Genotyping array

EP4802093A1Pending Publication Date: 2026-09-09ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024802410
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-10-30
Filing Date
2024-10-24
Publication Date
2026-09-09

AI Technical Summary

Technical Problem

Existing genotyping technologies face challenges in accurately genotyping SNPs located in problematic flanking regions, which can lead to issues such as hairpin formation, non-specific binding, and pseudogene interference.

Method used

The genotyping array employs probes with degenerate bases, intentionally mismatched bases, and modified complementary regions to specifically target SNPs associated with problematic flanking regions, thereby reducing hairpin formation, disrupting mononucleotide stretches, and preventing off-target hybridization.

Benefits of technology

This approach significantly enhances the success rate of genotyping by reducing non-specific binding and off-target interference, leading to more accurate genotype calls and improved reliability in genotyping arrays.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024052733_08052025_PF_FP_ABST
    Figure US2024052733_08052025_PF_FP_ABST
Patent Text Reader

Abstract

A genotyping array includes first and second sample probes. Each first sample probe a) is a single probe having a 3' terminus that complements a base directly adjacent to a query site of a respective sample fragment or b) includes two probes, each having a 3' terminus that complements a base at the query site of the respective sample fragment, or c) a combination of a) and b). The second sample probe includes a target probe selected from: i) a first target probe including a degenerate base within a predetermined number of bases of its 3' terminus; ii) a second target probe including predetermined mismatched bases with a first off-target fragment; iii) a third target probe including a complement of a known mismatch region of a second off-target fragment in place of a known complementary region of the second off-target fragment; and iv) any combination of i) through iii).
Need to check novelty before this filing date? Find Prior Art

Description

GENOTYPING ARRAYCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application S.N. 63 / 594,391 , filed October 30, 2023, the contents of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 22, 2024, is named IP-2711 - PCT_SL.xml and is 344,950 bytes in size.BACKGROUND

[0003] Personalized medicine uses an individual’s genetic profile to make decisions pertaining to preventative measures, diagnosis, and / or treatments. In the realm of treatments, pharmacogenomics (PGx) involves the analysis of genetic variants, such as single nucleotide polymorphisms (SNPs), to identify associations with drug response. It has been found that deoxyribonucleic acid (DNA) methylation can affect drug-response-related genes, and thus can influence therapeutic outcomes. DNA methylation is an epigenetic mechanism in the mammalian genome that involves the transfer of a methyl group onto the C5 position of the cytosine to form 5- methylcytosine. In addition to affecting variation in drug response, DNA methylation status can also affect variation in gene expression by recruiting proteins involved in gene repression or by inhibiting the binding of transcription factor(s) to DNA.SUMMARY

[0004] The genotyping array disclosed herein includes a variety of sample probes that are designed to query a single base at the 3’ end of the probe. Some of the sample probes are specifically designed to target single nucleotide polymorphisms (SNPs) that are known to be associated with problematic flanking regions, which cannegatively impact the SNPs ability to be genotyped. As used herein, “problematic flanking regions” include the 50 base pairs flanking either side of the targeted SNP that have aspects that can inhibit the usefulness of the probe. These aspects may include the tendency to form hairpins or the presence of mononucleotide stretches, each of which can lead to poor target DNA sample fragment binding; or may be high melting temperature (Tm) regions, which can lead to non-specific binding; or include the tendency to hybridize with off-target regions, which can lead to pseudogene interference. The target probes disclosed herein are specifically designed to i) include degenerate bases in predetermined positions relative to the 3’ end, ii) include bases intentionally mismatched with a portion of an off-target DNA sample fragment, and / or iii) have a complementary region that is intentionally deleted and replaced with a mismatched region. These target probes decrease the occurrence of hairpin formation, disrupt mononucleotide stretches, decrease high melting temperature (Tm) regions, and / or decrease the occurrence of hybridization with off-target regions. In turn, the target probes increase the probability that genotyping of the target SNP will be successful.

[0005] The probes described herein may be part of an array, such as a bead array, or part of an assay that is used, for example, in real-time polymerase chain reaction (qPCR), in target capture panels, or in enrichment panels.BRIEF DESCRIPTION OF THE DRAWINGS

[0006] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

[0007] Fig. 1 A depicts a perspective view of an example of the genotyping array disclosed herein;

[0008] Fig. 1 B depicts a cross-sectional view taken along line 1 B-1 B of Fig. 1 A;

[0009] Fig. 2 is a schematic illustration of a first target probe attached to a bead, and a DNA sample fragment hybridized thereto;

[0010] Fig. 3A is a schematic illustration depicting a comparative probe and how both an on-target DNA sample fragment and an off-target DNA sample fragment can hybridize to the comparative probe;

[0011] Fig. 3B is a schematic illustration depicting a second target probe and how the on-target DNA sample fragment can hybridize to the second target probe while the off-target DNA sample fragment is hindered from hybridizing to the second target probe;

[0012] Fig. 4A is a schematic illustration depicting another comparative probe and how both an on-target DNA sample fragment and an off-target DNA sample fragment can hybridize to the other comparative probe;

[0013] Fig. 4B is a schematic illustration depicting a third target probe and how the on-target DNA sample fragment can hybridize to the third target probe while the off-target DNA sample fragment is hindered from hybridizing to the third target probe;

[0014] Fig. 5A is a graph depicting normalized R [the sum of intensities of two channels - red fluorescence and green fluorescence) on the Y axis versus normalized theta [(2 / rr)Tan-1 (green fluorescence / red fluorescence)] on the X axis for DNA sample fragments genotyped with a comparative probe;

[0015] Fig. 5B is a graph depicting normalized R [the sum of intensities of two channels - red fluorescence and green fluorescence) on the Y axis versus normalized theta [(2 / TT)Tan-1 (green fluorescence / red fluorescence)] on the X axis for DNA sample fragments genotyped with an example of the second target probe described herein;

[0016] Fig. 6A is a graph depicting normalized R [the sum of intensities of two channels red fluorescence and green fluorescence) on the Y axis versus normalized theta [(2 / rr)Tan-1 (green fluorescence / red fluorescence)] on the X axis for DNA sample fragments genotyped with a comparative probe; and

[0017] Fig. 6B is a graph depicting normalized R [the sum of intensities of two channels - red fluorescence and green fluorescence) on the Y axis versus normalized theta [(2 / n)Tan-1 (green fluorescence / red fluorescence)] on the X axis for DNA sample fragments genotyped with an example of the third target probe described herein.DETAILED DESCRIPTION

[0018] The genotyping array disclosed herein includes two types of oligonucleotide probes.

[0019] The first type of oligonucleotide probes includes probes that are designed to hybridize selectively to a particular locus in the genome. In some examples, there is a single probe per single nucleotide polymorphism (SNP), and the 3’ end of the probe stops one base short of, i.e., before, the SNP of interest. In other examples, there are two probes per SNP, and the 3’ end of each probe is at the SNP of interest. The two probe design may be desirable for less common A / T and C / G SNPs.

[0020] The second type of oligonucleotide probes includes probes that are specifically designed for genotyping SNPs that are known to be associated with problematic flanking regions. The second type of probes has been found to overcome one or more of the challenges (e.g., hairpin formation, non-specific binding, etc.) often associated with problematic flanking regions. The second type of oligonucleotide probes can also be designed as the single probe per SNP or as two probes per SNP.

[0021] With all the probes of the genotyping array, marker specificity can be conferred by enzymatic single-base extension to incorporate a generically labeled nucleotide (e.g., nucleotides labeled with dinitrophenol (DNP), biotin, etc.). Color fluorescent staining enables detection of the incorporated nucleotide. With the single probe per SNP, GT base calling is by single base extension using two color detection and analysis of the intensity ratio of the two color signals. With the two probes per SNP, GT calling is by allele specific single base extension and analysis of the intensity ratio of the two corresponding probes.

[0022] Some examples of the genotyping array can also be used for methylation detection. In methylation assays, methylated cytosines can be distinguished from nonmethylated cytosines based on their differential reactivity with bisulfite, in which case the latter are converted to uracil and the former are protected from conversion (i.e., they remain cytosines). In some of the examples set forth herein, nucleic acids in a sample are treated with bisulfite, and are detected using an example of the array disclosed herein. When the genotyping array is to be used for methylation detection,the 3’ ends of the probes are designed for genomic CpG positions. It is to be understood that a genomic CpG position refers to a locus where a cytosine nucleotide (C) is followed by a guanine nucleotide (G) in the 5’ to 3’ direction, and where the C and G are linked by a phosphate group.

[0023] Still further, any of the probes described herein (e.g., the first type and / or the second type) may be part of a probe assay that is used in real-time polymerase chain reactions (qPCR), in a target capture panel, or in an enrichment panel. The probes in this assay may or may not be attached to a substrate.

[0024] An example of the genotyping array 10 is depicted in Fig. 1A. The genotyping array 10 includes a substrate 12 having a plurality of depressions 1 defined therein; a plurality of beads 16, each of the plurality of beads 16 positioned within one of the plurality of depressions 14; a plurality of first sample probes 18 or 18’, 18” respectively attached to some of the plurality of beads 16, each of the plurality of first sample probes 18 or 18’, 18” a) being a single probe (i.e., probe 18) having a 3’ terminus that complements a base directly adjacent to a query site of a respective DNA sample fragment or b) including two probes (i.e., probes 18’, 18”), each having a 3’ terminus that complements the base at the query site of the respective DNA sample fragment, or c) a combination of a) and b); and a plurality of second sample probes 20 or 20’, 20” respectively attached to some other of the plurality of beads 16, the plurality of second sample probes 20 or 20’, 20” including a target probe selected from the group consisting of: i) a first target probe (20A, see Fig. 2) including a degenerate base within a predetermined number of bases of its 3’ terminus; ii) a second target probe (20B, see Fig. 3B) including predetermined mismatched bases with a first off- target DNA sample fragment; iii) a third target probe (20C, see Fig. 4B) including a complement of a known mismatch region of a second off-target DNA sample fragment in place of a known complementary region of the second off-target DNA sample fragment; and iv) any combination of i) through iii).

[0025] The substrate 12 may be a single layer base support or a multi-layered structure. In either instance, the substrate 12 includes depressions 14 defined at the surface.

[0026] When the substrate 12 is a single layer base support, examples of suitable materials for the substrate 12 include siloxanes (e.g., epoxy siloxane), glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), polyethylene terephthalate (PET), polycarbonate, cyclic olefins / cyclo- olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceram ics / ceramic oxides, silica (i.e. , silicon dioxide (SiO2)), fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (SisN4), tantalum pentoxide (Ta2Os) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, or the like.

[0027] When the substrate 12 is a multi-layered structure, any of the materials described for the single layer base support may function as a base, and another layer (which has the depressions 14 defined therein) may be positioned on the base. In these examples, the other layer may be any material that can be etched or imprinted to form the depressions 14. Examples of the additional layer include inorganic oxides, such as tantalum oxide (e.g., Ta2Os), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiC>2), or hafnium oxide (e.g., HfC ), or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non- polyhedral oligomeric silsesquioxane epoxy resin, a polyethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.

[0028] Many different layouts of the depressions 14 may be used, including regular, repeating, or non-regular patterns. In an example, the depressions 14 are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 14 and interstitial regions 24 (i.e., regions of the substrate surface wheredepressions 14 are not formed). In still other examples, the layout can be a random arrangement of the depressions 14 and the interstitial regions 24.

[0029] The layout or pattern may be characterized with respect to the density (number) of the depressions 14 in a defined area. For example, the depressions 14 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1 ,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 100,000 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used.

[0030] The layout or pattern of the depressions 14 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 14 to the center of an adjacent depression 14 (center-to-center spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.15 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, or more or less. The average pitch for a particular pattern of depressions 14 can be between one of the lower values and one of the upper values selected from the ranges herein. In an example, the depressions 14 have a pitch (center-to-center spacing) of about 1 .5 pm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.

[0031] The size of each depression 14 is sufficient to receive the bead 16 used in the array 10. In some examples, the diameter of the bead 16 is 200 pm or less (e.g., 200 nm), and the depth and diameter or length and width of the depression 14 may be sufficient to accommodate a single bead 16. The depth can range from about 0.1 pm to about 210 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. The diameter or each of the length and width can range from about 0.1 pm to about 210 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.

[0032] In some instances, the size of the depression 14 is sufficient to physically immobilize the bead 16 in the depression 14. This is depicted in Fig. 1 B. In other instances, a capture agent may be used to immobilize the bead 16 in the depression 14. The capture agent may be any chemical, electrostatic, or hydrophilic / hydrophobic functionalization that can immobilize the bead 16 in the depression 14. One example of a capture agent is a capture primer, and the bead 16 includes a complementary primer that can hybridize to the capture primer. Another example of a capture agent is a first member of a binding pair, and the bead 16 includes a second member of the binding pair (e.g., biotin-avidin or biotin-streptavidin). Still another example of a capture agent is a material that can attract a magnetic bead. The capture agent may be selectively deposited or otherwise selectively introduced (e.g., using masking techniques) into the depressions 14 so that the interstitial regions 24 remain free of the capture agent and thus free of the beads.

[0033] As used herein, the term “bead” refers to a small body made of a rigid or semi-rigid material. The body can have a shape characterized, for example, as a sphere, oval, microsphere, or other recognized particle shape whether having regular or irregular dimensions. Example materials that are useful for beads 16 include, glass, such as modified or functionalized glass; polymeric materials, such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, polyamide, or polytetrafluoroethylene (e.g., TEFLON™ from DuPont); polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; nitrocellulose; resin; silica; silicon and modified silicon; carbon- fiber; or metal. Example beads 16 include controlled pore glass beads, paramagnetic beads, thoria sol, and Sepharose beads. In one example, the beads 16 are silica beads.

[0034] In the examples disclosed herein, the sample probes 18 and 20 or 18’, 18” and 20’, 20” are to capture respective target DNA fragment sequences from the human genome. These target sequences can be from any chromosome, e.g., 1 -22, X, or Y. In other examples, the sample probes 18 and 20 or 18’, 18” and 20’, 20” are to capture respective target DNA fragment sequences from the bovine genome, themaize genome, the canine genome, the ovine genome, porcine genome, or the shrimp genome.

[0035] In the examples disclosed herein, from greater than 90% to less than 100% of the beads 16 in the array 10 have the first sample probes 18 or 18’, 18” attached thereto, and from greater than 0% to less than 10% of the beads 16 in the array 10 have the second sample probes 20 or 20’, 20” attached thereto. In other words, the plurality of second sample probes 20 make up from greater than 0% to less than 10% of a total of the plurality of first sample probes and the plurality of second sample probes. In the examples disclosed herein, from greater than 95% to less than 100% of the beads 16 in the array 10 have the first sample probes 18 or 18’, 18” attached thereto. In some examples, the array 10 includes the first sample probes 18 and / or 18’, 18” and the second sample probes 20 and / or 20’, 20”. Moreover, it is to be understood that any of the probe percentages set forth herein apply to any of the arrays described herein.

[0036] In some examples when the array 10 is to be used for genotyping and not for methylation detection, each of the first sample probes 18 and / or 18’, 18” that is attached to a particular bead 16 is designed for a specific locus (e.g., SNP) of interest.

[0037] The probe 18 is a single probe for a single SNP i.e. , one probe 18 for both alleles. The 3’ end of the probe 18 stops one base before the locus of interest, and single base extension incorporates one of four generically labeled nucleotides that confers allele specificity. The first sample probes 18 are 50-mer probes and are suitable for non-complementary SNPs (e.g., A to C or G). These probes 18 enable genotyping of most loci in most organisms (e.g., about 84% of known SNPs in the human genome).

[0038] The probes 18’ and 18” are corresponding probes because they are designed for the same SNP. As such, there is one probe 18’, 18” for each allele. The 3’ end of each probe 18’, 18” corresponds with one of two possible bases at the locus of interest. A target DNA fragment is capable of hybridizing to the complementary probe 18’, 18”, and single base extension is enabled due to the hybridization at the 3’ end. Alternatively, the 3’ terminus of the other probe 18” or 18’ is not able to hybridizeto the target DNA fragment, and thus single base extension is not enabled. The mismatched base at the locus of interest will inhibit extension.

[0039] When the array 10 is to be used for genotyping and for methylation detection, each of the first sample probes 18 and / or 18’, 18” is a 50-mer probe designed for a specific CpG locus, which is based on the assumption that methylation is regionally correlated within a 50 base pair (bp) span. The sequence of the first sample probes 18 and / or 18’, 18” can be based on the original DNA target strands, the bisulfite converted DNA target strands, and / or the complements of the bisulfite converted DNA target strands.

[0040] In this particular example, the single probe 18 can detect either the methylated state or the unmethylated state of bisulfite converted DNA sample fragment hybridized thereto. The 3’ terminus of each of these probes 18 complements the base directly upstream of the query site. In some examples, the single base extension of the probe 18 results in the addition of a labeled G or A base, complementary to either the methylated C or unmethylated T of the bisulfite converted DNA sample fragment hybridized thereto. In other examples, the probe 18 is designed for the opposite strand and the single base extension results in the addition of a labeled C base (indicative of a methylated locus) or a labeled T base (indicative of an unmethylated locus). The strands upon which the first sample probes 18 are based include 4 or fewer CpG sites. The CpG sites of the probe 18 may be presented by the degenerate nucleotide R or the generate nucleotide Y. It is to be understood that other design principles may be used for these probes 18 (for methylation detection), such as those described in U.S. Patent No. 8,150,626, which is incorporated herein by reference in its entirety.

[0041] Moreover, the probes 18’, 18” can also be used for both genotyping and methylation. The 3’ terminus of each of these probes 18’, 18” is designed to match either the protected cytosine (methylated design) or the thymine base resulting from bisulfite conversion and whole-genome amplification (unmethylated design).

[0042] Like the first sample probe 18, the second sample probe 20 can also be designed as a single probe per locus. Thus, the probe 20 is similar to the probe 18, except that it includes a degenerate base, a mismatched base, or a knownmismatched region as described in reference to Fig. 2, Fig. 3A and Fig. 3B, and Fig. 4A and Fig. 4B. Similarly, like the first sample probes 18’, 18”, the second sample probes 20’, 20” can also be designed as two probes per locus. Thus, the probes 20’, 20” are similar to the probes 18’, 18”, except that they include a degenerate base, a mismatched base, or a known mismatched region as described in reference to Fig. 2, Fig. 3A and Fig. 3B, and Fig. 4A and Fig. 4B. As mentioned, the second sample probes 20 and / or 20’, 20” are designed to specifically target SNPs that are known to be associated with problematic flanking regions as described herein. Thus, these target sample probes 20 and / or 20’, 20” enable genotyping of hard-to-target areas of any genome.

[0043] An example of the first target probe 20A is schematically depicted in Fig. 2. The first target probe 20A is based on the fact that some DNA sample fragments include SNPs that are located near the 3’ end of the probe 20 and that prevent extension of the DNA sample fragment due to the mismatch between the probe 20 or 20’ and 20” and the DNA sample fragment. By “near the 3’ end,” it is meant that the SNP is located, starting at the 3’ end, within 10% of the total bases in the DNA sample fragment. For example, for a 50-mer DNA sample fragment, the SNP is located within 5 bases of the 3’ end. The first target probe 20A includes the degenerate nucleotide B within a predetermined number of bases of its 3’ terminus. The exact position of the degenerate nucleotide B will depend upon the location of the SNP in the particular DNA sample fragment that is to be analyzed using the first target probe 20A. The degenerate nucleotide B is complementary to A, G, and C, and thus allows extension of any DNA sample fragments 22 including any of these bases as the SNP. When at least one of the plurality of second sample probes 20 in the array 10 is the first target probe 20A, the predetermined number of bases (from the 3’ end and at which the degenerate base B can be positioned) is up to 10% of a total number of bases in the probe 20A.

[0044] As described herein, some of the known problematic flanking regions allow both on-target DNA sample fragments 22ON and off-target DNA sample fragments 22OFF to hybridize to the probe P, as depicted in Fig. 3A. The off-target DNA sample fragment 22OFF shown in Fig. 3A includes two bases 26A, 26B that arenaturally mismatched with the probe P. Even with the mismatched bases 26A, 26B, the off-target DNA sample fragment 22OFF is capable of hybridizing to the probe P, due to the complementary nature of the rest of the off-target DNA sample fragment 22OFF.

[0045] The second target probe 20B, shown in Fig. 3B, disrupts the off-target binding shown in Fig. 3A. The second target probe 20B includes predetermined mismatched bases 26C, 26D with both the on-target DNA sample fragment 22ON and with the off-target DNA sample fragment 22OFF. Even with the mismatched bases 26C, 26D, the on-target DNA sample fragment 22ON is capable of hybridizing to the probe P, due to the complementary nature of the rest of the on-target DNA sample fragment 22ON. In contrast, the naturally mismatched bases 26A, 26B of the off-target DNA sample fragment 22OFF in combination with the intentionally included mismatched bases 26C, 26D of the probe 20B create a delta Tm (ATm) between a primer melting temperature of the second target probe 20B and a primer melting temperature of the off-target DNA sample fragment 22oFF that prevents hybridization. As such, when at least one of the plurality of second sample probes 20 is the second target probe 20B, a number of the predetermined mismatched bases 26C, 26D creates the delta Tm between a primer melting temperature of the second target probe and a primer melting temperature of the off-target DNA sample fragment 22OFF. The positioning of the mismatched bases 26C, 26D may be based on the positioning of the naturally mismatched bases 26A, 26B of the off-target DNA sample fragment 22OFF. In particular, the intentionally added mismatched bases 26C, 26D may be offset from the naturally mismatched bases 26A, 26B, thus introducing a higher number of mismatches between the second target probe 20B and the off-target DNA sample fragment 22OFF. Additionally, mismatched bases 26C, 26D positioned closer to the 3’ end may be more sensitive to temperature, and thus fewer bases may be used to achieve the desired delta Tm if they are incorporated closer to the 3’ end. The additional mismatches create a higher delta Tm, which hinder off-target binding, while still allowing on-target binding. In one example, delta Tm (ATm) created by the additional mismatches ranges from about 2°C to about 20°C.

[0046] Examples of the second target probe 20B that have the single probe design (i.e., single probe per locus) include SEQ. ID. NO. 1 through SEQ. ID. NO. 51 ,SEQ. ID. NO. 61 through SEQ. ID. NO. 142, and SEQ. ID. NO. 152 through SEQ. ID. NO. 264. Other examples of the second target probe 20B have the two probe design (i.e. , two probes per locus). In these examples, the first of the two probes is selected from the group consisting of SEQ. ID. NO. 265 through SEQ. ID. NO. 273, SEQ. ID. NO. 278 through SEQ. ID. NO. 298, and SEQ. ID. NO. 303 through SEQ. ID. NO. 320; and the second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 321 through SEQ. ID. NO. 329, SEQ. ID. NO. 334 through SEQ. ID. NO. 351 , and SEQ. ID. NO. 359 through SEQ. ID. NO. 376.

[0047] Fig. 4A illustrates another example of the known problematic flanking regions that allow both on-target DNA sample fragments 22ON and off-target DNA sample fragments 22OFF to hybridize to the probe P. The off-target DNA sample fragment 22OFF shown in Fig. 4A does include at least one naturally mismatched base 26A, but the base(s) 26A is / are positioned beyond the 3’ end of the probe P. The portion 28 of the off-target DNA sample fragment 22OFF is complementary to, and thus is capable of hybridizing to the probe P, even though the off-target DNA sample fragment 22OFF is not the intended (on-target) DNA sample fragment 22ON.

[0048] The third target probe 20C, shown in Fig. 4B, disrupts the off-target binding shown in Fig. 4A. The third target probe 20C incorporates a complement 34 of a known mismatch region 32’ of the off-target DNA sample fragment 22OFF in place of a known complementary region 30 of the off-target DNA sample fragment 22OFF. This target probe 20C intentionally leaves out the known complementary region 30 - which is complementary to portions of both the on-target DNA sample fragment 22ON and the off-target DNA sample fragment 22OFF - and replaces it with the complement 34.Unlike the known complementary region 30, the complement 34 is complementary to a region 32 of the on-target DNA sample fragment 22ON but is not complementary to a similar region 32’ of the off-target DNA sample fragment 22OFF. The region 32’ of the off-target DNA sample fragment 22OFF includes at least one mismatched base 26A incorporated at a position that will inhibit binding to the probe 20C. In some examples, multiple mismatched bases are included at suitable positions to disrupt hybridization.

[0049] When forming the probe 20C, the regions 32, 32’ of the fragments 22ON, 22OFF that extend beyond the query site (e.g., the SNP or the CpG site of interest) areanalyzed to identify base(s), e.g., mismatched base 26A, of the off-target DNA sample fragment 22OFF that is / are different from those of the on-target DNA sample fragment 22ON. The extension beyond the query site may be in the 3’ or 5’ direction of the fragments 22ON, 22OFF, which will depend upon which flanking region of the query site is used for the initial probe design. If the flanking region for the initial probe design is in the 5’ direction from the query site, the regions 32, 32’ will be in the 3’ direction from the query site. In contrast, if the flanking region for the initial probe design is in the 3’ direction from the query site, the regions 32, 32’ will be in the 5’ direction from the query site. In one example when at least one of the plurality of second sample probes 20 is the third target probe 20C, the known mismatch region 32’ of the off-target DNA sample fragment 22OFF is within from 5 base pairs to 100 base pairs of a query site of a corresponding target DNA sample (for which the probe 20C is designed); and the complementary region 30 replaced by the complement 34 of the known mismatch region 32’ includes a corresponding number of base pairs. In other words, the replacement portion (i.e. , the complement 34) and the replaced portion (i.e. , the complementary region 30) have the same number of base pairs.

[0050] As shown in Fig. 4B, the probe 20C including the complement 34 allows the on-target DNA sample fragment 22ON to hybridize, while the mismatches of the off- target DNA sample fragment 22OFF hinder off-target binding.

[0051] Examples of the third target probe 20C that have the single probe design (i.e., single probe per locus) include SEQ. ID. NO. 52 through SEQ. ID. NO. 60 and SEQ. ID. NO. 143 through SEQ. ID. NO. 151. Other examples of the third target probe 20C have the two probe design (i.e., two probes per locus). In these examples, the first of the two probes is selected from the group consisting of SEQ. ID. NO. 274 through SEQ. ID. NO. 277; and a second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 330 through SEQ. ID. NO. 333. Each of these specific examples also includes at least one mismatched base in addition to the known mismatch region.

[0052] For any of the target probes 20B or 20C, it may be desirable for the 12 bases at the 3’ end to remain unchanged to allow for polymerase binding / extension when the on-target DNA sample fragment 22ON is bound. In one example, theintentionally included mismatched bases 26C, 26D of the probe 20B may be included at any position along the probe 20B that is 5’ of 12thbase from the 3’ terminus. In another example, the complement 34 of the probe 20B may be included at any position between the 5’ terminus and the 12thbase from the 3’ terminus.

[0053] The second sample probes 20 and / or 20’, 20” that are used in a single array 10 may all be of one type of target probe 20A or 20B or 20C, or may be any combination of target probes 20A and / or 20B and / or 20C. Moreover, any of the probes 20 and / or 20’, 20” may include any combinations of the degenerate base(s), the mismatched base(s), and the known mismatched region(s) all within a single probe sequence.

[0054] Any of the probes 18, 18’, 18”, 20, 20’, 20” can be based on the original DNA target strands and / or the complements of the original DNA target strands, with the caveat that the probes 20, 20’, 20” also include the degenerate bases, the mismatched bases, or the intentionally mismatched regions as described herein. In particular, the probes 18, 18’, 18”, 20, 20’, 20” can be designed from the top strand, the bottom strand, the plus stand, or the minus strand. When the A or T in a first unambiguous pair is on the 5’ side of the locus, then the sequence is designated as the top strand sequence. When the A or T in the first unambiguous pair is on the 3’ side of the locus, then the sequence is designated as the bottom strand sequence. The terms plus and minus correspond with the standard designation for all eukaryotic organisms used by HapMap and 1000 Genomes Project. The 5' end of the (+) strand is at the tip of the short arm (p arm) of the chromosome and the 5' end of the (-) strand is at the tip of the long arm (q arm).

[0055] Each of the plurality of first and second sample probes 18, 18’, 18”, 20, 20’, 20” may also include a unique barcode sequence (decoder) portion at its 5’ end. The barcode portion is a nucleotide sequence that may be used to distinguish individual beads 16. The barcode can be added to the probe 18, 18’, 18”, 20, 20’, 20” by methods that physically link or bond the decoder to the probe molecules, e.g., by ligation or transposition through polymerase, endonuclease, transposases, etc.

[0056] In the examples disclosed herein, all of the probes 18 and / or 18’, 18” and 20 and / or 20’, 20” are attached to respective bead 16. While a single sampleprobe 18, 18’, 18”, 20, 20’, 20” is shown attached to each bead 16 in the figures, it is to be understood that each bead 16 is coated with multiple copies of the respective probes 18, 18’, 18”, 20, 20’, 20”. The 5’ terminus of each probe 18, 18’, 18”, 20, 20’, 20” may be modified to allow a coupling reaction with a functional group at or introduced to a surface of the beads 16. An example of a 5’ terminal group is biotin.

[0057] The surface of the beads 16 can include physical alterations to attach the probes 18, 18’, 18”, 20, 20’, 20”. For example, the surface of a bead 16 can be modified to contain chemically modified sites that are useful for attaching, either- covalently or non-covalently, the probes 18, 18’, 18”, 20, 20’, 20”. The bead 16 surface may include chemical functional groups, including amino groups, carboxy groups, oxo groups and thiol groups, each of which can be used to covalently attach corresponding reactive 5’ terminal groups of the probes 18, 18’, 18”, 20, 20’, 20”. In one example, the beads 16 are coated with streptavidin to non-covalently attached a biotinylated probe 18, 18’, 18”, 20, 20’, 20”.

[0058] The probes 18, 18’, 18”, 20, 20’, 20” can be attached by sequential addition of monomeric units to synthesize the probes in situ. Probes 18, 18’, 18”, 20, 20’, 20” can alternatively be synthesized, and then attached using any of a variety of methods known in the art including printing techniques (e.g., ink-jet printing), a spotting technique, a photolithographic synthesis, or printing methods that utilize a mask.

[0059] Other examples of the probes 18 and / or 18’, 18” and 20 and / or 20’, 20” may be used in an assay, where the beads 16 to which they are attached are not attached to a substrate 12. In these examples, at least 10 different probes 18 and / or 18’, 18” and 20 and / or 20’, 20” may be selected for real time PCR (qPCR), target capture, or enrichment. With target capture and enrichment, it is desirable to narrow down the number of sample (library) fragments that are subsequently genotyped or tested for methylation, and thus probe sequences are specifically selected to capture the sample fragments of interest. In these types of panels, the sample fragments hybridize to a complementary probe, and then the unattached sample fragments are removed. The hybridized sample fragments are then dehybridized and transmitted to another array for methylation detection or genotyping.

[0060] The target capture panel may be a separate compartment that is selectively fluidly connected to, and upstream of, the array 10. The target capture panel may include preselected probes 18 and / or 18’, 18” and 20 and / or 20’, 20” attached to a solid surface, e.g., beads 16 in the depressions 14 of the substrate 12 or the substrate 12 itself, for capturing specific sample (library) fragments. The compartment may also be selectively fluidly connected to a waste container to receive the unattached sample fragments before the captured sample fragments are dehybridized and directed toward the array 10. Selective fluid connections may be achieved using valves and fluidic lines between the various components (e.g., compartment, array 10, waste container).

[0061] The enrichment panel may be a separate solution that contains the preselected probes 18 and / or 18’, 18” and 20 and / or 20’, 20”. In this example, the probes 18 and / or 18’, 18” and 20 and / or 20’, 20” may be attached to magnetic beads (one example of the beads 16) for ease of separation of the unattached sample fragments from the captured sample fragments, and of the dehybridized sample fragments from the beads 16 and probes 18 and / or 18’, 18” and 20 and / or 20’, 20”. With this example, the dehybridized sample fragments may be introduced into the array 10.

[0062] The array 10 (or any other example of the array disclosed herein) may be included in a genotyping kit. This kit includes any example of the array 10 disclosed herein and a genotyping mixture.

[0063] The genotyping mixture includes labeled nucleotides and a polymerase in a liquid carrier. The nucleotides include the following bases: adenine (tagged with dinitrophenol), cytosine (tagged with biotin), guanine (tagged with biotin) and thymine (tagged with dinitrophenol). Any polymerase that can accept the nucleotide, and that can successfully incorporate the base of the nucleotide at the 3’ end of the probe 18, 18’, 18” or 20, 20’, 20” may be used. Example polymerases include those polymerases from family A, such as Bsu Polymerase, Bst Polymerase, Taq Polymerase, T7 Polymerase, and many others; polymerases from families B and B2, such as Phi29 polymerase and other highly processive polymerases (family B2), Pfu Polymerase (family B), KOD Polymerase (family B), 9oN (family B), and many others;polymerases from family C, such as Escherichia coli DNA Pol III, and many others, polymerases from family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from family X, such as DNA Pol p, DNA Pol (3, DNA Pol o, and many others. The genotyping mixture may also include a liquid carrier, such as water and / or an ionic salt buffer fluid, e.g., saline citrate at milli-molar to molar concentrations, sodium chloride, potassium chloride, phosphate buffered saline, etc., and other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid) (HEPES). The liquid carrier may also include catalytic metal(s) intended for the extension reaction, such as Mg2+, Mn2+, etc. A single catalytic metal or a combination of catalytic metals may be used, and the total amount may range from about 0.01 mM to about 100 mM.

[0064] The kit also includes stains. For the two color approach, red and green fluorescent dyes may be attached, respectively, to anti-DNP and streptavidin.

[0065] The array 10 may also be included in a methylation detection kit. This kit includes any example of the array 10 disclosed herein, the genotyping solution, and a sodium bisulfite solution that can be used in the bisulfite conversion of the DNA sample that is to be used with the array 10. The methylation detection kit can also include the stains.

[0066] An example of the method for using the array 10 includes generating an amplified DNA sample; and performing a genotyping assay using the genotyping array 10.

[0067] Fragmentation and amplification of the DNA sample that is to be analyzed may be performed using any know method. The amplified DNA sample fragments are then introduced onto the array 10, where they will hybridize to corresponding probes 18 or 20 and / or 18’, 18” or 20’, 20” on the various beads 16.

[0068] In one example, an extension reaction is performed at the 3’ ends of the probes 18, 20. The reaction is initiated by introducing the genotyping mixture to the array 10. For the extension reaction, the genotyping mixture containing the generically labeled nucleotides and the polymerase is introduced into the array 10. The temperature of the array 10 may be adjusted to initiate the extension reaction. Example temperatures range from about 20°C to about 70°C. The polymeraseenables the extension of the 3’ end of the probe 18, 20, which is adjacent to the locus of interest. The stains can then be introduced, where red or green labeled linkers (e.g., anti-DNP and streptavidin) will attach depending upon the generic label of the incorporated nucleotide. As described, the first extension reaction and the color signal data obtained from this reaction enables one to determine the genotyping status. With the probes 18, 20, each assay genotypes the locus using two color readouts: one color for each allele. The relative intensity of the two colors indicates whether a genotype is heterozygous or homozygous at a particular locus.

[0069] In another example, an extension reaction is attempted at the 3’ ends of the probes 18’, 18”, 20’, 20”. The reaction is initiated by introducing the genotyping mixture to the array 10. For the extension reaction, the genotyping mixture containing the generically labeled nucleotides and the polymerase is introduced into the array 10. The temperature of the array 10 may be adjusted to initiate the extension reaction. Example temperatures range from about 20°C to about 70°C. The polymerase enables the extension of the 3’ end of the probe 18’ or 18” and 20’ or 20” that has the DNA sample fragment hybridized at the 3’ end. The corresponding probe 18” or 18’ and 20” or 20’ that is not fully hybridized at the 3’ end will not undergo the extension reaction. Thus, in this example, the single base extension is allele specific, and the dye label that attaches during staining will be indicative of this allele.

[0070] The data derived from any example of the array may be used as a discovery tool in order to determine the ethnicity of the individual whose sample is being tested, to identify new single nucleotide polymorphisms in the particular sample, for sample finger printing, sample tracking, methylation, or the like.

[0071] Another example of the method for using the array 10 includes generating a bisulfite converted and amplified DNA sample; and performing a methylation assay using the array 10.

[0072] For the bisulfite conversion, DNA is first denatured (made singlestranded) and then treated with sodium bisulfite. The converted DNA is also amplified. The methylation assay enables hybridization of the converted and amplified DNA sample strands to the sample probes 18, 20 or 18’, 18” and 20, 20”.

[0073] An extension reaction is performed or attempted at the 3’ ends of the probes 18, 20 or 18’, 18” and 20’, 20”. The extension reaction may be initiated, and when successful, performed as described herein for the genotyping method. In this example, the single base extension may result in the addition of a labeled G or A base, complementary to either the methylated C or unmethylated T of the bisulfite converted DNA sample strand. For opposite strands, the single base extension may result in the addition of a labeled C or T base. In one example, labeled nucleotides may include A and T tagged with red channel labels and G and C tagged with green channel labels.The use of opposed color channels enables one to interpret the data correctly. The level of methylation for the interrogated locus can be determined by calculating the ratio of the fluorescent signals from the methylated versus unmethylated sites.

[0074] To further illustrate the present disclosure, examples are given herein. It is to be understood that these examples are provided for illustrative purposes and are not to be construed as limiting the scope of the present disclosure.NON-LIMITING WORKING EXAMPLES

[0075] Example 1

[0076] The following comparative probe was synthesized for rs28371725, a single nucleotide variation on chromosome 22 at position 42127803:TGGAGCCCCGGGTGTCCCAGCAAAGTTCATGGGCCCCCGCCTGTACCCTT (SEQ. ID. NO. 377)

[0077] The following second target probe was also was synthesized for rs28371725, including mismatched bases (identified in bold):TGGAGCCCCGTGTGTCTCAGCAAAGTTCATGGGCCACCGCCTGTACCCTT (SEQ. ID. NO. 378)

[0078] The probes were exposed to an Illumina Infinium genotyping assay. The results for the comparative probe are shown in Fig. 5A and the results for the example probe are shown in Fig. 5B. The results are based on plotting normalized R [the sum of intensities of two channels red and green fluorescence) on the Y axis versus normalized theta [(2 / rr)Tan-1 (green fluorescence / red fluorescence )] on the X axis. A normalized theta value nearest 0 is homozygous for allele A, a theta value nearest 0.5 is heterozygote AB, and a theta value nearest 1 is homozygous for allele B. Any solid black dots in the graphs indicate that no call was able to be made. The hatched dots in the respective regions (near 0, nearest 0.5, and nearest 1 ) are indicative of successful calls for homozygous allele A, a heterozygote AB, and homozygous allele B.

[0079] The results in Fig. 5A illustrate poor separation of the genotype calls, likely due to similarities with multiple off target DNA strands and a high GC content. The results in Fig. 5B illustrate that the example probe with 3 mismatched bases outperformed the comparative probe in genotype calling. Thus, the example probe reduced off-target binding. Overall, these results illustrate that the second target probes improve the accuracy of the calling with good separation of the genotypes.

[0080] Example 2

[0081] For the CG query site located at 18,922, rs1799853 has a complete off- target match with rs17884712 between flanking region 18,881 and 18,980 and between flanking region 18,923 and 18,980. However, between 18,981 and 19,020, there are at least 8 mismatched bases between rs1799853 and rs17884712

[0082] A comparative probe for rs1799853 was synthesized. This probe was based on the flanking region 18,923-18,973. Due to the 100% identity of this flanking region with the same region in rs17884712, the comparative probe was expected to provide at least some inaccurate genotyping results.

[0083] An example probe in accordance with the third target probe described herein was synthesized. This probe was based on the flanking region 18,923-18,944 and on the region 59 bases away, i.e. , 18,974-19,003.

[0084] The probes were also exposed to an Illumina Infinium genotyping assay. The results for the comparative probe are shown in Fig. 6A and the results for the example probe are shown in Fig. 6B. Again, the results are based on plotting normalized R [the sum of intensities of two channels - red and green fluorescence) on the Y axis versus normalized theta [(2 / rr)Tan-1 (green fluorescence / red fluorescence)] on the X axis. A normalized theta value nearest 0 is homozygous for allele A, a theta value nearest 0.5 is heterozygote AB, and a theta value nearest 1 is homozygous for allele B. Any solid black dots in the graphs indicate that no call was able to be made. The hatched dots in the respective regions (near 0, nearest 0.5, and nearest 1 ) are indicative of successful calls for homozygous allele A, a heterozygote AB, and homozygous allele B.

[0085] A comparison of results in Fig. 6A and Fig. 6B illustrated that the comparative probe did not accurately genotype the rs1799853 variant, and that 13 of 18 samples produced false positive results. The example probe provided 100% accurate calling with good separation of the genotypes (Fig. 6B).

[0086] Additional Notes

[0087] The singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.

[0088] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.

[0089] The terms top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).

[0090] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.

[0091] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or sub-ranges were explicitly recited. For example, a range of about 2°C to about 20°C should be interpreted to include not only the explicitly recited limits of about 2°C to about 20°C, but also to include individual values, such as about 2.5°C, 10°C, 15°C, etc., and sub-ranges, such as from about 5°C to about 18°C, from about 2°C to about 16°C, etc.

[0092] Furthermore, when “about” and / or “substantially” are / is utilized to describe a value, they are meant to encompass minor variations (up to + / - 10%) from the stated value.

[0093] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection withO the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0094] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

What is claimed is:

1. A genotyping array, comprising: a substrate having a plurality of depressions defined therein; a plurality of beads, each of the plurality of beads positioned within one of the plurality of depressions; a plurality of first sample probes respectively attached to some of the plurality of beads, each of the plurality of first sample probes a) being a single probe having a 3’ terminus that complements a base directly adjacent to a query site of a respective DNA sample fragment, or b) including two probes, each having a 3’ terminus that complements a base at the query site of the respective DNA sample fragment, or c) a combination of a) and b); and a plurality of second sample probes respectively attached to some other of the plurality of beads, the plurality of second sample probes including a target probe selected from the group consisting of: i) a first target probe including a degenerate base within a predetermined number of bases of its 3’ terminus; ii) a second target probe including predetermined mismatched bases with a first off-target DNA sample fragment; iii) a third target probe including a complement of a known mismatch region of a second off-target DNA sample fragment in place of a known complementary region of the second off-target DNA sample fragment; and iv) any combination of i) through iii).

2. The genotyping array as defined in claim 1 , wherein the plurality of second sample probes make up from greater than 0% to less than 10% of a total of the plurality of first sample probes and the plurality of second sample probes.

3. The genotyping array as defined in claim 1 or claim 2, wherein at least one of the plurality of second sample probes is the first target probe, and wherein the predetermined number of bases is up to 10% of a total number of bases in the first target probe.

4. The genotyping array as defined in any of claims 1-3, wherein at least one of the plurality of second sample probes is the second target probe, and wherein a number of the predetermined mismatched bases creates a delta Tm between a primer melting temperature of the second target probe and a primer melting temperature of the first off-target DNA sample fragment.

5. The genotyping array as defined in any of claims 1-4, wherein: at least one of the plurality of second sample probes is the third target probe; the known mismatch region of the second off-target DNA sample fragment is within from 5 base pairs to 100 base pairs of a query site of a corresponding target DNA sample; and the complementary region replaced by the complement of the known mismatch region includes a corresponding number of base pairs.

6. The genotyping array as defined in any of claims 1-5, wherein the respective DNA sample fragments are from a mammal genome.

7. The genotyping array as defined in any of claims 1-6, wherein the plurality of first sample probes make up from greater than 90% to less than 100% of a total of the plurality of first sample probes and the plurality of second sample probes.

8. The genotyping array as defined in any of claims 1-7, wherein the beads are silica beads.

9. The genotyping array as defined in any of claims 1-8, wherein each of the plurality of first sample probes and each of the plurality of second sample probes further includes a unique barcode sequence.

10. The genotyping array as defined in any of claims 1 -9, wherein the query site is a methylation query site.11 . The genotyping array as defined in any of claims 1 , 4, or 6-10, wherein the plurality of second sample probes includes the second target probes, and each of the second target probes is a single probe having a sequence selected from the group consisting of SEQ. ID. NO. 1 through SEQ. ID. NO. 51 , SEQ. ID. NO. 61 through SEQ. ID. NO. 142, SEQ. ID. NO. 152 through SEQ. ID. NO. 264.

12. The genotyping array as defined in any of claims 1 , 4, or 6-10, wherein: the plurality of second sample probes includes the second target probes; each of the second target probes includes two probes; a first of the two probes is selected from the group consisting of SEQ. ID. NO. 265 through SEQ. ID. NO. 273, SEQ. ID. NO. 278 through SEQ. ID. NO. 298, and SEQ. ID. NO. 303 through SEQ. ID. NO. 320; and a second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 321 through SEQ. ID. NO. 329, SEQ. ID. NO. 334 through SEQ. ID. NO. 351 , and SEQ. ID. NO. 359 through SEQ. ID. NO. 376.

13. The genotyping array as defined in any of claims 1 or 5-10, wherein the plurality of second sample probes includes the third target probes, and each of the third target probes is a single probe having a sequence selected from the group consisting of SEQ. ID. NO. 52 through SEQ. ID. NO. 60 and SEQ. ID. NO. 143 through SEQ. ID. NO. 151.

14. The genotyping array as defined in any of claims 1 or 5-10, wherein: the plurality of second sample probes includes the third target probes; each of the third target probes includes two probes; a first of the two probes is selected from the group consisting of SEQ. ID. NO. 274 through SEQ. ID. NO. 277; and a second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 330 through SEQ. ID. NO. 333.

15. A genotyping kit, comprising: a genotyping array, including: a substrate having a plurality of depressions defined therein; a plurality of beads, each of the plurality of beads positioned within one of the plurality of depressions; a plurality of first sample probes respectively attached to some of the plurality of beads, each of the plurality of first sample probes a) being a single probe having a 3’ terminus that complements a base directly adjacent to a query site of a respective DNA sample fragment or b) including two probes, each having a 3’ terminus that complements a base at the query site of the respective DNA sample fragment, or c) a combination of a) and b); a plurality of second sample probes respectively attached to some other of the plurality of beads, the plurality of second sample probes including one or more target probes selected from the group consisting of: i) a first target probe including a degenerate base within a predetermined number of bases of its 3’ terminus; ii) a second target probe including predetermined mismatched bases with a first target DNA sample fragment; iii) a third target probe including a complement of a known mismatch region of a second off-target DNA sample fragment in place of known complementary region of the second off-target DNA sample fragment; and iv) any combination of i) through iii); and a genotyping mixture.

16. The genotyping kit as defined in claim 15, wherein the plurality of second sample probes make up from greater than 0% to less than 10% of a total of the plurality of first sample probes and the plurality of second sample probes.

17. The genotyping kit as defined in claim 15 or claim 16, wherein at least one of the plurality of second sample probes is the first target probe, and wherein the predetermined number of bases is up to 10% of a total number of bases in the first target probe.

18. The genotyping kit as defined in any of claims 15-17, wherein at least one of the plurality of second sample probes is the second target probe, and wherein a number of the predetermined mismatched bases creates a delta Tm between a primer melting temperature of the second target probe and a primer melting temperature of the first off-target DNA sample fragment.

19. The genotyping kit as defined in any of claims 15-18, wherein: at least one of the plurality of second sample probes is the third target probe; the known mismatch region of the second off-target DNA sample fragment is within from 5 base pairs to 100 base pairs of a query site of a corresponding target DNA sample; and the complementary region replaced by the complement of the known mismatch region includes a corresponding number of base pairs.

20. The genotyping kit as defined in any of claims 15-19, wherein the respective DNA sample fragments are from a mammal genome.

21. The genotyping kit as defined in any of claims 15-20, wherein the plurality of first sample probes make up from greater than 90% to less than 100% of a total of the plurality of first sample probes and the plurality of second sample probes.

22. The genotyping kit as defined in any of claims 15-21 , wherein the query site is a methylation query site, and wherein the genotyping kit further comprises a sodium bisulfite solution.

23. A method, comprising: generating an amplified DNA sample; and performing a genotyping assay using the amplified DNA sample and the genotyping array of claim 1 .

24. The method as defined in claim 23, wherein: the query site is a methylation query site; prior to generating the amplified DNA sample, the method further comprising generating a bisulfite converted DNA sample, and generating the amplified DNA sample from the bisulfite converted DNA sample; and results from the genotyping assay are indicative of a methylation status of the bisulfite converted and amplified DNA sample.

25. A qPCR panel / assay, comprising: at least 10 different probes, each of the at least 10 different probes being selected from the group consisting of: i) a first target probe including a degenerate base within a predetermined number of bases of its 3’ terminus; ii) a second target probe including predetermined mismatched bases with a first off-target DNA sample fragment; iii) a third target probe including a complement of a known mismatch region of a second off-target DNA sample fragment in place of a known complementary region of the second off-target DNA sample fragment; and iv) any combination of i) through iii).

26. The qPCR panel / assay as defined in claim 25, wherein the plurality of second sample probes includes the second target probes, and each of the second target probes is a single probe having a sequence selected from the group consisting of SEQ. ID. NO. 1 through SEQ. ID. NO. 51 , SEQ. ID. NO. 61 through SEQ. ID. NO. 142, SEQ. ID. NO. 152 through SEQ. ID. NO. 264.

27. The qPCR panel / assay as defined in claim 25, wherein: the plurality of second sample probes includes the second target probes; each of the second target probes includes two probes; a first of the two probes is selected from the group consisting of SEQ. ID. NO. 265 through SEQ. ID. NO. 273, SEQ. ID. NO. 278 through SEQ. ID. NO. 298, and SEQ. ID. NO. 303 through SEQ. ID. NO. 320; and a second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 321 through SEQ. ID. NO. 329, SEQ. ID. NO. 334 through SEQ. ID. NO. 351 , and SEQ. ID. NO. 359 through SEQ. ID. NO. 376.

28. The qPCR panel / assay as defined in claim 25, wherein the plurality of second sample probes includes the third target probes, and each of the third target probes is a single probe having a sequence selected from the group consisting of SEQ. ID. NO. 52 through SEQ. ID. NO. 60 and SEQ. ID. NO. 143 through SEQ. ID. NO. 151.

29. The qPCR panel / assay as defined in claim 25, wherein: the plurality of second sample probes includes the third target probes; each of the third target probes includes two probes; a first of the two probes is selected from the group consisting of SEQ. ID. NO. 274 through SEQ. ID. NO. 277; and a second of the two probes is respectively selected from the group consisting of SEQ. ID. NO. 330 through SEQ. ID. NO. 333.