, a variant AAV capsid protein is an AAV9 variant capsid protein.
[0388] In some embodiments, a rAAV particle comprising a variant AAV capsid protein disclosed herein and a heterologous nucleic acid comprising a nucleotide sequence encoding a payload is characterized in that when administered to a cell or tissue or subject, delivery of a payload is enhanced to a CNS cell or tissue as compared to delivery of a similar payload with an otherwise similar AAV particle without a variant AAV capsid protein disclosed herein.
[0389] In some embodiments, a CNS cell comprises a CNS connective tissue cell. In some embodiments, a CNS connective tissue cell comprises fat cells or meninges cells, or both. In some embodiments, a CNS cell comprises a stem cell or progenitor cell. In some embodiments, a stem cell comprises a neural stem cell. In some embodiments, a CNS cell comprises a cell that lines one or more brain ventricles. In some embodiments, a CNS cell comprises a meninges cell. In some embodiments, a CNS cell comprises a fat cell. Page 77 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0390] In some embodiments, a CNS tissue comprises tissue found in: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord. In some embodiments, CNS tissue comprises tissue found in a frontal cortex, a parietal cortex, an occipital cortex, a temporal cortex or combinations thereof.
[0391] In some embodiments, a rAAV particle comprising a variant AAV capsid protein disclosed herein is characterized in that when administered to a cell or tissue or subject, increased expression of a payload is observed compared to expression of a similar payload with an otherwise similar AAV particle without a variant AAV capsid protein disclosed herein. In some embodiments, expression of a payload is increased by at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at-least 60-fold, at-least 70-fold, at-least 80-fold, at-least 90-fold, or at- least 100-fold.
[0392] In some embodiments, expression of a payload is increased by about 1.5-fold, about 2-fold, about 2.5-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40- fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or about 100-fold.
[0393] In some embodiments, expression of a payload is increased by about 1.5-fold to about 100-fold, about 1.5-fold to about 90-fold, about 1.5-fold to about 80-fold, about 1.5-fold to about 70-fold, about 1.5-fold to about 60-fold, about 1.5-fold to about 50-fold, about 1.5-fold to about 40-fold, about 1.5-fold to about 30-fold, about 1.5-fold to about 20-fold, about 1.5-fold to about 15-fold, about 1.5-fold to about 10-fold, about 1.5-fold to about 9-fold, about 1.5-fold to about 8-fold, about 1.5-fold to about 7-fold, about 1.5-fold to about 6-fold, about 1.5-fold to about 5-fold, about 1.5-fold to about 4-fold, about 1.5-fold to about 3-fold, about 1.5-fold to about 2-fold, about 2-fold to about 100-fold, about 3-fold to about 100-fold, about 4-fold to about 100-fold, about 5-fold to about 100-fold, about 6-fold to about 100-fold, about 7-fold to about 100-fold, about 8-fold to about 100-fold, about 9-fold to about 100-fold, about 10-fold to about 100-fold, about 15-fold to about 100-fold, about 20-fold to about 100-fold, about 30-fold to about 100-fold, about 40-fold to about 100-fold, about 50-fold to about 100-fold, about 60- Page 78 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) fold to about 100-fold, about 70-fold to about 100-fold, about 80-fold to about 100-fold, about 90-fold to about 100-fold. CNS cells and / or tissues for delivering AAV particles comprising variant AAV capsid proteins
[0394] Disclosed herein are variant AAV capsid proteins which have enhanced tropism to CNS cells and / or tissue. In some embodiments, variant AAV capsid proteins disclosed herein can be used for targeting CNS cells and / or tissue. In some embodiments, a CNS cell or tissue is chosen from: a CNS epithelial cell, a nerve cell, a CNS connective tissue cell, a stem cell, a progenitor cell, a CNS immune cell, a spinal cord cell, a cell that lines one or more brain ventricles, a nerve support cell, a glial cell, a fat cell, a meninges cell, or combinations thereof.
[0395] In some embodiments, a CNS cell comprises a CNS epithelial cell. In some embodiments, a CNS epithelial cell comprises a cell that lines one or more brain ventricles.
[0396] In some embodiments, a CNS cell comprises a nerve cell (neuron). In some embodiments, a neuron comprises a unipolar neuron, a bipolar neuron, a pseudounipolar neuron, a multipolar neuron, or combinations thereof. In some embodiments, a neuron is a motor neuron, a sensory neuron, an interneuron, an excitatory neuron, an inhibitor neuron, a sympathetic neuron, a parasympathetic neuron, or combinations thereof. In some embodiments, a neuron comprises a pyramidal neuron, a dopaminergic neuron, a cholinergic neuron, an adrenergic neuron, a GABAergic neuron, a glutamatergic neuron, a serotonergic neuron, a purinergic neuron, a histaminergic neuron, a lower motor neuron, or combinations thereof.
[0397] In some embodiments, a nerve cell (neuron) comprises nerve support cells. In some embodiments, nerve support cells comprise glial cells. In some embodiments, glial cells comprise astrocytes, microglial cells, ependymal cells, oligodendrocytes, Schwann cells, or combinations thereof.
[0398] In some embodiments, a CNS cell comprises a CNS connective tissue cell. In some embodiments, a CNS connective tissue cell comprises fat cells or meninges cells, or both.
[0399] In some embodiments, a CNS cell comprises a stem cell or progenitor cell. In some embodiments, a stem cell comprises a neural stem cell. Page 79 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0400] In some embodiments, a CNS cell comprises a cell that lines one or more brain ventricles.
[0401] In some embodiments, a CNS cell comprises a meninges cell.
[0402] In some embodiments, a CNS cell comprises a fat cell.
[0403] In some embodiments, a CNS tissue comprises tissue found in: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord.
[0404] In some embodiments, CNS tissue comprises tissue found in a frontal cortex, a parietal cortex, an occipital cortex, a temporal cortex or combinations thereof. Payloads for use in AAV particles comprising a variant AAV capsid protein
[0405] A rAAV particle comprising a variant AAV capsid protein disclosed herein can also comprise a heterologous nucleic acid sequence comprising a nucleotide sequence encoding a payload.
[0406] In some embodiments, a payload is or comprises a polypeptide, e.g, encoded by a nucleic acid sequence within an rAAV particle. In some embodiments, a payload polypeptide is chosen from: a CRISPR-Cas protein, a Zinc finger protein, a TAL, a base editor, a prime editor, a meganuclease, or any combination thereof.
[0407] In some embodiments, a polypeptide is or comprises a CRISPR-Cas protein. In some embodiments, a CRISPR-Cas protein is chosen from: a Type II, Type V or Type VI CRISPR-Cas protein, e.g., a Cas9 protein, a Cas12a protein, a Cas12b protein, a Cas12c protein, a Cas12d protein, a Cas12e protein, a Cas12f protein, a Cas12g protein, a Cas12h protein, a Cas12i protein, a Cas13a protein, a Cas13b protein or a variant or fragment thereof of any of the foregoing. In some embodiments a CRISPR-Cas protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain. In some embodiments a CRISPR-Cas protein is a nuclease. In some embodiment a CRISPR-Cas protein is a nickase and only cleaves one strand of a target nucleic acid molecule. In some embodiment a CRISPR-Cas protein is inactivated and binds to but does not cleave a target nucleic acid molecule. Page 80 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0408] In some embodiments, a polypeptide is or comprises a Zinc finger protein, or a variant or fragment thereof. In some embodiments, a Zinc finger protein is chosen from: a Zinc finger nuclease, an artificial restriction enzyme fusion protein, a sequence-targeted zinc-finger DNA-binding unit optionally fused with a nuclease domain (e.g., Fok1 nuclease domain), or a variant or fragment or combination of any of the foregoing. In some embodiments a Zinc finger protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain.
[0409] In some embodiments, a polypeptide is or comprises a Transcription Activator- Like Effector (TAL) protein, or a variant or fragment thereof. In some embodiments, a TAL comprises: a TAL effector DNA binding domain (e.g., a TAL effector DNA binding domain isolated from Xanthomonas spp.), a Transcription Activator-Like Effector Nuclease (TALEN), e.g., a TAL effector DNA binding domain fused with a nuclease domain (e.g., Fok1 nuclease domain), or a variant or fragment or combination of any of the foregoing. In some embodiments a TAL protein is fused with one or more domains, e.g., an activator domain and / or a repressor domain.
[0410] In some embodiments, a polypeptide is or comprises a base editor, or a variant or fragment thereof. In some embodiments, a base editor comprises a deaminase, an adenosine deaminase enzyme (ABE), a cytosine deaminase enzyme (CBE), an APOBEC1, an APOBEC3A, an APOBEC3G, an evoAPOBEC, a BE4-YE1, a CDA1, an activation-induced cytidine deaminase (AID), a mutant TadA, an adenosine deaminases (TadA*), an E. coli tRNA-specific adenosine deaminase (TadA), a deaminase associated with a DNA binding domain monomer, a base editing enzyme that is RNA guided, a DNA glycosylase inhibitor, one or more DNA glycosylase inhibitor domains, a 5-methylcytosine deaminase, a cytidine deaminase domain, an adenine deaminase domain, an adenosine base editor (ABE), a Target-ACEmax, a synchronous programmable adenine and cytosine editor (SPACE), an A&C-BEmax., a circularly permuted base editor, an adenosine deaminase enzyme (ADAR), a RNA editing for programmable adenosine to inosine replacement (REPAIR), a leveraging endogenous ADAR for programmable editing of RNA (LEAPER) or a variant or fragment or combination of any of the foregoing. In some embodiments, the payload also comprises a guide RNA, gRNA, sgRNA, or crRNA / tracrNA that interacts with the base editor. Page 81 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0411] In some embodiments, a polypeptide is or comprises a prime editor, or a variant or fragment thereof, or a system comprising the same. In some embodiments, a prime editor and / or system comprising the same comprises: a reverse transcriptase, a prime editing enzyme, an editing enzyme that includes a reverse transcriptase domain, an Avian Myeloblastosis Virus (AMV) Reverse Transcriptase, a Murine Leukemia Virus (MLV) Reverse Transcriptase, a HIV- 1 reverse transcriptase, a bacterial reverse transcriptase, a reverse transcriptase associated with a DNA binding domain and / or protein, a reverse transcriptase fused to a DNA binding domain that is a catalytically impaired nuclease domain (e.g., a nickase), a prime editing 1 system (PE1), a prime editing 2 system (PE2), a prime editing 3 system (PE3), a prime editing 3b system (PE3b) or a variant or fragment or combination of any of the foregoing. In some embodiments, the payload also comprises a prime editing gRNA (pegRNA) or an extended sgRNA that interacts with the prime editor.
[0412] In some embodiments, a polypeptide is or comprises a meganuclease, or a variant or fragment thereof. In some embodiments, a meganuclease is chosen from: a homing endonuclease, a LAGLIDADG family meganuclease, a GIYYIG family meganuclease, a His- Cyst box family meganuclease, or HNH family endonuclease, an I-SeeI, an I-CeuI, a PI-PspI, a PI-SceI, an I-SceIV, an I-CsmI, an I-PanI, an I-SceII, an I-PpoI, an I-SceIII, an I-CreI, an I-TevI, an I-TevII an I-TevIII or a variant or fragment or combination of any of the foregoing
[0413] In some embodiments, a polypeptide is associated with a CNS disorder. In some embodiments, a CNS disorder is a CNS disorder disclosed herein. In some embodiments, a CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy), or any combination thereof.
[0414] In some embodiments, a polypeptide is an enzyme. In some embodiments, an enzyme is a lysosomal enzyme or an adenosine deaminase enzyme.
[0415] In some embodiments, a polypeptide is an antibody.
[0416] In some embodiments, a polypeptide is a secreted protein. Page 82 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0417] In some embodiments, a payload is or comprises an RNA molecule. In some embodiments, an RNA molecule is an siRNA, a miRNA, a gRNA, antisense RNA, circular RNA, an snRNA or an aptamer, or combinations thereof.
[0418] In some embodiments, a payload is or comprises a DNA molecule. In some embodiments, a DNA molecule comprises a nucleic acid sequence of up to 5,100 nt in length, e.g., up to about 5,000 nt, up to about 4,900, up to about 4,800, up to about 4,700, up to about 4,600, up to about 4,500, up to about 4,400, etc.
[0419] In some embodiments, an RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with a CNS disorder. In some embodiments, a CNS disorder is a CNS disorder disclosed herein. In some embodiments, a CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy), or combinations thereof. Promoters for use in AAV particles comprising a variant AAV capsid protein
[0420] A rAAV particle comprising a variant AAV capsid protein disclosed herein can comprise a heterologous a nucleotide sequence encoding a payload which is operably linked to a promoter, or a variant or a fragment thereof.
[0421] In some embodiments, a promoter is a CNS cell or tissue-specific promoter, or a variant or a fragment thereof. In some embodiments, a CNS promoter is chosen from: a Glial Fibrillary Acidic Protein (GFAP) promoter or a variant or a fragment thereof, a synapsin-1 (SYN1) promoter or a variant or a fragment thereof, a neuron-specific enolase / RU5’ (NSE / RU5’) promoter or a variant or a fragment thereof, a neuroactive peptide cholecystokinin (CCK) promoter or a variant or a fragment thereof, a myelin basic promoter (MBP) or a variant or a fragment thereof, a human myelin associated glycoprotein promoter or a variant or a fragment thereof, a phosphate-activated glutaminase (PAG) promoter or a variant or a fragment thereof, a vesicular glutamate transporter (vGLUT) promoter or a variant or a fragment thereof, a Page 83 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) glutamic acid decarboxylase (GAD) promoter or a variant or a fragment thereof, or any combination thereof.
[0422] In some embodiments, a CNS promoter is a human SYN1 (hSYN1) promoter or a variant or a fragment thereof. An exemplary hSYN1 promoter sequence is provided as SEQ ID NO: 2007.
[0423] AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCT ACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATT GCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCG CACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCC ACCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTC CCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACC ACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGG CGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGA GAGCGCAG (SEQ ID NO: 2007)
[0424] In some embodiments, a CNS promoter is a GFAP promoter or a variant or a fragment thereof. An exemplary GFAP promoter sequence is provided as SEQ ID NO: 2008.
[0425] AACATATCCTGGTGTGGAGTAGGGGACGCTGCTCTGACAGAGGCTCGG GGGCCTGAGCTGGCTCTGTGAGCTGGGGAGGAGGCAGACAGCCAGGCCTTGTCTGC AAGCAGACCTGGCAGCATTGGGCTGGCCGCCCCCCAGGGCCTCCTCTTCATGCCCAG TGAATGACTCACCTTGGCACAGACACAATGTTCGGGGTGGGCACAGTGCCTGCTTCC CGCCGCACCCCAGCCCCCCTCAAATGCCTTCCGAGAAGCCCATTGAGCAGGGGGCTT GCATTGCACCCCAGCCTGACAGCCTGGCATCTTGGGATAAAAGCAGCACAGCCCCC TAGGGGCTGCCCTTGCTGTGTGGCGCCACCGGCGGTGGAGAACAAGGCTCTATTCAG CCTGTGCCCAGGAAAGGGGATCAGGGGATGCCCAGGCATGGACAGTGGGTGGCAGG GGGGGAGAGGAGGGCTGTCTGCTTCCCAGAAGTCCAAGGACACAAATGGGTGAGGG GAGAGCTCTCCCCATAGCTGGGCTGCGGCCCAACCCCACCCCCTCAGGCTATGCCAG GGGGTGTTGCCAGGGGCACCCGGGCATCGCCAGTCTAGCCCACTCCTTCATAAAGCC CTCGCATCCCAGGAGCGAGCAGAGCCAGAGCAGGTTGGAGAGGAGACGCATCACCT CCGCTGCTCGC (SEQ ID NO: 2008) Page 84 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0426] In some embodiments, a CNS promoter is a chicken beta actin hybrid (CBh) promoter or a variant or a fragment thereof. An exemplary CBh promoter sequence is provided as SEQ ID NO: 2009.
[0427] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGA CCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATG GGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCA GTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT ATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCT CCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGC GGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGG CGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAG TTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCG GCGGGCGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCT CGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGG GACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGG ATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCAC TTTTTTTCAG (SEQ ID NO: 2009) Uses of AAV particles comprising a variant AAV capsid protein
[0428] The present disclosure, among other things, provides methods of delivering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein to a cell or tissue, e.g., a CNS cell or tissue. The present disclosure also provides methods of treating a subject with a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles produced using a method or system described herein.
[0429] In some embodiments, disclosed herein is a method for treating a CNS disorder in a subject comprising administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles described herein. Page 85 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0430] In some embodiments, also disclosed herein is a method for amelioration a symptom of a CNS disorder in a subject comprising administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles described herein.
[0431] In some embodiments, a CNS disorder is a result of a genetic abnormality.
[0432] In some embodiments, a CNS disorder is not a result of a genetic abnormality.
[0433] In some embodiments, a CNS disorder is a CNS disorder disclosed herein.
[0434] Exemplary CNS disorders are disclosed in International Patent Application PCT / US2019 / 054345 filed on October 2, 2019, the entire contents of which is hereby incorporated by reference.
[0435] In some embodiments, a CNS disorder is chosen from one or more of: Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies or genetic epilepsies (e.g., a STXBP1 genetic epilepsy, or a CDKL5 genetic epilepsy). In some embodiments, a CNS disorder is chosen from one or more of: (a) neuro- muscular disease, e.g., Amyotrophic lateral sclerosis (ALS) or Huntington’s disease, or a Myotonic Dystrophy; (b) Alzheimer’s disease; (c) an expanded repeat disease, e.g., Huntington’s disease or a Myotonic Dystrophy, or (d) a combination of any one of or all of (a)-(c).
[0436] In some embodiments, a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein is administered to a subject suffering from or at risk of a disease, disorder, or condition. In some embodiments, a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein is administered in combination with one or more additional therapeutics agents to a subject. In some embodiments, a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein is contacted with an organ, tissue, or cells ex vivo. The organ, tissue, or cells can be introduced into a subject and can be protected from damage that would otherwise be caused by the recipient’s immune system. Page 86 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0437] In some embodiments, methods and kits of the present invention may be used for the evaluation and / or monitoring of gene therapy. In some embodiments, gene therapy comprises administration of a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles described herein. In some embodiments, samples for evaluating and / or monitoring gene therapy may be obtained prior to the initiation of gene therapy. In some embodiments, samples are obtained after a first gene therapy treatment or dose. In some embodiments, samples are obtained after the conclusion of gene therapy. In some embodiments, samples are obtained at specific time points, intervals, or any other metric of time before, during, or after gene therapy is performed. Method of transfecting host cells using AAV particles comprising a variant AAV capsid protein
[0438] The present disclosure, among other things, provides methods for transfection of a host cell comprising: combining nucleic acids with a transfection reagent and introducing the mix to host cells under conditions that lead to transfection of the host cells with the nucleic acids.
[0439] In some embodiments, nucleic acids used in a method disclosed herein comprise one or more vectors. In some embodiments, nucleic acids disclosed herein comprise one or more vectors encoding: (i) at least one payload flanked by an AAV inverted terminal repeat (ITR) on either side of the at least one payload, (ii) at least one AAV Rep polypeptide, (iii) at least one AAV Cap polypeptide, and / or (iv) at least one Adenoviral helper polypeptide.
[0440] A host cell (e.g., a mammalian host cell, e.g., a HEK293) can be transfected with: at least one helper polypeptide or nucleic acid (e.g., at least one Ad2 helper polypeptide or nucleic acid), at least one Rep polypeptide or a fragment thereof, at least one Cap polypeptide or a fragment thereof, and at least one payload (e.g., for polypeptide expression or an inhibitory or guide nucleic acid).
[0441] In some embodiments, a transfection method disclosed herein is or comprises transient transfection. In some embodiments, a transient transfection method is a suspension transient transfection (sTT). In some embodiments, a transient transfection method is an adherent transient transfection. Page 87 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0442] In some embodiments, the disclosure provides transfected host cells comprising two, three, or four vectors as described herein.
[0443] In some embodiments, the method comprises transfecting a host cell with three vectors. In some embodiments, the three vectors comprise: (i) a first vector encoding at least one payload flanked by an AAV ITR on either side of the at least one payload, (ii) a second vector encoding at least one AAV Rep polypeptide and at least one AAV Cap polypeptide, and (iii) a third vector encoding at least one Adenoviral helper polypeptide.
[0444] In some embodiments, the method comprises transfecting a host cell with two vectors. In some embodiments, the two vectors comprise (i) a first vector encoding at least one AAV Cap polypeptide and at least one payload flanked by an AAV ITR on either side of the at least one payload; and (ii) a second vector encoding at least one Adenoviral helper polypeptide and at least one AAV Rep polypeptide.
[0445] Transfection methods disclosed herein comprise transfection of nucleic acids (e.g., comprising one or more vector) with any transfection reagent known to a skilled person for introducing nucleic acid molecules into host cells (e.g., mammalian cells, such as HEK293). In some embodiments, a transfection reagent comprises a lipid, a polymer, or a combination thereof. In some embodiments, a transfection reagent is a reagent that can form a complex with the nucleic acids.
[0446] In some embodiments, a transfection reagent comprises a polymer, a lipid, or both a polymer and a lipid. In some embodiments, a transfection reagent is or comprises a polymer. In some embodiments, a transfection reagent is or comprises lipid. In some embodiments, a transfection reagent comprises a polymer and a lipid.
[0447] In some embodiments, a transfection reagent is or comprises a polymer, e.g., a cationic polymer. In some embodiments, a transfection reagent comprises polyethyleneimine (PEI), FectoVIR, TransIT-VirusGEN, or a combination thereof. In some embodiments, a transfection reagent is or comprises polyethyleneimine (PEI).
[0448] In some embodiments, host cells are transfected with PEI. In some embodiments, host cells are transfected with a weight (wt.) ratio of DNA to transfection reagent (e.g., PEI) of about 1:1 to about 1:2, about 1:1 to about 1:5, or about 1:1 to about 1:10, e.g., about 1:0.05, about 1:1, about 1:1.25, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:3.5, about 1:4, Page 88 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) about 1:4.5, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. In some embodiments, a wt. ratio of DNA to transfection reagent is dependent on cell culture density (e.g., of adherent or suspension host cells).
[0449] In some embodiments, a vector mass ratio of: (i) a first vector encoding at last one payload to (ii) a second vector encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third vector encoding at least one helper polypeptide is used in a method of transfection disclosed herein. In some embodiments, a vector mass ratio of: (i) a first vector encoding at last one payload to (ii) a second vector encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third vector encoding at least one helper polypeptide is about 1:1:1. In some embodiments, a vector mass ratio of: (i) a first vector encoding at last one payload to (ii) a second vector encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third vector encoding at least one helper polypeptide is not about 1:1:1.
[0450] In some embodiments, a vector mass ratio of: (i) a first vector encoding at last one payload to (ii) a second vector encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third vector encoding at least one helper polypeptide is about 1:0.5:1, about 1:1:2, about 1:1:3, about 1:1:4, about 1:1:5, about 1:1:6, about 1:1:7, about 1:1:8, about 1:1:9, about 1:1:10, about 5:10:1, about 1:0.5:2, about 1:0.5:10, about 1:0.5:5, about 0.5:5:1, about 1:10:20, about 1:2:1, about 1:3:1, about 1:4:1, about 1:5:1, about 1:6:1, about 1:7:1, about 1:8:1, about 1:9:1, about 1:10:1, about 10:1:1, about 9:1:1, about 8:1:1, about 7:1:1, about 6:1:1, about 6:1:1, about 4:1:1, about 3:1:1, about 2:1:1, or about 1:0.5:5.
[0451] In some embodiments, a vector mass ratio of: (i) a first vector encoding at last one payload to (ii) a second vector encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third vector encoding at least one helper polypeptide is about 1:0.5:1 to about 1:0.5:10; about 1:1:1 to about 1:1:10; about 0.5:1:1 to about 5:1:1; about 1:1:1 to about 1:10:1; or about 1:1:1 to about 10:1:1. Host Cells
[0452] The present disclosure, among other things, provides host cells for transfection with at least one vector as described herein for production of rAAV particles. A host cell includes a progeny cell of an original cell transfected with at least one vector described herein. Page 89 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) A progeny cell of a parental cell may not be substantially identical in morphology or genomic content as a parent cell due to natural, accidental, or deliberate mutation.
[0453] Components for a host cell to produce rAAV particles may be provided in trans on at least one vector. A stable host cell may comprise at least one polypeptide to produce rAAV particles using methods known to those of skill in the art. In some embodiments, a stable host cell comprises at least one polypeptide under control of an inducible promoter. In other embodiments, a stable host cell comprises at least one polypeptide under control of a constitutive promoter. For example, a stable host cell (e.g., a HEK293 cell) may comprise a nucleic acid encoding an E1 helper polypeptide under the control of a constitutive promoter. Other stable host cells may be generated by one of skill in the art using routine methods.
[0454] Exemplary host cells include prokaryotes or eukaryotes (single-cell or multiple- cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp), mycobacteria cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, or Trichoplusia ni), non-human animal cells, human cells, or cell fusions, such as hybridomas or quadromas. In some embodiments the host cell is a mammalian cell. In some embodiments, the host cell is a human, monkey, ape, hamster, rat, or mouse cell.
[0455] In some embodiments, the host cell is selected from a kidney cell (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK), CHO cell (e.g., CHO Kl, DXB-11 CHO, or Veggie-CHO), COS cell (e.g., COS-7), retinal cell, Vero cell, CV1 cell, HepG2 cell, WI38 cell, MRC 5 cell, Colo205 cell, HB 8065 cell, HL-60 cell (e.g., BHK21), Jurkat cell, Daudi cell, A431 cell (epidermal), CV-1 cell, U937 cell, 3T3 cell, L cell, C127 cell, SP2 / 0 cell, NS-0 cell, MMT 060562 cell, Sertoli cell, BRL 3 A cell, HT1080 cell, myeloma cell, tumor cell, or a cell line derived from an aforementioned cell.
[0456] In some embodiments, the host cell comprises a kidney cell (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK). In certain embodiments, the host cell comprises a HEK293 cell. In some embodiments, the host cell (e.g., a HEK 293 cell) comprises or expresses an E1 polypeptide. In some embodiments, the host cell does not comprise or express an E1 polypeptide. In some embodiments, the host cell comprises a CHO cell (e.g., CHO-K, DXB-11 CHO, or Veggie-CHO). In certain embodiments, the host cell comprises a CHO-K cell. Page 90 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0457] In some embodiments, host cells are or comprise suspension cells. In some embodiments, at least 10% + / - 15%, at least 15 + / - 15%, at least 20 + / - 15%, at least 25 + / - 15%, at least 30 + / - 15%, at least 35 + / - 15%, at least 40 + / - 15%, at least 45 + / - 15%, at least 50 + / - 15%, at least 55 + / - 15%, at least 60 + / - 15%, at least 65 + / - 15%, at least 70 + / - 15%, at least 75 + / - 15%, at least 80 + / - 15%, at least 85 + / - 15%, at least 90 + / - 15%, at least 95 + / - 15%, at least 99 + / - 15%, or more host cells in culture are suspended.
[0458] In some embodiments, prior to transfection, host cells (e.g., adherent or suspended host cells) are seeded at a certain density. In some embodiments, prior to transfection, host cells (e.g., adherent host cells) are seeded at a density of at least about 1.0 x 104viable cells (vc) / cm2, e.g., at a density of about 1.0 x 104vc / cm2to about 2.0 x 104vc / cm2, e.g., about 1.0 x 104vc / cm2, about 1.1 x 104vc / cm2, about 1.2 x 104vc / cm2, about 1.3 x 104vc / cm2, about 1.4 x 104vc / cm2, about 1.5 x 104vc / cm2, about 1.6 x 104vc / cm2, about 1.7 x 104vc / cm2, about 1.8 x 104vc / cm2, about 1.9 x 104vc / cm2, or about 2.0 x 104vc / cm2. In some embodiments, prior to transfection, host cells (e.g., suspended host cells) are seeded at a density of at least 1.0 x 106vc / cm2+ / - 15%, e.g., at a density of 1.0 x 106vc / cm2+ / - 15% to 2.0 x 106vc / cm2+ / - 15%, e.g., 1.0 x 106vc / cm2+ / - 15%, 1.1 x 106vc / cm2+ / - 15%, 1.2 x 106vc / cm2+ / - 15%, 1.3 x 106vc / cm2+ / - 15%, 1.4 x 106vc / cm2+ / - 15%, 1.5 x 106vc / cm2+ / - 15%, 1.6 x 106vc / cm2+ / - 15%, 1.7 x 106vc / cm2+ / - 15%, 1.8 x 106vc / cm2+ / - 15%, 1.9 x 106vc / cm2+ / - 15%, or 2.0 x 106vc / cm2+ / - 15%. Vectors
[0459] Many forms of vectors can be used in methods of producing rAAV particles described herein. Non-limiting examples of vectors include plasmids, bacteriophage vectors, cosmids, phagemids, artificial chromosomes, and viral vectors (e.g., vectors suitable for gene therapy). A vector genetic element may be delivered by any suitable method known in the art, e.g., to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques (See, e.g., Sambrook 1989 as referenced herein).
[0460] In some embodiments, a vector encodes at least one helper polypeptide. In some embodiments, a vector encodes at least one Rep polypeptide and / or at least one Cap polypeptide. In some embodiments, a vector encodes at least one payload (e.g., for expression of polypeptide or as an inhibitory or guide nucleic acid). In some embodiments, a vector encodes at least one Page 91 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) helper polypeptide and at least one Rep polypeptide. In some embodiments, a vector encodes at least one Cap polypeptide and at least one payload.
[0461] A vector can include conventional control elements operably linked to a nucleic acid encoding any polypeptide or payload described herein, in a manner that permits transcription, translation and / or expression in a cell transfected with a vector described herein. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A number of expression control sequences, including promoters that are native, constitutive, inducible, and / or tissue- specific, are known in the art and may be included in a vector described herein.
[0462] Examples of constitutive promoters include, but are not limited to, a retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter (optionally with CMV enhancer), an SV40 promoter, and an dihydrofolate reductase promoter.
[0463] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors, such as temperature, or the presence of a specific physiological state (e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only). Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include a zinc-inducible sheep metallothionine (MT) promoter, a dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, a T7 polymerase promoter system, an ecdysone insect promoter, a tetracycline-repressible system, a tetracycline-inducible system, a RU486-inducible system, and an rapamycin-inducible system. Still other types of inducible promoters that may be useful are regulated by a specific physiological state, such as temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
[0464] In another embodiment, a native promoter or fragment thereof for a nucleic acid encoding any polypeptide or payload described herein may be used. In some embodiments, Page 92 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used to mimic native expression. Vector encoding Helper Polypeptides
[0465] The present disclosure, among other things, provides vectors (e.g., plasmids) encoding at least one helper polypeptide. AAV is a helper-dependent DNA parvovirus, which belongs to the genus Dependovirus. Production of recombination AAV requires co-infection with a related virus (e.g., adenovirus, herpes, or vaccinia virus) or a helper vector encoding helper polypeptides, such as structural proteins and proteins for viral genome replication.
[0466] A helper vector can comprise nucleotide sequences for non-AAV derived viral and / or cellular functions upon which AAV is dependent for replication, which may include, but are not limited to, activation of gene transcription, stage specific mRNA splicing, DNA replication, synthesis of at least one Cap polypeptide, and / or capsid assembly. Viral-based helper polypeptides can be derived from any known helper viruses such as adenovirus, herpesvirus, vaccinia virus, or a combination thereof. Thus, a helper vector (e.g., a plasmid) for culturing of the host cell can comprise sufficient helper polypeptides to permit packaging of the recombinant AAV vector into the AAV capsid polypeptides.
[0467] In some embodiments, a helper vector comprises an Ad2 helper vector. In certain embodiments, a nucleic acid sequence of an Ad2 helper vector is derived from an Adenovirus 2 genome (GenBank Accession No. J01917.1). In some embodiments, a helper vector comprises an Ad5 helper vector. In certain embodiments, a nucleic acid sequence of an Ad5 helper vector is derived from an Adenovirus 5 genome (GenBank Accession No. AY601635).
[0468] Helper polypeptides and nucleic acids can comprise at least one, two, three, or four of E1, E2a, E4, or VA RNA. In some embodiments, E1 comprises E1a and / or E1b. In some embodiments, one or both of E2a and VA RNA increase stability and / or efficiency of AAV mRNA translation, such as for cap gene transcripts. In some embodiments, E4 facilitates DNA replication. In some embodiments, E1a comprises a transactivator (e.g., regulating activity of at least one Ad gene, AAV rep gene, and / or AAV cap gene). In some embodiments, E1b comprises a viral mRNA transport. Helper polypeptides are described in further detail in Coura Page 93 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Rdos. and Nardi BN., (2008) Genetics and Molecular Biology 31(1): pp.1-11, which is hereby incorporated by reference in its entirety.
[0469] In some embodiments, a helper vector comprises a selection marker. Exemplary selection markers include, but are not limited to, antibiotic resistance genes. In some embodiments, an antibiotic resistance gene is not a gene encoding penicillin. In some embodiments, an antibiotic resistance gene is not a gene encoding a penicillin-derivative. In some embodiments, an antibiotic resistance gene comprises an antibiotic resistance gene chosen from kanamycin, puromycin, neomycin, hygromycin, blasticidin, gentamycin, Gr18, or zeocin. In certain embodiments, an antibiotic resistance gene comprises an antibiotic resistance gene for kanamycin.
[0470] In some embodiments, nucleic acids encoding helper polypeptides are oriented in the same direction (e.g., 5’ to 3’) on a helper vector. In some embodiments, nucleic acids encoding helper polypeptides are transcribed in the same direction from a helper vector. In certain embodiments, helper polypeptides and nucleic acids comprise VA RNA and E4 oriented in the same direction on a helper vector. In certain embodiments, helper polypeptides comprise E4 and E2a oriented in the same direction on a helper vector. In certain embodiments, helper polypeptides and nucleic acids comprise VA RNA, E4, and E2a oriented from 5’ to 3’ in direction on a helper vector. In some embodiments, a helper vector does not comprise a nucleic acid sequence encoding a Fiber protein or a fragment thereof (e.g., does not comprise a nucleic acid sequence of GenBank Accession No. AP_000226.1 or a fragment thereof). Vector encoding Rep and / or Cap Polypeptides
[0471] The present disclosure, among other things, provides vectors (e.g., plasmids) encoding at least one Rep polypeptide and / or at least one Cap polypeptide (e.g., a variant Cap disclosed herein). Production of rAAV particles can include culturing of a host cell with at least one Rep polypeptide and at least one Cap polypeptide (e.g., a variant Cap disclosed herein). Rep proteins (e.g., one, two, three, or four Rep78, Rep68, Rep52, and Rep40) are involved in viral DNA replication, resolution of replicative intermediates, and generation of single-stranded genomes. In some embodiments, a vector comprises a nucleic acid sequence encoding one, two, three, or four of Rep78, Rep68, Rep52, or Rep40, or a variant of any of the foregoing. Page 94 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0472] In some embodiments, a Rep polypeptide comprises a nucleic acid sequence derived from an AAV2 serotype. For example, a nucleic acid sequence encoding a Rep polypeptide may be derived from the AAV2 genome (as found in Accession No. NC_001401). In some embodiments, a Rep polypeptide comprises an AAV2 Rep polypeptide operably linked to a p5 and / or p19 promotor (as found in Accession No. NC_001401). In some embodiments, a Rep polypeptide comprises an amino acid sequence of YP_680422.1 or a fragment thereof. In some embodiments, a promoter is operably linked to a nucleic acid sequence encoding at least one Rep polypeptide. In certain embodiments, a promoter operably linked to a nucleic acid sequence encoding at least one Rep polypeptide comprises a p5 and / or p19 promoter. In some embodiments, a wildtype promoter of AAV2 or a variant thereof is operably linked to a nucleic acid sequence encoding at least one Rep polypeptide. In some embodiments, a promoter (e.g., a p5 promoter) regulating expression of at least one Rep polypeptide is located in a different location on a vector than a wildtype promoter of AAV2 or a variant thereof. In certain embodiments, a promoter (e.g., a p5 promoter) is located 3’ of a nucleic acid encoding at least one Rep polypeptide. In certain embodiments, a promoter (e.g., a p5 promoter) is located 5’ of a nucleic acid encoding at least one Rep polypeptide.
[0473] Cap polypeptides (e.g., VP1, VP2, and VP3) are structural proteins comprising a Capsid. In some embodiments, a vector comprises a nucleic acid sequence encoding one, two, or three of VP1, VP2, and VP3, e.g., comprising a variant AAV capsid disclosed herein. In some embodiments, a vector comprises a nucleic acid sequence encoding at least one Cap polypeptide (e.g., a variant AAV capsid polypeptide disclosed herein) and at least one Rep polypeptide. In other embodiments, a vector encodes at least one Cap polypeptide (e.g., a variant AAV capsid polypeptide disclosed herein) and a separate vector encodes at least one Rep polypeptide.
[0474] For example, a nucleic acid sequence encoding a Cap polypeptide comprising an AAV variant capsid protein disclosed herein may further comprise a nucleic acid sequence derived from a known AAV genome sequence including, but not limited to: AAV9 / hu14 provided as SEQ ID NO: 123 in U.S. Patent 7,906,111; AAV1 Accession No. NC_002077 or AF063497; AAV2 Accession No. NC_001401; AAV5 Accession No. Y18065 or AF085716; Accession No. AAV6 NC_001862; or AAV8 Accession No NC_006261.1In certain embodiments, a nucleic acid sequence encoding a Cap polypeptide (e.g., a variant AAV capsid polypeptide disclosed herein) is derived from an AAV genome sequence or a variant thereof as Page 95 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) described in US Patent No.7,906,111, which is hereby incorporated by reference in its entirety. In certain embodiments, a nucleic acid sequence encoding a Cap polypeptide (e.g., a variant AAV capsid polypeptide disclosed herein) is derived from an AAV genome sequence or a variant thereof as described in International Publication No. WO 2018 / 160582, which is hereby incorporated by reference in its entirety.
[0475] In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV2 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV1 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV2 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV3B serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV5 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV8 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV9 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV4 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV7 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV10 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV11 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV12 serotype, or a variant thereof. In certain embodiments, a Cap Page 96 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAV13 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAVhu68 serotype, or a variant thereof. In certain embodiments, a Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from an AAVrh10 serotype, or a variant thereof.
[0476] In some embodiments, a promoter is operably linked to a nucleic acid sequence encoding at least one Cap polypeptide comprising an AAV variant capsid protein disclosed herein. In some embodiments, a wildtype promoter of AAV2, AAV5, AAV8, AAV9, is operably linked to a nucleic acid sequence encoding at least one Rep polypeptide. In certain embodiments, a p40 promoter is operably linked to a nucleic acid sequence encoding at least one Cap polypeptide comprising an AAV variant capsid protein disclosed herein further comprises. Vector encoding Payload
[0477] The present disclosure, among other things, provides vectors (e.g., plasmids) encoding at least one payload. A payload sequence is generally a sequence of interest that is desired to be introduced into a cell, tissue, organ, or organism.
[0478] In some embodiments, a payload is flanked by inverted terminal repeats (ITRs). The AAV sequences of a rAAV vector typically comprise cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (See, e.g., Carter B.J., (1990) Handbook of Parvoviruses (I): pp.155- 168, which is hereby incorporated by reference in its entirety). ITR sequences are typically about 145 nt in length. In some embodiments, one or both of a 5’ITR or a 3’ ITR nucleic acid sequence are modified relative to a known ITR nucleic acid sequence. Modification of ITR nucleic acid sequences is within one of skill in the art (See, e.g., Sambrook J.1989; and Fisher K. et al., (1996) J Virol 70: pp.520-532, each of which is hereby incorporated by reference in its entirety). AAV ITR sequences may be obtained from any known AAV, including mammalian AAV types.
[0479] In some embodiments, a payload is a heterologous protein with a therapeutic purpose, e.g., an enzyme, cytokine, antibody, receptor, fusion protein, or chimeric polypeptide. In some embodiments, a payload is linked to a secretion signal sequence for secretion of an Page 97 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) expressed polypeptide from a host cell. In some embodiments, a payload is a heterologous nucleic acid with a therapeutic purpose, e.g., an miRNA, siRNA, shRNA, mRNA, snRNA, or CRISPR / Cas guide RNA, or a precursor thereof. One of skill in the art will recognize that a payload can be selected from any heterologous protein or nucleic acid of interest. In some embodiments, a payload sequence comprises one or more aptamer-binding domains or polypeptide-binding domains (e.g., transcription factor binding domains). A vector will also typically include other regulatory elements (e.g., promoters, introns, and / or enhancers) to regulate expression or amount of a payload in a cell or tissue.
[0480] In accordance with various embodiments, a payload sequence can be of any length, e.g., between 2 and 10,000 nucleotides in length or any integer value there between. In some embodiments, a nucleic acid sequence encoding a payload comprises at least 20 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 350 nucleotides, at least 400 nucleotides, at least 450 nucleotides, at least 500 nucleotides, at least 550 nucleotides, at least 600 nucleotides, at least 650 nucleotides, at least 700 nucleotides, at least 750 nucleotides, at least 800 nucleotides, at least 850 nucleotides, at least 900 nucleotides, at least 950 nucleotides, at least 1000 nucleotides, at least 1100 nucleotides, at least 1200 nucleotides, at least 1300 nucleotides, at least 1400 nucleotides, at least 1500 nucleotides, at least 1600 nucleotides, at least 1700 nucleotides, at least 1800 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 4000 nucleotides, at least 5000 nucleotides, at least 6000 nucleotides, at least 7000 nucleotides, at least 8000 nucleotides, at least 9000 nucleotides. In some embodiments, a nucleic acid sequence encoding a payload comprises between 50 and 25,000 nucleotides in length, between 100 and 20,000 nucleotides in length, between 500 and 10,000 nucleotides in length, between 1,000 and 8,000 nucleotides in length, and / or between 2,000 and 5,000 nucleotides in length. Culture vessels and culturing parameters
[0481] The present disclosure, among other things, provides methods for culturing of a host cell with at least one vector described herein for production of rAAV particles. A wide variety of growth media (e.g., mammalian growth media) may be used in accordance with the present invention. In certain embodiments, cells may be grown in one of a variety of chemically Page 98 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) defined media, wherein the components of the media are both known and controlled. In certain embodiments, cells may be grown in a complex medium, in which not all components of the medium are known and / or controlled.
[0482] A culture of host cells can be prepared in any medium suitable for a particular cell type being cultured. In some embodiments, a host cell medium comprises, e.g., inorganic salts, carbohydrates (e.g., sugars, such as glucose, galactose, maltose, or fructose), amino acids, vitamins (e.g., B group vitamins (e.g., B12), vitamin A, vitamin E, riboflavin, thiamine, or biotin), fatty acids (e.g., cholesterol or steroids), proteins (e.g., albumin, transferrin, fibronectin, or fetuin), serum (e.g., albumins, growth factors, or growth inhibitors, such as, fetal bovine serum, newborn calf serum, or horse serum), trace elements (e.g., zinc, copper, selenium, or tricarboxylic acid intermediates), hydrolysates (e.g., derived from plant or animal sources), or combinations thereof.
[0483] Commercially available media can be used for culturing host cells described herein. Exemplary media can include, but is not limited to, Dulbecco's Modified Eagle's Medium ([DMEM], Sigma), FreeStyle™ F17 Expression Medium (ThermoFisher), DMEM / F12 medium (Invitrogen), CD OptiCHO™ medium (Invitrogen), CD EfficientFeed™ media (Invitrogen), Cell Boost (HyClone™) media (GE Life Sciences), BalanCD™ CHO Feed (Irvine Scientific), BD Recharge™ (Becton Dickinson), Cellvento Feed™ (EMD Millipore), Ex-cell CHOZN Feed™ (Sigma-Aldrich), CHO Feed Bioreactor Supplement (Sigma-Aldrich), SheffCHO™ (Kerry), Zap-CHO™ (Invitria), ActiCHO™ (PAA / GE Healthcare), Minimal Essential Medium (Sigma), or RPMI-1640 (Sigma). Media can be supplemented as necessary with hormones and / or other growth factors (e.g., insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium, magnesium, or phosphate), buffers (e.g., HEPES), nucleosides (e.g., adenosine or thymidine), antibiotics (e.g., kanamycin, puromycin, neomycin, hygromycin, blasticidin, gentamycin, Gr18, or zeocin), trace elements, lipids (e.g., linoleic or other fatty acids), or glucose or an equivalent energy source. In some embodiments, the media for culturing host cells comprises glutamine or a glutamine dipeptide. In some embodiments, the media for culturing host cells comprises a surfactant. In some embodiments, the nutrient media is serum-free media, a protein-free media, or a chemically defined media. Any other necessary supplements can also be included at appropriate concentrations that would be known to those skilled in the art. Page 99 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0484] After culturing of host cells as described herein, a plurality of rAAV particles are recovered. In some embodiments, rAAV particles are recovered by lysing host cells and recovering rAAV particles from lysate, e.g., after centrifugation. In some embodiments, rAAV particles are recovered from culture supernatant. In some embodiments, a lysis solution for host cells comprises chemical reagents, e.g., detergents (e.g., sodium dodecyl sulfate (SDS), ethyl trimethyl ammonium bromide, Triton X-100, bile salts, such as cholate, or zwitterionic detergents, such as CHAPS). In some embodiments, a lysis solution for host cells comprises a salt (e.g., NaCl) and a high pH (e.g., a pH of greater than about 7). In some embodiments, rAAV particles are purified using purification methods, such as chromatography (e.g., affinity chromatography) or ion-exchange chromatography (e.g., cation exchange chromatography) or filtration (e.g., UF / DF filtration).
[0485] In some embodiments, a plurality of rAAV particles are produced in a large-scale preparation. In some embodiments, a large-scale preparation of host cells (e.g., suspension host cells) is at least 3 liters + / - 15% of culture media, 10 liters + / - 15% of culture media, e.g., between 50 liters + / - 15% to 1000 liters + / - 15% of culture media or between 50 liters + / - 15% to 2000 liters+ / - 15% of culture media, e.g., at least 20 liters + / - 15%, 30 liters + / - 15%, 40 liters + / - 15%, 50 liters + / - 15%, 55 liters + / - 15%, 60 liters + / - 15%, 65 liters + / - 15%, 70 liters + / - 15%, 75 liters + / - 15%, 80 liters + / - 15%, 85 liters + / - 15%, 90 liters + / - 15%, 95 liters + / - 15%, 100 liters + / - 15%, 200 liters + / - 15%, 300 liters + / - 15%, 400 liters + / - 15%, 500 liters + / - 15%, 600 liters + / - 15%, 700 liters + / - 15%, 800 liters + / - 15%, 900 liters + / - 15%, 1,000 liters + / - 15%, 1,250 liters + / - 15%, 1,500 liters + / - 15%, 1,750 liters + / - 15%, 2,000 liters + / - 15%, or more of culture media.
[0486] In some embodiments, a large-scale preparation of host cells (e.g., adherent host cells) is at least 5 m2+ / - 15% of culture media, e.g., between 5 m2+ / - 15% to 500 m2+ / - 15% of culture media, e.g., at least 5 m2+ / - 15%, 10 m2+ / - 15%, 15 m2+ / - 15%, 20 m2+ / - 15%, 25 m2+ / - 15%, 20 m2+ / - 15%, 35 m2+ / - 15%, 40 m2+ / - 15%, 45 m2+ / - 15%, 50 m2+ / - 15%, 55 m2+ / - 15%, 60 m2+ / - 15%, 65 m2+ / - 15%, 75 m2+ / - 15%, 80 m2+ / - 15%, 85 m2+ / - 15%, 90 m2+ / - 15%, 95 m2+ / - 15%, 100 m2+ / - 15%, 150 m2+ / - 15%, 175 m2+ / - 15%, 200 m2+ / - 15%, 225 m2+ / - 15%, 250 m2+ / - 15%, 275 m2+ / - 15%, 300 m2+ / - 15%, 325 m2+ / - 15%, 330 m2+ / - 15%, 340 m2+ / - 15%, 350 m2+ / - 15%, 375 m2+ / - 15%, 400 m2+ / - 15%, 425 m2+ / - 15%, 450 m2+ / - 15%, 475 m2+ / - 15%, 500 m2+ / - 15%, 600 m2+ / - 15%, 700 m2+ / - 15%, 800 m2+ / - 15%, 900 Page 100 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) m2+ / - 15%, 1000 m2+ / - 15%, 1100 m2+ / - 15%, 1200 m2+ / - 15%, 1300 m2+ / - 15%, 1400 m2+ / - 15%, 1500 m2+ / - 15%, 1600 m2+ / - 15%, 1700 m2+ / - 15%, 1800 m2+ / - 15%, 1900 m2+ / - 15%, 2000 m2+ / - 15%, 2500 m2+ / - 15%, 3000 m2+ / - 15%, 3500 m2+ / - 15%, 4000 m2+ / - 15%, 4500 m2+ / - 15%, 5000 m2+ / - 15%, 5500 m2+ / - 15%, 6000 m2+ / - 15%, 6500 m2+ / - 15%, 7000 m2+ / - 15%, 7500 m2+ / - 15%, 8000 m2+ / - 15%, 8500 m2+ / - 15%, 9000 m2+ / - 15%, 9500 m2+ / - 15%, 10,000 m2+ / - 15%, 11,000 m2+ / - 15%, 12,000 m2+ / - 15%, 13,000 m2+ / - 15%, 14,000 m2+ / - 15%, 15,000 m2+ / - 15%, or more of culture media.
[0487] A host cell can be cultured in a cell culture vessel or a bioreactor. In some embodiments, a cell culture vessel is suitable for / used for culturing adherent cells. In other embodiments, a cell culture vessel is suitable for / used for culturing suspension cells. Exemplary cell culture vessels include 35mm, 60mm, 100mm, or 150mm dishes, multi-well plates (e.g., 6- well, 12-well, 24-well, 48-well, or 96 well plates), or flasks (e.g., T-flasks, e.g., T-25, T-75, or T- 160 flasks), or shaker flasks.
[0488] In some embodiments, a host cell is cultured in a bioreactor. In some embodiments, a bioreactor is suitable for / used for culturing adherent cells. In some embodiments, a bioreactor is suitable for / used for culturing suspension cells. A bioreactor can be, e.g., a continuous flow batch bioreactor, a perfusion bioreactor, a batch process bioreactor, or a fed batch bioreactor. An exemplary bioreactor is a fixed bed bioreactor, e.g., an iCELL is bioreactor (used for culturing adherent cells). A bioreactor can be maintained under conditions sufficient to produce rAAV particles. Culture conditions can be modulated to optimize yield, purity, or structure of rAAV particles.
[0489] In some embodiments, a bioreactor comprises a plurality of host cells. In some embodiments, host cells in a bioreactor comprise viable cells (vc).
[0490] In some embodiments, a bioreactor comprises at least about 1 x 106, about 1 x 107, about 1 x 108, about 1 x 109, about 1 x 1010, about 1 x 1011, about 1 x 1012, about 1 x 1013, or about 1 x 1014host cells (e.g., viable host cells). In some embodiments, a bioreactor comprises between 1 x 106to 1 x 1014host cells; between 1 x 106to 0.5 x 1014host cells; between 1 x 106to 1 x 1013host cells; between 1 x 106to 0.5 x 1013host cells; between 1 x 106to 1 x 1012host cells; between 1 x 106to 0.5 x 1012host cells; between 1 x 106to 1 x 1011host cells; between 1 x 106to 0.5 x 1011host cells; between 1 x 106to 1 x 1010host cells; between 1 x 106to 0.5 x 1010host cells; between 1 x 106to 1 x 109host cells; between 1 x 106to 0.5 x 109host cells; between 1 x Page 101 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 106to 1 x 108host cells; between 1 x 106to 0.5 x 108host cells; between 1 x 106to 1 x 107host cells; between 1 x 106to 0.5 x 107host cells; between 0.5 x 107to 1 x 1014host cells; between 1 x 108to 1 x 1014host cells; between 0.5 x 109to 1 x 1014host cells; between 1 x 109to 1 x 1014host cells; between 0.5 x 1010to 1 x 1014host cells; between 1 x 1010to 1 x 1014host cells; between 0.5 x 1011to 1 x 1014host cells; between 1 x 1011to 1 x 1014host cells; between 0.5 x 1012to 1 x 1014host cells; between 1 x 1012to 1 x 1014host cells; between 0.5 x 1013to 1 x 1014host cells; between 1 x 1013to 1 x 1014host cells; or between 0.5 x 1013to 1 x 1014host cells.
[0491] In some embodiments, a bioreactor comprises about 0.5 million host cells / mL, about 1 million host cells / mL, about 1.5 million host cells / mL, about 2 million host cells / mL, about 2.5 million host cells / mL, about 3 million host cells / mL, about 3.5 million host cells / mL, about 4 million host cells / mL, about 4.5 million host cells / mL, about 5 million host cells / mL, about 5.5 million host cells / mL, about 6 million host cells / mL, about 7 million host cells / mL, about 8 million host cells / mL, about 9 million host cells / mL, about 10 million host cells / mL. In some embodiments, host cells in a bioreactor comprise viable cells (vc).
[0492] In some embodiments, a bioreactor comprises at least about 1 liter, about 2 liters, about 3 liters, about 10 liters, about 20 liters, about 30 liters, about 40 liters, about 50 liters, about 55 liters, about 60 liters, about 65 liters, about 70 liters, about 75 liters, about 80 liters, about 85 liters, about 90 liters, about 95 liters, about 100 liters, about 200 liters, about 300 liters, about 400 liters, about 500 liters, about 600 liters, about 700 liters, about 800 liters, about 900 liters, about 1000 liters, about 1500 liters, about 2000 liters or about 3000 liters of culture media.
[0493] In an embodiment, a bioreactor is maintained under conditions that promote growth of a host cell, e.g., at a temperature (e.g., 37°C) and gas concentration (e.g., 5% - 10% CO2) that is permissive for growth of the host cell. For example, a bioreactor can perform one or more of the following: feeding of nutrients and / or carbon sources, injection of suitable gas (e.g., oxygen), inlet and outlet flow of fermentation or cell culture medium, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH level, agitation (e.g., stirring), cleaning, and / or sterilization. Exemplary bioreactor units may contain multiple reactors within a unit, e.g., a unit can comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100, or more bioreactors. Any suitable bioreactor diameter and / or shape can be used. In some embodiments, suitable reactors can be round, e.g., cylindrical. In some embodiments, suitable reactors can be square, e.g., rectangular. Page 102 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) rAAV Particle Production
[0494] The present disclosure, among other things, rAAV particles produced using methods described herein. Generally, rAAV particles produced using methods described herein may be of any AAV serotype. AAV serotypes generally have different tropisms to infect different tissues. In some embodiments, an AAV serotype is selected based on a tropism.
[0495] In some embodiments, a rAAV particle may comprise or be based on a serotype selected from any of the following serotypes, and variants thereof, including, but not limited to: AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 AAV13, AAVhu68, or AAVrh10.
[0496] In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV1 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV2 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV3B serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV5 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV8 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV9 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV4 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV7 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV10 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV11 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV12 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises an AAV13 serotype or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid Page 103 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) protein disclosed herein comprises AAVhu68 or a variant thereof. In certain embodiments, a rAAV particle comprising an AAV variant capsid protein disclosed herein comprises AAVrh10 or a variant thereof.
[0497] In some embodiment, a plurality of rAAV particles are produced with methods described herein at a higher titer, e.g., such there is improved rAAV particle production. In some embodiments, the improved production comprises a higher yield of the plurality of rAAV particles relative to a plurality of rAAV particles produced with a helper vector comprising a nucleic acid sequence of an antibiotic resistance gene other than KanR (e.g., an Ampicillin resistance gene). In some embodiments, a high titer is relative to AAV particles produced from a reference helper vector (e.g., an Ad5 vector, e.g., an Ad5 vector described herein), e.g., under otherwise identical conditions.
[0498] In some embodiments, a high titer is greater than 7.0 x 109vg / mL + / - 15%, e.g., when cultured in suspension. In some embodiments, a high titer is greater than about 7.0 x 109vg / mL, e.g., greater than about 7.5 x 109vg / mL, 8.0 x 109vg / mL, 8.5 x 109vg / mL, 9.0 x 109vg / mL, 1.0 x 1010vg / mL, 1.5 x 1010vg / mL, 2.0 x 1010vg / mL, 2.5 x 1010vg / mL, 3.0 x 1010vg / mL, 3.5 x 1010vg / mL, 4.0 x 1010vg / mL, 4.5 x 1010vg / mL, 5.0 x 1010vg / mL, 5.5 x 1010vg / mL, 6.0 x 1010vg / mL, 6.5 x 1010vg / mL, 7.0 x 1010vg / mL, 7.5 x 1010vg / mL, 8.0 x 1010vg / mL, 8.5 x 1010vg / mL, 9.0 x 1010vg / mL, 9.5 x 1010vg / mL, 1.0 x 1011vg / mL, 1.5 x 1011vg / mL, 2.0 x 1011vg / mL, or higher, e.g., when cultured in suspension.
[0499] In some embodiments, a high titer of rAAV particles is at least about 7.0 x 109vg / cm2, about 7.5 x 109vg / cm2, about 8.0 x 109vg / cm2, about 8.5 x 109vg / cm2, about 9.0 x 109vg / cm2, about 9.5 x 109vg / cm2, about 1.0 x 1010vg / cm2, about 1.5 x 1010vg / cm2, or higher, e.g., when cultured in a bioreactor, e.g., a fixed bed bioreactor.
[0500] In some embodiments, a high titer of rAAV particles is greater than 5.0 x 1013vg / m2+ / - 15%, e.g., greater than 6.0 x 1013vg / m2+ / - 15, 7.0 x 1013vg / m2+ / - 15, 8.0 x 1013vg / m2+ / - 15, 9.0 x 1013vg / m2+ / - 15, 1.0 x 1014vg / m2+ / - 15, 2.0 x 1014vg / m2+ / - 15, 3.0 x 1014vg / m2+ / - 15, 4.0 x 1014vg / m2+ / - 15, 5.0 x 1014vg / m2+ / - 15, 6.0 x 1014vg / m2+ / - 15, 7.0 x 1014vg / m2+ / - 15, 8.0 x 1014vg / m2+ / - 15, 9.0 x 1014vg / m2+ / - 15, or more.
[0501] In some embodiments, a plurality of rAAV particles described herein is harvested after at least 3 days of culturing. In some embodiments, a plurality of rAAV particles described Page 104 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) herein is harvested after at least about 3 days to about 10 days of culturing, e.g., about 3 days to about 7 days, about 3 days to about 5 days, about 4 days to about 9 days, about 4 days to about 8 days, or about 4 days to about 6 days of culturing, e.g., after at least about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or longer after culturing. In some embodiments, a plurality of rAAV particles produced with methods described herein is substantially free of one or both of a helper adenovirus or a herpes virus. In some embodiments, a plurality of rAAV particles is substantially free of one or both of a helper adenovirus or a herpes virus, e.g., a purity of at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more free of one or both of a helper adenovirus or a herpes virus
[0502] The foregoing methods for producing recombinant vectors are not meant to be limiting, and other suitable methods will be apparent to the skilled artisan. rAAV Particle Compositions
[0503] The present disclosure, among other things, provides a composition comprising a plurality of rAAV particles formed by methods described herein and / or using systems described herein. In some embodiments, a composition comprises a pharmaceutical composition comprising at least one pharmaceutically acceptable component (e.g., a pharmaceutically acceptable carrier, diluent, or excipient). Such pharmaceutical compositions are useful for, among other things, administration to a subject in vivo or ex vivo.
[0504] In some embodiments, pharmaceutical compositions also contain a pharmaceutically acceptable carrier, excipient, or diluent. Such excipients include any pharmaceutical agent, e.g., a pharmaceutical agent that does not itself induce an immune response harmful to the individual receiving the composition, and which may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids, such as water, saline, glycerol, sugars, and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts, such as hydrochlorides, hydrobromides, phosphates, or sulfates; and the salts of organic acids, such as acetates, propionates, malonates, or benzoates. Additionally, auxiliary substances, such as wetting or emulsifying agents or pH buffering substances, may be present in such vehicles. Page 105 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0505] Pharmaceutical compositions may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, or succinic. Salts tend to be more soluble in aqueous or other protonic solvents than corresponding free base forms. In some embodiments, a pharmaceutical composition may be a lyophilized powder.
[0506] Pharmaceutical compositions can include solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, and isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions may include suspending agents and thickening agents. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powder, granules, and crystals. Supplementary active compounds (e.g., preservatives, antibacterial, antiviral, and antifungal agents) can also be incorporated into the compositions.
[0507] Pharmaceutical compositions can be formulated to be compatible with a particular route of administration or delivery, as set forth herein or known to one of skill in the art. Thus, pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes.
[0508] Compositions suitable for parenteral administration can comprise aqueous and non-aqueous solutions, suspensions or emulsions of the active compound, which preparations are typically sterile and can be isotonic with the blood of the intended recipient. Non-limiting illustrative examples include water, buffered saline, Hanks' solution, Ringer's solution, dextrose, fructose, ethanol, animal, vegetable, or synthetic oils. Aqueous injection suspensions may contain substances that increase the viscosity of a suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions may be prepared as appropriate oil injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Optionally, the suspension may also contain suitable stabilizers or agents that increase solubility to allow for preparation of highly concentrated solutions. Page 106 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0509] Cosolvents and adjuvants may be added to the formulation. Non-limiting examples of cosolvents contain hydroxyl groups or other polar groups, for example, alcohols, such as isopropyl alcohol; glycols, such as propylene glycol, polyethylene glycol, polypropylene glycol, glycol ether; glycerol; polyoxyethylene alcohols and polyoxyethylene fatty acid esters. Adjuvants include, for example, surfactants such as, soya lecithin and oleic acid; sorbitan esters such as sorbitan trioleate; and polyvinylpyrrolidone.
[0510] After pharmaceutical compositions have been prepared, they may be placed in an appropriate container and labeled for treatment. Such labeling can include amount, frequency, and method of administration.
[0511] Pharmaceutical compositions and delivery systems appropriate for the compositions, methods and uses of the disclosure are known in the art (see, e.g., Fox LM., (2006) Am J Pharm Educ.70(3): p.71). Administration
[0512] The present disclosure, among other things, provides methods of administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles formed by methods described herein and / or produced using systems described herein. Compositions (e.g., pharmaceutical compositions) comprising rAAVs produced with the methods described herein or using systems described herein can be used to treat a CNS disorder, e.g., subjects suffering from or susceptible to a CNS disorder described herein. The route and / or mode of administration can vary depending upon the desired results. One with skill in the art (e.g., a physician), is aware that dosage regimens can be adjusted to provide the desired response, e.g., a therapeutic response. Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin. Mode of administration is left to discretion of a practitioner.
[0513] For example, a composition may be administered by retinal, subretinal, intravitreal, intracameral or suprachoroidal injection or infusion. Additional exemplary routes of Page 107 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) administration may include, but are not limited to, bronchial (e.g., bronchial instillation), buccal, enteral, intradermal, intra-arterial, intracisterna magna (ICM), intradermal, intragastric, intramedullary, intramuscular, intranasal, intra-parenchymal (e.g., intra-thalamic), intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, intraspinal, spinal sub-pial, subcutaneous, sublingual, topical, tracheal (e.g., intratracheal instillation), transdermal, vaginal, and intravitreal administration.
[0514] Methods and uses disclosed herein include delivery and administration systemically, regionally or locally, or by any route, for example, by injection or infusion. A composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles formed by methods described herein may be administered by injection or infusion by any route.
[0515] Delivery of a pharmaceutical composition in vivo may generally be accomplished via injection using a conventional syringe, although other delivery methods such as convection- enhanced delivery can also be used. For example, compositions may be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorbitally, intramucosally, intraperitoneally, intravenously, intra-pleurally, intraarterially, intracoronarily, orally, intrahepatically, via the portal vein, or intramuscularly. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications. A clinician specializing in treatment of patients with certain diseases or disorders may determine the optimal route for administration of vectors described herein.
[0516] Additionally, a pharmaceutical composition disclosed herein may also be administered by perfusion, e.g., by limb perfusion.
[0517] The disclosure provides methods for introducing a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein into a cell, a tissue, or an animal. In some embodiments, such methods comprise contacting a cell, a tissue, or an animal with a composition comprising rAAV particles described herein, such that at least one payload is expressed or present in the cell, tissue, or animal.
[0518] The disclosure also provides methods for administering a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein to a subject. In some embodiments, such methods include administering to a subject (e.g., a mammal), a composition comprising rAAV particles described herein, such that at least one payload is expressed or Page 108 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) present in the subject (e.g., in a cell or tissue of a subject). In some embodiments, a method includes providing cells of a subject (e.g., a mammal) with a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein, such that at least one payload is expressed or present in the subject.
[0519] A composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein can be administered in a sufficient or effective amount to a subject in need thereof. Doses can vary and depend upon a type, onset, progression, severity, frequency, duration, or probability of disease to which treatment is directed, the clinical endpoint desired, previous or simultaneous treatments, the general health, age, gender, race or immunological competency of the subject, and other factors that will be appreciated by a skilled artisan. Dose amount, number, frequency, or duration may be proportionally increased or reduced, as indicated by any adverse side effects, complications, or other risk factors of treatment and status of the subject. A skilled artisan will appreciate the factors that may influence the dosage and timing required to provide an amount sufficient for providing a therapeutic or prophylactic benefit.
[0520] A dose to achieve a therapeutic effect will vary based on several factors including, but not limited to: route of administration, level of payload or payload expression required to achieve a therapeutic effect, specific disease treated, any host immune response, and stability of payload or payload expression. One skilled in the art can determine a dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors.
[0521] An effective amount or a sufficient amount can (but need not) be provided in a single administration, may require multiple administrations, and, can (but need not) be, administered alone or in combination with another composition. For example, an amount may be proportionally increased as indicated by need of a subject, type, status, and severity of disease treated or side effects (if any) of treatment. Amounts considered effective also include amounts that result in a reduction of use of another treatment, therapeutic regimen, or protocol.
[0522] Accordingly, pharmaceutical compositions include compositions comprising rAAV particles in an effective amount to achieve an intended therapeutic purpose. Determining a therapeutically effective dose is well within the capability of a skilled medical practitioner using techniques and guidance provided herein. Therapeutic doses can depend on, among other Page 109 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) factors, age and general condition of a subject, severity of a disease or disorder, and payload amount or expression in a subject. Thus, a therapeutically effective amount in humans will fall in a relatively broad range that may be determined by a medical practitioner based on response of an individual patient to rAAV-based treatment. Pharmaceutical compositions may be delivered to a subject so as to allow production of a payload described herein in vivo by gene- and or cell- based therapies or by ex vivo modification of a patient’s or donor’s cells.
[0523] In some embodiments, a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein may be administered to a subject once daily, weekly, every 2, 3, or 4 weeks, or even at longer intervals. In some embodiments, a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein may be administered according to a dosing regimen that includes (i) an initial administration that is once daily, weekly, every 2, 3, or 4 weeks, or even at longer intervals; followed by (ii) a period of no administration of, e.g., 1, 2, 3, 4, 5, 6, 8, or 10 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein may be administered (i) one or more times during an initial time period of up to 2, 4, or 6 weeks or less; followed by (ii) a period of no administration of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, a subject is monitored before and / or following treatment with a composition (e.g., a pharmaceutical composition) comprising rAAV particles described herein. Immunosuppressive regimens
[0524] Methods disclosed herein may also comprise administration of an immunosuppressive regimen in combination with an rAAV particle or a composition comprising the same.
[0525] In some embodiments, an immunosuppressive regimen comprises: (i) dexamethasone or prednisolone, and (ii) a calcineurin inhibitor. In some embodiments, a calcineurin inhibitor comprises a macrolide. In some embodiments, a calcineurin inhibitor comprises tacrolimus.
[0526] In some embodiments, an immunosuppressive regimen is administered intraosseously, intrathecally, intravenously, and / or orally. In some embodiments, an Page 110 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) immunosuppressive regimen is administered intraosseously. In some embodiments, dexamethasone is administered intrathecally.
[0527] In some embodiments, an immunosuppressive regimen is administered daily.
[0528] In some embodiments, administration of an immunosuppressive regimen is initiated prior to administration of a rAAV particle or a composition comprising the same.
[0529] In some embodiments, an immunosuppressive regimen is administered (i) on each of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days prior to administration of a rAAV particle or a composition comprising the same, (ii) on a same day as administration of a rAAV particle or a composition comprising the same, and / or (iii) on each day following administration of a rAAV particle or a composition comprising the same for about 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or longer.
[0530] In some embodiments, prednisolone is administered at a dose of about 0.3 mg / kg to about 10mg / kg. In some embodiments, prednisolone is administered at a dose of about 0.3 mg / kg, about 1mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg or about 10 mg / kg. In some embodiments, prednisolone is administered at a dose of about 3 mg / kg. In some embodiments, prednisolone is administered at a dose of 3 mg / kg.
[0531] In some embodiments, dexamethasone is administered at a dose of about 0.1 mg / kg to about 1 mg / kg. In some embodiments, dexamethasone is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, or about 1 mg / kg. In some embodiments, dexamethasone is administered at a dose of about 0.5 mg / kg.
[0532] In some embodiments, a calcineurin inhibitor is tacrolimus. In some embodiments, tacrolimus is administered at a dose of about 0.5 mg / kg to about 5 mg / kg. In some embodiments, tacrolimus is administered at a dose of about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg or about 5 mg / kg.
[0533] In some embodiments, tacrolimus is administered at a dose of about 1 mg / kg. Page 111 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0534] In some embodiments, an immunosuppressive regimen comprises prednisolone and tacrolimus. In some embodiments, prednisolone is administered at a dose of about 3mg / kg and tacrolimus is administered at a dose of about 1mg / kg. In some embodiments, an immunosuppressive regimen is administered daily from 2 days prior to administration of a dose of a rAAV particle or a composition comprising the same to 20 days after administration of a dose of a rAAV particle or a composition comprising the same. In some embodiments, an immunosuppressive regimen is dosed orally. In some embodiments, a rAAV particle or a composition comprising the same is dosed intravenously.
[0535] In some embodiments, an immunosuppressive regimen comprises dexamethasone and tacrolimus. In some embodiments, dexamethasone is administered at a dose of about 0.5mg / kg and tacrolimus is administered at a dose of about 1mg / kg. In some embodiments, an immunosuppressive regimen is administered daily from 2 days prior to administration of a dose of a rAAV particle or a composition comprising the same to 20 days after administration of a dose of a rAAV particle or a composition comprising the same. In some embodiments, an immunosuppressive regimen is dosed orally. In some embodiments, a rAAV particle or a composition comprising the same is dosed intravenously. AAV capsid reference sequences
[0536] SEQ ID NO: 2001: AAV9 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY KYLGPGNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ 121 AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE 181 SVPDPQPIGE PPAAPSGVGS LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI 241 TTSTRTWALP TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR 301 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY QLPYVLGSAH 361 EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF PSQMLRTGNN FQFSYEFENV 421 PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT INGSGQNQQT LKFSVAGPSN MAVQGRNYIP 481 GPSYRQQRVS TTVTQNNNSE FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS 541 LIFGKQGTGR DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG 601 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK NTPVPADPPT 661 AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYYKSNN VEFAVNTEGV 721 YSEPRPIGTR YLTRNL
[0537] SEQ ID NO: 2002: AAV1 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEGAKTAP GKKRPVEQSP QEPDSSSGIG KTGQQPAKKR LNFGQTGDSE Page 112 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 181 SVPDPQPLGE PPATPAAVGP TTMASGGGAP MADNNEGADG VGNASGNWHC DSTWLGDRVI 241 TTSTRTWALP TYNNHLYKQI SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301 INNNWGFRPK RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ LPYVLGSAHQ 361 GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP SQMLRTGNNF TFSYTFEEVP 421 FHSSYAHSQS LDRLMNPLID QYLYYLNRTQ NQSGSAQNKD LLFSRGSPAG MSVQPKNWLP 481 GPCYRQQRVS KTKTDNNNSN FTWTGASKYN LNGRESIINP GTAMASHKDD EDKFFPMSGV 541 MIFGKESAGA SNTALDNVMI TDEEEIKATN PVATERFGTV AVNFQSSSTD PATGDVHAMG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KNPPPQILIK NTPVPANPPA 661 EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ YTSNYAKSAN VDFTVDNNGL 721 YTEPRPIGTR YLTRPL
[0538] SEQ ID NO: 2003: AAV2 VP1 capsid reference sequence 1 MAADGYLPDW LEDTLSEGIR QWWKLKPGPP PPKPAERHKD DSRGLVLPGY KYLGPFNGLD 61 KGEPVNEADA AALEHDKAYD RQLDSGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEPVKTAP GKKRPVEHSP VEPDSSSGTG KAGQQPARKR LNFGQTGDAD 181 SVPDPQPLGQ PPAAPSGLGT NTMATGSGAP MADNNEGADG VGNSSGNWHC DSTWMGDRVI 241 TTSTRTWALP TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGFRPKR LNFKLFNIQV KEVTQNDGTT TIANNLTSTV QVFTDSEYQL PYVLGSAHQG 361 CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS QMLRTGNNFT FSYTFEDVPF 421 HSSYAHSQSL DRLMNPLIDQ YLYYLSRTNT PSGTTTQSRL QFSQAGASDI RDQSRNWLPG 481 PCYRQQRVSK TSADNNNSEY SWTGATKYHL NGRDSLVNPG PAMASHKDDE EKFFPQSGVL 541 IFGKQGSEKT NVDIEKVMIT DEEEIRTTNP VATEQYGSVS TNLQRGNRQA ATADVNTQGV 601 LPGMVWQDRD VYLQGPIWAK IPHTDGHFHP SPLMGGFGLK HPPPQILIKN TPVPANPSTT 661 FSAAKFASFI TQYSTGQVSV EIEWELQKEN SKRWNPEIQY TSNYNKSVNV DFTVDTNGVY 721 SEPRPIGTRY LTRNL
[0539] SEQ ID NO: 2010: AAV3B VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWALKPGVP QPKANQQHQD NRRGLVLPGY KYLGPGNGLD 61 KGEPVNEADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRILEPLG LVEEAAKTAP GKKRPVDQSP QEPDSSSGVG KSGKQPARKR LNFGQTGDSE 181 SVPDPQPLGE PPAAPTSLGS NTMASGGGAP MADNNEGADG VGNSSGNWHC DSQWLGDRVI 241 TTSTRTWALP TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGFRPKK LSFKLFNIQV KEVTQNDGTT TIANNLTSTV QVFTDSEYQL PYVLGSAHQG 361 CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS QMLRTGNNFQ FSYTFEDVPF 421 HSSYAHSQSL DRLMNPLIDQ YLYYLNRTQG TTSGTTNQSR LLFSQAGPQS MSLQARNWLP 481 GPCYRQQRLS KTANDNNNSN FPWTAASKYH LNGRDSLVNP GPAMASHKDD EEKFFPMHGN 541 LIFGKEGTTA SNAELDNVMI TDEEEIRTTN PVATEQYGTV ANNLQSSNTA PTTRTVNDQG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KHPPPQIMIK NTPVPANPPT 661 TFSPAKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYNKSVN VDFTVDTNGV 721 YSEPRPIGTR YLTRNL
[0540] SEQ ID NO: 2004: AAV5 VP1 capsid reference sequence 1 MSFVDHPPDW LEEVGEGLRE FLGLEAGPPK PKPNQQHQDQ ARGLVLPGYN YLGPGNGLDR 61 GEPVNRADEV AREHDISYNE QLEAGDNPYL KYNHADAEFQ EKLADDTSFG GNLGKAVFQA 121 KKRVLEPFGL VEEGAKTAPT GKRIDDHFPK RKKARTEEDS KPSTSSDAEA GPSGSQQLQI 181 PAQPASSLGA DTMSAGGGGP LGDNNQGADG VGNASGDWHC DSTWMGDRVV TKSTRTWVLP 241 SYNNHQYREI KSGSVDGSNA NAYFGYSTPW GYFDFNRFHS HWSPRDWQRL INNYWGFRPR 301 SLRVKIFNIQ VKEVTVQDST TTIANNLTST VQVFTDDDYQ LPYVVGNGTE GCLPAFPPQV 361 FTLPQYGYAT LNRDNTENPT ERSSFFCLEY FPSKMLRTGN NFEFTYNFEE VPFHSSFAPS 421 QNLFKLANPL VDQYLYRFVS TNNTGGVQFN KNLAGRYANT YKNWFPGPMG RTQGWNLGSG 481 VNRASVSAFA TTNRMELEGA SYQVPPQPNG MTNNLQGSNT YALENTMIFN SQPANPGTTA 541 TYLEGNMLIT SESETQPVNR VAYNVGGQMA TNNQSSTTAP ATGTYNLQEI VPGSVWMERD Page 113 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 601 VYLQGPIWAK IPETGAHFHP SPAMGGFGLK HPPPMMLIKN TPVPGNITSF SDVPVSSFIT 661 QYSTGQVTVE MEWELKKENS KRWNPEIQYT NNYNDPQFVD FAPDSTGEYR TTRPIGTRYL 721 TRPL
[0541] SEQ ID NO: 2005: AAV6 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPFG LVEEGAKTAP GKKRPVEQSP QEPDSSSGIG KTGQQPAKKR LNFGQTGDSE 181 SVPDPQPLGE PPATPAAVGP TTMASGGGAP MADNNEGADG VGNASGNWHC DSTWLGDRVI 241 TTSTRTWALP TYNNHLYKQI SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301 INNNWGFRPK RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ LPYVLGSAHQ 361 GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP SQMLRTGNNF TFSYTFEDVP 421 FHSSYAHSQS LDRLMNPLID QYLYYLNRTQ NQSGSAQNKD LLFSRGSPAG MSVQPKNWLP 481 GPCYRQQRVS KTKTDNNNSN FTWTGASKYN LNGRESIINP GTAMASHKDD KDKFFPMSGV 541 MIFGKESAGA SNTALDNVMI TDEEEIKATN PVATERFGTV AVNLQSSSTD PATGDVHVMG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KHPPPQILIK NTPVPANPPA 661 EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ YTSNYAKSAN VDFTVDNNGL 721 YTEPRPIGTR YLTRPL
[0542] SEQ ID NO: 2006: AAV8 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLQAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEGAKTAP GKKRPVEPSP QRSPDSSTGI GKKGQQPARK RLNFGQTGDS 181 ESVPDPQPLG EPPAAPSGVG PNTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV 241 ITTSTRTWAL PTYNNHLYKQ ISNGTSGGAT NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLSFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE YQLPYVLGSA 361 HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY FPSQMLRTGN NFQFTYTFED 421 VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR TQTTGGTANT QTLGFSQGGP NTMANQAKNW 481 LPGPCYRQQR VSTTTGQNNN SNFAWTAGTK YHLNGRNSLA NPGIAMATHK DDEERFFPSN 541 GILIFGKQNA ARDNADYSDV MLTSEEEIKT TNPVATEEYG IVADNLQQQN TAPQIGTVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL IKNTPVPADP 661 PTTFNQSKLN SFITQYSTGQ VSVEIEWELQ KENSKRWNPE IQYTSNYYKS TSVDFAVNTE 721 GVYSEPRPIG TRYLTRNL
[0543] SEQ ID NO: 2051: AAV4 VP1 capsid reference sequence 1 MTDGYLPDWL EDNLSEGVRE WWALQPGAPK PKANQQHQDN ARGLVLPGYK YLGPGNGLDK 61 GEPVNAADAA ALEHDKAYDQ QLKAGDNPYL KYNHADAEFQ QRLQGDTSFG GNLGRAVFQA 121 KKRVLEPLGL VEQAGETAPG KKRPLIESPQ QPDSSTGIGK KGKQPAKKKL VFEDETGAGD 181 GPPEGSTSGA MSDDSEMRAA AGGAAVEGGQ GADGVGNASG DWHCDSTWSE GHVTTTSTRT 241 WVLPTYNNHL YKRLGESLQS NTYNGFSTPW GYFDFNRFHC HFSPRDWQRL INNNWGMRPK 301 AMRVKIFNIQ VKEVTTSNGE TTVANNLTST VQIFADSSYE LPYVMDAGQE GSLPPFPNDV 361 FMVPQYGYCG LVTGNTSQQQ TDRNAFYCLE YFPSQMLRTG NNFEITYSFE KVPFHSMYAH 421 SQSLDRLMNP LIDQYLWGLQ STTTGTTLNA GTATTNFTKL RPTNFSNFKK NWLPGPSIKQ 481 QGFSKTANQN YKIPATGSDS LIKYETHSTL DGRWSALTPG PPMATAGPAD SKFSNSQLIF 541 AGPKQNGNTA TVPGTLIFTS EEELAATNAT DTDMWGNLPG GDQSNSNLPT VDRLTALGAV 601 PGMVWQNRDI YYQGPIWAKI PHTDGHFHPS PLIGGFGLKH PPPQIFIKNT PVPANPATTF 661 SSTPVNSFIT QYSTGQVSVQ IDWEIQKERS KRWNPEVQFT SNYGQQNSLL WAPDAAGKYT 721 EPRAIGTRYL THHL
[0544] SEQ ID NO: 2052: AAV7 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD NGRGLVLPGY KYLGPFNGLD Page 114 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEGAKTAP AKKRPVEPSP QRSPDSSTGI GKKGQQPARK RLNFGQTGDS 181 ESVPDPQPLG EPPAAPSSVG SGTVAAGGGA PMADNNEGAD GVGNASGNWH CDSTWLGDRV 241 ITTSTRTWAL PTYNNHLYKQ ISSETAGSTN DNTYFGYSTP WGYFDFNRFH CHFSPRDWQR 301 LINNNWGFRP KKLRFKLFNI QVKEVTTNDG VTTIANNLTS TIQVFSDSEY QLPYVLGSAH 361 QGCLPPFPAD VFMIPQYGYL TLNNGSQSVG RSSFYCLEYF PSQMLRTGNN FEFSYSFEDV 421 PFHSSYAHSQ SLDRLMNPLI DQYLYYLART QSNPGGTAGN RELQFYQGGP STMAEQAKNW 481 LPGPCFRQQR VSKTLDQNNN SNFAWTGATK YHLNGRNSLV NPGVAMATHK DDEDRFFPSS 541 GVLIFGKTGA TNKTTLENVL MTNEEEIRPT NPVATEEYGI VSSNLQAANT AAQTQVVNNQ 601 GALPGMVWQN RDVYLQGPIW AKIPHTDGNF HPSPLMGGFG LKHPPPQILI KNTPVPANPP 661 EVFTPAKFAS FITQYSTGQV SVEIEWELQK ENSKRWNPEI QYTSNFEKQT GVDFAVDSQG 721 VYSEPRPIGT RYLTRNL
[0545] SEQ ID NO: 2053: AAV10 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEAAKTAP GKKRPVEPSP QRSPDSSTGI GKKGQQPAKK RLNFGQTGES 181 ESVPDPQPIG EPPAGPSGLG SGTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV 241 ITTSTRTWAL PTYNNHLYKQ ISNGTSGGST NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLSFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE YQLPYVLGSA 361 HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY FPSQMLRTGN NFEFSYTFED 421 VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR TQSTGGTQGT QQLLFSQAGP ANMSAQAKNW 481 LPGPCYRQQR VSTTLSQNNN SNFAWTGATK YHLNGRDSLV NPGVAMATHK DDEERFFPSS 541 GVLMFGKQGA GRDNVDYSSV MLTSEEEIKT TNPVATEQYG VVADNLQQAN TGPIVGNVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL IKNTPVPADP 661 PTTFSQAKLA SFITQYSTGQ VSVEIEWELQ KENSKRWNPE IQYTSNYYKS TNVDFAVNTE 721 GTYSEPRPIG TRYLTRNL
[0546] SEQ ID NO: 2054: AAV11 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEGAKTAP GKKRPLESPQ EPDSSSGIGK KGKQPARKRL NFEEDTGAGD 181 GPPEGSDTSA MSSDIEMRAA PGGNAVDAGQ GSDGVGNASG DWHCDSTWSE GKVTTTSTRT 241 WVLPTYNNHL YLRLGTTSSS NTYNGFSTPW GYFDFNRFHC HFSPRDWQRL INNNWGLRPK 301 AMRVKIFNIQ VKEVTTSNGE TTVANNLTST VQIFADSSYE LPYVMDAGQE GSLPPFPNDV 361 FMVPQYGYCG IVTGENQNQT DRNAFYCLEY FPSQMLRTGN NFEMAYNFEK VPFHSMYAHS 421 QSLDRLMNPL LDQYLWHLQS TTSGETLNQG NAATTFGKIR SGDFAFYRKN WLPGPCVKQQ 481 RFSKTASQNY KIPASGGNAL LKYDTHYTLN NRWSNIAPGP PMATAGPSDG DFSNAQLIFP 541 GPSVTGNTTT SANNLLFTSE EEIAATNPRD TDMFGQIADN NQNATTAPIT GNVTAMGVLP 601 GMVWQNRDIY YQGPIWAKIP HADGHFHPSP LIGGFGLKHP PPQIFIKNTP VPANPATTFT 661 AARVDSFITQ YSTGQVAVQI EWEIEKERSK RWNPEVQFTS NYGNQSSMLW APDTTGKYTE 721 PRVIGSRYLT NHL
[0547] SEQ ID NO: 2055: AAV12 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NGRGLVLPGY KYLGPFNGLD 61 KGEPVNEADA AALEHDKAYD KQLEQGDNPY LKYNHADAEF QQRLATDTSF GGNLGRAVFQ 121 AKKRILEPLG LVEEGVKTAP GKKRPLEKTP NRPTNPDSGK APAKKKQKDG EPADSARRTL 181 DFEDSGAGDG PPEGSSSGEM SHDAEMRAAP GGNAVEAGQG ADGVGNASGD WHCDSTWSEG 241 RVTTTSTRTW VLPTYNNHLY LRIGTTANSN TYNGFSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGLRPKS MRVKIFNIQV KEVTTSNGET TVANNLTSTV QIFADSTYEL PYVMDAGQEG 361 SFPPFPNDVF MVPQYGYCGV VTGKNQNQTD RNAFYCLEYF PSQMLRTGNN FEVSYQFEKV Page 115 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 421 PFHSMYAHSQ SLDRMMNPLL DQYLWHLQST TTGNSLNQGT ATTTYGKITT GDFAYYRKNW 481 LPGACIKQQK FSKNANQNYK IPASGGDALL KYDTHTTLNG RWSNMAPGPP MATAGAGDSD 541 FSNSQLIFAG PNPSGNTTTS SNNLLFTSEE EIATTNPRDT DMFGQIADNN QNATTAPHIA 601 NLDAMGIVPG MVWQNRDIYY QGPIWAKVPH TDGHFHPSPL MGGFGLKHPP PQIFIKNTPV 661 PANPNTTFSA ARINSFLTQY STGQVAVQID WEIQKEHSKR WNPEVQFTSN YGTQNSMLWA 721 PDNAGNYHEL RAIGSRFLTH HL
[0548] SEQ ID NO: 2056: AAV13 VP1 capsid reference sequence 1 MTDGYLPDWL EDNLSEGVRE WWALQPGAPK PKANQQHQDN ARGLVLPGYK YLGPGNGLDK 61 GEPVNAADAA ALEHDKAYDQ QLKAGDNPYL KYNHADAEFQ ERLQEDTSFG GNLGRAVFQA 121 KKRILEPLGL VEEAAKTAPG KKRPVEQSPA EPDSSSGIGK SGQQPARKRL NFGQTGDTES 181 VPDPQPLGQP PAAPSGVGST TMASGGGAPM ADNNEGADGV GNSSGNWHCD SQWLGDRVIT 241 TSTRTWALPT YNNHLYKQIS SQSGATNDNH YFGYSTPWGY FDFNRFHCHF SPRDWQRLIN 301 NNWGFRPKRL NFKLFNIQVK EVTQNDGTTT IANNLTSTVQ VFTDSEYQLP YVLGSAHQGC 361 LPPFPADVFM VPQYGYLTLN NGSQAVGRSS FYCLEYFPSQ MLRTGNNFQF SYTFEDVPFH 421 SSYAHSQSLD RLMNPLIDQY LYYLNRTQTA SGTQQSRLLF SQAGPTSMSL QAKNWLPGPC 481 YRQQRLSKQA NDNNNSNFPW TGATKYHLNG RDSLVNPGPA MASHKDDKEK FFPMHGTLIF 541 GKEGTNANNA DLENVMITDE EEIRTTNPVA TEQYGTVSNN LQNSNAGPTT GTVNHQGALP 601 GMVWQDRDVY LQGPIWAKIP HTDGHFHPSP LMGGFGLKHP PPQIMIKNTP VPANPPTNFS 661 AAKFASFITQ YSTGQVSVEI EWELQKENSK RWNPEIQYTS NYNKSVNVDF TVDTNGVYSE 721 PRPIGTRYLT RNL
[0549] SEQ ID NO: 2057: AAVhu68 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY KYLGPGNGLD 61 KGEPVNEADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ 121 AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP QEPDSSVGIG KSGAQPAKKR LNFGQTGDTE 181 SVPDPQPIGE PPAAPSGVGS LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI 241 TTSTRTWALP TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR 301 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY QLPYVLGSAH 361 EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF PSQMLRTGNN FQFSYEFENV 421 PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT INGSGQNQQT LKFSVAGPSN MAVQGRNYIP 481 GPSYRQQRVS TTVTQNNNSE FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS 541 LIFGKQGTGR DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG 601 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK NTPVPADPPT 661 AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYYKSNN VEFAVNTEGV 721 YSEPRPIGTR YLTRNL
[0550] SEQ ID NO: 2058: AAVrh10 VP1 capsid reference sequence 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY KYLGPFNGLD 61 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF QERLQEDTSF GGNLGRAVFQ 121 AKKRVLEPLG LVEEGAKTAP GKKRPVEPSP QRSPDSSTGI GKKGQQPAKK RLNFGQTGDS 181 ESVPDPQPIG EPPAGPSGLG SGTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV 241 ITTSTRTWAL PTYNNHLYKQ ISNGTSGGST NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLNFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE YQLPYVLGSA 361 HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY FPSQMLRTGN NFEFSYQFED 421 VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR TQSTGGTAGT QQLLFSQAGP NNMSAQAKNW 481 LPGPCYRQQR VSTTLSQNNN SNFAWTGATK YHLNGRDSLV NPGVAMATHK DDEERFFPSS 541 GVLMFGKQGA GKDNVDYSSV MLTSEEEIKT TNPVATEQYG VVADNLQQQN AAPIVGAVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL IKNTPVPADP 661 PTTFSQAKLA SFITQYSTGQ VSVEIEWELQ KENSKRWNPE IQYTSNYYKS TNVDFAVNTD 721 GTYSEPRPIG TRYLTRNL Page 116 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0551] The disclosure is further illustrated by the following example. An example is provided for illustrative purposes only. It is not to be construed as limiting the scope or content of the disclosure in any way.
[0552] All publications, patent applications, patents, and other references mentioned herein, including GenBank Accession Numbers, are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein. ENUMERATED EMBODIMENTS
[0553] Embodiment 1. A recombinant adeno-associated virus (rAAV) particle comprising:
[0554] (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein:
[0555] (i) the peptide insertion comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; and
[0556] (ii) the peptide insertion site is in a variable region (VR) of the parental AAV capsid protein, and
[0557] (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.
[0558] Embodiment 2. A recombinant adeno-associated virus (rAAV) particle comprising:
[0559] (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: Page 117 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0560] (i) the peptide insertion comprises a sequence provided in Table 1 or Table 3; and
[0561] (ii) the peptide insertion site is in a variable region of the parental AAV capsid protein, and
[0562] (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.
[0563] Embodiment 3. The rAAV particle of embodiment 1 or 2, wherein the insertion site is located between two adjacent amino acids in the variable region of the parental AAV capsid protein.
[0564] Embodiment 4. The rAAV particle of embodiment 1 or 2, wherein the insertion site is located between two non-adjacent amino acids in the variable region of the parental AAV capsid protein.
[0565] Embodiment 5. The rAAV particle of any one of the preceding embodiments, wherein the insertion of the heterologous peptide replaces a contiguous stretch of amino acids of the parental AAV capsid protein.
[0566] Embodiment 6. The rAAV particle of any one of embodiments 1-4, wherein the insertion of the heterologous peptide does not replace a contiguous stretch of amino acids of the parental AAV capsid protein.
[0567] Embodiment 7. The rAAV particle of any one of the preceding embodiments, wherein the peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.
[0568] Embodiment 8. The rAAV particle of any one of the preceding embodiments, wherein the peptide insertion is in VR-VIII of the parental AAV capsid protein.
[0569] Embodiment 9. The rAAV particle of embodiment 6, wherein the parental AAV capsid protein is an AAV9 capsid protein and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. Page 118 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0570] Embodiment 10. The rAAV particle of embodiment 8 or 9, wherein the insertion site is located between amino acids 588 and 589 of VP1 of an AAV9 capsid protein or the corresponding position in VP1 of parental AAV capsid protein.
[0571] Embodiment 11. The rAAV particle of any one of embodiments 8-10, wherein the insertion site is located between amino acids 588 and 589 of VP2 of an AAV9 capsid protein or the corresponding position in the VP2 of another parental AAV capsid protein.
[0572] Embodiment 12. The rAAV particle of any one of embodiments 8-11, wherein the insertion site is located between amino acids 588 and 589 of VP3 of an AAV9 capsid protein or the corresponding position in the VP3 of another parental AAV capsid protein.
[0573] Embodiment 13. The rAAV particle of any one of the preceding embodiments, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the sequence of SEQ ID NO: 75, and (2) one or more sequences of VP1, VP2, or VP3 of the AAV9 capsid protein.
[0574] Embodiment 14. The rAAV particle of any one of embodiments 1-12, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the consensus sequence of SEQ ID NO: 1, and (2) one or more sequences of VP1, VP2, or VP3 of the AAV9 capsid protein.
[0575] Embodiment 15. The rAAV particle of embodiment 14, wherein the peptide insertion comprises a sequence provided in Table 2 or Table 4.
[0576] Embodiment 16. The rAAV particle of embodiment 14 or 15, wherein the peptide insertion comprises the sequence of SEQ ID NO: 14 (IPQGVYI).
[0577] Embodiment 17. The rAAV particle of embodiment 14 or 15, wherein the peptide insertion comprises the sequence of SEQ ID NO: 18 (KGGQVYI).
[0578] Embodiment 18. The rAAV particle of embodiment 14 or 15, wherein the peptide insertion comprises the sequence of SEQ ID NO: 24 (NNQGVYI).
[0579] Embodiment 19. The rAAV particle of embodiment 14 or 15, wherein the peptide insertion comprises the sequence of SEQ ID NO: 44 (TNHGVYI). Page 119 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0580] Embodiment 20. The rAAV particle of embodiment 14 or 15, wherein the peptide insertion comprises the sequence of SEQ ID NO: 47 (TQHGVYI).
[0581] Embodiment 21. The rAAV particle any one of embodiments 1-12, wherein the peptide insertion comprises a sequence provided in Table 3.
[0582] Embodiment 22. The rAAV particle of embodiment 15 or 21, wherein the peptide insertion comprises the sequence of SEQ ID NO: 75 (TTMGVYI).
[0583] Embodiment 23. The rAAV particle of any one of the preceding embodiments, wherein the variant AAV capsid protein confers increased infectivity and / or transduction of a central nervous system (CNS) cell compared to the infectivity and / or transduction of the CNS cell by a control AAV particle comprising the corresponding parental AAV capsid protein.
[0584] Embodiment 24. The rAAV particle of embodiment 23, wherein the variant AAV capsid protein confers at least 1.5-fold increased infectivity and / or transduction of a CNS cell compared to the infectivity and / or transduction of the CNS cell by a control AAV particle comprising the corresponding parental AAV capsid protein.
[0585] Embodiment 25. The rAAV particle of embodiment 23 or 24, wherein the CNS cell comprises a CNS epithelial cell, a nerve cell, a CNS connective tissue cell, a stem cell or progenitor cell, a CNS immune cell, a spinal cord cell, or combinations thereof.
[0586] Embodiment 26. The rAAV particle of embodiment 25, wherein the CNS epithelial cell comprises a cell that lines one or more brain ventricles.
[0587] Embodiment 27. The rAAV particle of embodiment 25, wherein the nerve cell comprises nerve support cells, e.g., astrocytes, glial cells, or Schwann cells.
[0588] Embodiment 28. The rAAV particle of embodiment 25, wherein the CNS connective tissue cell comprises fat cells or meninges cells, or both.
[0589] Embodiment 29. The rAAV particle of any one of the preceding embodiments, wherein the variant AAV capsid protein further comprises one or more modifications to an amino acid sequence flanking the peptide insertion site. Page 120 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0590] Embodiment 30. The rAAV particle of any one of embodiments 27-29, wherein the one or more modifications are within about 10 amino acids upstream or downstream of the location of the peptide insertion site, e.g., within about 5 amino acids upstream or downstream of the location of the peptide insertion site.
[0591] Embodiment 31. The rAAV particle of any one of embodiments 27-30, wherein the one or more modifications comprises an insertion, deletion, mutation, or combinations thereof.
[0592] Embodiment 32. The rAAV particle of any one of the preceding embodiments wherein the variant AAV capsid protein further comprises one or more modifications to an amino acid sequence that is at or near a glycan binding region.
[0593] Embodiment 33. The rAAV particle of embodiment 32, wherein the one or more modifications reduces glycan binding.
[0594] Embodiment 34. The rAAV particle of embodiment 32 or 33, wherein the glycan is galactose.
[0595] Embodiment 35. The rAAV particle of any one of embodiments 27-34, wherein the one or more modifications is at or between amino acids: (a) 271 and 272 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (b) 446 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (c) 470 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (e) 489 and 545 of VP1 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (f) 591 and 621 of VP1 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; or (g) any combination, or all, of (a)-(f).
[0596] Embodiment 36. The rAAV particle of any one of the preceding embodiments, wherein the variant AAV capsid protein has at least 90% identity relative to a parental AAV capsid protein. Page 121 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0597] Embodiment 37. The rAAV particle of embodiment 36, wherein percent identity is determined by comparing the sequence of the variant AAV capsid protein without the peptide insertion, with the parental AAV capsid protein.
[0598] Embodiment 38. The rAAV particle of embodiment 37, wherein the variant AAV capsid protein and the parental AAV capsid protein have 100% identity when: (a) the peptide insertion in the variant AAV capsid protein is not taken into account in the sequence comparison; and (b) the variant AAV capsid protein does not have one or more modifications other than the peptide insertion.
[0599] Embodiment 39. The rAAV particle of embodiment 37, wherein the variant AAV capsid protein and the parental AAV capsid protein have less than 100% identity when: (a) the peptide insertion in the variant AAV capsid protein is not taken into account in the sequence comparison; and (b) the variant AAV capsid protein comprises one or more modifications other than the peptide insertion.
[0600] Embodiment 40. The rAAV particle of any one of the preceding embodiments, wherein the parental AAV capsid protein is an AAV9 capsid protein of SEQ ID NO: 2001.
[0601] Embodiment 41. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV1 capsid protein of SEQ ID NO: 2002.
[0602] Embodiment 42. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV2 capsid protein of SEQ ID NO: 2003.
[0603] Embodiment 43. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV3B capsid protein of SEQ ID NO: 2010.
[0604] Embodiment 44. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV5 capsid protein of SEQ ID NO: 2004.
[0605] Embodiment 45. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV6 capsid protein of SEQ ID NO: 2005.
[0606] Embodiment 46. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV8 capsid protein of SEQ ID NO: 2006. Page 122 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0607] Embodiment 47. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV4 capsid protein of SEQ ID NO: 2051.
[0608] Embodiment 48. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV7 capsid protein of SEQ ID NO: 2052.
[0609] Embodiment 49. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV10 capsid protein of SEQ ID NO: 2053.
[0610] Embodiment 50. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV11 capsid protein of SEQ ID NO: 2054.
[0611] Embodiment 51. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV12 capsid protein of SEQ ID NO: 2055.
[0612] Embodiment 52. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAV13 capsid protein of SEQ ID NO: 2056.
[0613] Embodiment 53. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAVhu68 capsid protein of SEQ ID NO: 2057.
[0614] Embodiment 54. The rAAV particle of any one of embodiments 1-39, wherein the parental AAV capsid protein is an AAVrh10 capsid protein of SEQ ID NO: 2058.
[0615] Embodiment 55. The rAAV particle of any one of the preceding embodiments, wherein the payload is or comprises a polypeptide.
[0616] Embodiment 56. The rAAV particle of embodiment 55, wherein the polypeptide is or comprises: (i) a CRISPR-Cas protein, or a variant or a fragment thereof; (ii) a Zinc finger protein, or a variant or a fragment thereof; (iii) a TALEN protein, or a variant or a fragment thereof; (iv) a base editor, or a variant or a fragment thereof; (v) a prime editor, or a variant or a fragment thereof; and / or (vi) a meganuclease or a variant or a fragment thereof.
[0617] Embodiment 57. The rAAV particle of embodiment 56, wherein the CRISPR-Cas protein is a Type II, Type V or Type VI CRISPR-Cas protein, e.g., a Cas9 protein, a Cas12a protein, a Cas12b protein, a Cas12c protein, a Cas12d protein, a Cas12e protein, a Cas12f protein, a Cas12g protein, a Cas12h protein, a Cas12i protein, a Cas13a protein, a Cas13b protein or a variant or fragment of any of the foregoing. Page 123 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT)
[0618] Embodiment 58. The rAAV particle of embodiment 56 or 57, wherein the polypeptide is associated with a CNS disorder.
[0619] Embodiment 59. The rAAV particle of embodiment 58, wherein the CNS disorder is a result of a genetic abnormality.
[0620] Embodiment 60. The rAAV particle of embodiment 58, wherein the CNS disorder is a not a result of a genetic abnormality.
[0621] Embodiment 61. The rAAV particle of embodiment 58, wherein the CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies, or combinations thereof.
[0622] Embodiment 62. The rAAV particle of embodiment 55, wherein the polypeptide is an enzyme.
[0623] Embodiment 63. The rAAV particle of embodiment 55, wherein the polypeptide is an antibody.
[0624] Embodiment 64. The rAAV particle of embodiment 55, wherein the polypeptide is a secreted protein.
[0625] Embodiment 65. The rAAV particle of any one of embodiments 1-54, wherein the payload is or comprises an RNA molecule.
[0626] Embodiment 66. The rAAV particl...
Claims
Attorney Docket No.: 2011256-2476 (P1844PCT) CLAIMS We claim:
1. A recombinant adeno-associated virus (rAAV) particle comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insertion comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3and X4are independently any amino acid, and X5is Y, W or F; and (ii) the peptide insertion site is in a variable region (VR) of the parental AAV capsid protein, and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.
2. A recombinant adeno-associated virus (rAAV) particle comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insertion comprises a sequence provided in Table 1 or Table 3; and (ii) the peptide insertion site is in a variable region of the parental AAV capsid protein, and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.
3. The rAAV particle of claim 1 or 2, wherein the insertion site is located between two adjacent amino acids in the variable region of the parental AAV capsid protein.
4. The rAAV particle of any one of the preceding claims, wherein the insertion of the heterologous peptide replaces a contiguous stretch of amino acids of the parental AAV capsid protein. Page 139 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 5. The rAAV particle of any one of the preceding claims, wherein the peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.
6. The rAAV particle of any one of the preceding claims, wherein the peptide insertion is in VR-VIII of the parental AAV capsid protein.
7. The rAAV particle of claim 6, wherein the parental AAV capsid protein is an AAV9 capsid protein and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.
8. The rAAV particle of claim 6 or 7, wherein the insertion site is located between amino acids 588 and 589 of VP1, VP2 and / or VP3 of an AAV9 capsid protein or the corresponding position in VP1 of parental AAV capsid protein.
9. The rAAV particle of any one of the preceding claims, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the sequence of SEQ ID NO: 75, SEQ ID NO: 1, SEQ ID NO: 77 or SEQ ID NO: 78, and (2) one or more sequences of VP1, VP2, or VP3 of the AAV9 capsid protein.
10. The rAAV particle of claim 9, wherein the peptide insertion comprises a sequence provided in Table 2 or Table 4.
11. The rAAV particle any one of claims 1-8, wherein the peptide insertion comprises a sequence provided in Table 3.
12. The rAAV particle of any one of claims 9-11, wherein the peptide insertion comprises the sequence of SEQ ID NO: 75 (TTMGVYI).
13. The rAAV particle of any one of the preceding claims, wherein the variant AAV capsid protein confers increased infectivity and / or transduction of a central nervous system (CNS) cell Page 140 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) compared to the infectivity and / or transduction of the CNS cell by a control AAV particle comprising the corresponding parental AAV capsid protein.
14. The rAAV particle of claim 13, wherein the variant AAV capsid protein confers at least 1.5-fold increased infectivity and / or transduction of a CNS cell compared to the infectivity and / or transduction of the CNS cell by a control AAV particle comprising the corresponding parental AAV capsid protein.
15. The rAAV particle of claim 13 or 14, wherein the CNS cell comprises a CNS epithelial cell, a nerve cell, a CNS connective tissue cell, a stem cell or progenitor cell, a CNS immune cell, a spinal cord cell, or combinations thereof, optionally, wherein; (a) the CNS epithelial cell comprises a cell that lines one or more brain ventricles; (b) the nerve cell comprises nerve support cells, e.g., astrocytes, glial cells, or Schwann cells; and / or; (c) the CNS connective tissue cell comprises fat cells or meninges cells, or both; and / or one or more combinations thereof.
16. The rAAV particle of any one of the preceding claims, wherein the variant AAV capsid protein further comprises one or more modifications to an amino acid sequence flanking the peptide insertion site, optionally wherein the one or more modifications are within about 10 amino acids upstream or downstream of the location of the peptide insertion site, e.g., within about 5 amino acids upstream or downstream of the location of the peptide insertion site.
17. The rAAV particle of any one of the preceding claims wherein the variant AAV capsid protein further comprises one or more modifications to an amino acid sequence that is at or near a glycan binding region, optionally wherein the one or more modifications reduces glycan binding.
18. The rAAV particle of claim 16 or 17, wherein the one or more modifications is at or between amino acids: Page 141 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) (a) 271 and 272 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (b) 446 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (c) 470 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (d) 501 and 505 (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (e) 489 and 545 of VP1 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; (f) 591 and 621 of VP1 of an AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein; or (g) any combination, or all, of (a)-(f).
19. The rAAV particle of any one of the preceding claims, wherein the variant AAV capsid protein has at least 90% identity relative to a parental AAV capsid protein.
20. The rAAV particle of claim 19, wherein percent identity is determined by comparing the sequence of the variant AAV capsid protein without the peptide insertion, with the parental AAV capsid protein.
21. The rAAV particle of any one of the preceding claims, wherein the parental AAV capsid protein is an AAV9 capsid protein of SEQ ID NO: 2001.
22. The rAAV particle of any one of the preceding claims, wherein the payload is or comprises a polypeptide.
23. The rAAV particle of claim 22, wherein the polypeptide is or comprises: (i) a CRISPR-Cas protein, optionally, wherein the CRISPR-Cas protein is a Type II, Type V or Type VI CRISPR-Cas protein, e.g., a Cas9 protein, a Cas12a protein, a Cas12b protein, a Page 142 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Cas12c protein, a Cas12d protein, a Cas12e protein, a Cas12f protein, a Cas12g protein, a Cas12h protein, a Cas12i protein, a Cas13a protein, a Cas13b protein or a variant or fragment of any of the foregoing; (ii) a Zinc finger protein, or a variant or a fragment thereof; (iii) a TALEN protein, or a variant or a fragment thereof; (iv) a base editor, or a variant or a fragment thereof; (v) a prime editor, or a variant or a fragment thereof; (vi) a meganuclease or a variant or a fragment thereof; (vii) an enzyme; (viii) an antibody; and / or (ix) a secreted protein.
24. The rAAV particle of claim 23, wherein the polypeptide is associated with a CNS disorder.
25. The rAAV particle of any one of claims 1-21, wherein the payload is or comprises an RNA molecule, optionally, wherein the RNA molecule is an siRNA, a miRNA, a gRNA, an antisense RNA, a circular RNA, an snRNA or an aptamer.
26. The rAAV particle of claim 25, wherein the RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with a CNS disorder.
27. The rAAV particle of claim 24 or 26, wherein the CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies, or combinations thereof.
28. The rAAV particle of any one of claims 1-21, wherein the payload is or comprises a DNA molecule. Page 143 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 29. The rAAV particle of any one of the preceding claims, wherein the nucleotide sequence encoding a payload is operably linked to a promoter; optionally, wherein the promoter is or comprises a CNS promoter or a chicken beta actin hybrid (CBh) promoter.
30. The rAAV particle of claim 29, wherein the CNS promoter is chosen from: a GFAP promoter, a SYN1 promoter, a NSE / RU5’ promoter, a neuroactive peptide cholecystokinin (CCK) promoter, a myelin basic promoter (MBP), a human myelin associated glycoprotein promoter, a phosphate-activated glutaminase (PAG) promoter, a vesicular glutamate transporter (vGLUT) promoter, a glutamic acid decarboxylase (GAD) promoter, Camk2a promoter, TH (tyrosine hydroxylase) promoter, Hb9 promoter, CNP promoter, NES (nestin) promoter, Tub1a promoter, SST (somatostatin) promoter, MeCP2 promoter, or any combination thereof.
31. A pharmaceutical composition comprising: (a) a rAAV particle of any one of the preceding claims; and (b) a pharmaceutically acceptable excipient.
32. A method of delivering a payload to a CNS cell, comprising administering the pharmaceutical composition of claim 31 to the CNS cell, optionally, wherein; (a) the CNS cell is in vitro; or (b) the CNS cell is in vivo.
33. The method of claim 32, wherein the CNS cell is from a subject that has, or has been determined to have, a CNS disorder.
34. A method of treating a subject having a CNS disorder and / or ameliorating a symptom of a CNS disorder in a subject, the method comprising administering to the subject the pharmaceutical composition of claim 31.
35. The method of claim 33 or 34, wherein the CNS disorder is chosen from Friedreich’s Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington’s Page 144 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) Disease, Pompe Disease, Myotonic Dystrophy Type 1, Glut1 Deficiency Syndrome (De Vivo Syndrome), Tay-Sachs, Spinal Muscular Atrophy, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Danon disease, Rett Syndrome, Angelman Syndrome, Parkinson’s disease, tauopathies, genetic epilepsies, or combinations thereof.
36. The method of any one of claims 32-35, wherein the pharmaceutical composition is administered via a route of administration chosen from: intravenous, intraarterial, intracoronary, intraparenchymal, subpial, intrathecal, intraocular, intracerebroventricular (ICV), intracisternal magna (ICM), or intramuscular.
37. The method of any one of claims 33-36, wherein the subject is a human.
38. An isolated cell transduced with the rAAV particle of any one of claims 1-30.
39. An isolated nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprise a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; (ii) the peptide insertion site is in a variable region (VR) of the parental AAV capsid protein.
40. The isolated nucleic acid of claim 39, wherein the peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of AAV9 of the parental AAV capsid protein.
41. The isolated nucleic acid of claim 39 or 40, wherein the peptide insertion is in VR-VIII of the parental AAV capsid protein, optionally, wherein the parental AAV capsid protein is an AAV9 capsid protein and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. Page 145 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) 42. An isolated cell comprising the nucleic acid of any one of claims 39-41.
43. A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; (ii) the peptide insertion site is in a variable region (VR) of the parental AAV capsid protein.
44. The variant AAV capsid protein of claim 43, wherein the peptide insertion is in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.
45. A composition comprising a targeting moiety and a payload, wherein the targeting moiety comprises a peptide comprising a sequence of X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F.
46. A composition comprising a targeting moiety and a payload, wherein the targeting moiety comprises a peptide comprising a sequence provided in Table 1, Table 2, Table 3 or Table 4.
47. The composition of claim 45 or 46, wherein the targeting moiety is; (a) conjugated or fused to the payload; and / or (b) inserted into a viral protein, e.g., an AAV capsid.
48. The composition of any one of claims 45-47, wherein the targeting moiety is a CNS- targeting moiety.
49. A recombinant adeno-associated virus (rAAV) particle comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: Page 146 of 148 12404689v1Attorney Docket No.: 2011256-2476 (P1844PCT) (i) the peptide insertion comprises a sequence of at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in any one of Table 1, Table 2, Table 3, or Table 4; and (ii) the peptide insertion site is in a variable region (VR) of the parental AAV capsid protein, and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.
50. A composition comprising a targeting moiety and a payload, wherein the targeting moiety comprises a sequence of at least 4, at least 5, or at least 6 contiguous amino acids of a sequence provided in any one of Table 1, Table 2, Table 3, or Table 4. Page 147 of 148 12404689v1