Zbtb16 as a factor for cardiac aging and disease

Abstract

The present invention relates to a method for identifying a compound that increases the expression, amount and / or biological activity of the gene ZBTB16 in a cell of a subject, in particular a cardiac cell. Further provided are pharmaceutical compositions comprising compounds that increase the expression, amount and / or biological activity of the gene ZBTB 16 in a cell of a subject for use in medicine, in particular for use in the prevention or treatment of cardiovascular pathologies in a subject, in particular age-induced diastolic dysfunctions. Further provided are diagnostic methods, and kits.

Description

[0001] ZBTB16 AS A FACTOR FOR CARDIAC AGING AND DISEASE

[0002] The present invention relates to a method for identifying a compound that increases the expression, amount and / or biological activity of the gene ZBTB16 in a cell of a subject, in particular a cardiac cell. Further provided are pharmaceutical compositions comprising compounds that increase the expression, amount and / or biological activity of the gene ZBTB 16 in a cell of a subject for use in medicine, in particular for use in the prevention or treatment of cardiovascular pathologies in a subject, in particular age-induced diastolic dysfunctions. Further provided are diagnostic methods, and kits.

[0003] Background of the invention

[0004] Through advancements in modem medical care and improved living conditions, life expectancy has significantly increased over the past century. However, with the benefits of a longer lifespan comes the challenge of aging, which is considered the primary risk factor for numerous severe diseases, including cardiovascular disease, the leading cause of death worldwide (1). Given that the prevalence and severity of cardiovascular disease rise with age, understanding the impact of aging on the heart has become a matter of great interest.

[0005] During the process of chronological aging, cardiac function and the capacity for repair decline (2), accompanied by adverse remodeling. On a macroscopic level, age-related remodeling primarily affects cardiac chamber geometry, leading to left ventricular hypertrophy, wall stiffening, chamber dilation, and fibrosis (2). These structural changes underlie alterations in various cellular processes and intercellular communication (3), particularly within the endothelial niche — the microenvironment of endothelial cells (4). It has been observed that the microcirculatory endothelium plays a role in reparative functions through paracrine signaling, as seen in the lungs, liver, bone marrow, and heart (5-11). While previous studies have shown that the vascular niche function declines in the aging heart (3,12-15), little is known about the intrinsic factors and mechanisms underlying these alterations in endothelial cells.

[0006] Zinc Finger and BTB Domain-Containing Protein 16 (ZBTB 16) is a gene that codes for a transcriptional regulator protein (PLZF). It belongs to the BTB / POZ-ZF family of transcription factors and is associated with various cellular processes such as development, differentiation, and cell growth. PLZF is furthermore essential for nearly all of the unique characteristics of NKT cells including their rapid and potent response to antigen (Zhang S, Laouar A, Denzin LK, Sant' Angelo DB. Zbtbl6 (PLZF) is stably suppressed and not inducible in non-innate T cells via T cell receptor-mediated signaling. Sci Rep. 2015 Jul 16;5: 12113. doi: 10.1038 / srepl2113. PMID: 26178856; PMCID: PMC4503983).

[0007] The transcription factor ZBTB16 also showed pre-hypertrophic upregulation at both gene and protein levels, implicate stress-sensing in these regions as a potentially important early response in hypertrophic cardiomyopathy (HCM) (Farrell E, et al. Transcriptome Analysis of Cardiac Hypertrophic Growth in AffBPC3-Null Mice Suggests Early Responders in Hypertrophic Remodeling. Front Physiol. 2018 Oct 25;9: 1442. doi: 10.3389 / fphys.2018.01442. PMID: 30410445; PMCID: PMC6210548.).

[0008] In view of the above, new medical interventions to counteract chronological aging of the cardiac function and improve the capacity for repair are sought after. It is therefore an object of the present invention to provide such strategies. Other objects and advantages will readily become apparent for the person of skill from studying the following more detailed description and examples.

[0009] The present invention generally relates to the protein-coding gene ZBTB16 as an upstream regulator of cardiac aging and cardiac diseases, which targets cardiovascular pathologies, in particular age-induced diastolic dysfunctions, as a therapeutic target, and includes the medical use of respective agents that ultimately upregulate ZBTB16 expression and / or function.

[0010] In a first aspect of the present invention, the problem of the present invention is solved by a method for identifying a compound that increases the expression, amount and / or biological activity of the protein ZBTB16 in a cell of a subject, comprising the steps of i) contacting at least one candidate compound with a cell that expresses the gene for ZBTB16, and ii) detecting an increase of the expression, amount and / or biological activity of the protein ZBTB16 in the cell in the presence of the candidate compound compared to the expression, amount and / or biological activity in the absence of the candidate compound, wherein an increase of the expression, amount and / or biological activity of the ZBTB 16 protein in the cell identifies a compound that increases the expression, amount and / or biological activity of the protein ZBTB 16 in a cell of a subject. Preferably the cell is in a biological sample obtained from said subject.

[0011] Preferred is a method according to the present invention, further comprising detecting an antisenescence effect of the candidate compound on the cell of the subject.

[0012] In a second aspect of the present invention, the problem of the present invention is solved by providing a method for detecting senescence in a cell of a subject, comprising detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB 16 in the cell obtained from said subject, wherein a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB 16 in the cell when compared to a control is indicative for senescence of the cell of the subject.

[0013] Preferred is a method according to the present invention, further comprising detecting at least one of DNA methylation of the gene for ZBTB 16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence- associated secretory phenotype, SASP).

[0014] In a third aspect of the present invention, the problem of the present invention is solved by providing a method for producing a pharmaceutical composition, comprising performing a method according to the present invention as above, and admixing the compound as identified with at least one pharmaceutically acceptable carrier.

[0015] Further provided is a pharmaceutical composition, comprising at least one of the ZBTB 16 protein or functional fragment thereof, at least one nucleic acid or functional fragment thereof encoding for ZBTB 16, in particular an mRNA, preferably a modified mRNA, at least one expression cassette or at least one vector for expressing, in particular overexpressing, the ZBTB 16 protein or functional fragment thereof in a cell, such as, for example, a viral construct, such as a lentiviral construct, or a CRISPR-cas construct for introducing mutations in the ZBTB 16 gene, a cardiac cell overexpressing or cardiac stem cell expressing and preferably recombinantly expressing or overexpressing ZBTB 16, together with at least one pharmaceutically acceptable carrier, or a pharmaceutical composition as produced according to the present invention as above.

[0016] Further preferred is the pharmaceutical composition according to the present invention for use in the prevention or treatment of diseases in a subject, in particular for use in the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure (with reduced and preserved ejection fraction), pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation.

[0017] In a fourth aspect of the present invention, the problem of the present invention is solved by providing the non-medical use of the pharmaceutical composition according to the present invention for increasing the expression, amount and / or biological activity of the protein ZBTB16 in a cell as disclosed herein.

[0018] In a fifth aspect of the present invention, the problem of the present invention is solved by providing a method for the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation in a subject, comprising administering to said subject an effective amount of the pharmaceutical composition according to the present invention.

[0019] In a sixth aspect of the present invention, the problem of the present invention is solved by providing a kit comprising materials for performing a method for detecting senescence in a cell, in particular a cardiac cell, of a subject according to the present invention, in particular materials for detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in a cell obtained from a subject, and optionally further comprising materials for detecting at least one of DNA methylation of the gene for ZBTB16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence-associated secretory phenotype, SASP), such as buffers, antibodies against the protein ZBTB16, dyes and labels as well as instructions for performing the method. Further provided is the use of the kit according to the present invention for detecting senescence in a cell, in particular a cardiac cell, of a subject.

[0020] As mentioned above, in a first aspect of the present invention, the problem of the present invention is solved by providing a method for identifying a compound that increases the expression, amount and / or biological activity of the protein ZBTB16 in a cell of a subject.

[0021] In the context of the present invention, a “subject” relates to a mammal, animal or individual, such as a person or patient that is suspected to exhibit a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in a cell obtained from a subject. In the context of the present invention, a “patient” relates to a subject that is undergoing a preventive or therapeutic treatment of a disease or condition, such as a cardiac, age-related and / or senescence-related disease or condition.

[0022] The method according to the present invention comprises the first step of i) contacting at least one candidate compound with a cell that expresses the gene for ZBTB16. Contacting can be done, for example, in culture, on a plate or on a solid surface, depending on the cells as used and the desired analysis method(s) to follow. The contacting may be in vivo or in vitro, in solution or comprises the candidate compound molecule bound or conjugated to a solid carrier. Respective formats are also described in the art and known to the person of skill.

[0023] The second step comprises detecting an increase of the expression, amount and / or biological activity of the protein ZBTB16 in the cell in the presence of the candidate compound compared to the expression, amount and / or biological activity in the absence of the candidate compound. Expression includes at least one of transcription (mRNA production, epigenetic represssion), translation (amount of mRNA, stability of mRNA, and production of the protein, amount of the protein), and the biological activity of the protein (stability, amount and / or activity of the protein in the cell). Methods to detect expression are well-known to the person of skill and may comprise quantitative rtPCR analysis or an analysis using antibodies or stainings, mass spectrometry, NMR assays, pull-down assays, and the like. Similarly, the amount of the protein may be detected, for example using antibodies or stainings.

[0024] Preferred is a method according to the present invention, wherein the detecting an increase of the expression, amount and / or biological activity comprises detecting the amount of mRNA, protein, half-life of the ZBTB16 protein in the cell, and / or proteasomal degradation of target proteins. ZBTB 16 has been described as substrate-recognition component of an E3 ubiquitin- protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (Furukawa M, He YJ, Borchers C, Xiong Y. Targeting of protein ubiquitination by BTB-Cullin 3-Rocl ubiquitin ligases. Nat Cell Biol. 2003 Nov;5(l 1): 1001-7. doi: 10.1038 / ncbl056. Epub 2003 Oct 5. PMID: 14528312).

[0025] In the final step of the method according to the present invention an increase of the expression, amount and / or biological activity of the of the ZBTB 16 protein in the cell identifies a compound that increases the expression, amount and / or biological activity of a protein of the ZBTB 16 protein in a or the cell of the subject.

[0026] Preferably, the cell is a mammalian cell, such as a cell selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, purkinje cells, and recombinant cells thereof expressing ZBTB 16, and wherein preferably the cell is in a biological sample obtained from said subject.

[0027] As was identified in the context of the present invention, expression, de-repression and / or overexpression of ZBTB 16 has an anti-ageing and / or anti-senescence effect on the cells as tested, see for example, Figures 5 to 7 and the examples thereto.

[0028] Preferred is therefore a method according to the present invention, wherein the increase of the expression, amount and / or biological activity comprises detecting a prevention and / or reduction of repression in cells of aged or diseased subjects. Preferred is also a method according to the present invention, further comprising detecting an anti -senescence effect of the candidate compound on the cell of the subject. Examples for senescence markers and phenotypes to be measured are known to the person of skill, and are described herein, such as senescence- associated P-galactosidase activity, and may further include, for example, pl 6^^, p21 and p53 that results in cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation.

[0029] In the context of the present invention, the candidate compound can be selected from the group consisting of a chemical organic molecule, a molecule selected from a library of small organic molecules (molecular weight less than about 500 Da), a molecule selected from a combinatory library, a natural compound, a plant extract, a molecule selected from a peptide library, a peptide, a protein, a nucleic acid, a DNA, an RNA, an siRNA, a DNA-dem ethylating agent, and an antibody or antigen binding fragment thereof.

[0030] These candidate molecules may also be used as a basis to screen for improved compounds. Thus, preferred is the method according to the present invention, wherein after the identification of the ZBTB16 expression modifying compound and / or an anti-ageing or anti-senescence activity, the method further comprises the step of chemically modifying the compound. In general, many methods of how to modify compounds of the present invention are known to the person of skill and are disclosed in the literature.

[0031] Modifications of the compounds will usually fall into several categories, for example a) mutations / changes of amino acids into different amino acids, b) chemical modifications, e.g. through the addition of additional chemical groups, c) changes of the size / length of the compound, and / or d) the attachment of additional groups to the molecule (including marker groups, labels, linkers or carriers, such as chelators). In a next step, the modified compound is tested again in at least one of tests as above, and if the property of the compound is improved compared to its unaltered state. In the context of the present invention, an “improved” activity relates to an increase of ZBTB16 expression and / or anti-ageing or anti -senescence activity.

[0032] ZBTB16 is a gene encoding the transcription factor PLZF (promyelocytic leukemia zinc finger) (25). It is expressed by different cells and regulates various structural and cellular processes, such as skeletal embryonic development (26, 27) and leukocyte differentiation (28-31). Especially in oncology, the role of ZBTB16 has been described in detail (32). However, ZBTB16 also appears to play a role in the development of some cardiac pathology. In patients unable to express ZBTB16, biallelic absence of ZBTB16 has been associated with congenital heart disease (33). In addition, ZBTB16 appears to contribute to cardiac hypertrophy, fibrosis, and hypertension.

[0033] In renal epithelial cells, aldosterone has been shown to promote ZBTB16 expression, which in turn inhibits the expression of the P and y subunits of the epithelial Na+channel (ENaC) and thus Na+reabsorption (34). In addition, ZBTB16 is a direct interaction partner of the angiotensin II receptor AT2 (35, 36). Heterodimerization of AT2 with ZBTB16 leads to transcriptional activation, which may induce hypertension and cardiac remodeling via the reninangiotensin system (36-38). Previous animal studies have studied the role of ZBTB16 in spontaneously hypertensive rats with a predisposition to left ventricular hypertrophy, cardiac fibrosis, and metabolic disorders (39, 40). However, ZBTB16 deletion resulted in a significant reduction in hypertrophy and cardiac fibrosis in these rats. In mice, ZBTB16 has been described as highly expressed in hypertrophied hearts (41). However, this expression pattern is stimulusdependent, as ZBTB16 e.g. was observed to be increased in pregnancy-induced hypertrophy and decreased in exercise-induced hypertrophy (42). The inventor’s own data also show that ZBTB16 deletion leads to cardiac hypertrophy and fibrosis. ZBTB16 expression is also reduced in the endothelium of old and diseased hearts. In vascular cells, the role of ZBTB16 is largely unclear. To date, a ZBTB16 deletion has been shown to inhibit angiogenesis in human umbilical vein endothelial cells (HUVEC) (43).

[0034] In the context of the present invention, the term “ZBTB 16” or “PLZF”, respectively, shall relate to the amino acid sequence of the human ZBTB 16 protein according to SEQ ID NO: 1, or as can be accessed at Q05516 (ZBT16 HUMAN) in the UniProt database. The term further includes amino acid sequences that are identical or at least 80%, preferably at least 90%, more preferably at least 95% identical to the amino acid sequence of the mammalian, in particular human ZBTB 16 protein.

[0035] In the context of the present invention, the term “functional fragment of the ZBTB 16 protein” or “functional fragment of the PLZF protein”, respectively shall relate to a part of the amino acid sequences of the above proteins that is truncated at the N- and / or C-terminus of the amino acid sequence, but still performs its function as required / desired in the context of the present invention, namely - when expressed, translated and / or administered - causes prevention or treatment of senescence or anti-ageing in cells of a subject as described herein.

[0036] In the context of the present invention, the term “mRNA” shall relate to a respective nucleic acid molecule comprising a nucleic acid sequence encoding for the ZBTB 16 protein or functional fragment thereof as above. The mRNA molecule can be natural or produced synthetically or in vitro, or combinations thereof. The mRNA may comprise modified bases and / or DNA or other types of nucleic acid components, as long as the desired function(s) (see above) is / are not substantially impaired. In the context of the invention, in general and also preferably an mRNA as used comprises the same structural components as natural mRNA in eukaryotic cells. It has at least a 5' cap, a 5'-untranslated region (UTR), a 3'-UTR, an open reading frame.(ORF), which encodes the relevant Flt3L protein or functional fragment thereof, for example as adjuvant or antigen, and a 3'-poly(A) tail. Preferably, the term further includes mRNAs comprising nucleotide sequences that are identical or at least 80%, preferably at least 90%, more preferably at least 95% identical to the nucleotide sequence of an mRNA encoding at least one of the mammalian ZBTB16 protein, in particular a human protein. The nucleic acid molecule may be polycistronic.

[0037] Another aspect of the invention then relates to a method for detecting senescence in a cell of a subject, comprising detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in the cell obtained from said subject, wherein a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in the cell when compared to a control is indicative for senescence of the cell of the subject.

[0038] In vivo the inventors identified age-associated cardiac phenotypes, including diastolic dysfunction increased senescence, fibrosis, and cardiomyocyte hypertrophy, as well as a reduced cardiac innervation (Figures 2A-F) and also decreased endothelial function, as evidenced by reduced capillary density in the heart and impaired endothelial outgrowth in an ex vivo aortic ring assay (Figures 2F and G) in mice that showed a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16. Therefore, ZBTB16 is suitable as a marker for senescence and age-associated alterations. Examples for control senescence markers and phenotypes to be measured are known to the person of skill, and are described herein, such as senescence-associated P-galactosidase activity, and may further include detecting, for example, plb^43, p21 and p53 that results in cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation.

[0039] Preferred is therefore the method according to the present invention, further comprising detecting at least one of DNA methylation of the gene for ZBTB16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence-associated secretory phenotype, SASP) as described herein.

[0040] Preferred is the method according to the present invention, wherein the cell is a mammalian cell, such as a cell selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, purkinje cells, a cardiac stem cell, and recombinant cells thereof expressing ZBTB16, and wherein preferably the cell is in a biological sample obtained from said subject.

[0041] Another aspect of the present invention relates to a method for producing a pharmaceutical composition, comprising performing a method according to the present invention, and admixing the compound as identified with at least one pharmaceutically acceptable carrier (see also below).

[0042] Another aspect of the present invention relates to a pharmaceutical composition, comprising at least one of the ZBTB16 protein or functional fragment thereof, at least one nucleic acid or functional fragment thereof encoding for ZBTB16, in particular an mRNA, preferably a modified mRNAs, at least one expression cassette or at least one vector for expressing, in particular overexpressing, the ZBTB 16 protein or functional fragment thereof in a cell, such as, for example, a viral construct, such as a lentiviral and adeno-associated viral construct, or a CRISPR-cas construct for introducing mutations in the ZBTB 16 gene, a cardiac cell overexpressing or cardiac stem cell expressing and preferably recombinantly expressing or overexpressing, ZBTB 16, together with at least one pharmaceutically acceptable carrier, or a pharmaceutical composition as produced according to the present invention.

[0043] Preferred is the pharmaceutical composition according to the present invention, wherein the pharmaceutical composition as formulated specifically increases the expression, amount and / or biological activity of the ZBTB 16 protein or functional fragment thereof in a cell.

[0044] Preferably, said composition comprises an aqueous formulation. The term "pharmaceutical composition" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein (here, the at least one candidate compound) to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered. A pharmaceutical composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and / or mode of administration will vary depending upon the desired results. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The carrier can be suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g. by injection or infusion). Preferred is the pharmaceutical composition for use according to the present invention, wherein the composition is for injection, oral and / or time released application.

[0045] The pharmaceutical compositions according to the invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

[0046] The pharmaceutical compositions according to the invention may be in liquid, dry or semi-solid form, such as, for example, in the form of a tablet, coated tablet, effervescent tablet, capsule, powder, granulate, sugar-coated tablet, lozenge, pill, ampoule, drop, suppository, emulsion, ointment, gel, tincture, paste, cream, moist compress, gargling solution, plant juice, nasal agent, inhalation mixture, aerosol, mouthwash, mouth spray, nose spray, or room spray. Preferred is an injectable composition.

[0047] In some embodiments, the composition comprises the active ingredient, such as the at least one compound, antibody or functional fragment thereof, at least one nucleic acid or functional fragment thereof, at least one expression cassette or at least one vector at a concentration in the range of about 1 mg / ml to about 2 mg / ml, 3 mg / ml, 4 mg / ml, 5 mg / ml, 6 mg / ml, 7 mg / ml, 8 mg / ml, 9 mg / ml, lOmg / ml, 11 mg / ml, 12 mg / ml, 13 mg / ml, 14 mg / ml, 15 mg / ml, 16 mg / ml, 17 mg / ml, 18 mg / ml, 19 mg / ml or 20 mg / ml. In some embodiment, the composition further comprises one or more additional therapeutic agents, e.g., second, third or fourth therapeutic agents. So far, the exact cellular expression of ZB TB 16 has not been shown, nor has the exact signaling pathway or mechanism been elucidated. The inventors were able to identify very precisely the cardiac cell type involved in ZBTB 16 repression using single-cell nucleus methods and validate it not only in old age but also in human heart disease. The inventors were able to show in vitro and in vivo that ZBTB 16 repression impairs not only endothelial function, but also cardiac function globally.

[0048] The inventors therefore provide upregulation and overexpression, such as, for example, using targeted AAV9-mediated ZBTB 16 overexpression or overexpression of mRNA, including modified mRNAs, or prevention of repression in endothelial cells of aged or diseased individuals. Since initial data show an epigenetic repression of ZBTB 16, the inventors envision additional strategies in order to block these repressions.

[0049] The current literature discusses some controversial functions of the factor ZBTB 16, and is not clear to what extent, in which specific disease and in which cells ZBTB 16 has a specific effect. The present invention shows that ZBTB 16 is particularly repressed in the endothelium in progressed and old age, and thus negatively affects heart function. In addition, the inventors show a link between cardiac aging and heart disease and thus provide a specific therapeutic option to inhibit aging and senescence-mediated paracrine effects with the use of agents that increase ZBTB 16 expression and / or function, such as constructs based on endothelium-directed AAV9 or the provision of specific mRNAs.

[0050] Another aspect of the present invention relates to the pharmaceutical composition according to the present invention for use in the prevention or treatment of diseases in a subject, in particular for use in the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation. Details regarding the pharmaceutical composition and the uses thereof are also described above.

[0051] Further preferred is the method according to the present invention, wherein the at least one protein or functional fragment thereof, the at least one compound, the at least one nucleic acid or functional fragment thereof, the at least one expression cassette or at least one vector, such as lentiviral vector, are administered as a pharmaceutical composition together with at least one pharmaceutically acceptable carrier, or as a pharmaceutical composition produced according to the present invention.

[0052] In another embodiment of the present invention, the at least one nucleic acid or functional fragment thereof for use according to the present invention is RNA, DNA, or mixtures thereof, is in the form of naked RNA, an expression cassette or vector, or has been recombinantly or synthetically produced or in vitro transcribed. In general, any suitable nucleic acid can be used to provide the nucleic acid or functional fragment thereof for use according to the present invention to a subject or a cell. Administration as a naked mRNA or an RNA in the form of a coated nucleic acid or as a particle comprising the nucleic acid can be achieved (for reviews, see Yamada Y. Nucleic Acid Drugs-Current Status, Issues, and Expectations for Exosomes. Cancers (Basel). 2021 Oct 5; 13(I9):5002. doi: 10.3390 / cancersl3195002. PMID: 34638486; PMCID: PMC8508492, and Kulkami JA, Witzigmann D, Thomson SB, Chen S, Leavitt BR, Cullis PR, van der Meel R. The current landscape of nucleic acid therapeutics. NatNanotechnol. 2021 Jun; 16(6): 630-643. doi: 10.1038 / s41565-021-00898-0. Epub 2021 May 31. Erratum in: Nat Nanotechnol. 2021 Jul; 16(7): 841. PMID: 34059811). The person of skill is readily able to produce the at least one nucleic acid or functional fragment thereof for use according to the present invention.

[0053] Preferred is the pharmaceutical composition for use according to the present invention, wherein the composition is for injection, oral and / or time-release application.

[0054] Even further preferred is the pharmaceutical composition for use according to the present invention, wherein the use is as preventive therapy in order to avoid cardiac ageing and to maintain cardiac function.

[0055] Yet another aspect of the present invention relates to the non-medical use of the pharmaceutical composition according to the present invention for increasing the expression, amount and / or biological activity of the protein ZBTB16 in a cell. Examples are, for example recombinant, cell culture cells and respective in vitro methods to study ZBTB16-related cardiac and senescence functions.

[0056] Yet another aspect of the present invention relates to a method for the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation in a subject, comprising administering to said subject an effective amount of the pharmaceutical composition according to the present invention. Details regarding the method of treatment are similar to the medical uses and compositions as above. Preferred is the method according to the present invention, wherein the composition is for injection, oral and / or time-release application.

[0057] Yet another aspect of the present invention then relates to a kit comprising materials for performing a method for detecting senescence in a cell, in particular a cardiac cell, of a subject according to the present invention, in particular materials for detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in a cell obtained from a subject, and optionally further comprising materials for detecting at least one of DNA methylation of the gene for ZBTB16, senescence permanent cell cycle arrest, cellular dysfunction, senescence-associated P-galactosidase activity, and pro-fibrotic and pro- inflammatory secretory phenotype (senescence-associated secretory phenotype, SASP), such as buffers, antibodies against the protein ZBTB16, dyes and labels as well as instructions for performing the method.

[0058] Preferred is the use of the kit according to the present invention for detecting senescence in a cell, in particular a cardiac cell, of a subject, preferably according to the method as disclosed herein.

[0059] The term "treating" or “treatment” as used herein means stabilizing or reducing an adverse symptom associated with a condition; reducing the severity of a disease symptom; slowing the rate of the progression of a disease; inhibiting or stabilizing the progression of a disease condition; or changing a metric that is associated with the disease state in a desirable way. The term "preventing" or “prevention” as used herein means the avoidance of the occurrence of an adverse symptom associated with a condition or disease before they occur.

[0060] Preferred is the method according to the present invention, wherein the protein or functional fragment thereof has been recombinantly produced, for example in a bacterial, mammalian, yeast or insect cell. Further preferred is the method according to the present invention, wherein the treatment is as preventive therapy against ageing or senescence in the for example cardiac cells of the subject.

[0061] In the context of the present invention, the term “about” shall mean to include a deviation of + / - 10% of the value as given, if not indicated otherwise.

[0062] First, the inventors performed single-nucleus ATAC sequencing (snATAC-seq) on hearts of young (3 months old) and old (18 months old) mice. An analysis of the snATAC-seq data revealed a total of six clusters: cardiomyocytes, endothelial cells, epicardial cells, fibroblasts, pericytes, and Purkinje cells. In order to specifically identify endothelial factors, the inventors further compared the most important genes in the endothelial cluster. Among the 50 most downregulated genes, the inventors identified a common, overarching target, the transcription factor ZBTB16. The analysis of proprietary and partly publicly available single-core RNA sequencing data (snRNA-seq) from human hearts of patients with aortic stenosis, heart failure and pediatric dilated cardiomyopathy showed that ZBTB16 was also one of the most downregulated genes in other heart cells.

[0063] In vitro, the inventors investigated the function of ZBTB16 in endothelial cells by inducing siRNA-mediated ZBTB16 downregulation in human umbilical vein endothelial cells (HUVECs). Suppression of ZBTB16 resulted in decreased endothelial function, resulting in impaired ability to form networks, decreased migration, and decreased proliferation, while effects on apoptosis and necrosis remained unchanged. As a feature of aging, cellular senescence as measured by senescence-associated P-galactosidase activity was increased in Z57B76-repressed HUVECs compared to control.

[0064] In vivo the inventors worked with a mouse model showing a heterozygous deletion of ZBTB16. In the hearts of 3 to 4-month-old mice, an aged phenotype was induced compared to wild-type mice. It had diastolic dysfunction and an increase in left ventricular mass. Histological examination also revealed age-associated phenotypes, including increased senescence, fibrosis, and cardiomyocyte hypertrophy, as well as a reduced cardiac innervation. Consistent with the in vitro data, these mice also exhibited decreased endothelial function, as evidenced by reduced capillary density in the heart and impaired endothelial outgrowth in an ex vivo aortic ring assay. Fibroblasts showed contractile phenotype and increased proliferation in the presence of supernatants from siZBTB16-treated HUVECs. To further investigate possible interactions between endothelium and cardiomyocytes, the inventors cultured neonatal rat cardiomyocytes with ZBTB16-deficient HUVECs. In the presence of the ZBTB16-deficient HUVECs, the cardiomyocytes showed an increased beat frequency. These data suggest that age-related ZBTB16 deficiency can lead to an adverse endothelial secretome, that affects neighboring heart cells in a paracrine way.

[0065] Bulk RNA sequencing data from control and ZBTB16 siRNA-treated HUVECs confirmed the upregulation of pro-fibrotic factors such as TGFB-2, SerpinEl, CRACR2A and others in ZBTB16 deficiency.

[0066] The inventors compared vascular cells from young and old mouse hearts with each other and identified a superordinate transcription factor ZBTB16, which significantly controls heart function. The role of the transcription factor ZBTB16 was experimentally investigated in vitro and in vivo, and the link to human pathophysiology was demonstrated by publicly available snRNA-seq data from human hearts. Repression of ZBTB16 led to endothelial and cardiac dysfunction in the mouse model. Overexpression in endothelial cells showed positive effects on network formation and fibroblast activation.

[0067] In conclusion, the inventor’s findings suggest that endothelial ZBTB16 acts as an upstream regulator of cardiac aging and disease. ZBTB16 deficiency results in endothelial dysfunction in vivo and in vitro, while an overall cardiac dysfunction was observed in mice. Of note, endothelial specific Zbtbl6-KO models are needed to demonstrate the role of ZBTB16 in the cardiac vascular niche, but first in vitro studies suggest already a paracrine interaction between Z57B76-defiecient HUVECs and cardiomyocytes and fibroblasts. Nevertheless, the common regulation of ZBTB16 in endothelial cells across various pathologies and aging suggest that ZBTB16 might be an important upstream regulator of cardiac function. Apart from the endothelial niche in aged mouse hearts, ZBTB16 is found to be regulated in cardiomyocytes, fibroblasts, immune cells and others during disease and aging in humans. Approaching it therapeutically is a valuable asset to tackle cardiovascular pathologies. To further develop this, the inventors currently establish adeno-associated viral vectors, serotype 9 (AAV9) to specifically induce Zbtbl6 expression in aged endothelial / heart cells in vivo and thus to tackle aged-related cardiac dysfunction. The present invention relates to the following items:

[0068] Item 1. A method for identifying a compound that increases the expression, amount and / or biological activity of the protein ZBTB16 in a cell of a subject, comprising the steps of i) contacting at least one candidate compound with a cell that expresses the gene for ZBTB16, and ii) detecting an increase of the expression, amount and / or biological activity of the protein ZBTB16 in the cell in the presence of the candidate compound compared to the expression, amount and / or biological activity in the absence of the candidate compound, wherein an increase of the expression, amount and / or biological activity of the ZBTB 16 protein in the cell identifies a compound that increases the expression, amount and / or biological activity of the protein ZBTB 16 in a cell of a subject.

[0069] Item 2. The method according to Item 1, wherein the detecting an increase of the expression, amount and / or biological activity comprises detecting the amount of mRNA, protein, half-life of the ZBTB 16 protein in the cell, and / or proteasomal degradation of target proteins.

[0070] Item 3. The method according to Item 1 or 2, wherein the increase of the expression, amount and / or biological activity comprises detecting a prevention or reduction of repression in cells of aged or diseased subjects.

[0071] Item 4. The method according to any one of Items 1 to 3, wherein the cell is selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, purkinje cells, and recombinant cells thereof expressing ZBTB16, and wherein preferably the cell is in a biological sample obtained from said subject.

[0072] Item 5. The method according to any one of Items 1 to 4, wherein the candidate compound is selected from the group consisting of a natural compound, a plant extract, a peptide, a protein, a small molecule (less than about 500 Da), a nucleic acid, a DNA, an RNA, an siRNA, a DNA- demethylating agent, and an antibody or antigen binding fragment thereof.

[0073] Item 6. The method according to any one of Items 1 to 5, further comprising detecting an antisenescence effect of the candidate compound on the cell of the subject. Item 7. A method for detecting senescence in a cell of a subject, comprising detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in the cell obtained from said subject, wherein a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB 16 in the cell when compared to a control is indicative for senescence of the cell of the subject.

[0074] Item 8. The method according to Item 7, further comprising detecting at least one of DNA methylation of the gene for ZBTB 16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence- associated secretory phenotype, SASP).

[0075] Item 9. The method according to any one of Items 1 to 8, wherein the cell is selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, cardiac smooth muscle cells, cardiac adipocytes, immune cells, nervous fibers, purkinje cells, a cardiac stem cell, and recombinant cells thereof expressing ZBTB 16, and wherein preferably the cell is in a biological sample obtained from said subject.

[0076] Item 10. A method for producing a pharmaceutical composition, comprising performing a method according to any one of Items 1 to 6, and admixing the compound as identified with at least one pharmaceutically acceptable carrier.

[0077] Item 11. A pharmaceutical composition, comprising at least one of the ZBTB 16 protein or functional fragment thereof, at least one nucleic acid or functional fragment thereof encoding for ZBTB 16, in particular an mRNA, preferably a modified mRNAs, at least one expression cassette or at least one vector for expressing, in particular overexpressing, the ZBTB 16 protein or functional fragment thereof in a cell, such as, for example, a viral construct, such as a lentiviral construct, or a CRISPR-cas construct for introducing mutations in the ZBTB16 gene, a cardiac cell overexpressing or cardiac stem cell expressing and preferably recombinantly expressing or overexpressing, ZBTB 16, together with at least one pharmaceutically acceptable carrier, or a pharmaceutical composition as produced according to Item 10. Item 12. The pharmaceutical composition according to Item 11 for use in the prevention or treatment of diseases in a subject, in particular for use in the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation.

[0078] Item 13. The pharmaceutical composition for use according to Item 11 or 12, wherein the composition is for injection, oral and / or time-release application.

[0079] Item 14. Non-medical use of the pharmaceutical composition according to Item 11 for increasing the expression, amount and / or biological activity of the protein ZBTB16 in a cell.

[0080] Item 15. A method for the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation in a subject, comprising administering to said subject an effective amount of the pharmaceutical composition according to Item 11.

[0081] Item 16. The method according to Item 15, wherein the composition is for injection, oral and / or time-release application.

[0082] Item 17. A kit comprising materials for performing a method for detecting senescence in a cell, in particular a cardiac cell, of a subject according to Item 7 or 8, in particular materials for detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in a cell obtained from a subject, and optionally further comprising materials for detecting at least one of DNA methylation of the gene for ZBTB16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence-associated secretory phenotype, SASP), such as buffers, antibodies against the protein ZBTB16, dyes and labels as well as instructions for performing the method.

[0083] Item 18. Use of the kit according to Item 17 for detecting senescence in a cell, in particular a cardiac cell, of a subject. The invention will now be described further in the following examples with reference to the accompanying figures, nevertheless, without being limited thereto. For the purposes of the present invention, all references as cited are incorporated by reference in their entireties.

[0084] Figure 1 shows ZBTB 16 expression in aging and disease. AUMAP plot of snATAC sequencing data from 3-month-old (young) versus 18-month-old (old) male mice showing six clusters representing cardiomyocytes (CM), endothelial cells (EC), epicardial cells (Epi), fibroblasts (Fibr), pericytes (Peri), and purkinje cells (Purk). A total of n=3 hearts per group were used. B Venn diagram of the top-50 down-regulated genes in the endothelial cluster of the snATAC sequencing versus endothelial bulk RNA sequencing data 12 from young versus old mouse hearts (snATAC sequencing: n=3; bulk RNA sequencing n=6). C shows the respective top-25 regulated genes (snATAC sequencing: n=3; bulk RNA sequencing n=6). After passing normality test, p-values were calculated using an unpaired, two-sided t-test (B, C).

[0085] Figure 2 shows that ZBTB16 repression impairs endothelial function in vitro. A siRNA- mediated ZBTB16 repression in human umbilical vein endothelial cells (HUVECs, n=6). B Network formation assay of HUVECs with and without siRNA-mediated ZBTB16-knockdown (n=4). C Boyden-chamber transmigration assay of HUVECs with and without siRNA-mediated ZBTB16-knockdown. Assay has been conducted in the presence (basal) and absence of VEGFA (n=3). D Mean HUVEC count per cell culture dish with and without siRNA-mediated ZBTB16-knockdown (n=5). E To assess cell death, Annexin N i l AAD FACS staining was conducted on HUVECs with and without siRNA-mediated ZBTB16-knockdown (n=3). F Betagalactosidase staining of HUVECs with and without siRNA-mediated ZBTB16-knockdown (n=5). Data are shown as mean and error bars indicate the standard error of the mean (SEM). After applying normality tests, p-values were calculated using the unpaired, two-sided t-test.

[0086] Figure 3 shows that heterozygous Zbtbl6 deletion impairs cardiac function in vivo. A-B Male and female Zbtbl6-wt / wt and -ko / wt (3- to 4-month-old mice) were assessed via echocardiography to determine the diastolic function (A) and left ventricular (LV) mass (B) (n=5 vs. n=6). C-G Male and female Zbtbl6-wt / wt and -ko / wt (3- to 4-month-old mice) were assessed histologically for senescence (C, arrow heads indicate senescence n=3), fibrosis (D, n=4 vs. n=3), cardiomyocyte (CM) size (E, n=4 vs. n=3), innervation (F, n= vs. n=6) and capillary density (n=4 vs. n=3). H Aortic ring assay of 3- to 4-month-old Zbtbl6-\\Nw. versus Zbtbl6- olv mice in the presence and absence of VEGFA (n=3). Data are shown as mean and error bars indicate the standard error of mean (SEM). After passing normality tests, p-values were calculated using the unpaired, two-sided t-test.

[0087] Figure 4 shows that Z7> 77> 76-defi ci ent HUVECs exhibit impaired cellular cross-talks. A-C Culture supernatants from HUVECs with or without Z7>77>76-deficiency were transferred to human fibroblasts. Collagen production was assessed after 48h and 72h histologically in fibroblasts by immune labeling (A, n=9) and contractility was assessed by using a collagen contraction assay (B, n=3). Proliferation was studied by using pH3 staining on fibroblasts, 72h after supernatant transfer (C, n=9). D-E primary neonatal rat cardiomyocytes were cultured on HUVEC monolayers being transfected with Control or anti-Z7>77>76 siRNAs. One representative image is shown in D (DAP I, blue, Phalloidin green, actinin red and VE-Cadherin magenta). Beating frequency of cardiomyocytes was determined as contraction per minute (E, n=3). F Bulk RNA sequencing of HUVECs being transfected with Control or anti-ZBTB16 siRNAs. Top regulated genes being assigned as secreted factor are shown in the graph. Data are shown as mean and error bars indicate the standard error of mean (SEM). After passing normality tests, p-values were calculated using the unpaired, two-sided t-test.

[0088] Figure 5 shows that human endothelial cells (HUVEC) develop less senescence due to the overexpression of ZBTB16 than cells without overexpression.

[0089] Figure 6 shows that ZBTB16 overexpression in senescent endothelial cells (long-term passaged HUVEC) has a beneficial effect on network formation.

[0090] Figure 7 shows that ZBTB16 overexpression in senescent endothelial cells (long-term passaged HUVEC) has a preventive effect on fibroblast activation.

[0091] Figure 8 shows that ZBTB16-deficieny induces PDGF-signaling between endothelial cells and fibroblasts. A Single-nucleus RNA sequencing was performed on hearts of Zbtbl6+ / + and Zbtbl6+ / - mice (n=2, with n=2 pooled hearts from one male and female mouse per group). B- C CellChat analysis of the endothelial cluster. D Pdgfir expression in the fibroblast clusters of both groups. E HUVEC were transfected with si Ctrl or siZBTB16 and supernatant was transferred to fibroblasts. After 72h fibroblasts were stained for C0L1A1 (grey), DAPI (blue) and Phalloidin (green) (n=8). F ChIP sequencing peak upon ZBTB16 pulldown after 5 and 10 minutes of PF A fixation versus input control. Shown is peak 18 that was identified within the NRIP1 gene locus. G NRIP1 gene expression in HUVEC transfected with non-targeting siRNAs (siCtrl, n=4) versus siRNAs against ZBTB16 (siZBTB16, n=3). H Nripl gene expression in cardiac endothelial cells isolated from young and old mouse hearts (n=6)8. I NRIP1 gene expression in HUVEC transfected with non-targeting siRNAs (siCtrl, n=4) versus siRNAs against ZBTB16 (siZBTB16, n=3) versus siRNAs against ZBTB16 and NRIP1 (siZBTB16+siNRIPl, n=3). J HUVE were transfected with either non-targeting siRNAs (siCtrl), siRNAs against ZBTB16 (siZBTB16) or with siRNAs against ZBTB16 and NRIP1 (siZBTB16+siNRIPl). Supernatants were collected and transferred to human cardiac fibroblasts (n=3). After 72h, fibroblasts were stained for C0L1A1 (grey), DAPI (blue) and Phalloidin (green). Corresponding images are shown in Suppl. Figure 5. Data are shown as mean and error bar indicate the standard error of the mean. P-value was calculated by two-tailed Student’s t-test (E, G, H) or using an ordinary one-way ANOVA with a post-hoc Tukey’s test (I, J).

[0092] SEQ ID NO: 1 shows the amino acid sequence of human ZBTB16 (PLZF).

[0093] SEQ ID NO: 2 shows the sequence of the transfer plasmid for ZBTB16 lentiviral overexpression in vitro.

[0094] SEQ ID NOs: 3 to 10 show primer sequences as used.

[0095] Examples

[0096] Material and Methods

[0097] Antibodies used for this project:

[0098] Human PDGF-BB Neutralizing antibody (2 pg / mL, AB-220-NA, RnD Systems)

[0099] RNA isolation

[0100] The miRNeasy Mini kit (217004, Qiagen) in comination with an on-column DNase I digestion (79254, Qiagen) was used for RNA isolation in accordance with the manufacturer’s instruction. The RNA concentration was determined by measuring absorption at 260 nm and 280 nm with the NanoDrop ND 2000-spectrophotometer (PeqLab). cDNA synthesis and quantitative PCR Reverse transcription was performed using reverse transcriptase M-MLV (28025013, ThermoFisher Scientific) from 500 ng of RNA and assessed using the SYBR™ Green PCR Master Mix (4385617, Applied Biosystems). The primers were designed and purchased from Merck:

[0101] Primers (5’->3’): human RPLO fw: TCGACAATGGCAGCATCTAC (SEQ ID NO: 3) human RPLO rev: ATCCGTCTCCACAGACAAGG (SEQ ID NO: 4) human ZBTB16 fw: CCACCTTCGCTCACATACAG (SEQ ID NO: 5) human ZBTB16 rev: TCTTGCCACAGCCATTACA (SEQ ID NO: 6) human PDGFB fw: GCGCCCATTTTTCATTCCCTA (SEQ ID NO: 7) human PDGFB rev: TTTTCTCTTTGCAGCGAGGC (SEQ ID NO: 8) human NRIP1 fw: ACACAGCCAGAAGATGCACA (SEQ ID NO: 9) human NRIP1 rev: ACGCAAGGAGGAGGAGAAGA (SEQ ID NO: 10)

[0102] Functional endothelial cell in vitro assays

[0103] In vitro network formation was performed with 1.5x 105 HUVECs cultured in 12-well plates (Greiner Bio-One GmbH) that had been coated with 250 pL Matrigel (number 356234; Corning). Network formation was determined after 24 hours by measuring the cumulative tube length in 5 randomly chosen microscopic fields with a computer-assisted microscope using Axiovision 4.5 (Zeiss).

[0104] Angiogenic sprouting was studied by HUVEC spheroid-based angiogenic sprouting assay as previously described.

[0105] Cell proliferation was determined by BrdU flow-cytometry analysis as previously described.

[0106] Cell migration was assessed by Boyden chamber transmigration assays. The assays were conducted in 24-well plates (Corning) using the Boyden chamber (FluoroBlok, 4137, Coming) inserts with 8-pm pores. The bottom chamber was loaded with 800 pL full EBM. 5x 104 HUVECs were adjusted in 200 pL and added to the upper chamber. The cells were incubated for 3 hours at 37°C and 5% CO2 in a humidified atmosphere, and the filters were fixed in 4% PFA and stained with 4',6-diamidino-2-phenylindole (DAPI). The number of cells that migrated through the filter was determined by counting the cells in 5 randomly chosen images in the center of the filter at * 10 magnification using the inverted Nikon Eclipse fluorescence microscope.

[0107] Chromatin immuno precipitation (ChIP)

[0108] HUVECS expressing HA-tagged ZBTB16 were fixed with culture medium containing 1% PF A for 10 minutes at room temperature and quenched with 125 mM glycine. The cells were harvested with a scraper and centrifuged at 3000 rpm at 4°C for 5 minutes, and chromatin was isolated with lysis buffer. Isolated chromatin was sheared to fragments of 300-500 bp average length in the Diagenode Bioruptor for 12 cycles with 30-second pulses of ON or OFF at maximum power. 10% of the sheared chromatin was kept as input control, and the rest was added to protein G Dyna beads coated with 5 ug anti -HA antibody (AB9110). Both input and ChIP DNA were treated with RNase, proteinase K, and crosslinks were reversed by incubation overnight at 65 °C followed by phenol-chloroform extraction and ethanol precipitation.

[0109] ChIP sequencing analysis

[0110] Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of QI 5 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides. Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 109) with STAR 2.7. I la. Alignments were filtered to remove: duplicates with Picard 3.0.0 (Picard: A set of tools (in Java) for working with next generation sequencing data in the BAM format), spliced, multi-mapping, ribosomal, or mitochondrial reads. Peak calling was performed with MUSIC version 20170728 in punctate mode with q-value < 0.2, p-value normalization window length 1500 and enrichment vs. input > 3x. Peaks overlapping ENCODE blacklisted regions (known misassemblies, satellite repeats) were excluded. Remaining peaks were unified to represent a common set of regions for all samples. Counts were produced with featureCounts. The raw count matrix was normalized with DESeq2 version 1.36.0. Peaks were annotated with the promoter (TSS +- 5000 nt) of the nearest gene based on Ensembl release 109. Contrasts were created with DESeq2 based on the normalized count peak matrix with all size factors set to one. Peaks were classified as significantly differential at average count > 10 and -1 < log2FC > 1.

[0111] Single nuclei assessment

[0112] To isolate nuclei for transcriptomic analysis, hearts were perfused with IX DPBS in vivo, snap- frozen in liquid nitrogen and stored at -80°C until usage. Eight mice hearts were sequenced (n=4 per group, two females and two males, respectively). For the nuclei isolation, one female and one male heart per group were pooled and processed together. The hearts were minced in pre-filtered homogenization buffer containing 250 mM sucrose (1623637, Sigma-Aldrich), 25 mM KC1 (AM9640G, Invitrogen), 5 mM MgC12 (AM9530G, Invitrogen), 10 mM Tris buffer pH 8.0 (AM9855G, Invitrogen), 1 mM DTT (P2325, Thermo-Fisher Scientific), IX protease inhibitor (11697498001, Roche), 0.6 U / pL Ambion RNase inhibitor (AM2682, Thermo-Fisher Scientific), 0.1% Triton (T8787, Sigma-Aldrich) and 2% BSA (A8022, Sigma-Aldrich) in ultra- pure DNase / RNase-free distilled water (10977035, Thermo-Fisher Scientific). Cells were disrupted with seven strokes of a loose pestle in a glass dounce homogenizer. The homogenized solution was filtered using a pre-wetted 40 pm cell strainer followed by a pre-wetted 20 pm cell strainer. After centrifugation (500 g at 4°C for 8 minutes), the cell pellet was re-suspended in sorting buffer containing 2% BSA, 0.6 U / pL Ambion RNase inhibitor, 1 mM DTT in DPBS. 7AAD (420403, Biolegend) positive nuclei were separated from cell debris using the FACS- Aria III instrument (BD Biosciences; Nozzle size 100 microns) into collection buffer containing 2% BSA, 1 U / pL Ambion RNase inhibitor, 1 mM DTT in DPBS. Sorted nuclei were washed with 0.04% BSA in DPBS.

[0113] Library preparation was performed as previously described and single-nucleus RNA sequencing results were processed with the 10X Genomics Cell Ranger pipeline (7.2.0). The command “count” was employed to align the raw reads to the mouse reference genome (GRCm38-2019). Following the best practices for single-nucleus RNA sequencing, the option “include-introns” was activated during the analysis. To mitigate ambient RNA contamination, the ‘remove-background’ module of CellBender (0.3.0) was applied to the raw data counts. The downstream processing and analysis were conducted with Scanpy (1.9.6) operated within Python 3.9.18. Our downstream analysis excluded genes expressed in less than 3 cells. We further removed cells with insufficient gene counts (<250 UMI) and with an excess of mitochondrial RNA counts (>10%). Doublet detection was performed using Scrublet (0.2.3) assuming an expected doublet rate of 6%. Additionally, the top 5% of cells with the highest number of UMI counts were discarded. After normalization of the data to total counts and a log-transformation, the most variable genes across the different batches were identified to performed dimensionality reduction and integration through principal component analysis and BBKNN batch correction approach (1.6.0) using 3 neighboring cells within batches. The uniform manifold approximation and projection (UMAP) embeddings were computed to visualize the data. Cell clustering was conducted using the Leiden algorithm with a resolution parameter of 0.3. Identified clusters were automatically annotated by using CellTypist (1.6.2., Human Heart model VI.0.). The annotation was further cross-checked with gene markers previously identified for the different cell types of the heart. To identify differentially expressed genes between the two conditions, the Wilcoxon rank-sum test and the Benjamini -Hochberg correction method was applied using the “rank genes groups” function of Scanpy. To delve deeper into potential cell-to-cell interactions among the identified cell types in the different conditions, we employed CellChat (2.1.1) within R 4.3.3., by following the recommended “Comparison of multiple datasets” tutorial.

[0114] Single nuclei ATAC sequencing was performed as previously described.

[0115] Bulk RNA sequencing

[0116] For genome-wide analysis of gene expression, RNA sequencing libraries from isolated mRNA were generated and sequenced by the Institute for Lung Health (ILH) - Genomics and Bioinformatics - at the Justus-Liebig-University (JLU) Giessen (Germany). Total RNA was used to enrich for polyadenylated mRNA followed by cDNA sequencing library preparation utilizing the Illumina® Stranded mRNA Prep Kit (Illumina) according to the manufacturer’s instructions. After library quality control by capillary electrophoresis (4200 TapeStation, Agilent), cDNA libraries were sequenced on the Illumina NovaSeq 6000 platform generating 50 bp paired-end reads.

[0117] Statistical analysis

[0118] Statistical data are represented as mean and error bars indicate the standard error of mean (SEM). Shapiro Wilk test was carried out the normality distribution analysis. To compare two groups, an unpaired two sided t-test (Gaussian distributed data) or a Mann Whitney U test (nonGaussian distributed data) was used. For multi-group comparison, an ordinary one-way ANOVA with a post-hoc Tukey test (Gaussian distributed data) or a Kruskal -Wallis test (nonGaussian distributed data) was used.

[0119] In order to identify endothelial factors that undergo epigenetic dysregulation during cardiac aging, the inventors employed single-nuclei ATAC sequencing (snATAC-seq) on hearts obtained from young (3-month-old) and old (18-month-old) mice. This technique allows the identification of accessible DNA regions by probing open chromatin using a hyperactive mutant transposase, which inserts sequencing adapters into open regions of the genome. Unsupervised clustering of the snATAC-seq data revealed six clusters representing cardiomyocytes, endothelial cells, epicardial cells, fibroblasts, pericytes, and purkinje cells (Figure 1A).

[0120] To specifically identify endothelial intrinsic factors, the inventors compared the top differentially accessible genes (DAGs) in the endothelial cluster with the top differentially expressed genes (DEGs) obtained from bulk RNA sequencing data of isolated cardiac endothelial cells from young and old mice (12). Among the top 50 down-regulated genes, the inventors identified a common target, the transcription factor Zbtbl6 (Zinc finger and BTB domain-containing protein 16) (Figure IB, C). Notably, ZBTB16 was not solely regulated in aged cardiac endothelial cells. Analysis of own partially publicly available single-nuclei RNA sequencing data (snRNA-seq) from human hearts of patients with aortic stenosis (16) and heart failure and pediatric dilated cardiomyopathy (17) revealed that ZBTB16 is also one of the top down-regulated genes in diseased and aged (18) cardiac cells also apart from endothelial cells (Table 1).

[0121] For identifying the chromatin remodeling in adult and aging mouse hearts, single-nuclei ATAC (Assay for Transposase-Accessible Chromatin using sequencing) sequencing was performed. Hearts were obtained from young adult (3-month-old) and old (18-month-old) C57B1 / 6J mice and Hoechst-positive nuclei were isolated using flow cytometry. Nuclei were separated and library preparation were performed using the 10X Genomics System. After Illumina sequencing, accessible chromatin areas were analyzed using R-studios and the Seurat packages. To assess transcriptional changes in hearts from young versus old mice, single-nuclei RNA sequencing was performed. Hearts were obtained from young adult (3-month-old) and old (18- month-old) C57B1 / 6J mice. Data were taken from own published data sets that can be found at (14).

[0122] ZBTB16 is known to limit enhancer activity during hematopoietic progenitor aging (19) and has been shown to enhance proliferation (20) and autophagy (21) in endothelial cells. These findings suggest a potential role for ZB TB 16 in endothelial function; however, its involvement in cardiac aging and disease has not been described to date. Therefore, the inventors further investigated its function in endothelial cells in vitro by employing siRNA-mediated repression of ZBTB16 in human umbilical vein endothelial cells (HUVECs) (Figure 2A). Indeed, repression of ZBTB16 resulted in reduced endothelial function, as evidenced by impaired network formation capacity, diminished migration, and decreased proliferation, while apoptosis and necrosis remained unchanged (Figures 2B-F). Consistent with the hallmarks of aging (22), cellular senescence, as assessed by senescence-associated P-galactosidase activity, was increased in Z7> 77> / 6-repressed HUVECs compared to control (Figure 2G).

[0123] For the data as shown in Figure 2 A, ZBTB 16 function was assessed in vitro by siRNA-mediated gene silencing in human umbilical cord vein endothelial cells (HUVEC, from Lonza). ZBTB 16 repression was achieved using 40 nM of the pre-designed siRNA pool from Dharmakon / HORIZON (L-018719-00-0005). 40 nM of a negative control siRNA (4457287, Ambion) served as control treatment. Knockdown efficacy was determined 72h post siRNA transfection.

[0124] For the data as shown in Figure 2B, in order to study whether ZBTB 16 impacts endothelial cell function, a network formation was performed. ZBTB16 was repressed in HUVEC as outlined for Figure 2A. 48h after transfection, 200 pL matrigel (354234, Corning) was added per well of a 12-well plate and solidified for 2h at 37°C. Afterwards, 500 pL endothelial basal medium (Lonza) was applied and equilibrated for Ih at 37°C. 15*104HUVEC were added per well in 500 pL medium. After incubating overnight, network formation was assessed with the Zeiss AxioVision System.

[0125] For the data as shown in Figure 2C, in order to study whether ZBTB 16 impacts endothelial cell function, a Boyden Chamber migration assay was performed. ZBTB16 was repressed in HUVEC as outlined for Figure 2A. 48h after transfection, 800 pL endothelial basal medium (Lonza) was added to the bottom well. After adding the insert, 5 *104cells were added in 200 pL per well. After incubating the assay for 3h at 37°C, cells were washed, fixed with 4% PFA and stained with DAPI. Transmigrated cells were imaged using an inverted laser microscope (Nikon Eclipse). For the data as shown in Figure 2D and F, to study whether ZBTB 16 impacts endothelial cell senescence, a beta-galactosidase staining was performed. ZBTB16 was repressed in HUVEC as outlined for Figure 2A. 72h after transfection, cells were fixed and stained for active beta-galactosidase as described by the manufacturer (9860, Cell Signaling Technologies). Beta-galactosidase positive cells (blue stain) were imaged using the Zeiss AxioVision System. Furthermore, cell count was determined per image to assess cell viability / proliferation. For the data as shown in Figure 2E, to study whether ZBTB16 impacts endothelial cell viability, an Annexin V staining was performed. ZBTB16 was repressed in HUVEC as outlined for Figure 2A. 72h after transfection, cells detached, and Annexin V (a measure for apoptosis) was stained for flow cytometry as described by the manufacturer (A23204, Invitrogen).

[0126] To establish the in vivo relevance of ZBTB16, the inventors utilized consecutive Zbtbl6- knockout (Zbtbl6-KO) mice. Interestingly, the distribution of individual genotypes within the litter was highly uneven, with 7% of all litters being homozygous for Zbtbl6 deletion, while wildtype and heterozygous animals were equally distributed. Consistent with literature findings (23), the tested homozygous mice exhibited structural deformities such as polydactyly, curved posture, and elongated limbs. As these systemic effects could influence cardiac function, the inventors excluded homozygote knock out mice from the study and focused on heterozygote littermates.

[0127] Remarkably, the heterozygous deletion of Zbtbl6 was sufficient to induce an aged-like phenotype in the hearts of 3- to 4-month-old heterozygotes compared to wildtype mice, as evidenced by diastolic dysfunction and an increase in left ventricular mass (Figure 3A, B). Histological examination further revealed age-associated phenotypes, including increased senescence, fibrosis, and cardiomyocyte hypertrophy, along with reduced cardiac innervation (Figures 3C-F). In line with the in vitro data, heterozygous mice exhibited reduced endothelial function, as demonstrated by decreased capillary density in the heart and impaired endothelial outgrowth in an ex vivo aortic ring assay (Figures 3F, G). These findings suggest that depletion of ZBTB16 is sufficient to induce cardiac aging.

[0128] In Figure 3, to assess the role of ZBTB16 in vivo, 3-month-old global heterozygous Zbtbl6- deletion (Zbtbl6 - / +) mice were used that were obtained from MMRRC (UC Davis Mouse Biology Program Mutant Mouse Regional Resource Center). Wildtype littermates (Zbtbl6 + / +) served as control group. For the data as shown in Figure 3 A-B, the heart function of wildtype and Zbtbl6 - / + mice was determined via echocardiography using the Vevo 3100 echocardiography system with the Vevo LAB software (Fujifilm VisualSonics). Diastolic dysfunction as assessed by EZE’ ratio and left ventricular mass were compared between both groups. For the data as shown in Figure 3C, the cellular senescence was determined in heart sections of wildtype and Zbtbl6 -!+ mice using beta-galactosidase staining as described by the manufacturer (9860, Cell Signaling Technologies). Beta-galactosidase positive areas (blue stain) were imaged using the Zeiss AxioVision System.

[0129] For the data as shown in Figure 3D, the fibrosis was determined in heart sections of wildtype and Zbtbl6 - / + mice using picosirius red staining (PSR-1, Biotrend) and imaged using the Zeiss AxioVision System. For the data as shown in Figure 3E, to assess cardiac hypertrophy in heart sections of wildtype and Zbtbl6 - / + mice wheat germ agglutinin (WGA, W32464, Invitrogen) staining was performed. DAPI served as counter stain. Images were taken using the Leica Stellaris confocal microscope and the LASX software. For the data as shown in Figure 3F, to assess cardiac innervation in heart sections of wildtype and Zbtbl6 - / + mice TUJ1 (ab 18207, Abeam) staining was performed. DAPI and Isolectin B4 (endothelial marker, VEC-B-1205, Biozol) served as counter stain. Images were taken using the Leica Stellaris confocal microscope and the LASX software.

[0130] For the data as shown in Figure 3G, the capillary density was determined in heart sections of wildtype and Zbtbl6 - / + mice by Isolectin B4 (endothelial marker, VEC-B-1205, Biozol) staining. Images were taken using the Leica Stellaris confocal microscope and the LASX software.

[0131] For the data as shown in Figure 3H, the angiogenic capacity was determined using the aortic ring assay. After euthanizing the mice, hearts were perfused with cold HBSS. Aorta was isolated and cut into at least 8 rings. Each ring was embedded in one well of a 96-well plate containing 50 pL type I collagen (08-115, Millipore) in lx medium Ml 19 (M0650, Sigma- Aldrich), 8 mM NaHCO3 (HN01.2, Carl Roth GmbH) and 10 mM NaOH (6771.1 Carl Roth GmbH). Aortic rings were kept for Ih at 37°C prior to adding 150 pL DMEM / F-12 (10565018, Gibco) supplemented with 2.5% FBS (4133, Invitrogen) per well. Aortic rings were cultured in the presence and absence of VEGFA (SRP4363-10UG, Sigma-Aldrich) for 7 days. Aortic rings were fixed with 4% PFA (28908, ThermoFisher Scientific) for 30 minutes and were permeabilized in PBS containing 0.25% Triton X-100 for 15 minutes. After blocking for 30 minutes in Dako protein blocking buffer (X0909, DAKO), aortic rings were incubated overnight in PBLEC buffer (50 pl IM MgCh, 50 pl IM CaCh, 5 pl IM MnCh, 5 ml 10% Triton-X-100, in 50 ml PBS) containing 1 : 100 IB4. Rings were washed three times for 15 minutes in PBS and were incubated with Streptavidin conjugated to Alexa488 (1 : 500) for 3h at room temperature. After washing three times in PBS (15 minutes each), aortic rings were imaged using the Leica Stellaris confocal microscope and the LASX software.

[0132] As previously mentioned, the expression of Zbtbl6 is reduced in aged cardiac endothelial cells, and repression of ZBTB16 in HUVECs leads to endothelial dysfunction. Notably, cellular senescence, a hallmark of aging (22), is induced in endothelial cells upon ZBTB16 repression. Cellular senescence is a complex cellular state characterized by permanent cell cycle arrest, cellular dysfunction, and a pro-fibrotic and pro-inflammatory secretory phenotype (senescence- associated secretory phenotype, SASP, 24). This SASP may result in an adverse cellular crosstalk. Indeed, transferring cell culture supernatants from Z7> 77> 76-repressed HUVECs onto human fibroblasts induced collagen expression in the fibroblasts (Figure 4A). Furthermore, fibroblasts exhibited a contractile phenotype in the presence of supernatants from siZBTB16- treated HUVECs (Figure 4B) and increased proliferation (Figure 4C). To further investigate potential endothelial-cardiomyocyte crosstalk, the inventors co-cultured neonatal rat cardiomyocytes with Z57B76-deficient HUVECs. In the presence of Z57B76-deficient HUVECs, cardiomyocytes showed increased beating frequency (Figures 4D, E).

[0133] These data show that age-induced Zbtb 16 deficiency results in an adverse endothelial secretome that affects neighboring cardiac cells in a paracrine manner. Bulk RNA sequencing data of control- versus ZBTB16- siRNA-treated HUVECs further confirmed the upregulation of pro- fibrotic factors such as TGFB-2, SerpinEl, CRACR2A and others upon ZBTB16 deficiency (Figure 4F).

[0134] For the data as shown in Figure 4 A, to study to what extent ZBTB 16-loss does affect endothelial paracrine function, ZBTB16 was repressed in HUVEC as described for Figure 2A. Cell culture supernatants of these cells were transferred to human cardiac fibroblasts (HCF) that were obtained from PromoCell (C-12375). Fibroblast activation was assessed by collagen 1A1 staining 48h and 72h after supernatant transfer. For the data as shown in Figure 4B, to further study fibroblast activation, fibroblasts (PromoCell (C-12375)) were seeded in a collagen gel and cultured in supernatant of HUVEC with and without ZBTB16-knockdown. Activated fibroblasts have the ability to contract, hence collagen gel contraction can be used as a measure for fibroblast activation. Collagen gel size was determined 24h, 48, 72h and 96h after supernatant transfer. For the data as shown in Figure 4C, to study to what extent ZBTB 16-loss does affect endothelial paracrine function, ZBTB16 was repressed in HUVEC as described for Figure 2A. Cell culture supernatants of these cells were transferred to human cardiac fibroblasts (HCF) that were obtained from PromoCell (C-12375). Fibroblast proliferation was assessed by phosphor histone H3 (pH3) staining 48h after supernatant transfer.

[0135] For the data as shown in Figure 4D-E, to study to what extent ZBTB16-loss does affect endothelial paracrine function, ZBTB16 was repressed in HUVEC as described for Figure 2A. Isolated neonatal rat cardiomyocytes were seeded onto HUVEC and were stained by Phalloidin and a-actinin. Cells were imaged using the Leica Stellaris confocal microscope and the LASX software and cardiomyocyte contraction was determined as beats per minute.

[0136] For the data as shown in Figure 4F, to study to what extent ZBTB16-loss does affect endothelial paracrine function, ZBTB16 was repressed in HUVEC as described for Figure 2A. Total RNA was purified from ZBTB16-knockdown versus control HUVEC by using the miRNeasy Mini kits (217004, Qiagen), combined with on-column DNase digestion (DNase Set, 79254, Qiagen) as described in the manufacturer’s instruction. Bulk RNA sequencing was performed as described in (14).

[0137] The inventors' findings also show that endothelial ZBTB16 acts as an upstream regulator of cardiac aging and disease. ZBTB16 deficiency leads to endothelial dysfunction in vivo and in vitro, resulting in general cardiac dysfunction.

[0138] As the proof of concept, regulation in the other direction (overexpression) produced positive effects. Senescent (long-passaged) HUVECs were used and ZBTB16 was lentivirally overexpressed. As an endpoint, cellular senescence was measured via immunostaining, and cell function was checked via co-cultures (transfer of cell culture supernatants) with fibroblasts.

[0139] Table 1: ZBTB16 mRNA expression human and mouse data sets. Trend in ZBTB16 mRNA expression was assessed in cardiac cells from aged mouse and human data and from snRNA sequencing data from aortic stenosis (AS) and pediatric dilated cardiomyopathy (DCM)17 patients. SnRNA sequencing data from heart failure with preserved ejection fraction (HFpEF) patients are not published and only two samples were available. Tended regulation versus respective control is indicated by “down”, while indicates no changes. Empty fields indicate that no data were available.

[0140]

[0141] Human endothelial cells (HUVEC) develop less senescence due to the overexpression of ZBTB16 than cells without overexpression (Figure 5)

[0142] Human endothelial cells from the umbilical vein (HUVEC) from the company Lonza were used. These were cultivated with the appropriate medium EBM (with 10% FBS instead of 1% FBS). To induce cellular senescence, the inventors cultured the cells over at least eleven passages. Senescence is controlled with the B-galactosidase staining kit (Catalog-No. 9860) from CST. ZBTB16 overexpression was lentiviral via the attached transfer plasmid from VectorBuilder (SEQ ID NO: 2). A transfer plasmid with a corresponding non-coding placeholder sequence served as a negative control.

[0143] For the experiment, the Pl 1-HUVEC were transduced with the corresponding lentivirus. Eight days after transduction, cellular senescence was detected via the above-mentioned staining kit. Untreated P2-HUVEC were only used as a negative control for B-galactosidase staining. The coloring was evaluated using the software ImageJ (or FIJI) with a corresponding RGB macro.

[0144] ZBTB16 overexpression in endothelial cells has an effect on network formation (Figure 6) The network formation images of Figure 6 are senescent HUVECs (Pl 3 or Pl 7) that have overexpressed ZBTB16 for either two (17 days) or four weeks (31 days). The corresponding control has an ORF stuffer in the plasmid, analogous to previous results. At any point in time, they are n=l biological replicates, each with 4 different image sections, which have been averaged. The trend shows that senescent cells with ZBTB16 overexpression are better able to form networks. In the fibroblast experiments, HCF-c cells were treated with supernatant of senescent HUVEC (P12 or P16) for 72 h with either 1 week or 3 weeks of overexpression. The results with n=l biological replicates (but n=3 technical replicas) show that fibroblasts are less activated (measured by collagen 1A1 versus DAPI) and thus the overexpression of ZBTB16 appears to be protective. This effect is visible through both short-term overexpression (1 week) and long-term (3 weeks).

[0145] ZBTB16 overexpression in endothelial cells has an effect on fibroblast activation (Figure 7)

[0146] In the fibroblast experiments, HCF-c cells were treated with supernatant of senescent HUVEC (Pl 2 or Pl 6) for 72 h with either 1 week or 3 weeks of overexpression. The results with n=l biological replicas (but n=3 technical replicas) show that fibroblasts are less activated (measured by collagen 1A1 versus DAPI) and thus the overexpression of ZBTB16 appears to be protective. This effect is visible through both short-term overexpression (1 week) and longterm (3 weeks).

[0147] ZBTB16-deficieny induces PDGF-signaling between endothelial cells and fibroblasts (Figure 8)

[0148] To determine if the observed cellular communication defects in vitro, are active in vivo, the inventors analyzed the gene expression in the different cell populations in hearts of ZBTB 16+ / - mice by single nuclei RNA sequencing (Figure 8A). Indeed, ligand-receptor analyses predict an increased outgoing signaling from endothelial cells of Zbtbl6-deficient hearts in particular to fibroblasts and activated fibroblasts (Figure 8B). Especially PDGFB-signaling was predicted to be increased in endothelial cells from ZBTB 16+ / - hearts (Figure 8C), while the mRNA expression of the corresponding receptor Pdgfrb was up-regulated in fibroblasts and activated fibroblasts in ZBTB 16+ / - hearts (Figure 8D). In vitro modelling confirmed that addition of neutralizing PDGFB-antibodies partially recues fibroblast activation by conditioned media from ZBTB 16 deficient HUVEC (Figure 8E).

[0149] In order to elucidate the downstream mechanism on how ZBTB 16 drives PDGFB expression, a ZBTB16-HA-tag construct was overexpressed in HUVEC followed by ChIP (chromatin immunoprecipitation) DNA sequencing. Among 18 targets, NRIP1 (nuclear receptor interacting protein 1) was identified at both 5 and 10 minutes of cell fixation (Figure 8F). Indeed, NRIP1 / Nripl expression is induced in both ZBTB 16-defici ent HUVEC (Figure 8G) and in aged cardiac mouse endothelial cells (Figure 8H). To determine the role of NRIP1 in mediating ZBTB 16 effects, HUVECs were co-transfected with siRNA pools against ZBTB 16 and NRJP1, which blunted PDGFB-induction (Figure 81). In addition, conditioned media from HUVECs co-transfected with both siRNA pools did not activate fibroblasts as compared to conditioned media from HUVEC being transfected with siRNAs against ZBTB 16 alone (Figure 8J).

[0150] References

[0151] 1. Benjamin EJ, et al. Heart Disease and Stroke Statistics — 2017 Update: A Report From the American Heart Association. Circulation [Internet], 2017;135:el46-e603. Available from: https: / / doi.Org / 10.1161 / CIR.0000000000000485

[0152] 2. Obas V, Vasan RS. The aging heart. Clin Sci [Internet], 2018;132: 1367-1382. Available from: https: / / doi.org / 10.1042 / CS20171156

[0153] 3. Wagner JUG, Dimmeler S. Cellular cross-talks in the diseased and aging heart. J Mol Cell

[0154] Cardiol [Internet], 2020;138:136-146. Available from: https: / / doi.Org / 10.1016 / j.yjmcc.2019.l l.152

[0155] 4. Nikolova G, Strilic B, Lammert E. The vascular niche and its basement membrane. Trends Cell Biol. 2007;17: 19-25.

[0156] 5. Ding B, et al. Endothelial -derived inductive angiocrine signals initiate and sustain regenerative lung alveolarization. Cell. 2012;147:539-553.

[0157] 6. Yosif M, A. BR, Stefanie D. Vascular Niche Controls Organ Regeneration. Circ Res

[0158] [Internet], 2014;114: 1077-1079. Available from: https: / / doi.org / 10.1161 / CIRCRESAHA.l 14.303452

[0159] 7. Rhee S, et al. Endocardial / endothelial angiocrines regulate cardiomyocyte development and maturation and induce features of ventricular non-compaction. Eur Heart J. 2021;42:4264- 4276.

[0160] 8. Hu J, et al. Endothelial Cell-Derived Angiopoietin-2 Controls Liver Regeneration as a Spatiotemporal Rheostat. Science (80- ) [Internet], 2014;343:416 LP - 419. Available from: http: / / science.sciencemag.org / content / 343 / 6169 / 416.abstract

[0161] 9. Ding B-S, et al. Divergent angiocrine signals from vascular niche balance liver regeneration and fibrosis. Nature [Internet], 2014;505:97-102. Available from: https: / / doi.org / 10.1038 / naturel2681

[0162] 10. Bassat E, et al. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature [Internet], 2017;547: 179-184. Available from: https: / / doi.org / 10.1038 / nature22978

[0163] 11. Stefanie D. Regulation of Bone Marrow-Derived Vascular Progenitor Cell Mobilization and Maintenance. Arterioscler Thromb Vase Biol [Internet], 2010;30: 1088-1093. Available from: https: / / doi.org / 10.1161 / ATVBAHA.109.191668

[0164] 12. Wagner JUG, et al. Ageing impairs the neuro-vascular interface in the heart. bioRxiv

[0165] [Internet], 2022;2022.07.29.501999. Available from: http: / / biorxiv.org / content / early / 2022 / 08 / 02 / 2022.07.29.501999.abstract

[0166] 13. Wagner JUG, et al. Switch in Laminin [32 to Laminin [31 Isoforms During Aging Controls

[0167] Endothelial Cell Functions — Brief ReportHighlights. Arterioscler Thromb Vase Biol [Internet], 2018;38: 1170-1177. Available from: http: / / atvb.ahajoumals.org / lookup / doi / 10.1161 / ATVBAHA.117.310685

[0168] 14. Vidal R, et al. Transcriptional heterogeneity of fibroblasts is a hallmark of the aging heart. JCI Insight [Internet], 2019;4. Available from: https: / / doi.org / 10.1172 / jci.insight.131092

[0169] 15. Nicin L, Wagner JUG, Luxan G, Dimmeler S. Fibroblast-mediated intercellular crosstalk in the healthy and diseased heart. FEBSLett. 2021; 16. Nicin L, et al. Cell type-specific expression of the putative SARS-CoV-2 receptor ACE2 in human hearts. Eur Heart J [Internet], 2020;41 : 1804-1806. Available from: https: / / doi.org / 10.1093 / eurheartj / ehaa311

[0170] 17. Nicin L, et al. Single Nuclei Sequencing Reveals Novel Insights into the Regulation of Cellular Signatures in Children with Dilated Cardiomyopathy. Circulation [Internet], 2021;0. Available from: https: / / doi.org / 10.1161 / CIRCULATIONAHA.120.051391

[0171] 18. Litvinukova M, et al. Cells of the adult human heart. Nature. 2020;588:466-472.

[0172] 19. Poplineau M, et al. PLZF limits enhancer activity during hematopoietic progenitor aging. Nucleic Acids Res. 2019;47:4509-4520.

[0173] 20. Joko T, et al. Effects of promyelocytic leukemia zinc finger protein on the proliferation of cultured human corneal endothelial cells. Mol Vis. 2007;13:649-658.

[0174] 21. Chen C-H, et al. Far-infrared protects vascular endothelial cells from advanced glycation end products-induced injury via PLZF-mediated autophagy in diabetic mice. Sci Rep. 2017;7:40442.

[0175] 22. Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G. The hallmarks of aging. Cell. 2013;153.

[0176] 23. Fischer S, et al. Biallelic loss of function of the promyelocytic leukaemia zinc finger (PLZF) gene causes severe skeletal defects and genital hypoplasia. JMed Genet [Internet], 2008;45:731 LP - 737. Available from: http: / / jmg.bmj.com / content / 45 / l l / 731.abstract

[0177] 24. Kirkland JL, Tchkonia T. Cellular Senescence: A Translational Perspective. EBioMedicine . 2017;21 :21-28.

[0178] 25. Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang ZY, Waxman S, Zelent A. Fusion between a novel Kriippel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(l l;17) translocation associated with acute promyelocytic leukaemia. EMBO J [Internet], 1993;12: 1161-1167. Available from: https: / / doi.Org / 10.1002 / j.1460- 2075.1993 ,tb05757.x

[0179] 26. Barna M, Hawe N, Niswander L, Pandolfi PP. Plzf regulates limb and axial skeletal patterning. Nat Genet. 2000;25: 166-172.

[0180] 27. Barna M, Pandolfi PP, Niswander L. Gli3 and Plzf cooperate in proximal limb patterning at early stages of limb development. Nature. 2005;436:277-281.

[0181] 28. Bracamonte-Baran W, Chen G, Hou X, Talor M V, Choi HS, Davogustto G, Taegtmeyer H, Sung J, Hackam DJ, Nauen D, Cihakova D. Non-cytotoxic Cardiac Innate Lymphoid Cells Are a Resident and Quiescent Type 2-Commited Population. Front Immunol. 2019;10:634.

[0182] 29. Park J-Y, DiPalma DT, Kwon J, Fink J, Park J-H. Quantitative Difference in PLZF Protein Expression Determines iNKT Lineage Fate and Controls Innate CD8 T Cell Generation. Cell Rep. 2019;27:2548-2557. e4.

[0183] 30. Hosokawa H, Romero-Wolf M, Yui MA, Ungerback J, Quiloan MLG, Matsumoto M, Nakayama KI, Tanaka T, Rothenberg E V. Bell lb sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtbl6. Nat Immunol. 2018;19: 1427-1440.

[0184] 31. Mao A-P, Ishizuka IE, Kasai DN, Mandal M, Bendelac A. A shared Runxl -bound Zbtbl6 enhancer directs innate and innate-like lymphoid lineage development. Nat Commun. 2017;8:863.

[0185] 32. Suliman BA, Xu D, Williams BRG. The promyelocytic leukemia zinc finger protein: two decades of molecular oncology. Front Oncol. 2012;2:74.

[0186] 33. McKean DM, et al. Loss of RNA expression and allele-specific expression associated with congenital heart disease. Nat Commun [Internet], 2016;7: 12824. Available from: https: / / doi.org / 10.1038 / ncommsl2824

[0187] 34. Naray-Fejes-Toth A, Boyd C, Fejes-Toth G. Regulation of epithelial sodium transport by promyelocytic leukemia zinc finger protein. Am J Physiol Physiol [Internet], 2008;295:F18- F26. Available from: https: / / doi.org / 10.1152 / ajprenal.00573.2007 35. Senbonmatsu T, et al. A novel angiotensin II type 2 receptor signaling pathway: possible role in cardiac hypertrophy. EMBO J. 2003;22:6471-6482.

[0188] 36. Ahmed BAM, Seda O, Lavoie JL. (Pro)renin receptor as a new drug target. Curr Pharm Des. 2011;17:3611-3621.

[0189] 37. Funke-Kaiser H, Reinemund J, Steckelings UM, Unger T. Adapter proteins and promoter regulation of the angiotensin AT2 receptor— implications for cardiac pathophysiology. J Renin Angiotensin Aldosterone Syst. 2010; 11 :7-17.

[0190] 38. Schefe JH, Unger T, Funke-Kaiser H. PLZF and the (pro)renin receptor. J Mol Med (Berl). 2008;86:623-627.

[0191] 39. Liska F, et al. Plzf as a candidate gene predisposing the spontaneously hypertensive rat to hypertension, left ventricular hypertrophy, and interstitial fibrosis. Am J Hypertens. 2014;27:99-106.

[0192] 40. Liska F, et al. Downregulation of Plzf Gene Ameliorates Metabolic and Cardiac Traits in the Spontaneously Hypertensive Rat. Hypertens (Dallas, Tex 1979). 2017;69: 1084-1091.

[0193] 41. Farrell E, et al. Transcriptome Analysis of Cardiac Hypertrophic Growth in MYBPC3-Null Mice Suggests Early Responders in Hypertrophic Remodeling [Internet], Front. Physiol. . 2018;9: 1442. Available from: https: / / www.frontiersin.org / article / 10.3389 / fphys.2018.01442

[0194] 42. Chung E, Heimiller J, Leinwand LA. Distinct Cardiac Transcriptional Profiles Defining Pregnancy and Exercise. PLoS One [Internet], 2012;7:e42297. Available from: https: / / doi.org / 10.1371 / joumal.pone.0042297

[0195] 43. Rho SB, Choi K, Park K, Lee J-H. Inhibition of angiogenesis by the BTB domain of promyelocytic leukemia zinc finger protein. Cancer Lett [Internet], 2010;294:49-56. Available from: https: / / www.sciencedirect.com / science / article / pii / S0304383510000479

Claims

Claims1. A method for identifying a compound that increases the expression, amount and / or biological activity of the protein ZBTB16 in a cell of a subject, comprising the steps of i) contacting at least one candidate compound with a cell that expresses the gene for ZBTB16, and ii) detecting an increase of the expression, amount and / or biological activity of the protein ZBTB16 in the cell in the presence of the candidate compound compared to the expression, amount and / or biological activity in the absence of the candidate compound, wherein an increase of the expression, amount and / or biological activity of the ZBTB 16 protein in the cell identifies a compound that increases the expression, amount and / or biological activity of the protein ZBTB 16 in a cell of a subject.

2. The method according to claim 1, wherein the detecting an increase of the expression, amount and / or biological activity comprises detecting the amount of mRNA, protein, half-life of the ZBTB 16 protein in the cell, and / or proteasomal degradation of target proteins.

3. The method according to claim 1 or 2, wherein the increase of the expression, amount and / or biological activity comprises detecting a prevention or reduction of repression in cells of aged or diseased subjects.

4. The method according to any one of claims 1 to 3, wherein the cell is selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, purkinje cells, and recombinant cells thereof expressing ZBTB16, and wherein preferably the cell is in a biological sample obtained from said subject.

5. The method according to any one of claims 1 to 4, wherein the candidate compound is selected from the group consisting of a natural compound, a plant extract, a peptide, a protein, a small molecule (less than about 500 Da), a nucleic acid, a DNA, an RNA, an siRNA, a DNA- demethylating agent, and an antibody or antigen binding fragment thereof.

6. The method according to any one of claims 1 to 5, further comprising detecting an antisenescence effect of the candidate compound on the cell of the subject.

7. A method for detecting senescence in a cell of a subject, comprising detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in the cell obtained from said subject, wherein a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB 16 in the cell when compared to a control is indicative for senescence of the cell of the subject, preferably further comprising detecting at least one of DNA methylation of the gene for ZBTB 16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence- associated secretory phenotype, SASP).

8. The method according to any one of claims 1 to 7, wherein the cell is selected from the group consisting of cardiac cells, in particular derived from aged and / or diseased subjects, cardiomyocytes, cardiac endothelial cells, epicardial cells, cardiac fibroblasts, cardiac pericytes, cardiac smooth muscle cells, cardiac adipocytes, immune cells, nervous fibers, purkinje cells, a cardiac stem cell, and recombinant cells thereof expressing ZBTB 16, and wherein preferably the cell is in a biological sample obtained from said subject.

9. A method for producing a pharmaceutical composition, comprising performing a method according to any one of claims 1 to 6, and admixing the compound as identified with at least one pharmaceutically acceptable carrier.

10. A pharmaceutical composition, comprising at least one of the ZBTB 16 protein or functional fragment thereof, at least one nucleic acid or functional fragment thereof encoding for ZBTB 16, in particular an mRNA, preferably a modified mRNAs, at least one expression cassette or at least one vector for expressing, in particular overexpressing, the ZBTB 16 protein or functional fragment thereof in a cell, such as, for example, a viral construct, such as a lentiviral construct, or a CRISPR-cas construct for introducing mutations in the ZBTB 16 gene, a cardiac cell overexpressing or cardiac stem cell expressing and preferably recombinantly expressing or overexpressing, ZBTB 16, together with at least one pharmaceutically acceptable carrier, or a pharmaceutical composition as produced according to claim 9.

11. The pharmaceutical composition according to claim 10 for use in the prevention or treatment of diseases in a subject, in particular for use in the prevention or treatment of cellular senescence, cardiovascular diseases, cardiac ageing, age-induced diastolic dysfunctions, epigenetic dysregulation during cardiac aging, aortic stenosis, heart failure, pediatric dilated cardiomyopathy, cardiac fibrosis, cardiomyocyte hypertrophy, and reduced cardiac innervation.

12. The pharmaceutical composition for use according to claim 10 or 11, wherein the composition is for injection, oral and / or time-release application.

13. Non-medical use of the pharmaceutical composition according to claim 10 for increasing the expression, amount and / or biological activity of the protein ZBTB16 in a cell.

14. A kit comprising materials for performing a method for detecting senescence in a cell, in particular a cardiac cell, of a subject according to claim 7, in particular materials for detecting a decrease and / or repression of the expression, amount and / or biological activity of the protein ZBTB16 in a cell obtained from a subject, and optionally further comprising materials for detecting at least one of DNA methylation of the gene for ZBTB16, senescence permanent cell cycle arrest, cellular dysfunction, and pro-fibrotic and pro-inflammatory secretory phenotype (senescence-associated secretory phenotype, SASP), such as buffers, antibodies against the protein ZBTB16, dyes and labels as well as instructions for performing the method.

15. Use of the kit according to claim 14 for detecting senescence in a cell of a subject, in particular a cardiac cell.

Images