Annelid hemoglobin for use in the treatment of Fuchs' disease

ES3073476T3Undetermined Publication Date: 2026-07-13

Patent Information

Authority / Receiving Office
ES · ES
Patent Type
Patents
Filing Date
2023-06-09
Publication Date
2026-07-13

AI Technical Summary

Technical Problem

Current treatments for Fuchs' corneal endothelial dystrophy are limited, invasive, and temporary, and there is a need for an effective, non-invasive treatment to manage the disease progression and reduce the reliance on corneal transplantation.

Method used

The use of annelid globin, annelid globin protomer, and annelid extracellular hemoglobin to address intermittent hypoxia and reduce stress on corneal endothelial cells by decreasing the expression of MMP2 and BAG3, thereby protecting the cells from hypoxia/reoxygenation stress.

Benefits of technology

Significantly reduces intermittent hypoxia-induced stress in corneal endothelial cells, decreasing the expression of MMP2 and BAG3 by at least 20-50%, and protects cells from hypoxic stress, potentially slowing the progression of Fuchs' dystrophy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000011_0000
    Figure 00000011_0000
  • Figure 00000011_0001
    Figure 00000011_0001
  • Figure 00000011_0002
    Figure 00000011_0002
Patent Text Reader

Abstract

The invention relates to the use of at least one molecule selected from an annelid globin, an annelid globin protomer, and an annelid extracellular hemoglobin for the treatment of Fuchs' disease.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The present invention relates to the use of at least one molecule selected from an annelid globin, an annelid globin protomer and an annelid extracellular hemoglobin, for the treatment of Fuchs' disease.

[0002] The corneal endothelium, located at the posterior surface of the cornea, plays a key role in maintaining it in a state of relative dehydration, essential for maintaining corneal clarity (1). The corneal endothelium is a single layer of cells resting on Descemet's membrane, its basement membrane, secreted by endothelial cells and which thickens throughout life. The homeostasis of the extracellular matrix contained within Descemet's membrane is governed by a balance between the production and lysis of extracellular matrix by metalloproteinases (MMPs) and their inhibitors (TIMPs) (2). In humans, endothelial cell density is <4000 cells / mm² at birth and gradually decreases throughout life (3).Excessive loss of endothelial cells can result from multiple pathological mechanisms, such as infection (like viral endotheliitis), trauma (for example, after cataract surgery), or genetic disorders. Beyond a certain threshold of endothelial cell loss, a pathological condition called "endothelial insufficiency" develops, leading to an accumulation of fluid in the corneal stroma, or corneal edema, which causes a loss of corneal transparency and decreased visual acuity.

[0003] One of the main causes of endothelial insufficiency is Fuchs' corneal endothelial dystrophy, which is the leading indication for corneal transplantation worldwide (4). It is a multifactorial disease resulting in cellular abnormalities and increased cell death In the endin a progressive decrease in endothelial cell density. Its pathophysiology involves endoplasmic reticulum stress with aggresome formation on the one hand (5), and metalloproteinase dysfunction on the other hand (6).

[0004] This disease is characterized in particular by the presence of drops in the most severely affected areas (in the center of the cornea). These drops correspond to an abnormal deposition of extracellular matrix at the level of Descemet's membrane. They can be observed clinically in 9 to 11% of women compared to 3.5 to 9% of men (7).

[0005] Only a small proportion of patients with Fuchs' dystrophy require a corneal transplant. These patients report, in the initial stage, transient blurred vision upon waking in the morning, clinically corresponding to transient corneal edema. This corneal edema could be due to corneal hypoxia occurring in a pathological endothelium during prolonged eyelid closure. Data from the literature describe endothelial dysfunction during prolonged contact lens wear, resulting in transient corneal edema. This endothelial dysfunction is a consequence of prolonged corneal hypoxia (8).

[0006] Treatments for Fuchs' corneal endothelial dystrophy are currently limited; they are both medical and surgical (see, for example, Price et al., Progress In Retinal and Eye Research, vol. 82, September 22, 2020).

[0007] On the one hand, some eye drops are used to reduce corneal edema. However, their effectiveness is variable and always limited to the early stages of the disease, and they only constitute a palliative treatment for corneal damage.

[0008] On the other hand, the standard treatment remains corneal transplantation. More specifically, the transplant is performed by transposing a sheet of endothelial and Descemet cells. This technique, called DMEK (Descemet Membrane Endothelial Keratoplasty), has the advantage of replacing only the diseased tissue. However, this technique remains invasive and temporary, since the graft's lifespan is estimated at around ten years in the absence of rejection.

[0009] Therefore, there is a need for an effective treatment for Fuchs' corneal endothelial dystrophy that is easy to administer and non-invasive. Such a treatment would notably help to overcome the shortage of grafts and avoid the need for corneal transplantation.

[0010] The present invention addresses this need.

[0011] Surprisingly, as described in the examples, the inventors demonstrated that intermittent hypoxia contributes to the progression of the disease by exacerbating endoplasmic reticulum stress and altering the expression of factors involved in its pathophysiology, such as BAG3 (BCL2-Associated Athanogen 3) and MMP2 (metalloproteinase type 2). Indeed, in samples from patients with the disease, the inventors identified that BAG3, a chaperone protein involved in aggresome formation in response to cellular stress, interacts with MMP2 and forms aggregates in the pathological areas characterized by the presence of droplets. These formations result from intracellular retention of MMP2 secondary to endoplasmic reticulum stress.

[0012] Furthermore, some models in vitroSeveral models of Fuchs' dystrophy have been described to date, but their main drawback is that they only target one aspect of the pathophysiology. Here again, and surprisingly, the inventors have developed a cellular model in vitro of Fuchs' dystrophy based on cobalt chloride, and a hypoxia / reoxygenation model mimicking the oxygen variations encountered in vivo. This cellular model of Fuchs' dystrophy would group together in a single molecule, cobalt chloride, several pathophysiological characteristics of Fuchs' dystrophy.

[0013] The inventors also discovered that the use of extracellular hemoglobin of Arenicola marina helps to limit nocturnal fluctuations in oxygen at the level of the corneal endothelium.

[0014] The present invention thus relates to the use of at least one molecule chosen from an annelid globin, an annelid globin protomer and an annelid extracellular hemoglobin, for the treatment of Fuchs' corneal endothelial dystrophy.

[0015] The use according to the invention includes at least one molecule selected from an Annelid globin, an Annelid globin protomer and an Annelid extracellular hemoglobin.

[0016] This molecule is an oxygen carrier. By "oxygen carrier," we mean a molecule capable of reversibly transporting oxygen from the environment to target cells, tissues, or organs.

[0017] Extracellular hemoglobin is present in all three classes of annelids: Polychaetes, Oligochaetes, and Achaetes. It is called extracellular hemoglobin because it is naturally not contained within a cell and can therefore circulate freely in the bloodstream without chemical modification to stabilize or make it functional.

[0018] Annelid extracellular hemoglobin is a giant biopolymer with a molecular weight between 2000 and 4000 kDa, consisting of approximately 200 polypeptide chains of between 4 and 12 different types, which are generally grouped into two categories.

[0019] The first category, comprising 144 to 192 elements, includes the so-called "functional" polypeptide chains which carry an active heme-type site and are capable of reversibly binding oxygen; these are globin-type chains (eight types in total for hemoglobin). Marine sand worm:a1, a2, b1, b2, b3, c, d1 and d2), whose masses are between 15 and 18 kDa. They are very similar to the α and β type chains of vertebrates.

[0020] The second category, comprising 36 to 42 elements, includes the so-called "structural" or "linker" polypeptide chains, which have few or no active sites but allow the assembly of subunits called twelfths or protomers. There are two types of linkers, L1 and L2.

[0021] Each hemoglobin molecule consists of two superimposed hexagons called the hexagonal bilayer, and each hexagon is itself formed by the assembly of six teardrop-shaped subunits (dodecamers or protomers). The native molecule is composed of twelve of these subunits (dodecamers or protomers). Each subunit has a molecular mass of approximately 250 kDa and constitutes the functional unit of the native molecule.

[0022] Preferably, the extracellular hemoglobin of annelids is chosen from among the extracellular hemoglobins of polychaete annelids and the extracellular hemoglobins of oligochaete annelids. Preferably, the extracellular hemoglobin of annelids is chosen from among the extracellular hemoglobins of the family of Lumbricidae, extracellular hemoglobins of the family Arenicolidae and extracellular hemoglobins of the family of Nereididae. Even more preferentially, the extracellular hemoglobin of Annelids is chosen from the extracellular hemoglobin of Lumbricus terrestris, extracellular hemoglobin of Arenicola sp and extracellular hemoglobin of Nereis sp. More preferably according to the invention, the extracellular hemoglobin of Annelids is selected from the extracellular hemoglobin of Arenicola marina or Nereis virens, extracellular hemoglobin is more preferentially used of Arenicola marina. The lugworm Marine sand wormis a polychaete annelid worm living primarily in sand.

[0023] According to the invention, the globin protomer of extracellular hemoglobin from Annelids constitutes the functional unit of native hemoglobin, as indicated above.

[0024] Finally, the globin chain of the extracellular hemoglobin of Annelids can notably be chosen from the Ax and / or Bx type globin chains of extracellular hemoglobin of Annelids.

[0025] Annelid extracellular hemoglobin, its globin protomers, and / or its globins do not require a cofactor to function, unlike mammalian hemoglobin, particularly human hemoglobin. Furthermore, because annelid extracellular hemoglobin, its globin protomers, and / or its globins are not blood-typed, they avoid any potential immunological or allergic reactions. Annelid extracellular hemoglobin, its globin protomers, and / or its globins exhibit intrinsic superoxide dismutase (SOD) activity. Consequently, this intrinsic antioxidant activity does not require any additional antioxidants to function, unlike mammalian hemoglobin, where the antioxidant molecules are contained within the red blood cell and are not bound to the hemoglobin.

[0026] Annelid extracellular hemoglobin, its globin protomers and / or its globins can be native or recombinant.

[0027] Preferably, extracellular hemoglobin is that of Arenicola marina or that of Nereis virens, more preferentially extracellular hemoglobin of Arenicola marina.

[0028] Preferably, the molecule is present in a composition at a content of between 0.01% and 10% by weight relative to the total weight of the composition, preferably between 0.05% and 5% by weight, preferably between 0.06% and 2% by weight, preferably between 0.07% and 1% by weight.

[0029] Preferably, the use according to the invention makes it possible to significantly reduce the intermittent hypoxia of the endothelial cells of the cornea, thus reducing the stress on the endoplasmic reticulum of the endothelial cells of the cornea.

[0030] By "significantly reducing intermittent hypoxia of corneal endothelial cells," we mean significantly decreasing the cellular stress induced by nocturnal hypoxia occurring in the pathological endothelium. This phenomenon occurs at night, during prolonged eyelid closure. The reduction of intermittent hypoxia of corneal endothelial cells can be measured using the hypoxia model described as an example, particularly by measuring markers. MMP2 and / or BAG3.

[0031] Preferably, the use according to the invention makes it possible to significantly reduce the expression of MMP2 and / or BAG3 in the corneal endothelium.

[0032] By "significantly reducing the expression of MMP2 and / or BAG3 in the corneal endothelium,” refers to a reduction in the transcription and / or translation of MMP2 and / or BAG3in corneal endothelial cells, by at least 20%, preferably by at least 30%, preferably by at least 40%, preferably by at least 50%. Preferably, the use of at least one molecule selected from an annelid globin, an annelid globin protomer, and an annelid extracellular hemoglobin according to the invention reduces the transcription and / or translation of MMP2 and / or BAG3 in corneal endothelial cells, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, compared to control corneal endothelial cells. The controls may be corneal endothelial cells untreated with the molecule, or corneal endothelial cells before treatment with the molecule. The transcription and / or translation of MMP2 and / or BAG3 can be measured by any method known in the prior art, and in particular as described in the example.

[0033] Preferably, the use according to the invention allows the corneal endothelial cells to be protected from hypoxia / reoxygenation stress.

[0034] By "protecting corneal endothelial cells from hypoxic stress" is meant a decrease in the expression of at least one endoplasmic reticulum stress marker of corneal endothelial cells, and / or a decrease in the expression of at least one autophagy marker of corneal endothelial cells, preferably BAG3, and / or an increase in the cell viability of corneal endothelial cells of at least 20%, preferably at least 30%. Preferably, the endoplasmic reticulum stress marker is chosen from HSPA5 (BIP), DDIT3 (CHOP) and sXBP1.Preferably, the autophagy marker of corneal endothelial cells is BAG3. Preferably, the use of at least one molecule selected from an annelid globin, an annelid globin protomer, and an annelid extracellular hemoglobin according to the invention decreases the expression of at least one endoplasmic reticulum stress marker of corneal endothelial cells, and / or decreases the expression of at least one autophagy marker of corneal endothelial cells, preferably BAG3, and / or increases the cell viability of corneal endothelial cells by at least 20%, preferably by at least 30%, compared to control corneal endothelial cells. The controls may be corneal endothelial cells untreated with the molecule, or corneal endothelial cells before treatment with the molecule.The expression of at least one endoplasmic reticulum stress marker of corneal endothelial cells, the expression of at least one autophagy marker of corneal endothelial cells, and the cell viability of corneal endothelial cells, can be measured by any method known in the prior art, and in particular as described in the example.

[0035] Preferably, the molecule chosen from an annelid globin, an annelid globin protomer, and an annelid extracellular hemoglobin according to the invention is formulated in a buffer solution. The resulting solution (i.e., the buffer solution containing the molecule) can be lyophilized to obtain a powder. Preferably, the resulting solution (i.e., the buffer solution containing the molecule) is used as is (liquid form), in its non-lyophilized form.

[0036] Typically, the buffer solution creates a suitable saline environment for hemoglobin, its protomers, and its globins, thus maintaining the quaternary structure and therefore the functionality of this molecule. The buffer solution is preferably an aqueous solution containing salts, preferably chloride, sodium, calcium, magnesium, and potassium ions, and its pH is between 5 and 9, preferably between 5.5 and 8.5, ideally between 7.4 and 7.7 (which corresponds to the physiological pH of the tear film). Its formulation is similar to that of a physiologically injectable fluid. Preferably, the buffer solution also includes an antioxidant, such as ascorbic acid. Under these conditions, the extracellular hemoglobin of annelids, its globin protomers, and its globins remain functional.

[0037] In this description, pH is understood to be at room temperature (25°C), unless otherwise stated. Preferably, the buffer solution is an aqueous solution comprising sodium chloride, calcium chloride, magnesium chloride, potassium chloride, sodium gluconate, and sodium acetate, and has a pH between 6.5 and 7.6, preferably 7.1 ± 0.5, preferably about 7.35. More preferably, the buffer solution is an aqueous solution comprising 90 mM NaCl, 23 mM Na-gluconate, 2.5 mM CaCl₂, 27 mM Na-acetate, 1.5 mM MgCl₂, 5 mM KCl, and has a pH of 7.1 ± 0.5. Preferably, the buffer solution has an osmolarity close to that of the tear film, i.e. between 270 and 315 mOsm / L, preferably around 300 mOsm / L.

[0038] Preferably, the molecule chosen from an Annelid globin, an Annelid globin protomer and an Annelid extracellular hemoglobin according to the invention (formulated or not in a buffer solution) is formulated in a pharmaceutical composition preferably suitable for ocular administration.

[0039] By "pharmaceutical composition suitable for ocular administration" is meant any pharmaceutical composition (medicine) having a galenic form suitable for ocular administration.

[0040] Preferably, the pharmaceutical composition suitable for ocular administration is chosen from eye drops, ophthalmic ointments, ophthalmic gels, conjunctival inserts and therapeutic lenses.

[0041] Eye drops are sterile liquid preparations (e.g., solutions, suspensions, or emulsions) intended for the treatment of eye conditions. They are typically presented in specific multidose bottles of 5 to 10 ml with a dropper tip or in unit doses (ophthalmic doses). The packaging is typically designed for administering the eye drops and may allow for a maximum volume of approximately 30 µl per drop. Eye drops generally contain a solvent, preferably aqueous. The formulation may include an adjuvant, preferably boric acid or one of its salts, and / or isotonic agents such as sodium chloride, and / or vitamin C or its derivatives, preferably ascorbic acid. Eye drops may also contain a surfactant, preferably chosen from polysorbates, polyoxyethylenes, and tyloxapol. The surfactant improves the solubility of the active ingredient.The eye drops are sterile and isotonic (pH between 6.4 and 7.8).

[0042] Eye ointments have a semi-solid consistency. They are used for a longer-lasting effect because the active ingredient remains in contact with the eye for a longer period. They are also prescribed for the treatment of eyelid conditions (blepharitis or styes). Common excipients in eye ointments include petrolatum or liquid paraffin.

[0043] Ophthalmic gels are sterile, semi-solid preparations intended for application to the conjunctiva. They generally contain one or more active ingredients dissolved in a suitable excipient. The excipient is typically a hydrophilic polymer that gels in the presence of water, for example, a carbomer, a carbopol, or polyacrylic acid.

[0044] Conjunctival inserts are devices implanted under the eyelid. An example of this type of insert, based on tropicamide and phenylephrine hydrochloride, is the Mydriasert product.

[0045] Therapeutic lenses are medical devices that maintain binocular vision (for example, compared to an eye patch). Such a lens can be pre-impregnated with a molecule chosen from among an annelid globin, an annelid globin protomer, and an annelid extracellular hemoglobin according to the invention, formulated or not in a buffer solution.

[0046] The invention also relates to a model in vitroof Fuchs' dystrophy, comprising cells, preferably healthy corneal endothelial cells, and a culture medium containing cobalt chloride (CoCl2). "Healthy corneal endothelial cells" means cells not affected by Fuchs' dystrophy. Preferably, CoCl2 is present at a concentration of 1 to 15 µM, preferably 2 to 10 µM. Preferably, the healthy corneal endothelial cells are the HCEC B4G12 endothelial cell line.

[0047] Cobalt chloride (CoCl2) can be used as an additive in a cell culture medium; when said culture medium contains healthy corneal endothelial cells, a model can be obtained in vitro of Fuchs' dystrophy.

[0048] The invention is illustrated by the following examples and figures. [ Fig 1Cobalt chloride induces loss of the endothelial phenotype with endothelial-mesenchymal transition in the HCEC B4G12 endothelial cell line. A: Gene expression, endothelial-mesenchymal transition marker SNAI2 , prolonged culture. Prolonged treatment for 7 days with cobalt chloride induces the expression of the endothelial-mesenchymal transition gene SNAI2 in a dose-dependent manner; B: Gene expression, endothelial differentiation markers ZO1, COL8A1, MMP14 And CD166, Short-term culture. A short course of treatment (24 hours) leads to a decrease in the expression of endothelial differentiation markers. ZO1, COL8A1, MMP14 And CD166, in a dose-dependent manner. Fig 2 Induction of gene expression of endoplasmic reticulum stress markers by cobalt chloride (CoCl2). Fig 3 Induction of gene expression of BAG3 And MMP2by hypoxia / reoxygenation (H / R) with or without cobalt chloride (CoCl2). Fig 4 Hemoglobin of Arenicola marina (M101) at 0.5 g / l decreases the effect of hypoxia / reoxygenation (H / R) and cobalt chloride (CoCl2) on gene expression of BAG3 And MMP2. Example Materials and Methods : Cellular culture:

[0049] HCEC-B4G12 (DSZM ®< , Braunschweig, Germany) is a clonal subpopulation created from the parental cell line HCEC-12 (ACC 646) established from normal corneal endothelium cells of a 91-year-old Caucasian woman transformed with the SV40 genome region.

[0050] The flasks should be coated with a solution containing 10 µg / mL of laminin (L2020, Sigma®, St. Louis, USA) and 10 mg / mL of chondroitin sulfate (C4383, Sigma®, St. Louis, USA). The culture medium consists of Human Endothelial SFM (11111-044 Gibco®, Carlsbad, USA) with 10 ng / mL of FGF2 (233-FB-025 Sigma®, St. Louis, USA). The cells are cultured at 37°C with 5% CO2. The culture medium is changed every 48 hours. The cells reach confluence in one week. The cells passed to confluence after incubation with Trypsin TripleExpress (2604-021 Gibco ®< , Carlsbad, USA) for 5 minutes at 37°C. Model in vitro of Fuchs' dystrophy:

[0051] Cobalt chloride (CoCl2) (C8661, Sigma®, St. Louis, USA) is used as an inducer of a proteostasis disorder. A 25 µM stock solution is prepared by diluting 12 mg of powdered cobalt chloride in 2 mL of sterile distilled water and stored at 4°C for one week. The cobalt chloride is then diluted directly into endothelial culture medium (Human Endothelial SFM + FGF2) to obtain the desired concentrations: 2.5 µM, 5 µM, or 10 µM. The media are changed every 48 hours, with or without cobalt chloride, for a total culture time of 8 days. Cellular senescence test:

[0052] Beta-galactosidase activity in the cells was detected using the Senescent Cell Histochemical Staining Kit (CS0030, Sigma®, St. Louis, USA) according to the manufacturer's instructions. HCEC B4G12 cells were cultured for one week with or without cobalt chloride (concentration ranging from 2.5 to 30 µM) in a 24-well plate and then fixed with the kit's fixation buffer for 7 minutes at room temperature. After rinsing with PBS, the cells were incubated overnight with the staining solution containing X-gal at 37°C without CO2. After incubation, the cells were observed under a microscope; the cytoplasm of the senescent cells appeared blue. Hypoxia model:

[0053] A hypoxic incubator (PHCBI®, Bernolsheim, France) was used. Initially, cells were cultured to confluence under normoxic conditions, approximately 7 days after inoculation, and then transferred to a hypoxic medium of 1% O2, 5% CO2, and 94% NO at 37°C for 12 hours. A hypoxia / reoxygenation (H / R) cycle was then performed by incubating the cells again under normoxic conditions of 21% O2 and 5% CO2 at 37°C after changing the medium. For gene expression analysis by RT-qPCR, the reoxygenation time was 1 hour; for protein expression analysis by immunofluorescence, the reoxygenation time was 3 hours. Using M101 in the model in vitro:

[0054] Hemoglobin of Arenicola marina(M101) according to the invention is issued by Hemarina, Morlaix, France. A 50 g / L stock solution is stored at -80°C. The solution is thawed at room temperature before use and is directly diluted in the culture medium prior to the hypoxia / reoxygenation test at a concentration ranging from 1 g / L to 0.1 g / L. All controls are performed in the presence of the stock solution at the same volumes as the conditions tested. RT-Q PCR:

[0055] RNA was extracted using the RNAeasy Mini Plus kit 74136 (Qiagen®, Hilden, Germany) according to the manufacturer's instructions. The isolated RNA was quantified using the Tecan® detection platform (Mannedorf, Switzerland) by spectrophotometric assay. cDNA was then obtained from each sample by reverse transcription using the SuperScript III (ThermoFischer®, Waltham, USA) according to the manufacturer's instructions. Each well contained 20 µL of solution with 1 µg of RNA, 10 µL of RT Reaction Mix, 2 µL of enzyme, and a variable complement of water. Quantitative PCR was then performed on each amplified cDNA sample using the QuantStudio5 qPCR instrument (ThermoFischer®, Waltham, USA) with the SYBR-Green detection method. The curves were analyzed using QuantStudio5 software. The primers used for the different genes of interest are described in Table 1.The housekeeping gene, Beta-2 Microglobulin, was selected based on literature data concerning the lineage. In parallel, various other housekeeping genes known from the literature were also selected. (B2M, GAPDH, PPIA ) were tested on different samples of the line. B2M proved to be the gene least susceptible to variations in experimental conditions with a constant detection threshold across different samples. [Table 1] Gènes d'intérêt Amorce Forward Amorce Reverse BAG3 GGAGATCAAGATCGACCCGC (SEQ ID NO :1) AGAGGATGGAGTCTCCTTGGG (SEQ ID NO :2) B2M ACTGAATTCACCCCCACTGA (SEQ ID NO :3) CCTCCATGATGCTGCTTACA (SEQ ID NO :4) CD166 CCCCAGAGGAATTTTTGTTTTAC (SEQ ID NO :5) AGCCTGATGTTATCTTTCATCCA (SEQ ID NO:6) COL8A1 CCAACTCACCCTTGAAGTCAT (SEQ ID NO :7) GGCTGGTTTCTGTCTCTTCAG (SEQ ID NO :8) DDIT3 ATGGCAGCTGAGTCATTGCCTTTC (SEQ ID NO :9) AGAAGCAGGGTCAAGGTGGTGAA (SEQ ID NO :10) HSPA5 SEQ ID NO:11 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 CACCTTGAACGGCAAGAACT (SEQ ID NO :12) MMP2 GTGAAGTATGGGAACGCCGA (SEQ ID NO :13) AGAAGCCGTACTTGCCATCC (SEQ ID NO :14) MMP1 TCCAGCAACTTTATGGGGGT (SEQ ID NO :15) TTCCCGTCACAGATGTTGGG (SEQ ID NO :16) SNAI2 TGGTTGCTTCAAGGACACAT (SEQ ID NO :17) GCAAATGCTCTGTTGCAGTG (SEQ ID NO :18) sXBP1 CTGAGTCCGAATCAGGTGCA (SEQ ID NO :19) ATCCATGGGGAGATGTTCTGG (SEQ ID NO :20) ZO1 GGTCAGAGCTTCTGATCATTC (SEQ ID NO :21) CATCTCTACTCCGGAGACTGC (SEQ ID NO :22) Immunofluorescence on HCEC B4G12 cell line:

[0056] The cells on coverslips are fixed with 4% diluted PFA (1040051000 Merck ®<, Darmstadt, Germany) for 15 min. The coverslips are incubated with the permeabilization and saturation buffer: 0.5% Tween 20 (85113 ThermoScientific ®<, Waltham, USA), 1% Triton (437002A VWR ®< Radnor, USA), 5% albumin Fraction V (1.12018.0100 Merck ®<, Darmstadt, Germany) for 1 h at room temperature and then incubated with the primary antibodies for 3 h in the saturation buffer. The dilution of the primary antibodies in the saturation buffer is as follows: BAG3 (Rabbit 10599-1-AP Proteintech ®< ) (1 / 100), MMP2 Rabbit (37150 Abcam ®< ) (1 / 200), MMP2 Mouse (436000 Invitrogen ®< ) (1 / 100), alpha-tubulin (MAB1864, Merck ®< , Darmstadt, Germany) (1 / 400).

[0057] The slides are then rinsed with PBS for 5 minutes (x3), and then incubated with the mixture of secondary antibodies and DAPI for one hour at room temperature, protected from light, in the permeabilization and saturation buffer. The dilution of the secondary antibodies is as follows: Alexa Fluor 555 goat anti-rabbit (A21428 ThermoScientific®, Waltham, USA) (1 / 500) and Alexa Fluor 488 goat anti-mouse (A11001 ThermoScientific®, Waltham, USA) (1 / 500) with DAPI (62248 ThermoScientific®, Waltham, USA) (1 / 2000) diluted in the saturation buffer. The coverslips were rinsed with PBS for 5 minutes (x3), then mounted on slides with Permafluor mounting medium (TA-030-FM TermoScientifc®, Waltham, USA). All negative controls were performed in the absence of primary antibodies but in the presence of secondary antibodies. Image acquisition was performed using the LSM 800 confocal microscope (Zeiss®, Oberkochen, Germany).The images are then analyzed with the Fiji® software. Each primary antibody is tested at least three times under different experimental conditions. Results Preliminary data on patient samples (Images not shown)

[0058] In immunofluorescence, an increase in the signal of the endoplasmic reticulum stress marker BIP (or GRP78) was found on patient samples, which corresponds to current data in the literature placing reticulum stress at the center of the pathophysiology of Fuchs' dystrophy.

[0059] Using orthogonal projection reconstructions, the inventors were able to demonstrate a loss of the linear distribution of MMP2 within the Descemet membrane compared to healthy subjects. In pathological Descemet's endothelial cells, MMP2 forms intracellular aggregates in the perinuclear domain.

[0060] We also observed a change in BAG3 expression. In a healthy individual, its expression is cytoplasmic and diffuse by immunofluorescence. In an individual with Fuchs' dystrophy, regional changes in BAG3 expression are observed. BAG3 is found in the perinuclear domain of cells located at the periphery of a pathological Descemet's endothelial cell carcinoma (in areas without guttate ducts), whereas in the central area of ​​the Descemet's endothelial cell carcinoma, rich in guttate ducts, the BAG3 signal is nuclear and forms perinuclear cytoplasmic aggregates co-localizing with MMP2.

[0061] Co-labeling of MMP2 and LCIII, aggresome markers, on patient samples indicates the presence of aggresomes containing MMP2.

[0062] Preliminary data from patient sample analyses suggest that BAG3 is involved in aggresome formation on pathological endothelio-Descemet cells in which MMP2 is found. Cobalt chloride induces loss of endothelial phenotype with endothelio-mesenchymal transition on HCEC B4G12 endothelial line

[0063] During prolonged treatment with cobalt chloride in the culture medium for doses ranging from 2.5µM to 10µM, the cells lose their endothelial phenotype, notably with a loss of their contiguous and hexagonal appearance (photos not shown) and the presence of fibroblast-like cells with larger and elongated cytoplasm.

[0064] Similarly, prolonged treatment for 7 days with cobalt chloride induces the expression of the endothelial-mesenchymal transition gene. SNAI2 in a dose-dependent manner ( Figure 1A ).

[0065] Beta-galactosidase activity, illustrated by the perinuclear cytoplasmic blue staining (photos not shown) of endothelial cells in the presence of cobalt chloride, is also increased, indicating the phenomenon of cellular senescence induced by the molecule.

[0066] A short course of treatment (24 hours) leads to a decrease in the expression of endothelial differentiation markers. ZO1, COL8A1, MMP14 And CD166, in a dose-dependent manner ( Figure 1B ).

[0067] These data suggest that cobalt chloride leads to a loss of endothelial differentiation with endothelial-mesenchymal transition, and induces cellular senescence, phenomena observed in vivo in patients with Fuchs' dystrophy. Cobalt chloride induces endoplasmic reticulum stress on HCEC B4G12 endothelial lineage

[0068] Cobalt chloride induces the expression of endoplasmic reticulum markers, HSPA5 (BIP), DDIT3 (CHOP) and sXBP1 ( Figure 2), assessed by RT-qPCR, whether during a short incubation of 24h ( Figure 2a ) for doses ranging from 50 to 200µM, or during a prolonged culture of 7 days ( Figure 2b ) for doses ranging from 2.5 to 10µM.

[0069] In immunofluorescence, prolonged culture of cobalt chloride induces the formation of MMP2 aggregates in the perinuclear domain and along microtubules. An increase in BIP signal is also observed in the endoplasmic reticulum in the presence of cobalt chloride (images not shown).

[0070] The use of cobalt chloride makes it possible to mimic in vitro endoplasmic reticulum stress and aggresome formation as observed in vivo on patient samples. Hypoxia / reoxygenation alters the expression of BAG3 and MMP2 on the HCEC B4G12 cell line

[0071] Hypoxia / reoxygenation increases the expression of BAG3 and MMP2 as assessed by RT-qPCR, as much as during incubation with cobalt chloride for one week. Performing a hypoxia / reoxygenation cycle in the presence of cobalt chloride increases the expression of BAG3 and MMP2 even further ( Figure 3 ).

[0072] In immunofluorescence, the BAG3 signal is enhanced in the perinuclear domain in the presence of cobalt chloride. The BAG3 signal is also detected in the nuclear domain when a hypoxia / reoxygenation cycle is performed in the presence of cobalt chloride (Images not shown).

[0073] This nuclear translocation of BAG3, in the same way as in the most pathological areas of patient samples, could indicate an increased susceptibility of endothelial cells to hypoxia / reoxygenation in the presence of pre-existing endoplasmic reticulum stress. The use of M101 in the presence of cobalt chloride or hypoxia / reoxygenation restores the expression of BAG3 And MMP2

[0074] The use of hemoglobin M101 at a concentration of 0.5 g / l decreases gene expression of MMP2 And BAG3 in each treatment condition. This decrease in expression is more pronounced in the hypoxia / reoxygenation condition in the presence of endoplasmic reticulum stress ( Figure 4 ) generated by the use of cobalt chloride, only under conditions where a hypoxia / reoxygenation cycle is performed alone or those where cells are incubated with cobalt in isolation.

[0075] Immunofluorescence labeling of BAG3 does not show a nuclear signal with M101 (0.5g / L) under the hypoxia / reoxygenation condition in the presence of cobalt chloride (Images not shown).

[0076] These results indicate that the use of M101 on the model in vitroappears to reverse the effect of fluctuations in oxygen levels in culture media and could protect endothelial cells under hypoxic stress conditions. Conclusion

[0077] All the elements presented above suggest that intermittent hypoxia influences the expression of markers involved in the pathophysiology of Fuchs' dystrophy, such as BAG3 and MMP2. The effect of hypoxia / reoxygenation is more severe in the presence of pre-existing endoplasmic reticulum stress, a cellular stress that can be observed in patient samples.

[0078] These data suggest that the use of hemoglobin Arenicola marina (M101) in Fuchs' dystrophy, in various possible pharmaceutical forms, could limit nocturnal oxygen fluctuations at the level of the corneal endothelium. Its use would reduce cellular stress and in finecell loss in order to slow the progression of the disease towards a stage requiring a corneal transplant, which remains, to date, the only curative treatment available. Bibliographical references:

[0079] 1. Bonanno JA. Identity and regulation of ion transport mechanisms in the corneal endothelium. Prog Retin Eye Res. janv 2003;22(1):69-94. 2. Eghrari AO, Riazuddin SA, Gottsch JD. Overview of the Cornea: Structure, Function, and Development. Prog Mol Biol Transl Sci. 2015;134:7-23. 3. Elbaz U, Mireskandari K, Tehrani N, Shen C, Khan MS, Williams S, et al. Corneal Endothelial Cell Density in Children: Normative Data From Birth to 5 Years Old. Am J Ophthalmol. janv 2017;173:134-8. 4. Gain P, Jullienne R, He Z, Aldossary M, Acquart S, Cognasse F, et al. Global Survey of Corneal Transplantation and Eye Banking. JAMA Ophthalmol. févr 2016;134(2):167-73. 5. Okumura N, Kitahara M, Okuda H, Hashimoto K, Ueda E, Nakahara M, et al. Sustained Activation of the Unfolded Protein Response Induces Cell Death in Fuchs' Endothelial Corneal Dystrophy. Invest Ophthalmol Vis Sci. 1 juill 2017;58(9):3697-707. 6. Xu I, Thériault M, Brunette I, Rochette PJ, Proulx S.Matrix metalloproteinases and their inhibitors in Fuchs endothelial corneal dystrophy. Exp Eye Res. 19 févr 2021;205:108500. 7. Zoega GM, Arnarsson A, Sasaki H, Söderberg PG, Jonasson F. The 7-year cumulative incidence of cornea guttata and morphological changes in the corneal endothelium in the Reykjavik Eye Study. Acta Ophthalmol. mai 2013;91(3):212-8. 8. Pang K, Lennikov A, Yang M. Hypoxia adaptation in the cornea: Current animal models and underlying mechanisms. Anim Models and Exp Med. déc 2021;4(4):300-10.

Claims

1. A molecule selected from Annelida globin, Annelida globin protomer and Annelida extracellular hemoglobin for use in the treatment of Fuchs' corneal endothelial dystrophy.

2. The molecule for use according to claim 1, characterized in that the Annelid extracellular hemoglobin is chosen from Polychaete Annelid extracellular hemoglobins and Oligochaete Annelid extracellular hemoglobins.

3. The molecule for use according to claim 1 or 2, characterized in that the Annelid extracellular hemoglobin is chosen from extracellular hemoglobins of the family Lumbricidae, extracellular hemoglobins of the family Arenicolidae and extracellular hemoglobins of the family Nereididae, preferably from Lumbricus terrestris extracellular hemoglobin, Arenicola sp extracellular hemoglobin and Nereis sp extracellular hemoglobin.

4. The molecule for use according to one of the preceding claims, characterized in that the Annelid extracellular hemoglobin is the Arenicola marina extracellular hemoglobin5. The molecule for use according to one of the preceding claims, characterized in that it is present in a composition in a content comprised between 0.01% and 10% by weight relative to the total weight of the composition, preferably between 0.05% and 5% by weight, preferably between 0.06% and 2% by weight, preferably between 0.07% and 1% by weight.

6. The molecule for use according to any of the preceding claims, for significantly reducing intermittent hypoxia of corneal endothelial cells.

7. The molecule for use according to one of the preceding claims, for reducing the stress of the endoplasmic reticulum of corneal endothelial cells.

8. The molecule for use according to one of the preceding claims, for significantly reducing the expression of MMP2 and / or BAG3 in the corneal endothelium.

9. The molecule for use according to one of the preceding claims, for protecting corneal endothelial cells from hypoxic stress.

10. The molecule for use according to one of the preceding claims, characterized in that it is formulated in a pharmaceutical composition suitable for ocular administration, preferably chosen from eye drops, ophthalmic ointments, ophthalmic gels, conjunctival inserts and therapeutic lenses.