Humanized Sirpa-IL15 inserted mice and rats and methods of their use
Patent Information
- Application Number
- ES2023175415T
- Authority / Receiving Office
- ES · ES
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-04-12
- Filing Date
- 2016-04-12
- Publication Date
- 2026-09-14
- Estimated Expiration
- 2036-04-12
Abstract
Description
Humanized Sirpa-IL15 inserted mice and rats and methods of their use Cross-reference Field of invention The invention relates to the field of genetically modified rodents. Introduction Genetically modified non-human animals, such as humanized mice, hold great promise for transfer research, as they allow for the modeling and study of human diseases in vivo. Over the past decade, considerable progress has been made in the development of humanized mice through the genetic insertion of human genes essential for the proper development and function of human immune cells in the mouse. However, some limitations still restrict the usefulness of humanized mice in transfer research. In particular, the development and survival of human T lymphocytes is suboptimal. Although the bone marrow-liver-thymus (BLT) model has been shown to enhance intestinal T-cell reconstitution in NS / NSG-BLT mice (Denton PW, Nochi T., Lim A. et al. Mucosal Immunol 2012; 5:555-566, Nochi T., Denton PW, Wahl A. et al. Cell Rep 2013; 3:1874-1884), these mice have been found to develop graft-versus-host disease, resulting in massive infiltration of immune cells into multiple tissues (Greenblatt MB, Vrbanac V., Tivey T. et al. PLoS One 2012; 7:e44664). Therefore, current humanized mouse models still lack adequate development and function of human T cells. In particular, the absence of memory T lymphocytes residing in human tissues prevents the use of humanized mice as a preclinical tool to develop and test more effective immunization strategies aimed at inducing long-lasting mucosal immunity against pathogens such as HIV. To better understand the development and survival of human tissue-resident T lymphocytes and to provide a model for testing novel immunization strategies to induce long-lasting T-cell-dependent mucosal immunity, it would be useful to have a genetically modified non-human animal that develops human tissue-resident T lymphocytes. Such a mouse model could also be used to study the interaction of human tissue-resident immune cells with the gut microbiota—for example, how the microbiota may shape the development and survival of human immune cells in the small intestine and colon. Furthermore, there is a need in the field for non-human animal models of human natural killer (NK) cell development and function. Summary Genetically modified rodents are provided as specified in the claims. Methods for making non-human animals express human SIRP and human IL-15 from the non-human animal genome, and methods for using non-human animals expressing human SIRP and human IL-15 from the non-human animal genome, are also described. These animals and methods find many uses in the field, including, for example, in modeling the development and function of human natural killer (NK) cells and / or T lymphocytes; in modeling human pathogen infection of NK cells and / or human T lymphocytes; in the in vivo selection of agents that inhibit infection by a pathogen that activates, induces, and / or targets T lymphocytes and / or NK cells; and in the in vivo selection of agents that modulate the development and / or function of human NK cells and / or T lymphocytes, for example, in a healthy or diseased state.in the in vivo selection of agents that are toxic to human NK cells and / or T lymphocytes; in the in vivo selection of agents that prevent, mitigate, or reverse the toxic effects of toxic agents on human NK cells and / or T lymphocytes; in the in vivo selection of candidate vaccines that induce T lymphocytes; and in the in vivo and in vitro selection of agents that inhibit tumor growth and / or infection by activating antibody-dependent cellular cytotoxicity (ADCC) processes mediated by NK cells. In a first aspect, the present disclosure provides a genetically modified rodent according to claim 1, comprising: a nucleic acid sequence incorporated into the genome of the genetically modified rodent, a sequence encoding a human SIRP protein and operatively linked to a promoter of the SIRP gene; and a nucleic acid sequence incorporated into the genome of the genetically modified rodent, a sequence encoding a human IL-15 protein and operatively linked to a promoter of the IL-15 gene, wherein the genetically modified rodent expresses the human SIRP protein and the human IL-15 protein. The SIRP gene promoter is an endogenous rodent SIRP gene promoter. The SIRP gene promoter is the endogenous rodent SIRP gene promoter at the rodent SIRP gene locus. The genetically modified rodent may include a knockout mutation in the rodent SIRP gene at the rodent SIRP gene locus. In one embodiment, the genetically modified rodent is a mouse, and the knockout mutation is a deletion of at least exons 2 to 4 of mouse SIRP. In another embodiment, the genetically modified rodent is heterozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. In yet another embodiment, the genetically modified rodent is homozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. In another embodiment of the first aspect, or in a further embodiment of any of the above embodiments thereof, the nucleic acid sequence encoding the human SIRP protein includes the human SIRP genomic coding and non-coding sequence. In another embodiment of the first aspect, or in a further embodiment of any of the preceding embodiments thereof, the human SIRP protein is a functional fragment of a full-length human SIRP protein. In such embodiment, the functional fragment includes an extracellular domain of human SIRP, for example, an extracellular domain that includes at least amino acids 28 to 362 of SEQ ID NO: 12. The IL-15 gene promoter is an endogenous rodent IL-15 gene promoter at the rodent IL-15 gene locus. In one embodiment, the genetically modified rodent includes a knockout mutation in the rodent IL-15 gene at the rodent IL-15 gene locus. In this embodiment, the genetically modified rodent is a mouse, and the knockout mutation is a deletion of at least exons 5 to 8 of mouse IL-15. In another embodiment, the genetically modified rodent is heterozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. In yet another embodiment, the genetically modified rodent is homozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. In another embodiment of the first aspect, or in a further embodiment of any of the above embodiments thereof, the nucleic acid sequence encoding the human IL-15 protein includes the genomic coding and non-coding sequence of human IL-15. In another embodiment of the first aspect, or in a further embodiment of any of the preceding embodiments thereof, the human IL-15 protein is a functional fragment of a full-length human IL-15 protein. In another embodiment of the first aspect, or in a further embodiment of any of the preceding embodiments thereof, the genetically modified rodent is immunodeficient. For example, in one embodiment, the genetically modified rodent includes an inactivation of the Rag2 gene. In another embodiment, the genetically modified rodent includes an inactivation of the IL2rg gene, or both an inactivation of the Rag2 gene and an inactivation of the IL2rg gene. In one realization, the rodent is a mouse. In another embodiment of the first aspect, or in a further embodiment of any of the preceding embodiments thereof, the genetically modified rodent includes a human hematopoietic stem cell graft. In such embodiment, the genetically modified rodent includes an infection with a human pathogen. In one embodiment where the genetically modified rodent includes an infection with a human pathogen, the human pathogen activates, induces, and / or targets T lymphocytes and / or natural killer (NK) cells. In another embodiment where the genetically modified rodent includes an infection with a human pathogen, the human pathogen is a pathogen that affects (e.g., infects) the human intestine. In such embodiment, the human pathogen is a human rotavirus. In another embodiment where the genetically modified rodent includes an infection with a human pathogen, the pathogen affects (e.g., infects) the human lung.In this embodiment, the human pathogen is the influenza virus. In another embodiment, where the genetically modified rodent carries an infection with a human pathogen, the pathogen affects (e.g., infects) the human liver. In yet another embodiment, a genetically modified rodent carries a human hematopoietic cell graft and a tumor, e.g., a transplanted human tumor. This disclosure further describes an in vivo model, which includes a genetically modified non-human animal comprising: a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human SIRP protein and operatively linked to a promoter of the SIRP gene; a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human IL-15 protein and operatively linked to a promoter of the IL-15 gene; and a human hematopoietic cell graft, wherein the genetically modified non-human animal (i) expresses the human SIRP protein and the human IL-15 protein, and (ii) includes human intraepithelial lymphocytes (IELs) in the small intestine and Peyer's patches of the genetically modified non-human animal. The genetically modified non-human animal includes an infection with a human pathogen, for example, an intestinal pathogen. The intestinal pathogen is selected from: Campylobacter jejuni, Clostridium difficile, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, human rotavirus, Listeria monocytogenes, Norwalk virus, Salmonella enterica, Shigella flexneri, Shigella sonnei, Shigella dysenteriae, Yersinia pestis, Yersinia enterocolitica, and Helicobacter pylori. The SIRP gene promoter is an endogenous non-human SIRP gene promoter. The SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus. When the SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human SIRP gene at the non-human animal SIRP gene locus. The genetically modified non-human animal can be a mouse, and the knockout mutation is a deletion of at least exons 2 to 4 of the non-human animal SIRP. The genetically modified non-human animal is heterozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The genetically modified non-human animal is homozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The nucleic acid sequence that encodes the human SIRP protein includes the coding and non-coding genomic sequence of human SIRP. The human SIRP protein is a functional fragment of a full-length human SIRP protein. The functional fragment includes an extracellular domain of human SIRP, for example, an extracellular domain that includes amino acids 28 to 362 of SEQ ID NO: 12. The IL-15 gene promoter is an endogenous non-human IL-15 gene promoter. The IL-15 gene promoter may be the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus. When the IL-15 gene promoter is the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human IL-15 gene at the non-human animal IL-15 gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation is a deletion of at least exons 5 to 8 of mouse IL-15. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The nucleic acid sequence that encodes the human IL-15 protein includes the coding and non-coding genomic sequence of human IL-15. The human IL-15 protein may be a functional fragment of a full-length human IL-15 protein. The genetically modified non-human animal may be immunodeficient. For example, the genetically modified non-human animal may contain an inactivation of the Rag2 gene. The genetically modified non-human animal may contain an inactivation of the IL2r gene, or an inactivation of both the Rag2 and IL2r genes. The non-human animal may be a mammal. The mammal is a rodent, for example, a mouse. Also described is an in vivo model, which includes a genetically modified non-human animal comprising: a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human SIRP protein and operatively linked to a promoter of the SIRP gene; a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human IL-15 protein and operatively linked to a promoter of the IL-15 gene; and a human hematopoietic cell graft, wherein the genetically modified non-human animal (i) expresses the human SIRP protein and the human IL-15 protein, and (ii) includes human intraepithelial lymphocytes (IELs) in the lung of the genetically modified non-human animal. The genetically modified non-human animal includes an infection with a human pathogen, for example, a lung pathogen. The lung pathogen is selected from: Streptococcus pyogenes, Haemophilus influenzae, Corynebacterium diphtheriae, SARS coronavirus, Bordetella pertussis, Moraxella catarrhalis, influenza virus (A, B, C), coronavirus, adenovirus, respiratory syncytial virus, parainfluenza virus, mumps virus, Streptococcus pneumoniae, Staphylococcus aureus, Legionella pneumophila, Klebsiella pneumoniae, Pseudomonas aeruginosa, Mycoplasma pneumoniae, Mycobacterium tuberculosis, Chlamydia pneumoniae, Blastomyces dermatitidis, Crohn's disease, Pseudomonas neoformans, and Aspergillus fumigatus. The SIRP gene promoter may be an endogenous non-human SIRP gene promoter. The SIRP gene promoter may be the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus. When the SIRP gene promoter is the endogenous human SIRP gene promoter at the non-human animal SIRP gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human SIRP gene at the non-human animal SIRP gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation may be a deletion of at least exons 2 to 4 of mouse SIRP. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The nucleic acid sequence that encodes the human SIRP protein includes the coding and non-coding genomic sequence of human SIRP. The human SIRP protein may be a functional fragment of a full-length human SIRP protein. The functional fragment includes an extracellular domain of human SIRP, for example, an extracellular domain that includes at least amino acids 28 to 362 of SEQ ID NO: 12. The IL-15 gene promoter may be an endogenous non-human IL-15 gene promoter. The IL-15 gene promoter may be the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus. When the IL-15 gene promoter is the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human IL-15 gene at the non-human animal IL-15 gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation may be a deletion of at least exons 5 to 8 of mouse IL-15. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The nucleic acid sequence that encodes the human IL-15 protein includes the coding and non-coding genomic sequence of human IL-15. The human IL-15 protein may be a functional fragment of a full-length human IL-15 protein. The genetically modified non-human animal is immunodeficient. For example, the genetically modified non-human animal includes an inactivation of the Rag2 gene. The genetically modified non-human animal includes an inactivation of the IL2r gene, or an inactivation of both the Rag2 and IL2r genes. The non-human animal is a mammal. The mammal can be a rodent, for example, a mouse. Also described is a method for determining the efficacy of a candidate T-cell inducing vaccine, including the method: administering a candidate T-cell inducing vaccine to a genetically modified non-human animal, wherein the genetically modified non-human animal is deficient in an endogenous immune system and includes: (i) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence encoding a human SIRP protein and operatively linked to a SIRP gene promoter, (ii) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence encoding a human IL-15 protein and operatively linked to an IL-15 gene promoter, and (iii) a human hematopoietic cell graft, wherein the genetically modified non-human animal expresses the human SIRP protein and the human IL-15 protein;to expose the genetically modified non-human animal to a human pathogen; and to determine whether the T-cell-inducing vaccine candidate induces a T-cell-mediated immune response in the genetically modified non-human animal. The SIRP gene promoter is an endogenous non-human SIRP gene promoter. For example, the SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus. When the SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human SIRP gene at the non-human animal SIRP gene locus. The genetically modified non-human animal could be a mouse, and the knockout mutation could be a deletion of at least exons 2 to 4 of mouse SIRP. The genetically modified non-human animal could be heterozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The genetically modified non-human animal could be homozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The nucleic acid sequence that encodes the human SIRP protein includes the coding and non-coding genomic sequence of human SIRP. The human SIRP protein may be a functional fragment of a full-length human SIRP protein. The functional fragment includes an extracellular domain of human SIRP, for example, an extracellular domain that includes at least amino acids 28 to 362 of SEQ ID NO: 12. The IL-15 gene promoter may be an endogenous non-human IL-15 gene promoter. The IL-15 gene promoter may be the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus. When the IL-15 gene promoter is the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus, the genetically modified non-human animal carries a knockout mutation in the non-human IL-15 gene at the non-human animal IL-15 gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation may be a deletion of at least exons 5 to 8 of mouse IL-15. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence that codes for the human IL-15 protein. The nucleic acid sequence that encodes the human IL-15 protein includes the coding and non-coding genomic sequence of human IL-15. The human IL-15 protein may be a functional fragment of a full-length human IL-15 protein. The genetically modified non-human animal includes an inactivation of the Rag2 gene. The genetically modified non-human animal includes an inactivation of the IL2r gene. The genetically modified non-human animal can be a mammal, such as a rodent, for example, a mouse. A method is also described for identifying an agent that inhibits infection by a pathogen that activates, induces, and / or targets human T lymphocytes and / or natural killer (NK) lymphocytes, including the method: administering an agent to a genetically modified non-human animal, wherein the genetically modified non-human animal is deficient in an endogenous immune system and includes: (i) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human SIRP protein and operatively linked to a SIRP gene promoter, (ii) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, a sequence encoding a human IL-15 protein and operatively linked to an IL-15 gene promoter.(iii) a human hematopoietic cell graft, and (iv) an infection by a pathogen that activates, induces and / or targets human T lymphocytes and / or natural killer cells, wherein the genetically modified non-human animal expresses the human SIRP protein and the human IL-15 protein; and to determine whether the agent reduces the amount of the pathogen in the non-human animal infected by the pathogen. The SIRP gene promoter may be an endogenous non-human SIRP gene promoter. For example, the SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus. When the SIRP gene promoter is the endogenous non-human SIRP gene promoter at the non-human animal SIRP gene locus, the genetically modified non-human animal includes a knockout mutation in the non-human SIRP gene at the non-human animal SIRP gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation may be a deletion of at least exons 2 to 4 of mouse SIRP. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence encoding the human SIRP protein. The nucleic acid sequence that encodes the human SIRP protein includes the coding and non-coding genomic sequence of human SIRP. The human SIRP protein is a functional fragment of a full-length human SIRP protein. The functional fragment includes an extracellular domain of human SIRP, for example, an extracellular domain that includes amino acids 28 to 362 of SEQ ID NO: 12. The IL-15 gene promoter may be an endogenous non-human IL-15 gene promoter. The IL-15 gene promoter may be the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus. When the IL-15 gene promoter is the endogenous non-human IL-15 gene promoter at the non-human animal IL-15 gene locus, the genetically modified non-human animal carries a knockout mutation in the non-human IL-15 gene at the non-human animal IL-15 gene locus. The genetically modified non-human animal may be a mouse, and the knockout mutation may be a deletion of at least exons 5 to 8 of mouse IL-15. The genetically modified non-human animal may be heterozygous for the allele that includes the nucleic acid sequence encoding the human IL-15 protein. The genetically modified non-human animal may be homozygous for the allele that includes the nucleic acid sequence that codes for the human IL-15 protein. The nucleic acid sequence that encodes the human IL-15 protein includes the coding and non-coding genomic sequence of human IL-15. Human IL-15 protein is a functional fragment of a full-length human IL-15 protein. The genetically modified non-human animal includes an inactivation of the Rag2 gene. The genetically modified non-human animal includes an inactivation of the IL2r gene. The genetically modified non-human animal is a mammal, such as a rodent, for example, a mouse. A method for causing a non-human animal to express a human IL-15 protein and a human SIRP protein is also described, comprising: introducing into a genome of a first non-human animal a nucleic acid sequence encoding a human IL-15 protein, wherein the sequence encoding the human IL-15 protein is operatively linked to a promoter sequence of the IL-15 gene; introducing into a genome of a second non-human animal a nucleic acid sequence encoding a human SIRP protein, wherein the sequence encoding the human SIRP protein is operatively linked to a promoter sequence of SIRP; and causing a third non-human animal to include the nucleic acid sequence encoding the human IL-15 protein and the nucleic acid sequence encoding the human SIRP protein, wherein the third non-human animal expresses the human IL-15 protein and the human SIRP protein. The introduction stages include the generation of a non-human animal from a pluripotent stem cell that includes the nucleic acid encoding human IL-15 or human SIRP. The first animal can be a different animal than the second animal, and the stage of making the third animal includes crossing the first and second animals. The first animal and the second animal can be the same; the stage of introducing into the genome of the first animal includes contacting a first pluripotent stem cell with the nucleic acid sequence that codes for the human IL-15 protein to obtain a second pluripotent stem cell; the stage of introducing into the genome of the second animal can include contacting the second pluripotent stem cell with the nucleic acid sequence that codes for the human SIRP protein to obtain a third pluripotent stem cell; and the third non-human animal is made from the third pluripotent stem cell. A method for causing a non-human animal to express a human IL-15 protein and a human SIRP protein is also described, comprising: introducing into a genome of a first non-human animal a nucleic acid sequence encoding a human SIRP protein, wherein the sequence encoding the human SIPR protein is operatively linked to a promoter sequence of the SIPR gene; introducing into a genome of a second non-human animal a nucleic acid sequence encoding a human IL-15 protein, wherein the sequence encoding the human IL-15 protein is operatively linked to an IL-15 promoter sequence; and causing a third non-human animal to include the nucleic acid sequence encoding the human IL-15 protein and the nucleic acid sequence encoding the human SIRP protein, wherein the third non-human animal expresses the human IL-15 protein and the human SIPR protein. The first animal and the second animal can be the same; the stage of introducing into the genome of the first animal includes contacting a first pluripotent stem cell with the nucleic acid sequence that codes for the human SIRP protein to obtain a second pluripotent stem cell; the stage of introducing into the genome of the second animal includes contacting the second pluripotent stem cell with the nucleic acid sequence that codes for the human IL-15 protein to obtain a third pluripotent stem cell; and the third non-human animal is made from the third pluripotent stem cell. The pluripotent stem cell can be an EM cell or an MPi cell. The pluripotent stem cell may be deficient in Rag2. The pluripotent stem cell may be deficient in IL2rg. The third non-human animal may be deficient in one or both of Rag2 and IL2rg. The IL-15 promoter sequence may be a human IL-15 promoter sequence. The IL-15 promoter sequence may be a sequence for the endogenous, non-human animal IL-15 promoter. Integration may result in a replacement of the non-human IL-15 gene at the non-human IL-15 gene locus. The nucleic acid sequence encoding the human IL-15 protein includes both human IL-15 genomic coding and non-coding sequences. Furthermore, a method for grafting a genetically modified non-human animal expressing a human IL-15 protein is described, which includes: transplanting a cell population that includes human hematopoietic cells into the genetically modified non-human animal manufactured by a method according to the sixth aspect or any embodiment thereof. The transplantation includes injection into the tail vein, injection into the fetal liver, or retro-orbital injection. The genetically modified non-human animal is irradiated sublethally before transplantation. Human hematopoietic cells are CD34+ cells. Human hematopoietic cells are derived from fetal liver, adult bone marrow, or umbilical cord blood. Also described is a method for determining the efficacy of a candidate therapeutic antibody or antigen-binding protein in destroying a target cell, including the method: administering the candidate therapeutic antibody or antigen-binding protein to a genetically modified non-human animal, wherein the genetically modified non-human animal is deficient in an endogenous immune system and includes: (i) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human SIRP protein and is operatively linked to a promoter of the SIRP gene, (ii) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human IL-15 protein and is operatively linked to a promoter of the IL-15 gene, and (iii) a human hematopoietic cell graft.where the genetically modified non-human animal expresses the human SIRP protein and the human IL-15 protein; and to determine whether the candidate therapeutic antibody or antigen-binding protein modulates antibody-dependent NK cell-mediated cellular cytotoxicity against the target cell in the genetically modified non-human animal. Also described is a method for determining the efficacy of a candidate therapeutic antibody or antigen-binding protein in destroying a target cell, which includes: isolating an NK cell from a genetically modified non-human animal, wherein the genetically modified non-human animal is deficient in an endogenous immune system and includes: (i) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human SIRP protein and is operatively linked to a SIRP gene promoter, (ii) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human IL-15 protein and is operatively linked to an IL-15 gene promoter, and (iii) a human hematopoietic cell graft, wherein the genetically modified non-human animal expresses the human SIRP protein and the human IL-15 protein;to bring the isolated NK cell into contact with the candidate therapeutic antibody or antigen-binding protein and the target cell; and to determine the antibody- or antigen-binding protein-dependent cytolytic activity of the isolated NK cell against the target cell. A method for selecting a candidate therapeutic antibody or antigen-binding protein to improve efficacy in destroying a target cell is also described, which includes: administering the candidate therapeutic antibody or antigen-binding protein to a genetically modified non-human animal, wherein the genetically modified non-human animal is deficient in an endogenous immune system and includes: (i) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human SIRP protein and is operatively linked to a SIRP gene promoter, (ii) a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human IL-15 protein and is operatively linked to an IL-15 gene promoter, and (iii) a human hematopoietic cell graft.where the genetically modified non-human animal expresses the human SIRP protein and the human IL-15 protein; and to determine whether the candidate therapeutic antibody or antigen-binding protein shows improved efficacy in destroying the target cell in the genetically modified non-human animal. The target cell is one or more of a tumor cell, a virus-infected cell, a bacteria-infected cell, a bacterial cell, a fungal cell, and a parasitic cell. Brief description of the drawings The patent or application file contains at least one color drawing. The office will provide copies of this patent or patent application publication with color drawings upon request and payment of the required fee. Figure 1 provides a schematic representation of the replacement of the mouse SIRP gene with the human SIRP sequence. Figure 1 (top) shows the mouse SIRP locus indicating the relative location of exons 1 to 8. Figure 1 (bottom) provides a schematic representation showing the final target allele with human exons 2 to 4. The encoded chimeric protein has an extracellular region corresponding to amino acids 28 to 362 of the wild-type human SIRP protein fused with the intracellular portion of the mouse SIRP protein. The diagonally striped shapes represent an inserted human sequence. Figure 2 provides a schematic representation illustrating the targeted genomic replacement of the mouse IL-15 gene as achieved for mouse 2. The empty shapes represent an inserted human sequence. Figure 3A provides graphs showing hIL-15 gene expression in various tissues of non-grafted SRG mice (human SIRP, Rag KO, IL-2r KO) and SRG-15 mice (human SIRP, Rag KO, IL-2r KO, human IL-15 (mouse 1)). The y-axis shows the hIL-15 mRNA level relative to the constitutive Hprt gene. Figure 3B provides graphs showing the expression of the human hIL-15 gene in various tissues of non-grafted RG mice (Rag KO, IL-2r KO) and non-grafted SRG-15 mice (human SIRP, Rag KO, IL-2r KO, human IL-15) (mouse #1 and mouse #2 as indicated). Figure 4 shows serum levels of human IL-15 protein in SRG mice, SRG IL-15h / m (mouse 2) and SRG IL-15h / h (mouse 2) after exposure with poly(I:C). Figure 5A provides a graph showing the successful engraftment of human hematopoietic cells into the blood of NSG, SRG, and SRG-15 mice (mouse 2) 12 to 14 weeks post-engraftment. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (* P < 0.05, ** P < 0.01, **** P < 0.0001). Figure 5B provides graphs showing the number of human CD45+ cells in the BM, spleen, GL, liver, and lung of SRG and SRG-15 (mouse 2) 14 weeks post-graft. Figure 6A provides diagrams showing frequencies of human NK cells and T lymphocytes in SRG and SRG-15 mice (mouse 1) in the bone marrow (BM), liver, and lung. Figure 6B provides graphs showing the frequencies of human NK cells in SRG and SRG-15 mice (mouse 1) in various tissues. Figure 6C provides diagrams and graphs illustrating the maturation of human NK cells in the liver of SRG and SRG-15 mice (mouse 1). Figure 6D provides graphs showing that human CD56dark CD16- NK cells express elevated levels of human cytolytic inhibitory receptors in the spleen of SRG-15 mice. Figure 7A provides a graph showing the frequency of human NK cells in the blood of NSG, SRG, and SRG-15 mice (mouse 2) 10 to 12 weeks post-graft. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent samples (* P < 0.05, ** P < 0.01, **** P < 0.0001). Figure 7B provides a graph showing the percentage of human Nkp46+ cells in the spleen 14 weeks post-graft for SRG, SRG-15h / m and SRG-15h / h. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent samples (* P <0.05, ** P <0.01, **** P <0.0001). Figure 7C provides graphs showing the frequency of human NK cells in the blood, spleen (B), liver, and lung of SRG and SRG-15 mice (mouse 2) 14 weeks post-graft. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (* P < 0.05, ** P < 0.01, **** P < 0.0001). Figure 7D provides graphs showing the frequency of human NK cells in the spleen (B), liver, and lung of SRG and SRG-15 mice (mouse 2) 14 weeks post-graft. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (* P < 0.05, ** P < 0.01, **** P < 0.0001). Figure 8 provides diagrams (left) showing the distribution of human T lymphocytes and NK cells in SRG and SRG-15 mice (mouse 2) in blood (classified into human CD45+ cells (hematopoietic cells) and NKp46+ cells (NK cells)); and a graph (right) showing the percentage of hCD45+ cells that are NKp46+ cells in the blood of grafted SRG-15 mice. Figure 9A provides diagrams showing the distribution of NK cells and T lymphocytes in the spleen and graphs showing the percentage and number of NKp46+ cells in the spleen of SRG-15 mice (mouse 2) grafted with CD34+ huHSCs relative to SRG mice grafted with CD34+ huHSCs. Figure 9B provides a graph showing the composition of human immune cells in the blood of NSG (n = 5), SRG (n = 19), and SRG-15 (mouse 2) (n = 39) mice 10 to 12 weeks post-graft. Figure 9C shows the number of human CD45+ cells in the thymus of SRG and SRG-15 (mouse 2) mice 14 weeks post-graft. Figure 9D provides representative flow cytometry diagrams of hCD45+ cells in the thymus of an SRG and SRG-15 mouse (mouse 2). Figure 9E provides a graph showing the hCD45+ cell composition in the thymus of SRG (n = 8) and SRG-15 (mouse 2) (n = 4) mice 14 weeks post-graft. Figure 10A provides diagrams showing the frequency of CD56bright CD16- and CD56dark CD16+ NK cell subsets in the blood and spleen of SRG and SRG-15 mice (mouse 2) seven weeks post-graft. Figure 10B provides graphs showing the frequency of CD56bright CD16- and CD56dark CD16+ NK cell subsets in the blood and spleen of SRG and SRG-15 mice (mouse 2) seven weeks post-graft. Figure 10C provides diagrams and graphs showing the expression of killer inhibitory receptors (KIRs) in subsets of NK cells in humans and SRG-15 mice (mouse 2). Figure 11 provides two diagrams (top left and top right) showing the distribution of CD16+ versus CD16- NK cells in the blood of SRG-15 mice (mouse 2) relative to a PBMC sample. Figure 11 also provides a graph (bottom) showing the percentage of CD16+ versus CD16- NK cells in blood obtained from SRG-15 mice (mouse 2) or a PBMC sample. Figure 12 provides graphs showing the development of human NK cells in the bone marrow of SRG and SRG-15 mice (mouse 2) seven weeks post-graft. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (* P < 0.05, ** P < 0.01, **** P < 0.0001). Figure 13A provides graphs showing human T lymphocyte frequencies in SRG and SRG-15 mice (mouse 1) in various tissues. (K / µl = thousands of cells per µl). Figure 13B provides diagrams and graphs showing the human CD8+ T lymphocyte phenotype in blood and liver for SRG and SRG-15 mice (mouse 1). Figure 14A provides diagrams and a graph showing the expression of the tissue-resident marker CD69 in CD8+ lung T lymphocytes from SRG and SRG-15 mice (mouse 1). Figure 14B provides a diagram and graph showing the expression of the tissue-resident marker CD69 in liver CD8+ T lymphocytes from SRG and SRG-15 mice (mouse 1). Figure 15A provides graphs showing the frequency of hCD3+ T lymphocytes in the spleen, lung, and liver of SRG and SRG-15 mice (mouse 2) 16 weeks post-graft. Figure 15B provides graphs showing the CD4 / CD8 ratio in the spleen, lung, and liver of SRG and SRG-15 mice (mouse 2) 16 weeks post-graft. Figure 16A provides diagrams illustrating the frequency of human lamina propria lymphocytes (LLP) in the colon of SRG and SRG-15 mice (mouse 1). Figure 16B provides graphs illustrating the frequency of human lamina propria lymphocytes (LLP) in the colon of SRG and SRG-15 mice (mouse 1). Figure 17A, along with Figures 17B and 17C, illustrates the successful engraftment of human intraepithelial lymphocytes (IELs) into the small intestine of 16-week-old SRG-15 mice (mouse 1). Diagrams and graphs showing human CD45+ cells and CD8+ T lymphocytes in the IEL fraction of SRG and SRG-15 mice (mouse 1) are provided in Figure 17A. Figure 17B provides immunohistochemical staining images of hCD45 in the small intestine of 16-week-old SRG and SRG-15 mice (mouse 1). Figure 17C provides diagrams showing the phenotypic characteristics of human CD8+ T lymphocytes in the spleen and small intestine of SRG-15 mice (mouse 1). Representative FACS diagrams are provided in Figure 18A showing human and mouse CD45+ cells in the IEL fraction of SRG and SRG-15 mice (mouse 2) 16 weeks post-graft. Figure 18B provides graphs showing the number of human IELs in the small intestine of SRG mice relative to SRG-15 mice (mouse 2) and the number of human LLPs in the large intestine of SRG mice relative to SRG-15 mice (mouse 2). All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (*** P < 0.001). Figure 18C provides a diagram showing the hCD3+ cell composition in the small intestine of SRG-15 mice (mouse 2). A representative FACS diagram of eight SRG-15 mice (mouse 2). Figure 18D provides graphs showing the phenotypic characteristics of hCD3+ hCD8+ T lymphocytes in the spleen and small intestine of SRG-15 mice (mouse 2). Figure 18E shows immunohistochemical staining images of hCD8 in the small intestine of SRG and SRG-15 mice (mouse 2). Arrows indicate hCD8+ IEL. Images are representative of three mice per group. Figure 19A provides diagrams and graphs showing the distribution and number of hCD45+ cells in the intraepithelial lymphocyte populations of SRG and SRG-15 mice and the relative percentages of NK cells and T lymphocytes in the hCD45+ cell populations in the intraepithelial lymphocyte populations of SRG and SRG-15 mice (mouse 2). Figure 19B provides diagrams and graphs showing the distribution and percentage of CD16+ and CD16- NK cells in intraepithelial lymphocytes of SRG-15 mice (mouse 2) compared to blood and spleen. Figure 19C provides diagrams and graphs showing the distribution and number of human IELs and human lamina propria lymphocytes (LPLs) in SRG and SRG-15 mice (mouse 2). Figures 20A and 20B provide diagrams and graphs demonstrating the presence of discernible Peyer's patches containing predominantly hCD45+ cells in SRG-15 mice (mouse 2). Figure 21A provides a timeline for cohabitation and the collection of stool samples for gut microbiota sequencing. Figure 21B provides a diagram showing the relative abundance of mouse bacteria in the gut of non-grafted and grafted SRG and SRG-15 mice (mouse 1). Figure 22 illustrates the functional relevance of human tissue-resident T lymphocytes in SRG-15 mice. More specifically, Figure 22 provides a graph demonstrating the functional relevance of human IELs in clearing acute rotavirus infection. Figure 23A provides ViSNE diagrams showing CyTOF-based analyses of 42 parameters of CD56bright CD16- and CD56dark CD16+ NK cell subsets in humans (n = 20) and SRG-15 mice (mouse 2) (n = 9). Each dot represents a single cell. Figure 23B provides ViSNE diagrams showing the expression intensity of eight selected markers in CD56bright CD16- NK cells in humans (n = 20) and SRG-15 mice (mouse 2) (n = 9). ViSNE diagrams in Figure 23C show the expression intensity of eight selected markers in CD56dark CD16+ NK cells in humans (n = 20) and SRG-15 mice (n = 9). Figure 24A provides a graph showing the percentage of NK cells in blood in SRG vs SRG-15 mice (mouse 2) that are CD69+ before and after poly-IC injection. Figure 24B provides graphs showing IFN production from NK cells derived from SRG and SRG-15 (mouse 2) after in vitro stimulation with poly I:C or human IL-12p70. Mouse NK cells are compared with NK cells derived from healthy human PBMCs. All samples are normalized for NK cell count. Figure 24C provides graphs showing the cytolytic capacity of splenic NK cells from SRG and SRG-15 (mouse 2) against HLA class I deficient K562 cells (left) or against Raji cells in the absence (top right) or in the presence (bottom right) of anti-CD20 antibody. SRG-15 No. 1 and SRG-15 No. 2 represent two different preparations of SRG-15 littermate NK cells (mouse 2). Figure 25A provides a graph showing that human NK cells in SRG-15 mice (mouse 2) inhibit tumor growth after treatment with rituximab (RTX). All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (*** P < 0.001). Figure 25B provides diagrams and a graph showing the frequency of human NK cells and T lymphocytes in human tumor xenografts from untreated (n = 5) and RTX-treated (n = 1) SRG-15 mice. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (*** P < 0.001). Figure 25C provides diagrams and graphs showing subsets of human NK cells in the blood and tumor of untreated (n = 2) and RTX-treated (n = 1) SRG-15 mice. All data shown are mean ± SEM. Statistical analyses were performed using the two-tailed Mann-Whitney U test for independent data (*** P < 0.001). Detailed description Before describing the present methods and compositions, it should be noted that this invention is not limited to any particular method or composition described, as these may vary. It should also be noted that the terminology used herein is solely for the purpose of describing particular embodiments and is not intended to be restrictive, since the scope of the present invention is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as they are commonly understood by a person skilled in the art to which the present invention pertains. Although any method and material similar or equivalent to those described herein may be used in the practice or testing of the present invention, particular methods and materials are described below. As will be evident to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete features and components that can easily be separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the present invention. Any method cited may be carried out in the order of events cited or in any other logically possible order. It should be noted that, as used herein and in the appended claims, the singular forms "a," "one," and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, the reference to "a cell" includes a plurality of such cells, and the reference to "the protein" includes the reference to one or more proteins and their equivalents known to those skilled in the art, and so forth. The publications discussed herein are provided solely for disclosure prior to the filing date of this application. Nothing herein shall be construed as an admission that the present invention is not entitled to precede such publication. Genetically modified rodents expressing human SIRP and human IL-15 from the rodent genome are provided. Methods for creating non-human animals expressing human SIRP and human IL-15 from the genome of a non-human animal, and methods for utilizing non-human animals expressing human SIRP and human IL-15 from the genome of a non-human animal, are also described. These animals and methods find many applications in the field, including, for example, in modeling the development and function of human natural killer (NK) cells and / or T lymphocytes; in modeling human pathogen infection, for example, infection of specific tissues, such as intestinal, pulmonary, or hepatic pathogens; and in modeling human pathogen infection of human NK cells and / or T lymphocytes.in the in vivo selection of agents that inhibit infection by a pathogen that activates, induces, and / or targets T lymphocytes and / or NK cells; in the in vivo selection of agents that modulate the development and / or function of human NK cells and / or T lymphocytes, for example, in a healthy or diseased state; in the in vivo selection of agents that are toxic to human NK cells and / or T lymphocytes; in the in vivo selection of agents that prevent, mitigate, or reverse the toxic effects of toxic agents on human NK cells and / or T lymphocytes; in the in vivo selection of candidate vaccines that induce T lymphocytes; and in the in vivo and in vitro selection of agents that inhibit tumor growth and / or infection by activating antibody-dependent cell-mediated cytotoxicity (ADCC) processes mediated by NK cells. Humanized SIRP Non-Human Animals A humanized SIRP rodent is provided. A humanized SIRP rodent is a rodent that includes a nucleic acid sequence encoding a human SIRP protein. As used herein, "human SIRP protein" means a protein that is either a wild-type (or native) human SIRP protein or a variant of a wild-type (or native) human SIRP protein, retaining one or more signaling and / or receptor functions of a wild-type human SIRP protein. As used herein, the term "variant" defines a naturally occurring genetically isolated mutant of a human polypeptide or nucleic acid sequence or a recombinantly prepared variation of a human polypeptide or nucleic acid sequence, each containing one or more mutations compared to the corresponding wild-type human nucleic acid or polypeptide sequence.For example, such mutations may be one or more substitutions, additions, and / or deletions of amino acids. The term "variant" also includes human homologs and orthologs. In some embodiments, a variant polypeptide of the present invention has 70% or more identity, for example, 75%, 80%, or 85% or more identity with a wild-type human polypeptide, for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a wild-type human polypeptide. The percentage of identity between two sequences can be determined using any convenient technique in the field, for example, sequence alignment with a publicly available computer program. Mutations can be introduced using conventional molecular biology techniques, such as site-directed mutagenesis, PCR-mediated mutagenesis, directed evolution, and the like. A person skilled in the art will recognize that one or more nucleic acid substitutions can be introduced without altering the amino acid sequence, and that one or more amino acid mutations can be introduced without altering the functional properties of the human protein. Conservative amino acid substitutions can be performed in human proteins to produce human protein variants. Conservative amino acid substitutions are recognized substitutions of one amino acid for another amino acid with similar characteristics. For example, each amino acid can be described as possessing one or more of the following characteristics: electropositive, electronegative, aliphatic, aromatic, polar, hydrophobic, and hydrophilic. A conservative substitution is the replacement of an amino acid with a specific structural or functional characteristic by another amino acid with the same characteristic.Acidic amino acids include aspartate and glutamate; basic amino acids include histidine, lysine, and arginine; aliphatic amino acids include isoleucine, leucine, and valine; aromatic amino acids include phenylalanine, glycine, tyrosine, and tryptophan; polar amino acids include aspartate, glutamate, histidine, lysine, asparagine, glutamine, arginine, serine, threonine, and tyrosine; and hydrophobic amino acids include alanine, cysteine, phenylalanine, glycine, isoleucine, leucine, methionine, proline, valine, and tryptophan. Conservative substitutions include substitution between amino acids within each group. Amino acids can also be described in terms of relative size: alanine, cysteine, aspartate, glycine, asparagine, proline, threonine, serine, and valine are all typically considered small. Human variants may include synthetic amino acid analogues, amino acid derivatives and / or unconventional amino acids, including by way of illustration, but not limitation, α-aminobutyric acid, citrulline, canavanine, cyanoalanine, diaminobutyric acid, diaminopimelic acid, dihydroxyphenylalanine, djenkolic acid, homoarginine, hydroxyproline, norleucine, norvaline, 3-phosphoserine, homoserine, 5-hydroxytryptophan, 1-methylhistidine, methylhistidine and ornithine. Human variants are typically encoded by nucleic acids that have a high degree of identity with a nucleic acid encoding the wild-type human protein. The complement of a nucleic acid encoding a human variant specifically hybridizes to a nucleic acid encoding a wild-type human under highly rigorous conditions. Nucleic acids encoding a human variant can be isolated or generated recombinantly or synthetically using well-established methods. The term "human SIRP protein" also encompasses fragments of a wild-type human SIRP protein (or a variant thereof) that retain one or more signaling and / or receptor functions of a wild-type human SIRP protein, such as an extracellular domain of a human SIRP protein. The term "human SIRP protein" also encompasses fusion proteins, i.e., chimeric proteins, which include one or more fragments of a wild-type human SIRP protein (or a variant thereof) and retain one or more signaling and / or receptor functions of a wild-type human SIRP protein. A fusion protein that includes one or more fragments of a wild-type human SIRP protein (or a variant thereof), for example, in combination with one or more non-human peptides or polypeptides, may also be referred to herein as a humanized SIRP protein. Thus, for example, a protein that includes an amino acid sequence from an extracellular domain of a wild-type human SIRP protein fused with a signaling domain of a wild-type mouse SIRP protein is encompassed by the term "human SIRP protein." In some cases, a human SIRP protein according to this disclosure includes an amino acid sequence that has at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95%, at least approximately 98%, at least approximately 99%, or 100% amino acid sequence identity with amino acids 28 to 362 of SEQ ID NO: 12. A nucleic acid sequence encoding a human SIRP protein is, therefore, a polynucleotide that includes a sequence encoding a human SIRP protein, e.g., a wild-type human SIRP protein, a variant of a wild-type human SIRP protein, a fragment of a wild-type human SIRP protein (or a variant thereof) that retains one or more signaling and / or receptor functions of a wild-type human SIRP protein, or fusion proteins, i.e., chimeric proteins, that include one or more fragments of a wild-type human SIRP protein (or a variant thereof) and that retain one or more signaling and / or receptor functions of a wild-type human SIRP protein. SIRP (also known as "signal-regulatory protein" and "CD172A" in humans) is a member of the signal-regulatory protein (SIRP) family and also belongs to the immunoglobulin superfamily. SIRP has been shown to enhance cell engraftment in immunodeficient mice (Strowig et al. Proc Natl Acad Sci USA 2011; 108:13218-13223). The polypeptide sequence for wild-type human SIRP and the nucleic acid sequence encoding wild-type human SIRP can be found in GenBank under the registration numbers NM_001040022.1 (variant 1), NM_001040023.1 (variant 2), and NM_080792.2 (variant 3). The SIRP gene is conserved in at least the chimpanzee, rhesus macaque, dog, cow, mouse, rat, and chicken. The genomic locus encoding the wild-type human SIRP protein can be found in the human genome on chromosome 20; NC_000020.11 (1894117-1939896).The protein sequence is encoded by exons 1 to 8 at this locus. Thus, in some embodiments, a nucleic acid sequence that includes the coding sequence for human SIRP includes one or more of exons 1 to 8 of the human SIRP gene. In some cases, the nucleic acid sequence also includes aspects of the human SIRP genomic locus, such as introns and untranslated portions (UTRs) at the 3' and / or 5' ends. In some cases, the nucleic acid sequence includes entire regions of the human SIRP genomic locus. In some cases, the nucleic acid sequence includes exons 2 to 4 of the human SIRP genomic locus. In the humanized SIRP rodents of this application, the nucleic acid sequence encoding a human SIRP protein is operatively linked to one or more regulatory sequences of a SIRP gene, e.g., a regulatory sequence of a rodent SIRP gene. Rodent SIRP regulatory sequences, e.g., mouse SIRP, are those sequences of the non-human animal SIRP genomic locus that regulate the expression of non-human animal SIRP, e.g., 5' regulatory sequences, e.g., the SIRP promoter, a 5' untranslated region (UTR) of SIRP, etc.; 3' regulatory sequences, e.g., the 3'-UTR; and enhancers, etc. A "promoter" or "promoter sequence" refers to a regulatory region of DNA capable of binding to RNA polymerase in a cell and initiating transcription of a coding sequence downstream (3' direction). The promoter sequence is limited at its 3' end by the transcription start site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above the background. Within the promoter sequence, a transcription start site is found, as well as protein-binding domains responsible for RNA polymerase binding. Eukaryotic promoters often, but not always, contain "TATA" boxes and "CAT" boxes.Of particular interest for the present disclosure are the regulatory elements of DNA, for example, promoters, which promote the transcription of the human protein in the same spatial and temporal expression pattern, that is, in the same cells and tissues and at the same times, as would be observed for the corresponding endogenous protein. Murine SIRP is located on chromosome 2; NC 000068.7 (129592606-129632228), and the coding sequence of murine SIRP can be found in Genbank with the registration numbers NM_007547.4 (isoform 1), NM_001177647.2 (isoform 2), NM_001291019.1 (isoform 3), NM_001291020.1 (isoform 3), NM_001291021.1 (isoform 4), NM_001291022.1 (isoform 5). The regulatory sequences of murine SIRP are well defined in the subject and can be easily identified by computer methods, e.g., by referencing past Genbank registration numbers in the UCSC Genome Browser on the World Wide Web, or by experimental methods as described in the subject.In some cases, for example, when the nucleic acid sequence encoding a human SIRP protein is located at the mouse SIRP genomic locus, the regulatory sequences operatively linked to the human SIRP coding sequence are endogenous, or native, to the mouse genome; that is, they were present in the mouse genome before the integration of the human nucleic acid sequences. In some cases, the humanized non-human SIRP, for example, mouse, is generated by the random integration, or insertion, of a human nucleic acid sequence encoding a human SIRP protein (including the fragments described above)—that is, a "human SIRP nucleic acid sequence," or "human SIRP sequence"—into the genome. Typically, the location of the nucleic acid sequence encoding a human SIRP protein within the genome is unknown. In other cases, the humanized non-human SIRP is generated by the targeted integration, or insertion, of the human SIRP nucleic acid sequence into the genome, for example, through homologous recombination.In homologous recombination, a polynucleotide is inserted into the host genome at a target locus while, simultaneously, host genomic material is removed—for example, 50 base pairs (bp) or more, 100 bp or more, 200 bp or more, 500 bp or more, 1 kb or more, 2 kb or more, 5 kb or more, 10 kb or more, 15 kb or more, 20 kb or more, or 50 kb or more of genomic material—from the target locus. Thus, for example, in a humanized mouse SIRP that includes a nucleic acid sequence encoding a human SIRP protein created by targeting the human SIRP nucleic acid sequence to the mouse SIRP locus, the human SIRP nucleic acid sequence can replace some or all of the mouse sequences, for example, exons and / or introns, at the SIRP locus.In some of these cases, a human SIRP nucleic acid sequence integrates into the mouse SIRP locus in such a way that the expression of the human SIRP sequence is regulated by the native, or endogenous, regulatory sequences at the mouse SIRP locus. In other words, the regulatory sequence(s) to which the nucleic acid sequence encoding a human SIRP protein is operatively bound are the native SIRP regulatory sequences at the mouse SIRP locus. In some cases, integration of the human SIRP sequence does not affect the transcription of the gene into which it has integrated. For example, if the human SIRP sequence integrates into a coding sequence such as an intein, or if the human SIRP sequence includes a peptide 2A, the human SIRP sequence will be transcribed and translated concurrently with the gene into which it has integrated. In other cases, integration of the human SIRP sequence disrupts the transcription of the gene into which it has integrated. For example, following integration of the human SIRP sequence by homologous recombination, some or all of the coding sequence at the integration locus may be deleted, so that the human SIRP sequence is transcribed in its place. In some such cases, integration of a human SIRP sequence creates a null mutation and thus a null allele.A null allele is a mutant copy of a gene that completely lacks the gene's normal function. This can result from the complete absence of the gene product (protein, RNA) at the molecular level, or from the expression of a non-functional gene product. At the phenotypic level, a null allele is indistinguishable from the complete deletion of the locus. In some cases, the humanized SIRP rodent, for example, a mouse, includes a copy of the nucleic acid sequence that encodes a human SIRP protein. For example, the rodent may be heterozygous for the nucleic acid sequence. In other words, one allele at one locus will include the nucleic acid sequence, while the other will be the endogenous allele. For example, as discussed earlier, in some cases, a human SIRP nucleic acid sequence is integrated into the SIRP locus of a rodent, for example, a mouse, in such a way that it creates a null allele for the non-human animal SIRP. In some of these embodiments, the humanized SIRP rodent may be heterozygous for the nucleic acid sequence that encodes the human SIRP; that is, the humanized SIRP rodent includes a null allele for the non-human animal SIRP (the allele that includes the nucleic acid sequence) and an endogenous SIRP allele (wild-type or otherwise).In other words, the rodent is a non-human SIRP h / m animal, where "h" represents the allele that includes the human sequence and "m" represents the endogenous allele. In other cases, the humanized SIRP includes two copies of the nucleic acid sequence that codes for a human SIRP protein. For example, the rodent, such as a mouse, may be homozygous for the nucleic acid sequence; that is, both alleles for a locus in the diploid genome will include the nucleic acid sequence. In other words, the humanized SIRP rodent includes two null alleles for the SIRP of (the allele that includes the nucleic acid sequence). In other words, the rodent is an h / h SIRP rodent. In some embodiments, the humanized SIRP rodent, for example, a mouse, includes other genetic modifications. In some embodiments, the humanized SIRP rodent is an immunocompromised animal. For example, the humanized SIRP rodent may include at least one null allele for the Rag2 gene ("recombination activator gene 2," where the coding sequence for the mouse gene can be found under GenBank registration number NM_009020.3). In some embodiments, the humanized SIRP rodent includes two null alleles for Rag2. In other words, the humanized SIRP rodent is homozygous null for Rag2. As another example, the humanized SIRP rodent includes at least one null allele for the IL2r gene ("interleukin 2 receptor", also known as common chain, or C, where the coding sequence for the mouse gene can be found with the Genbank registration number NM_013563.3). In some embodiments, the humanized SIRP rodent includes two null alleles for IL2r.In other words, the humanized SIRP rodent is homozygous null for IL2r, that is, it is IL2r- / - (or IL2rY / - where the IL2r gene is located on the X chromosome, as in the mouse). In some embodiments, the SIRP rodent includes a null allele for Rag2 and IL2r, that is, it is Rag2- / - IL2r- / - (or Rag2- / - IL2rY / - where the IL2r gene is located on the X chromosome, as in the mouse). Other genetic modifications are also contemplated. For example, the humanized SIRP rodent may include modifications in other genes associated with the development and / or function of hematopoietic cells and the immune system, such as the replacement of one or more other rodent genes with a nucleic acid sequence encoding the human ortholog.Additionally or as an alternative, the humanized SIRP rodent may include modifications in genes associated with the development and / or function of other cells and tissues, for example, genes associated with human disorders or diseases, or genes that, when modified in rodents, for example, mice, provide models of human disorders or diseases. NON-HUMAN ANIMALS IL-15 HUMANIZED A humanized IL-15 rodent is provided. A humanized IL-15 rodent, or "IL-15 rodent," is a rodent that includes a nucleic acid sequence encoding a human IL-15 protein. As used herein, "human IL-15 protein" means a protein that is a wild-type (or native) human IL-15 protein or a variant of a wild-type (or native) human IL-15 protein, that retains one or more signaling functions of a wild-type (or native) human IL-15 protein, for example, that enables stimulation of (or signaling through) the human IL-15 receptor, and / or that is capable of binding to the human IL-15 receptor alpha subunit and the human IL-15 receptor, and / or that is capable of binding to IL-2Rβ / IL-15Rβ and the common chain (c).The expression "human IL-15 protein" also encompasses fragments of a wild-type human IL-15 protein (or variants thereof), which retain one or more signaling functions of a wild-type human IL-15 protein, e.g., a fragment of a human IL-15 protein, which enables stimulation of (or signaling through) the human IL-15 receptor, and / or which is able to bind to the alpha subunit of the human IL-15 receptor, and / or which is able to bind to IL-2Rβ / IL-15Rβ and the common chain (c). The term "human IL-15 protein" also encompasses fusion proteins, i.e., chimeric proteins, which include one or more fragments of a wild-type human IL-15 protein (or a variant thereof) and which retain one or more signaling functions of a wild-type human IL-15 protein, for example, as described above. A fusion protein that includes one or more fragments of a wild-type human IL-15 protein (or a variant thereof) may also be referred to herein as a humanized IL-15 protein. A nucleic acid sequence encoding a human IL-15 protein is, therefore, a polynucleotide that includes a sequence encoding a human IL-15 protein, i.e., a wild-type human IL-15 protein, a variant of a wild-type human IL-15 protein, a fragment of a wild-type human IL-15 protein (or a variant thereof) that retains one or more signaling functions of a wild-type human IL-15 protein, or fusion proteins, i.e., chimeric proteins, that include one or more fragments of a wild-type human IL-15 protein (or a variant thereof) and that retain one or more signaling functions of a wild-type human IL-15 protein, for example, as described above. IL-15 (also known as "Interleukin 15") is a cytokine that stimulates T lymphocyte proliferation. The polypeptide sequence for wild-type human IL-15 and the nucleic acid sequence encoding wild-type human IL-15 can be found in GenBank under the registration numbers NM_000585.4; NP_000576.1 (isoform 1), NM_172175.2; NP_751915.1 (isoform 2). The genomic locus encoding the wild-type human IL-15 protein can be found in the human genome on chromosome 4; NC_000004.12 (141636596-141733987). The human IL-15 locus includes 8 exons, with exons 3 through 8 being the coding exons. Thus, in some embodiments, a nucleic acid sequence that includes the human IL-15 coding sequence includes one or more of exons 3 to 8 of the human IL-15 gene (i.e., coding exons 1 to 6, see Figure 2).For example, several IL-15 mRNA isoforms have been identified that are produced through the following combinations of exon usage: Exons 1-2-3-4-5-6-7-8; Exons 1-3-4-5-6-7-8; or Exons 1-3-4-(alternative exon 5)-5-6-7-8. In some cases, the nucleic acid sequence also includes aspects of the human IL-15 genomic locus, such as introns, untranslated regions (UTRs) at the 3' and / or 5' ends. In some cases, the nucleic acid sequence includes entire regions of the human IL-15 genomic locus. In some cases, the nucleic acid sequence includes exons 5 to 8 of the human IL-15 genomic locus (i.e., it encodes exons 3 to 6). In some cases, a human IL-15 protein according to this disclosure includes an amino acid sequence that has at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95%, at least approximately 98%, at least approximately 99%, or 100% amino acid sequence identity with SEQ ID NO: 31. In the humanized IL-15 rodents of this application, the nucleic acid sequence encoding a human IL-15 protein is operatively linked to one or more regulatory sequences of an IL-15 gene, e.g., a rodent IL-15 regulatory sequence. Rodent IL-15 regulatory sequences, e.g., mouse, are those sequences of the non-human animal IL-15 genomic locus that regulate the expression of non-human animal IL-15, e.g., 5' regulatory sequences, e.g., the IL-15 promoter, a 5' untranslated region (UTR) of IL-15, etc.; 3' regulatory sequences, e.g., the 3'-UTR; and enhancers, etc. Mouse IL-15 is located on chromosome 8, NC_000074.6 (82331624-82403227, complement), and the mouse IL-15 coding sequence can be found in Genbank with the registration numbers NM_008357.2 (variant 1); NM_001254747.1 (variant 2).The regulatory sequences of murine IL-15 are well defined in the subject and can be readily identified using computational methods, for example, by referencing the GenBank registration numbers above in the UCSC Genome Browser on the World Wide Web at genome.ucsc.edu, or by experimental methods as described in the subject. In some cases, for example, when the nucleic acid sequence encoding a human IL-15 protein is localized to the mouse IL-15 genomic locus, the regulatory sequences operatively linked to the human IL-15 coding sequence are endogenous, or native, to the mouse genome; that is, they were present in the mouse genome before the integration of the human nucleic acid sequences. In some cases, the humanized non-human IL-15, for example, mouse, is generated by the random integration, or insertion, of a human nucleic acid sequence encoding a human IL-15 protein (including the fragments described above), i.e., a "human IL-15 nucleic acid sequence," or "human IL-15 sequence," into the genome. Typically, in such embodiments, the location of the nucleic acid sequence encoding a human IL-15 protein within the genome is unknown. In other cases, the humanized non-human IL-15 is generated by the targeted integration, or insertion, of the human IL-15 nucleic acid sequence into the genome, by means of, for example, homologous recombination.In homologous recombination, a polynucleotide is inserted into the host genome at a target locus while, simultaneously, host genomic material is removed, for example, 50 base pairs (bp) or more, 100 bp or more, 200 bp or more, 500 bp or more, 1 kb or more, 2 kb or more, 5 kb or more, 10 kb or more, 15 kb or more, 20 kb or more, or 50 kb or more of genomic material, from the target locus. Thus, for example, in a humanized mouse IL-15 that includes a nucleic acid sequence encoding a human IL-15 protein created by targeting the human IL-15 nucleic acid sequence to the mouse IL-15 locus, the human IL-15 nucleic acid sequence can replace some or all of the mouse sequences, e.g., exons and / or introns, at the IL-15 locus.In some of these cases, a human IL-15 nucleic acid sequence integrates into the mouse IL-15 locus in such a way that the expression of the human IL-15 sequence is regulated by the native, or endogenous, regulatory sequences at the mouse IL-15 locus. In other words, the regulatory sequence(s) to which the nucleic acid sequence encoding a human IL-15 protein is operatively bound are the native IL-15 regulatory sequences at the mouse IL-15 locus. In some cases, integration of the human IL-15 sequence does not affect the transcription of the gene into which it has integrated. For example, if the human IL-15 sequence integrates into a coding sequence such as an intein, or if the human IL-15 sequence includes a peptide 2A, the human IL-15 sequence will be transcribed and translated concurrently with the gene into which it has integrated. In other cases, integration of the human IL-15 sequence disrupts the transcription of the gene into which it has integrated. For example, following integration of the human IL-15 sequence by homologous recombination, some or all of the coding sequence at the integration locus may be deleted, so that the human IL-15 sequence is transcribed in its place.In some of these cases, the integration of a human IL-15 sequence creates a null mutation and, therefore, a null allele. A null allele is a mutant copy of a gene that completely lacks that gene's normal function. This can result from the complete absence of the gene product (protein, RNA) at the molecular level, or from the expression of a non-functional gene product. At the phenotypic level, a null allele is indistinguishable from a complete locus deletion. In some cases, the humanized IL-15 in rodents, such as mice, includes a copy of the nucleic acid sequence that codes for a human IL-15 protein. For example, the rodent may be heterozygous for the nucleic acid sequence. In other words, one allele at one locus will carry the nucleic acid sequence, while the other will carry the endogenous allele. For example, as discussed earlier, in some cases, a human IL-15 nucleic acid sequence integrates into the IL-15 locus of a rodent, such as a mouse, in such a way that it creates a null allele for rodent IL-15. In some of these embodiments, the humanized IL-15 rodent may be heterozygous for the nucleic acid sequence encoding human IL-15, i.e., the humanized IL-15 rodent includes a null allele for rodent IL-15 (the allele that includes the nucleic acid sequence) and an endogenous (wild-type or otherwise) IL-15 allele.In other words, the rodent is an IL-15 h / m rodent, where "h" represents the allele that includes the human sequence and "m" represents the endogenous allele. In other cases, humanized IL-15 includes two copies of the nucleic acid sequence that codes for a human IL-15 protein. For example, the rodent, such as a mouse, may be homozygous for the nucleic acid sequence; that is, both alleles for a locus in the diploid genome will include the nucleic acid sequence. In other words, the humanized IL-15 rodent includes two null alleles for rodent IL-15 (the allele that includes the nucleic acid sequence). In other words, the non-human animal is an IL-15h / h rodent. NON-HUMAN ANIMALS SIRP-IL-15 HUMANIZED By crossing humanized IL-15 rodents as described above with humanized SIRP rodents of the same species as described above, genetically modified rodents expressing both human SIRP and human IL-15 can be produced. In some embodiments, such genetically modified rodents are deficient in an endogenous immune system, e.g., immunocompromised animals, as a result of a null allele for one or both Rag2 and IL2r. For example, in some embodiments, a rodent according to this disclosure is Rag2- / - and / or IL2r- / - (or Rag2- / - and / or IL2rY / - where the IL2r gene is located on the X chromosome as in the mouse). In some embodiments, a genetically modified rodent is provided, wherein the genetically modified rodent, for example a mouse, is SIRPh / m IL-15h / m Rag2- / - IL2rY / -, SIRPh / h IL-15h / m Rag2- / - IL2rY / - or SIRPh / m IL-15h / h Rag2- / - IL2rY / -. A genetically modified rodent, for example a mouse, is provided that includes a nucleic acid sequence incorporated into the genome of the genetically modified rodent, the sequence of which encodes a human SIRP protein and is operatively linked to a promoter of the SIRP gene; and a nucleic acid sequence incorporated into the genome of the genetically modified rodent, the sequence of which encodes a human IL-15 protein and is operatively linked to a promoter of the IL-15 gene, wherein the genetically modified rodent expresses the human SIRP protein and the human IL-15 protein. The SIRP gene promoter is an endogenous rodent SIRP gene promoter. The SIRP gene promoter is the endogenous rodent SIRP gene promoter at the rodent SIRP gene locus. The IL-15 gene promoter is an endogenous rodent IL-15 gene promoter. The IL-15 gene promoter is the endogenous rodent IL-15 gene promoter at the rodent IL-15 gene locus. In some embodiments, a genetically modified rodent as described herein expresses human IL-15 mRNA in the liver, lung, bone marrow (BM), small intestine (SI), and colon. In some embodiments, a genetically modified rodent, for example, a mouse, expressing both human SIRP and human IL-15, as described herein, exhibits a higher percentage and number of human T lymphocytes and NK cells than a genetically modified rodent, for example, a mouse, expressing only human SIRP, after grafting with human hematopoietic stem cells, for example, CD45+ cells. In some embodiments, a genetically modified rodent, for example, a mouse, expressing both human SIRP and human IL-15, as described herein, exhibits a higher percentage and number of NK cells in the blood and spleen.In some embodiments, a genetically modified rodent, e.g., a mouse, expressing both human SIRP and human IL-15, as described herein, includes both subsets of human NK cells, CD56brightCD16- and CD56darkCD16+, in the blood, spleen, and liver, after engraftment with human hematopoietic cells, e.g., CD45+ cells. In some embodiments, a genetically modified rodent, e.g., a mouse, expressing both human SIRP and human IL-15, as described herein, exhibits a similar distribution of CD16+ versus CD16- NK cells in blood to the distribution of CD16+ versus CD16- NK cells in PBMCs obtained from human subjects. In some embodiments, a genetically modified rodent, e.g. a mouse, expressing both human SIRP and human IL-15, as described herein, includes NK cells in the liver of the genetically modified rodent that exhibit a higher level of CD16 and CD56 expression, indicating greater maturation of the NK cells, relative to a genetically modified rodent, e.g. a mouse, expressing only human SIRP, after grafting with human hematopoietic cells, e.g., CD45+ cells.In some embodiments, a genetically modified rodent, e.g. a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, e.g. CD45+ cells, includes NK cells in the spleen exhibiting a distinct level of expression of cytolytic inhibitory receptors, with the dark CD56CD16+ NK cell population including the highest percentage of cells expressing CD158, similar to what is found for NK cell subsets in human blood. In some embodiments, a genetically modified rodent, e.g., a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, e.g., CD45+ cells, exhibits a higher frequency of human CD45+ and CD8+ T lymphocytes in the intraepithelial lymphocyte population compared to a genetically modified rodent, e.g., a mouse, expressing only human SIRP. In some embodiments, a genetically modified rodent, e.g., a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, exhibits a comparable CD16+ to CD16- NK cell distribution in the intraepithelial lymphocytes (IELs), and more CD16+ than CD16- NK cells in the blood and spleen, reflecting normal human physiology. In some embodiments, a genetically modified rodent, e.g., a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, e.g., CD45+ cells, exhibits a higher number of human T lymphocytes in the lung compared to a genetically modified rodent, e.g., a mouse, expressing only human SIRP. In some of these embodiments, the genetically modified rodent, e.g., a mouse, exhibits a higher level of CD69 expression on human CD8+ T lymphocytes in the lung compared to a genetically modified non-human animal, e.g., a mouse, expressing only human SIRP. In some embodiments, a genetically modified rodent, e.g. a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, e.g., CD45+ cells, exhibits a higher level of CD69 expression in human CD8+ T lymphocytes in the liver compared to a non-human animal, e.g. a mouse, genetically modified expressing only human SIRP. In some embodiments, a genetically modified rodent, for example a mouse, expressing both human SIRP and human IL-15, as described herein, and grafted with human hematopoietic cells, exhibits discernible Peyer's patches that are predominantly human CD45+. In several embodiments, the genetically modified rodent subject is a mouse, a rat, or a rabbit. In one embodiment, the rodent is selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the superfamily Muroidea. In one embodiment, the genetically modified rodent is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, and voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (crawling mice, rock mice, white-tailed rats, Madagascar rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rats, bamboo rats, and zokors). In one specific embodiment, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In one embodiment, the genetically modified rodent subject is a rat. In one such embodiment, the rat is selected from a Wistar rat, a LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In another embodiment, the rat strain is a mixture of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti. In another embodiment, the genetically modified rodent subject is a mouse, for example, a mouse of a C57BL strain (for example, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, C57BL / Ola, etc.); a mouse of strain 129 (e.g., 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2); a mouse of strain BALB; e.g., BALB / c; and the like. See, e.g., Festing et al. (1999) Mammalian Genome 10:836, see also, Auerbach et al. (2000) "Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines". In another embodiment, a mouse is a mixture of the aforementioned strains. In some embodiments, the genetically modified mouse subject is also immunodeficient. "Immunodeficiency" includes deficiencies in one or more aspects of an animal's native or endogenous immune system; for example, the animal is deficient in one or more types of functioning host immune cells, such as deficient in the number and / or function of non-human B lymphocytes, number and / or function of non-human T lymphocytes, number and / or function of non-human NK cells, etc. One method for achieving immunodeficiency in animal subjects is sublethal irradiation. For example, newborn genetically modified mouse pups can be irradiated sublethally, for example, with 2 × 200 cGy at a four-hour interval. Alternatively, immunodeficiency can be achieved by any one of a number of known genetic mutations in the subject matter, any of which can be crossed alone or in combination with the genetically modified non-human animals that are the subject of this disclosure or which can be used as a source of stem cells into which the genetic modifications of this disclosure can be introduced.Non-limiting examples include X-linked SCID, associated with IL2r gene mutations and characterized by the T (-)B (+)NK (-) lymphocyte phenotype; autosomal recessive SCID associated with Jak3 gene mutations and characterized by the T (-)B (+)NK (-) lymphocyte phenotype; ADA gene mutations characterized by the T (-)B (-)NK (-) lymphocyte phenotype; IL-7R chain mutations characterized by the T (-)B (+)NK (+) lymphocyte phenotype; CD3 or mutations characterized by the T (-)B (+)NK (+) lymphocyte phenotype; RAG1 and RAG2 mutations characterized by the T (-)B (-)NK (+) lymphocyte phenotype; mutations of the Artemis gene characterized by the phenotype of T (-) B (-) NK (+) lymphocytes, mutations of the CD45 gene characterized by the phenotype of T (-) B (+) NK (+) lymphocytes; and Prkdcscid mutations characterized by the phenotype of T (-) , B (-) lymphocytes.Thus, in some embodiments, the genetically modified immunodeficient rodent has one or more selected deficiencies, including IL2 receptor chain deficiency (IL2ry / -), Jak3 deficiency, ADA deficiency, IL7R deficiency, CD3 deficiency, RAG1 and / or RAG2 deficiency, Artemis deficiency, CD45 deficiency, and Prkdc deficiency. These and other animal models of immunodeficiency will be known to those skilled in the art, any of which may be used to generate the immunodeficient animals of this disclosure. In some embodiments, genetically modified rodents according to the invention are used as recipients of human hematopoietic cells, capable of developing human immune cells from grafted human hematopoietic cells.Thus, in some aspects of the invention, the genetically modified animal subject is a genetically modified immunodeficient rodent that has been grafted with human hematopoietic cells. Humanized non-human animal grafts SIRP-IL-15 As discussed above, in some aspects of the invention, the rodent, for example, a humanized SIRP-IL-15 mouse, for example, an hSIRP hIL-15 Rag2- / -IL2rY / - mouse, or a sublethally irradiated hSIRP hIL-15 mouse, is grafted, or transplanted, with cells. The cells may be mitotic or post-mitotic cells and include cells of interest such as pluripotent stem cells, for example, ME cells, MPi cells, and embryonic germ cells; and somatic cells, for example, fibroblasts, hematopoietic cells, neurons, muscle cells, bone cells, vascular endothelial cells, intestinal cells, and the like, and their lineage-restricted progenitors and precursors.Cell populations of particular interest include those comprising hematopoietic stem cells or progenitor cells, which will contribute to or reconstitute the humanized SIRP-IL-15 rodent hematopoietic system, e.g., peripheral blood leukocytes, fetal liver cells, fetal bone, fetal thymus, fetal lymph nodes, vascularized skin, arterial segments, and purified hematopoietic stem cells, e.g., mobilized MHC or umbilical cord blood MHC. Any source of human hematopoietic cells, human hematopoietic stem cells (HSCs), and / or hematopoietic progenitor stem cells (HPSCs) as known in the art or described herein may be transplanted into the genetically modified immunodeficient rodents of this disclosure. One suitable source of human hematopoietic cells known in the art is human umbilical cord blood cells, particularly CD34-positive (CD34+) cells. Another source of human hematopoietic cells is human fetal liver. Another source is human bone marrow. Also included are induced pluripotent stem cells (iPSCs) and induced hematopoietic stem cells (iHSCs) produced by the dedifferentiation of somatic cells, for example, by methods well known in the art. The cells may be from any mammalian species, for example, murine, rodent, canine, feline, equine, bovine, ovine, primate, human, etc. The cells may be from established cell lines or they may be primary cells, where "primary cells," "primary cell lines," and "primary cultures" are used interchangeably herein to refer to cells and cell cultures derived from a subject and allowed to grow in vitro for a limited number of passages, i.e., divisions, of the culture. For example, primary cultures are cultures that may have been passed 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, or 15 times, but do not undergo the crisis stage sufficiently often. Typically, the primary cell lines of the present invention are maintained for fewer than 10 in vitro passages. If the cells are primary cells, they can be collected from an individual by any convenient method. For example, blood cells, such as leukocytes, can be collected by apheresis, leukocytapheresis, density gradient separation, etc. As another example, cells from skin, muscle, bone marrow, spleen, liver, pancreas, lung, intestine, stomach tissue, etc., can be collected by biopsy. An appropriate solution can be used for dispersing or suspending the collected cells. Such a solution will generally be a balanced salt solution, such as normal brine, PBS, Hank's balanced salt solution, etc., conveniently supplemented with fetal calf serum or other naturally occurring factors, along with an acceptable buffer at a low concentration, generally 5 to 25 mM. Suitable buffers include HEPES, phosphate buffers, lactate buffers, etc. In some cases, a heterogeneous cell population will be transplanted into the humanized rodent, for example, a mouse. In other cases, a cell population enriched for a particular cell type, for example, a hematopoietic progenitor cell, will be grafted into the humanized rodent, for example, a mouse. Enrichment of a cell population of interest can be achieved using any convenient separation technique. For example, cells of interest can be enriched using culture methods. In such culture methods, specific growth factors and nutrients are typically added to a culture that promote the survival and / or proliferation of one cell population over others. Other culture conditions that affect survival and / or proliferation include growth on adherent or non-adherent substrates, culture for specific time periods, and so on.These culture conditions are well known in the field. As another example, cells of interest can be enriched by separating them from the initial population using affinity separation techniques. Affinity separation techniques may include magnetic separation using magnetic beads coated with an affinity reagent, affinity chromatography, screening with an affinity reagent bound to a solid matrix (e.g., a plate), cytotoxic agents bound to or used in conjunction with an affinity reagent (e.g., complement or cytotoxins), or other suitable techniques. Techniques that provide accurate separation include fluorescence-activated cell sorters, which can have varying degrees of sophistication, such as multiple color channels, low- and obtuse-angle light scattering detection channels, independent channels, and so on.Cells can be selected against dead cells by using dyes associated with dead cells (e.g., propidium iodide). Any technique that is not unduly detrimental to the viability of the cells of interest may be used. For example, using affinity sorting techniques, cells that are not the target cells for transplantation can be depleted from the population by exposing the population to affinity reagents that specifically recognize and selectively bind markers not expressed on the target cells. For instance, to enrich a hematopoietic progenitor cell population, cells expressing markers of mature hematopoietic cells could be depleted. Alternatively, positive selection and separation can be achieved by exposing the population to affinity reagents that specifically recognize and selectively bind markers associated with hematopoietic progenitor cells, such as CD34, CD133, etc. "Selective binding" means that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules.For example, an antibody will bind to a molecule that includes an epitope for which it is specific, and not to unrelated epitopes. In some embodiments, the affinity reagent may be an antibody, i.e., an antibody that is specific for CD34, CD133, etc. In other embodiments, the affinity reagent may be a receptor or ligand specific for CD34, CD133, etc., for example, a peptide ligand and receptor; effector molecules and receptors; a T-cell receptor specific for CD34, CD133, etc., and the like. In some embodiments, multiple affinity reagents specific for the marker of interest may be used. The antibodies and T-cell receptors used as affinity reagents can be monoclonal or polyclonal and can be produced by transgenic animals, immunized animals, immortalized human or animal B cells, cells transfected with DNA vectors encoding the antibody or T-cell receptor, and so on. The details of antibody preparation and their suitability for use as specific binding members are well known to experts in the field. Of particular interest is the use of labeled antibodies as affinity reagents. Conveniently, these antibodies are conjugated to a marker for use in the separation.The markers include magnetic beads, which allow for direct separation; biotin, which can be removed with avidin or streptavidin attached to a support; fluorochromes, which can be used with a fluorescence-activated cell sorter; or similar markers, to facilitate separation of the particular cell type. Useful fluorochromes include phycobiliproteins, such as phycoerythrin and allophycocyanins, fluorescein, and Texas red. Often, each antibody is labeled with a different fluorochrome to allow for independent sorting for each marker. The initial cell population is brought into contact with the affinity reagent(s) and incubated for a period of time sufficient to bind the available cell surface antigens. Incubation will generally be at least approximately 5 minutes and usually less than approximately 60 minutes. It is desirable to have a sufficient concentration of antibodies in the reaction mixture so that the efficiency of the separation is not limited by a lack of antibodies. The appropriate concentration is determined by titration, but will typically be a dilution of antibody in the volume of the cell suspension that is approximately 1:50 (i.e., 1 part antibody to 50 parts reaction volume), approximately 1:100, approximately 1:150, approximately 1:200, approximately 1:250, approximately 1:500, approximately 1:1000, approximately 1:2000, or approximately 1:5000.The medium in which the cells will be suspended will be any medium that maintains cell viability. A preferred medium is phosphate-buffered saline containing 0.1 to 0.5% BSA or 1 to 4% goat serum. Various media are commercially available and may be used depending on the nature of the cells, including Dulbecco's Modified Eagle Medium (dMEM), Hank's Balanced Saline Solution (HBSS), Dulbecco's Phosphate-Buffered Saline (dPBS), RPMI, Iscove Medium, PBS with 5 mM EDTA, etc., frequently supplemented with fetal calf serum, BSA, HSA, goat serum, etc. Cells in the contacted population that are labeled with the affinity reagent are selected using any convenient affinity separation technique, for example, as described above or as known in the field. After separation, the separated cells can be collected in any suitable medium that maintains cell viability, which typically has a serum band at the bottom of the collection tube. Various media are commercially available and can be used depending on the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Iscove medium, etc., often supplemented with fetal calf serum. Highly enriched compositions for a cell type of interest, for example, hematopoietic cells, are achieved in this way. The cells will be approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90% or more of the enriched cell composition, and preferably approximately 95% or more of the enriched cell composition. In other words, the composition will be a substantially pure composition of the cells of interest. The cells to be transplanted into rodents, for example, humanized SIRP-IL-15 mice, whether a heterogeneous cell population or an enriched cell population, can be transplanted immediately. Alternatively, the cells can be frozen at liquid nitrogen temperatures and stored for extended periods, thawing and being reused. In such cases, the cells are generally frozen in 10% DMSO, 50% serum, 40% buffered medium, or some other similar solution commonly used in the field to preserve cells at these freezing temperatures, and thawed in the manner commonly known in the field for thawing frozen cultured cells. Additionally, or alternatively, the cells can be cultured in vitro under various culture conditions. The culture medium can be liquid or semi-solid, for example, containing agar, methylcellulose, etc.The cell population can be conveniently suspended in an appropriate nutrient medium, such as Iscove modified DMEM or RPMI-1640, typically supplemented with fetal calf serum (approximately 5 to 10%), L-glutamine, a thiol, particularly 2-mercaptoethanol, and antibiotics, for example, penicillin and streptomycin. The culture may contain growth factors to which the cells are sensitive. Growth factors, as defined herein, are molecules capable of promoting cell survival, growth, and / or differentiation, either in culture or in unaltered tissue, through specific effects on a transmembrane receptor. Growth factors include both polypeptide and non-polypeptide growth factors. Cells can be genetically modified before transplantation into rodents, such as mice, with SIRP-IL-15, for example, to provide a selectable or detectable marker, to induce a genetic defect in the cells (e.g., for disease modeling), to repair a genetic defect, or to ectopically express a gene in the cells (e.g., to determine whether such modifications will affect the course of the disease), etc. Cells can be genetically modified by transfection or transduction with a suitable vector, homologous recombination, or another appropriate technique, to express a gene of interest, or with antisense mRNA, siRNA, or ribozymes to block the expression of an unwanted gene. Various techniques are known for introducing nucleic acids into target cells. Various techniques can be used to demonstrate that the cells have been genetically modified.The genome of cells can be restricted and used with or without amplification. Polymerase chain reaction, gel electrophoresis, restriction analysis, Southern, Northern, and Western blots, sequencing, or similar methods can be employed. General methods in molecular and cellular biochemistry for these and other purposes disclosed in this application can be found in conventional textbooks such as Molecular Cloning: A Laboratory and Manual, 3rd ed. (Sambrook et al., Cold Spring Harbor Laboratory and Press 2001); Short Protocols in Molecular Biology, 4th ed. (Ausubel et al., John Wiley & Sons 1999); "Protein Methods" (Bollag et al., John Wiley & Sons 1996); "Nonviral Vectors for Gene Therapy" (Wagner et al., Academic Press 1999); "Viral Vectors" (Kaplift & Loewy eds., Academic Press 1995) ; "Immunology Methods Manual" (I. Lefkovits ed.Academic Press 1997); and "Cell and Tissue Culture: Laboratory Procedures in Biotechnology" (Doyle & Griffiths, John Wiley & Sons 1998). The reagents, cloning vectors, and genetic manipulation kits referenced in this disclosure are available from commercial suppliers such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and ClonTech. The cells can be transplanted into SIRP-IL-15 humanized rodents, such as mice, using any convenient method, including, for example, intrahepatic injection, caudal vein injection, retro-orbital injection, and similar methods. Typically, approximately 0.5 × 10⁵ to 2 × 10⁶ pluripotent or progenitor cells are transplanted, for example, approximately 1 × 10⁵ to 1 × 10⁶ cells, or approximately 2 × 10⁵ to 5 × 10⁵ cells. In some cases, the rodent, for example, a mouse, is sublethally irradiated before the human cells are transplanted. In other words, the rodent, for example, a mouse, is exposed to a sublethal dose of radiation, as is commonly understood in the field.The humanized SIRP-IL-15 grafted rodents, for example, mice, are kept in animal breeding laboratory conditions for at least 1 week, for example, 1 week or more, or 2 weeks or more, sometimes 4 weeks or more, and in some cases 6 weeks or more, such as 10 weeks or more, or 15 weeks or more, to allow sufficient reconstitution of the immune system with the grafted cells. Rodents, such as humanized SIRP-IL-15 mice and humanized SIRP-IL-15 mice grafted with human hematopoietic cells, such as hSIRP-IL-15 mice grafted with Rag2- / -IL2rY / -, and optionally other genetic modifications, are useful in many applications. For example, these rodents, such as mice, provide a useful system for modeling human immune diseases and human pathogens. For example, rodent subjects, such as mice, are useful for modeling the development and function of human natural killer (NK) cells and / or T lymphocytes.The infection of specific tissues and / or cells by human pathogens, for example, infection by human pathogens of the intestine or lungs, and / or infection by human pathogens or the response of human NK cells and / or T lymphocytes. Such rodents are also used in the in vivo detection of agents that inhibit infection by a pathogen, for example, a pathogen that affects (for example, infects) a specific tissue or cell type, for example, a human pathogen of the intestine or lungs, for example, a human pathogen that activates, induces, and / or targets T lymphocytes and / or NK cells; in the in vivo selection of agents that modulate the development and / or function of human NK cells and / or T lymphocytes, for example, in a healthy or diseased state; in the in vivo selection of agents that are toxic to human NK cells and / or T lymphocytes;in the in vivo selection of agents that prevent, mitigate, or reverse the toxic effects of toxic agents on human NK cells and / or T lymphocytes; in the in vivo selection of candidate vaccines that induce T lymphocytes; and in the in vivo and in vitro selection of agents that inhibit tumor growth and / or infection by activating antibody-dependent cell-mediated cytotoxicity (ADCC) processes mediated by NK cells. This disclosure provides unexpected results demonstrating that humanized SIRP-IL-15 mice grafted with human hematopoietic stem cells, such as hSIRP hIL-15 Rag2- / -IL2rY / - mice, develop tissue-resident lymphocytes, such as intraepithelial lymphocytes, in the intestine and lung. Accordingly, this disclosure provides previously unavailable animal models that allow for the monitoring and testing of such tissue-resident lymphocytes. These animal models are particularly useful for modeling the immune response of tissue-resident lymphocytes, such as T lymphocytes and NK cells, to human pathogens that affect (e.g., infect) the intestine and / or lung, and for selecting therapies and vaccines that target such pathogens and / or induce or enhance a tissue-resident lymphocyte response.Furthermore, the presence of these tissue-resident lymphocytes also allows for the modeling of autoimmune diseases driven by human immune cells that affect the gastrointestinal tract, such as celiac disease and IBD. Accordingly, an in vivo model is also described, which includes a genetically modified non-human animal incorporating a nucleic acid sequence into its genome. This sequence encodes a human SIRP protein and is operatively linked to a SIRP gene promoter. The genetically modified non-human animal also incorporates a nucleic acid sequence into its genome that encodes a human IL-15 protein and is operatively linked to an IL-15 gene promoter.Finally, the genetically modified non-human animal includes a human hematopoietic cell graft, wherein the genetically modified non-human animal (i) expresses the human SIRP protein and the human IL-15 protein, and (ii) includes human tissue-resident lymphocytes, e.g., intraepithelial lymphocytes (IELs), in the intestine of the genetically modified non-human animal. In some such embodiments, the genetically modified non-human animal is infected with a human pathogen, e.g., a human pathogen that affects (e.g., infects) the intestine. Human pathogens that can affect (e.g., infect) the intestine include, but are not limited to, Campylobacter jejuni, Clostridium difficile, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, human rotavirus, Listeria monocytogenes, Norwalk virus, Salmonella enterica, Shigella flexneri, Shigella sonnei, Shigella dysenteriae, Yersinia pestis, Yersinia enterocolitica, and Helicobacter pylori. An in vivo model is also described, which includes a genetically modified non-human animal incorporating a nucleic acid sequence into its genome that encodes a human SIRP protein and is operatively linked to a SIRP gene promoter. The genetically modified non-human animal also incorporates a nucleic acid sequence into its genome that encodes a human IL-15 protein and is operatively linked to an IL-15 gene promoter. Finally, the genetically modified non-human animal includes a human hematopoietic stem cell graft, wherein the genetically modified non-human animal (i) expresses the human SIRP protein and the human IL-15 protein, and (ii) includes human tissue-resident lymphocytes, e.g., intraepithelial lymphocytes (IELs), in the lung of the genetically modified non-human animal.In some of these embodiments, the genetically modified non-human animal is infected by a human pathogen, e.g., a human pathogen that affects (e.g., infects) the lung. Human pathogens that can affect (e.g., infect) the lung include, but are not limited to, Streptococcus pyogenes, Haemophilus influenzae, Corynebacterium diphtheriae, SARS coronavirus, Bordetella pertussis, Moraxella catarrhalis, influenza viruses (A, B, and C), coronavirus, adenovirus, respiratory syncytial virus, parainfluenza virus, mumps virus, Streptococcus pneumoniae, Staphylococcus aureus, Legionella pneumophila, Klebsiella pneumoniae, Pseudomonas aeruginosa, mycoplasma pneumoniae, Mycobacterium tuberculosis, Chlamydia pneumoniae, Blastomyces dermatitidis, Crohn's disease, Pseudomonas neoformans, and Aspergillus fumigatus. New therapies, new vaccines, and new ways to test the efficacy of therapies and vaccines are needed. A non-human animal, such as a mouse, that can successfully engraft human T lymphocytes and NK cells, for example, would be useful for identifying new therapies and vaccines, particularly for a human pathogen that infects human T lymphocytes and / or NK cells.New therapies and new vaccines could be tested in such a non-human animal, e.g., a mouse, by, for example, determining the amount of a human pathogen, e.g., a virus, in the non-human animal (in the blood or in a specified tissue) in response to treatment with a putative antiviral agent, or by inoculating the mouse with a putative vaccine followed by exposure to an infectious administration of a human pathogen, e.g., HIV, and observing any change in infectivity due to inoculation by the putative vaccine compared to a control not inoculated with the vaccine but infected with HIV. Such models of pathogen infection in non-human animals, such as mice, are useful in research, for example, to better understand the progression of a human infection. These mouse models are also useful in drug discovery, for example, to identify candidate agents that protect against or treat an infection. The genetically modified grafted animals described herein are used in the selection of candidate agents to identify those that will treat infections caused by human pathogens, for example, human pathogens that target human T lymphocytes and / or NK cells. The terms "treat," "treatment," "treating," and similar terms are used herein to broadly encompass the attainment of a desired pharmacological and / or physiological effect. The effect may be prophylactic, meaning it completely or partially prevents a disease or a symptom thereof, and / or it may be therapeutic, meaning it partially or completely cures a disease and / or an adverse effect attributable to the disease."Treatment", as used herein, includes any treatment of a mammalian disease and includes: (a) preventing the disease from occurring in a subject who may be predisposed to the disease but has not yet been diagnosed; (b) inhibiting the disease, i.e., stopping its development; or (c) alleviating the disease, i.e., causing the disease to regress. The terms "individual", "subject", "host", and "patient" are used interchangeably in this document and include any mammalian subject for whom diagnosis, treatment or therapy is desired, in particular, human beings. Humanized SIRP-IL-15 non-human animals, such as mice, grafted with human hematopoietic cells provide a useful system for selecting candidate agents for other desired in vivo activities, such as agents that can modulate (i.e., promote or suppress) the development and / or activity of human T lymphocytes and NK cells, for example, in a healthy or diseased state, to identify new therapies and / or develop a better understanding of the molecular basis of immune system development and function; agents that are toxic to T lymphocytes and / or NK cells and their progenitors; and agents that prevent, mitigate, or reverse the toxic effects of toxic agents on T lymphocytes, NK cells, and their progenitors; antibodies or antigen-binding proteins that mediate NK cell-dependent ADCC processes, etc.As yet another example, the genetically modified mice described herein provide a useful system for predicting an individual's responsiveness to a disease therapy, e.g., by providing an in vivo platform for screening an individual's immune system responsiveness to an agent, e.g., a therapeutic agent, to predict an individual's responsiveness to that agent. In screening trials for biologically active agents, humanized SIRP-IL-15 non-human animals, e.g., mice, e.g., hSIRP hIL-15 Rag2- / -IL2rY / - mice, which have been grafted with human hematopoietic cells and, in some cases, infected with human pathogens, or cells to be grafted into a humanized SIRP-IL-15 non-human animal, e.g., a mouse, are brought into contact with a candidate agent of interest and the effect of the candidate agent is evaluated by controlling one or more production parameters.These production parameters can reflect cell viability, for example, the total number of hematopoietic cells or the number of cells of a particular hematopoietic cell type, or the apoptotic state of the cells, for example, the amount of DNA fragmentation, the amount of cellular zeiosis, the amount of phosphatidylserine on the cell surface, and similar factors, using well-established methods. Alternatively or additionally, these production parameters can reflect the differentiation capacity of the cells, for example, the proportions of differentiated cells and differentiated cell types, such as T lymphocytes and / or NK cells.Alternatively or in addition, these production parameters can reflect cell function, for example, the cytokines and chemokines produced by the cells, the ability of the cells to target and extravasate to a site of exposure, the ability of the cells to modulate, i.e., promote or suppress, the activity of other cells in vitro or in vivo, etc. Other production parameters can reflect the extent of pathogen infection in the animal, for example, the pathogen's prevalence in the non-human animal, e.g., mouse, etc. Parameters are quantifiable components of cells, particularly components that can be accurately measured, ideally in a high-throughput system. A parameter can be any cellular component or product, including cell surface determinants, receptors, proteins or their conformational or post-translational modifications, lipids, carbohydrates, organic or inorganic molecules, nucleic acids (e.g., mRNA, DNA), or a portion of such a cellular component or combinations thereof. While most parameters will provide a quantitative reading, in some cases, a semi-quantitative or qualitative result will be acceptable. Readings may include a single, defined value or may include the mean, median, variance, etc.Typically, a range of parameter readings will be obtained for each parameter from multiple identical trials. Variability is expected, and a range of values will be obtained for each set of trial parameters using conventional statistical methods, with a common statistical method used to provide unique values. Candidate agents of interest for screening include known and unknown compounds spanning numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, vaccines, antibiotics or other agents suspected of having antibiotic properties, peptides, polypeptides, antibodies, antigen-binding proteins, agents that have been approved as pharmaceuticals for use in humans, etc. An important aspect of the invention is to evaluate candidate drugs, including toxicity controls; and the like. Candidate agents include organic molecules containing functional groups necessary for structural interactions, particularly hydrogen bonding, and typically include at least one amine, carbonyl, hydroxyl, or carboxyl group, and frequently at least two of these functional groups. Candidate agents often include carbon-based or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the aforementioned functional groups. Candidate agents also include biomolecules such as peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogues, or combinations thereof. Pharmacologically active drugs, genetically active molecules, and other compounds of interest are also included. Compounds of interest include chemotherapeutic agents, hormones, hormone antagonists, and other similar compounds.Examples of pharmaceutical agents suitable for this invention are those described in "The Pharmacological Basis of Therapeutics", Goodman and Gilman, McGraw-Hill, New York, NY, (1996), ninth edition. Also included are toxins and biological and chemical warfare agents, for example, see Somani, SM (Ed.), "Chemical Warfare Agents", Academic Press, New York, 1992). Candidate agents of interest for screening also include nucleic acids, for example, nucleic acids encoding siRNA, hsRNA, antisense molecules, or miRNA, or nucleic acids encoding polypeptides. Many useful vectors are available for transferring nucleic acids to target cells. Vectors can be maintained episomally, for example, as plasmids, minicircle DNA, or vectors derived from viruses such as cytomegalovirus, adenovirus, etc., or they can be integrated into the target cell genome through homologous recombination or random integration, for example, vectors derived from retroviruses such as MMLV, HIV-1, VLA, etc. Vectors can be delivered directly to the target cells. In other words, pluripotent cells are brought into contact with vectors containing the nucleic acid of interest so that the vectors are taken up by the cells. Methods for bringing cells into contact—for example, cultured cells or cells in a non-human animal, such as a mouse—with nucleic acid vectors, such as electroporation, calcium chloride transfection, and hypofection, are well known in the field. Alternatively, the nucleic acid of interest can be delivered to the cells via a virus. In other words, the cells are brought into contact with viral particles containing the nucleic acid of interest. Retroviruses, such as lentiviruses, are particularly suitable for the method of the invention. Commonly used retroviral vectors are "defective," that is, incapable of producing the viral proteins required for a productive infection. Instead, replication of the vector requires growth in a packaged cell line.To generate viral particles containing nucleic acids of interest, retroviral nucleic acids are packaged into viral capsids using a packaging cell strain. Different packaging cell strains provide different envelope proteins to be incorporated into the capsid; these envelope proteins determine the viral particle's cell specificity. Envelope proteins are of at least three types: ecotropic, amphotropic, and xenotropic. Retroviruses packaged with ecotropic envelope protein, such as MMLV, are capable of infecting most types of murine and rat cells and are generated using ecotropic packaging cell strains, such as BOSC23 (Pear et al. (1993) PNAS 90:8392-8396).Retroviruses carrying amphotropic envelope protein, such as 4070A (Danos et al., cited above), are capable of infecting most mammalian cell types, including those of humans, dogs, and mice, and are generated using amphotropic packaging cell lines, such as PA12 (Miller et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6:2895-2902); and GRIP (Danos et al. (1988) PNAS 85:6460-6464). Retroviruses packaged with xenotropic envelope protein, such as AKR env, are capable of infecting most mammalian cell types, except for murine cells. The appropriate packaging cell lineage can be used to ensure that the cells of interest, in some cases the grafted cells, in some examples the host cell, i.e., the humanized SIRP-IL-15, are the target of the packaged viral particles. The vectors used to deliver the nucleic acid of interest to the target cells will typically include promoters suitable for directing the expression, i.e., transcriptional activation, of the nucleic acid of interest. This may include ubiquitous promoters, such as the CMV-β-actin promoter, or inducible promoters, such as promoters that are active in particular cell populations or that respond to the presence of drugs such as tetracycline. Transcriptional activation is intended to increase transcription above basal levels in the target cell by at least approximately 10-fold, at least approximately 100-fold, or more generally, at least approximately 1000-fold.Furthermore, the vectors used to provide reprogramming factors to the subject cells may include genes that must then be removed, for example, by a recombinase system, such as Cre / Lox, or the cells that express them are destroyed, for example, by including genes that allow selective toxicity, such as herpesvirus TK, bcl-xs, etc. Candidate agents of interest for screening also include polypeptides. These polypeptides can optionally be fused to a polypeptide domain that enhances the product's solubility. The domain can be attached to the polypeptide via a defined protease cleavage site, for example, a TEV sequence, which is cleaved by the TEV protease. The linker can also include one or more flexible sequences, for example, 1 to 10 glycine residues. Cleavage of the fusion protein is performed in a buffer that maintains the product's solubility, for example, in the presence of 0.5 to 2 M urea, or in the presence of solubility-enhancing polypeptides and / or polynucleotides. Domains of interest include endosomolytic domains, for example, the influenza HA domain; and other polypeptides that aid in production, for example, the IF2 domain, GST domain, GRPE domain, and similar domains.Additionally, or alternatively, these polypeptides can be formulated for enhanced stability. For example, the peptides can be PEGylated, where the polyethylene xy group provides an extended half-life in the bloodstream. The polypeptide can be fused to another polypeptide to provide additional functionality, for example, to increase in vivo stability. In general, such fusion pairs form a stable plasma protein, which can, for example, extend the in vivo plasma half-life of the polypeptide when present as a fusion, particularly where this stable plasma protein is an immunoglobulin constant domain.In most cases where the stable plasma protein is normally found in a multimeric form, for example, immunoglobulins or lipoproteins, in which the same or different polypeptide chains are typically linked by disulfide bonds and / or non-covalently to form an assembled multichain polypeptide, herein, fusions containing the polypeptide will also be produced and used as a multimer having substantially the same structure as the stable plasma protein precursor. These multimers will be homogeneous with respect to the polypeptide agent they include or may contain more than one polypeptide agent. The candidate polypeptide agent can be produced from eukaryotic cells or from prokaryotic cells. It can be further processed by unfolding, for example, heat denaturation, DTT reduction, etc., and can be refolded using known methods. Modifications of interest that do not alter the primary sequence include chemical derivatization of polypeptides, for example, acylation, acetylation, carboxylation, amidation, etc. Also included are glycosylation modifications, for example, those made by altering the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; for example, by exposing the polypeptide to enzymes that affect glycosylation, such as mammalian glycosylating or deglycosylating enzymes.Also included are sequences containing phosphorylated amino acid residues, such as phosphotyrosine, phosphoserine, or osfothreonine. Polypeptides may have been modified using ordinary molecular biology techniques and synthetic chemistry to improve their resistance to proteolytic degradation, optimize their solubility properties, or make them more suitable as therapeutic agents. Analogues of such polypeptides include those containing residues other than naturally occurring L-amino acids, such as D-amino acids or synthetic amino acids that are not naturally occurring. The D-amino acids may be replaced by some or all of the amino acid residues. The candidate polypeptide agent can be prepared by in vitro synthesis using conventional methods. Various commercial synthetic apparatuses are available, such as automated synthesizers from Applied Biosystems, Inc., Beckman, etc. Using these synthesizers, naturally occurring amino acids can be substituted with non-natural amino acids. The specific sequence and method of preparation will be determined by convenience, cost-effectiveness, required purity, and other factors. Alternatively, the candidate polypeptide agent can be isolated and purified according to conventional recombinant synthesis methods. A lysate can be prepared from the expression host and purified using HPLC, size exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques.Most compositions used will include at least 20% by weight of the desired product, more commonly at least approximately 75% by weight, preferably at least approximately 95% by weight, and, for therapeutic purposes, usually at least approximately 99.5% by weight, relative to contaminants related to the method of product preparation and purification. The percentages will usually be based on total protein. In some cases, the candidate polypeptide agents for screening are antibodies or antigen-binding proteins. The term "antibody" or "antibody fraction" is intended to include any molecular structure containing polypeptide chains with a specific shape that fits and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. The specific or selective fit of a given structure to its specific epitope is sometimes called a "lock and key" fit. The archetypal antibody molecule is immunoglobulin, and all types of immunoglobulins—IgG, IgM, IgA, IgE, IgD, etc.—from all sources, e.g., human, rodent, rabbit, cow, sheep, pig, dog, other mammals, chicken, other birds, etc., are considered "antibodies." The antibodies used in the present invention may be polyclonal antibodies or monoclonal antibodies.Antibodies are typically provided in the media in which cells are cultured. In addition to antibodies, antigen-binding proteins encompass polypeptides that are also designed to bind to an antigen of interest and elicit a response, such as an immune reaction. Known antigen-binding fragments (including, for example, Fab, Fab', F(ab')2, Fabc, and scFv) are also included in the expression "antigen-binding protein." The terms "antibody" and "antigen-binding protein" also encompass one or more immunoglobulin chains or fragments that can be chemically conjugated, or expressed as, fusion proteins with other proteins, single-stranded antibodies, and bispecific antibodies. Candidate agents can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. For example, numerous methods are available for the random and targeted synthesis of a wide variety of organic compounds, including biomolecules, such as the expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds are readily available or easily produced in the form of bacterial, fungal, plant, and animal extracts. Furthermore, natural or synthetically produced libraries and compounds are easily modified by conventional chemical, physical, and biochemical means and can be used to produce combinatorial libraries. Known pharmacological agents can undergo targeted or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc., to produce structural analogues. Candidate agents are screened for biological activity by administering the agent to at least one, and usually multiple, samples, sometimes along with samples lacking the agent. The change in parameters in response to the agent is measured, and the result is evaluated against reference cultures, for example, in the presence and absence of the agent, obtained with other agents, etc. In cases where screening is performed to identify candidate agents that will prevent, mitigate, or reverse the effects of a toxic agent, the screening is generally carried out in the presence of the toxic agent, with the toxic agent added at the most appropriate time for the desired outcomes. For example, when testing the protective / preventive capacity of the candidate agent, the candidate agent may be added before the toxic agent, simultaneously with the candidate agent, or after treatment with the candidate agent.As another example, in cases where the ability of a candidate agent to reverse the effects of a toxic agent is being tested, the candidate agent can be added after treatment with the toxic agent. As mentioned previously, in some cases, the sample is the humanized SIRP-IL-15 non-human animal, for example, a mouse, into which cells have been grafted; that is, a candidate agent is administered to the humanized SIRP-IL-15 non-human animal, for example, a mouse, into which cells have been grafted. In some cases, the sample is the cells to be grafted; that is, the candidate agent is administered to the cells before transplantation. If the candidate agent is to be administered directly to a non-human animal, such as a mouse, the agent may be administered by any of several well-established methods for administering peptides, small molecules, and nucleic acids. For example, the agent may be administered orally, mucosally, otically, intradermally, or by injection, such as intraperitoneal, subcutaneous, intramuscular, intravenous, or intracranial injection, and the like. The agent may be administered in a buffer or incorporated into any of a variety of formulations, for example, by combination with a suitable pharmaceutically acceptable vehicle. "Pharmaceutically acceptable vehicles" may be vehicles approved by a federal or state government regulatory agency or listed in the United States Pharmacopeia or another pharmacopoeia generally recognized for use in mammals, such as humans.The term "vehicle" refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is formulated for administration to a mammal. Such pharmaceutical vehicles may be lipids, for example, liposomes, for example, liposomal dendrimers; liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like, saline solution; gum arabic, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary agents, stabilizers, thickeners, lubricants, and colorants may be used. Pharmaceutical compositions can be formulated in preparations in solid, semi-solid, liquid or gaseous form, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres and aerosols.The agent may be systemic after administration or localized through regional administration, intramural administration, or the use of an implant that retains the active dose at the implantation site. The active agent may be formulated for immediate or sustained release. For some conditions, particularly those affecting the central nervous system, it may be necessary to formulate agents to cross the blood-brain barrier (BBB). One strategy for drug delivery across the BBB involves disruption of the BBB, either osmotically, using mannitol or leukotrienes, or biochemically, using vasoactive substances such as bradykinin. A BBB-disrupting agent may be co-administered with the active agent when the formulations are given by intravascular injection.Other strategies for crossing the blood-brain barrier (BBB) may involve the use of endogenous transport systems, including Caveolin-1-mediated transcytosis, carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p-glycoprotein. Active transport fractions may also be conjugated with the therapeutic compounds for use in the invention to facilitate transport across the blood vessel endothelial wall. Alternatively, drug delivery behind the BBB may be achieved by local release, for example, by intrathecal release, for example, via an Ommaya depot (see, for example, U.S. Patent No. 5,222).982 and 5385582); by bolus injection, for example, by means of a syringe, for example, intravitreal or intracranially; by continuous infusion, for example, by cannulation, for example, with convection (see, for example, U.S. Application No. 20070254842); or by implantation of a device on which the agent has been reversibly fixed (see, for example, U.S. Applications Nos. 20080081064 and 20090196903). If the candidate agent(s) are provided to the cells prior to transplantation, the agents are conveniently added in solution or in readily soluble form to the cell culture medium. The agents can be added in a continuous flow system, either as a stream, intermittent, or continuous flow, or alternatively, by adding a bolus of the compound, individually or incrementally, to an otherwise static solution. In a continuous flow system, two liquids are used: one is a physiologically neutral solution, and the other is the same solution with the test compound added. The first liquid is passed over the cells, followed by the second. In a single-solution method, a bolus of the test compound is added to the volume of medium surrounding the cells.The overall concentrations of the culture medium components should not change significantly with the addition of the bolus, or between the two solutions in a continuous flow method. Multiple assays can be performed in parallel with different concentrations of the agent to obtain a differential response to the various concentrations. As is known in the field, determining the effective concentration of an agent typically uses a range of concentrations resulting from 1:10 dilutions or other logarithmic scales. The concentrations can be further refined with a second series of dilutions, if necessary. Typically, one of these concentrations serves as a negative control, that is, at a concentration of zero or below the detection level of the agent, or at a concentration of the agent equal to or lower than that which does not produce a detectable change in the phenotype. An analysis of the cellular response in a non-human animal, such as a mouse, to the candidate agent can be performed at any time after treatment with the agent. For example, cells can be analyzed 1, 2, or 3 days, sometimes 4, 5, or 6 days, sometimes 8, 9, or 10 days, sometimes 14 days, sometimes 21 days, sometimes 28 days, and sometimes 1 month or more after exposure to the candidate agent, such as 2 months, 4 months, 6 months, or more. In some implementations, the analysis includes analysis at multiple time points. The selection of the time point(s) for analysis will be based on the type of analysis being performed, as readily understood by someone skilled in the art. The analysis may include measuring any of the parameters described herein or known in the field to assess cell viability, cell proliferation, cell identity, cell morphology, and cell function, particularly with regard to immune system cells, such as T lymphocytes and / or NK cells. For example, flow cytometry may be used to determine the total number of hematopoietic cells or the number of cells of a particular hematopoietic cell type. Histochemistry or immunohistochemistry may be performed to determine the apoptotic state of cells, for example, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to measure DNA fragmentation or immunohistochemistry to detect annexin V binding to phosphatidylserine on the cell surface.Flow cytometry can also be used to assess the proportions of differentiated cells and differentiated cell types, for example, to determine the ability of hematopoietic cells to differentiate in the presence of the agent. ELISA, Western blots, and Northern blots can be performed to determine the levels of cytokines, chemokines, immunoglobulins, etc., expressed in the grafted humanized SIRP-IL-15 non-human animal, for example, a mouse, to assess the function of the grafted cells. In vivo assays can also be performed to test the function of immune cells, as well as timely assays for diseases or disorders of particular interest, such as diabetes, an autoimmune disease, graft-versus-host disease, AMD, etc. See, for example, Current Protocols in Immunology (Richard Coico, ed. John Wiley & Sons, Inc. 2012) and Immunology Methods Manual (I. Lefkovits, ed., Academic Press 1997) . Thus, for example, a method is described for determining the effect of an agent on a human pathogen, including exposing a humanized SIRP-IL-15 grafted non-human animal, e.g., a mouse, e.g., an hSIRP hIL-15 Rag2- / -IL2rY / - grafted mouse, to an effective amount of a human pathogen, the effective amount of which is the amount of pathogen required to produce an infection in the mouse; enabling the pathogen to infect the mouse; measuring a parameter of the infection over time in the presence of the agent; and comparing that measurement with the measurement of a humanized SIRP-IL-15 grafted non-human animal, e.g., a mouse, not exposed to the agent. The agent is determined to be an antipathogenic agent if it reduces the amount of the agent in the blood or tissue of the non-human animal, e.g., mouse, by at least half after a single administration or two or more administrations of the agent over a selected period of time. As another example, a method is described for determining whether an isolate or strain of a pathogen of interest is drug-resistant, e.g., multidrug-resistant. In these methods, a humanized SIRP-IL-15 grafted non-human animal, e.g., a mouse, e.g., an hSIRP hIL-15 Rag2- / -IL2rY / - grafted mouse, is exposed to an effective amount of a human pathogen isolate or strain of interest, the effective amount of the pathogen being the amount of pathogen needed to produce an infection in the non-human animal, e.g., a mouse; the pathogen is then allowed to infect the non-human animal;A parameter of the infection is measured in the presence of the drug, for example, the value of the isolate or strain of interest in the blood or tissue of the non-human animal, the ability of the isolate or strain of interest to maintain an infection in the non-human animal, or the ability of the isolate or strain of interest to reproduce in the non-human animal at a point in time after administration of the drug;This measurement is compared to the measurement of a grafted humanized SIRP-IL-15 non-human animal, for example, a pathogen-infected mouse not exposed to the agent. Examples of drugs of interest include amoxicillin, ampicillin, cefotaxime, ceftriaxone, ceftazidime, chloramphenicol, ciprofloxacin, cotrimoxazole, ertapenem, imipenem, fluoroquinolones (e.g., ciprofloxacin, gatifloxacin, and ofloxacin), streptomycin, sulfadiazine, sulfamethoxazole, tetracycline, and combinations thereof. In a specific embodiment, administration of the drug or drug combination is at least one week, 10 days, two weeks, three weeks, or four weeks after infection-producing exposure to the isolate or strain of interest. Furthermore, humanized SIRP-IL-15 non-human animals (e.g., mice) and humanized SIRP-IL-15 non-human animals (e.g., mice) grafted with human hematopoietic cells, e.g., hSIRP hIL-15 Rag2- / -IL2rY / - mice, and optionally with other genetic modifications, are useful for studying antibody-dependent cell-mediated cytotoxicity (ADCC) mediated by NK cells (e.g., human NK cells). Such animals are also useful models for testing the ability of therapeutic drug candidates, e.g., antigen-binding proteins or antibodies, designed to target various cells (e.g., tumors or infected cells) or infectious agents, to activate NK cell pathways involved in the destruction of those cells or infectious agents. It is widely known that one of the mechanisms underlying monoclonal antibody therapy is the activation of NK cells through the binding of the NK cell Fc receptor CD16 (Fc gamma receptor IIIA). Attempts have been made to increase the affinity of several known monoclonal antibody candidates (e.g., rituximab) for Fc gamma receptor IIIA to enhance ADCC (e.g., Bowles et al. Blood 2006; 108:2648-2654; Garff-Tavernier et al. Leukemia 2011; 25:202-209). As demonstrated herein, humanized SIRP-IL-15-grafted non-human animals produce human NK cells capable of mediating ADCC; thus, these animals provide a useful in vivo model for studying ADCC mechanisms and screening various therapeutic candidates. Therefore, humanized SIRP-IL-15-endogenated cells and non-human animals, such as human NK cells, isolated from them, can be used in screening methods designed to identify agents that enhance the antibody-dependent cellular cytotoxicity (ADCC) activity of a cell type engrafted in the non-human animal or humanized cells, such as human NK cells. For example, a suitable method might involve administering an agent to a humanized SIRP-IL-15-endogenated non-human animal and determining the agent's effect on the antibody-dependent cellular cytotoxicity (ADCC) activity of a cell type engrafted in vivo in the humanized non-human animal. This effect could result in improved tumor destruction, for example, of a transplanted tumor, such as a human tumor.This effect can result in improved destruction of infected cells, for example, virus-infected cells or bacteria-infected cells. This effect can result in improved destruction of a bacterium, fungus, or parasite. The agent can be an antibody or an antigen-binding protein. The antibody or antigen-binding protein can be designed to target an antigen expressed on a human tumor cell. The antibody or antigen-binding protein can be designed to target an antigen expressed on a virus-infected cell or a bacteria-infected cell. The antibody or antigen-binding protein can be designed to target a bacterial, fungal, or parasitic antigen.An in vitro method is described in which human cells, e.g., human NK cells, are isolated from a non-human SIRP-IL-15 grafted cell and contacted in vitro with an agent, such as an antibody or antigen-binding protein, and a target cell (e.g., a tumor cell) to determine the agent's efficacy in mediating the destruction of the target cell. The effect of the agent on the cytolytic activity of the human cells, e.g., human NK cells, can then be determined. Additional examples of uses for the mice in question are provided elsewhere in this document. Further applications of the genetically modified, grafted mice described in this disclosure will be apparent to those skilled in the art after reading this disclosure. METHODS FOR MAKING THE GENETICALLY MODIFIED NON-HUMAN ANIMALS IN QUESTION Methods for manufacturing the non-human animals that are the subject of this disclosure are described. In the practice of the methods in question, a non-human animal is generated that includes a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human SIRP protein and is operatively linked to a SIRP gene promoter, for example, a non-human endogenous SIRP gene promoter; and a nucleic acid sequence incorporated into the genome of the genetically modified non-human animal, the sequence of which encodes a human IL-15 protein and is operatively linked to an IL-15 gene promoter, for example, a non-human endogenous IL-15 gene promoter. The generation of a non-human animal that includes a nucleic acid sequence encoding a human SIRP protein and is operatively linked to a SIRP promoter and / or a nucleic acid sequence encoding a human IL-15 protein and is operatively linked to an IL-15 gene promoter, can be achieved by any method convenient for making genetically modified animals, e.g., as known in the field or as described herein. For example, a nucleic acid encoding a human SIRP protein or a human IL-15 protein can be incorporated into a recombinant vector in a manner suitable for insertion into the host cell genome and expression of the human protein in a non-human host cell. The recombinant vector includes one or more regulatory sequences operatively linked to the nucleic acid encoding the human protein in a way that allows transcription of the nucleic acid into mRNA and translation of the mRNA into the human protein, as described above. It should be understood that the vector design may depend on factors such as the choice of host cell to be transformed and / or the amount of human protein to be expressed. Next, any of several methods can be used to introduce the human nucleic acid sequence into an animal cell to produce a genetically modified animal that expresses the human gene. Such techniques are well known in the field and include, but are not limited to, pronuclear microinjection, embryonic stem cell transformation, homologous recombination, and gene insertion techniques. Methods for generating genetically modified animals that can be used include, but are not limited to, those described in Sundberg and Ichiki (2006, Genetically Engineered Mice Handbook, CRC Press), Hofker and van Deursen (2002, Genetically Modified Mouse Methods and Protocols, Humana Press), Joyner (2000, Gene Targeting: A Practical Approach, Oxford University Press), Turksen (2002, Embryonic Stem Cells: Methods and Protocols in Methods Mol Biol., Humana Press), Meyer et al. (2010, Proc. Nat. Acad. Sci.USA 107:15022-15026) and Gibson (2004, A Primer of Genome Science 2nd ed. Sunderland, Massachusetts: Sinauer), the US patent. UU. No. 6,586,251, Rathinam et al. (2011, Blood 118:3119-28) , Willinger et al., (2011, Proc Natl Acad Sci USA, 108:2390-2395) , Rongvaux et al. (2003, Nat Biot 21:652–659). For example, the genetically modified animals in question can be created by introducing the nucleic acid encoding the human protein into an oocyte, for example, by microinjection, and allowing the oocyte to develop in a female host animal. The nucleic acid is injected into fertilized oocytes. Fertilized oocytes can be collected from superovulated females the day after mating and injected with the expression construct. The injected oocytes are cultured overnight or transferred directly into the oviducts of pseudopregnant females. The methods for superovulation, oocyte collection, injection of the expression construct, and embryo transfer are known in the field and are described in Manipulating the Mouse Embryo (2002, A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory and Press).The offspring can be evaluated for the presence of the introduced nucleic acid by DNA analysis (e.g., PCR, Southern blotting, DNA sequencing, etc.) or by protein analysis (e.g., ELISA, Western blotting, etc.). As another example, the construct containing the nucleic acid sequence encoding the human protein can be transfected into stem cells (e.g., ME cells or MPi cells) using well-known methods such as electroporation, calcium phosphate precipitation, lipofection, etc. The cells can then be assessed for the presence of the introduced nucleic acid by DNA analysis (e.g., PCR, Southern blotting, DNA sequencing, etc.) or by protein analysis (e.g., ELISA, Western blotting, etc.). Cells determined to have incorporated the expression construct can then be introduced into preimplantation embryos. For a detailed description of known methods in the field relevant to the compositions and methods of the invention, see Nagy et al., (2002, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory and Press).(1990, Development 110:815-821), U.S. Patent No. 7,576,259, U.S. Patent No. 7,659,442, U.S. Patent No. 7,294,754 and Kraus et al. (2010, Genesis 48:394-399). A method for generating a genetically modified animal described herein uses a targeted construct made with VELOCIGENE® technology, by introducing the construct into ME cells and introducing the targeted ME cell clones into a mouse embryo with VELOCIMOUSE® technology, as described in the examples. The initial genetically modified animals can be crossed with additional animals carrying the genetic modification. For example, humanized SIRP nonhuman animals can be crossed with humanized IL-15 nonhuman animals of the same species to produce the hSIRP-hIL-15 nonhuman animals described herein. Genetically modified animals carrying a nucleic acid encoding the human protein(s) of this disclosure can be further crossed with inactivated animals, for example, a nonhuman animal that is deficient in one or more proteins, for example, that does not express one or more of its genes, for example, an animal deficient in Rag2 and / or an animal deficient in IL2r. As discussed above, the genetically modified non-human animal in question is an immunodeficient animal. Genetically modified non-human animals that are immunodeficient and include one or more human proteins, for example, hSIRP and / or hIL-15, can be generated by any method convenient for generating genetically modified animals, for example, as known in the field or as described herein. For example, the generation of the genetically modified immunodeficient animal can be achieved by introducing the nucleic acid encoding the human protein into an oocyte or stem cell that includes an allele of the mutant SCID gene which, when homozygous, will result in immunodeficiency as described in more detail above and in the working examples herein.Next, mice are generated from the modified oocyte or ME cells using, for example, the methods described herein and known in the field, and are bred to produce immunodeficient mice that include the desired genetic modification. As another example, genetically modified non-human animals can be generated in an immunocompetent environment and bred with an animal that includes an allele of the mutant gene which, when hemizygous or homozygous, will result in immunodeficiency. The offspring are then bred to create an immunodeficient animal that expresses at least one human protein of interest. The genetically modified non-human animal is treated to eliminate any endogenous hematopoietic cells that may be present. This treatment includes irradiation of the genetically modified non-human animal.Newborn genetically modified mouse pups are irradiated sublethally. The pups are irradiated with 2 × 200 cGy at a four-hour interval. Various embodiments of the invention provide genetically modified animals that incorporate a human nucleic acid into substantially all of their cells, as well as genetically modified animals that incorporate a human nucleic acid into some, but not all, of their cells. In some cases, for example, in directed recombination, one copy of the human nucleic acid will be integrated into the genome of the genetically modified animals. In other cases, for example, in random integration, multiple copies, adjacent or distant from each other, of the human nucleic acid may be integrated into the genome of the genetically modified animals. Therefore, the genetically modified non-human animal in question may be an immunodeficient animal that includes a genome containing a nucleic acid encoding a human polypeptide operatively linked to the corresponding non-human animal promoter, where the animal expresses the encoded human polypeptide. In other words, the genetically modified non-human immunodeficient animal in question includes a genome containing a nucleic acid encoding at least one human polypeptide, where the nucleic acid is operatively linked to the corresponding non-human promoter and a polyadenylation signal, and where the animal expresses the encoded human polypeptide. REAGENTS, DEVICES AND KITS Reagents, devices, and kits for performing one or more of the methods described above are also described. These reagents, devices, and kits can vary considerably. The reagents or kits will include one or more agents for use in the methods described herein. For example, the kit may include a humanized SIRP-IL-15 non-human animal, e.g., a mouse, e.g., an hSIRP hIL-15 Rag2- / --IL2rY / - mouse. The kit may include reagents for breeding humanized SIRP-IL-15 non-human animals, e.g., mice, e.g., primers, and, in some cases, reagents for genotyping humanized SIRP-IL-15 non-human animals, e.g., mice. The kit may include human hematopoietic cells or an enriched population of human hematopoietic progenitor cells for transplantation into a humanized SIRP-IL-15 non-human animal, for example, a mouse, or reagents to prepare a hematopoietic cell population or an enriched population of hematopoietic cells from a human for transplantation into a humanized SIRP-IL-15 non-human animal, for example, a mouse.Other reagents may include reagents for determining the viability and / or function of hematopoietic cells or differentiated immune cells (e.g., T lymphocytes and / or NK cells), for example, in the presence / absence of the candidate agent, for example, one or more antibodies that are specific for markers expressed by different types of hematopoietic cells or differentiated immune cells (e.g., T lymphocytes and / or NK cells), or reagents for detecting particular cytokines, chemokines, etc. Other reagents may include culture media, culture complements, matrix compositions, or the like. In addition to the components described above, the kits of the invention shall also include instructions for practicing the methods of the invention. These instructions may be present in the kits of the invention in a variety of forms, one or more of which may be included in the kit. One form in which these instructions may be included is as information printed on a suitable medium or substrate, for example, one or more pieces of paper on which the information is printed, on the kit packaging, in a leaflet, etc. Another form would be a computer-readable medium, for example, a floppy disk, CD, etc., on which the information has been recorded. Yet another form that may be included is the address of a website that can be used via the Internet to access the information remotely. Any convenient form may be included in the kits. Examples The following examples are presented to provide those skilled in the art with a complete disclosure and description of how to produce and use the present invention and are not intended to limit the scope of what the inventors consider to be their invention, nor are they intended to represent that the experiments presented below are all or the only experiments carried out. Efforts have been made to ensure accuracy with regard to the numbers used (e.g., quantities, temperature, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise stated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is atmospheric or near atmospheric. Example 1: Generation of humanized SIRP-inserted mice (SRG) A human SIRP-inserted mouse was generated, expressing the extracellular domain of human SIRP operatively linked to the mouse SIRP promoter (see Figure 1). Human SIRP is known to exist in at least 10 allelic forms. In this particular example, human SIRP variant 1 is used to humanize an endogenous mouse SIRP gene. Materials and methods The generation of inserted mice encoding human SIRP in the 129xBalb / c Rag2- / - IL2rY / - (N2) genetic environment was performed using VELOCIGENE® technology as described in further detail below. The mice were maintained under specific pathogen-free conditions and with continuous treatment of enrofloxacin in the drinking water (Baytril; 0.27 mg / ml). A targeted vector was constructed for the humanization of an extracellular region of a SIRP gene (e.g., SIRP) using VELOCIGENE® technology (see, e.g., U.S. Patent No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21 (6):652-659). In summary, the mouse bacterial artificial chromosome (BAC) clone bMQ-261H14 was modified to delete the sequence containing exons 2–4 of an endogenous SIRP gene and to insert exons 2–4 of a human SIRP gene using the human BAC clone CTD-3035H21. The genomic DNA corresponding to exons 2–4 of an endogenous SIRP gene (-8555 bp) was replaced in the BAC clone bMQ-261H14 with a DNA fragment of -8581 bp containing exons 2–4 of a human SIRP gene from the BAC clone CTD-3035H21. Sequence analysis of the human SIRP allele contained in the BAC clone CTD-3035H21 revealed that the allele corresponds to human variant 1. A neomycin cassette flanked by loxP sites was added to the end of the -8581 bp human DNA fragment containing exons 2 to 4 of the human SIRP gene (Figure 1 (below)). Up- and down-strand homology arms were obtained from mouse BAC DNA at the 5' and 3' positions of exons 2 and 4, respectively, and added to the -8581 bp neomycin-human fragment cassette to create the final targeting vector for humanization of an endogenous SIRP gene, containing a 5' to 3' homology arm containing 19 kb of mouse DNA at the 5' end of exon 2 of the endogenous SIRP gene, an -8581 bp DNA fragment containing exons 2 to 4 of a human SIRP gene, a neomycin cassette flanked by loxP sites, and a 3' homology arm containing 21 kb of mouse DNA at the 3' end of exon 4 of an endogenous SIRP gene. Targeted insertion of the targeting vector placed the neomycin cassette in the fifth intron of a mouse SIRP gene between exons 4 and 5.The targeting vector was linearized by SwaI digestion and then used in homologous recombination in bacterial cells to achieve a targeted replacement of exons 2 to 4 in a mouse SIRP gene with exons 2 to 4 of a human SIRP gene (Figure 1 (below)). The BAC target DNA (described above) was used to electroporate Rag2- / - IL2rY / - mouse ME cells to create modified ME cells that include a replacement of exons 2 to 4 in an endogenous mouse SIRP gene with a genomic fragment including exons 2 to 4 of a human SIRP gene. Positive ME cells containing a genomic fragment including exons 2 to 4 of a human SIRP gene were identified by quantitative PCR using TAQMAN™ probes (Lie and Petropoulos, 1998. Curr. Opin. Biotechnology 9:43-48). The nucleotide sequence across the upstream insertion point included the following, indicating the mouse endogenous sequence upstream of the insertion point (contained in parentheses below) contiguously joined to the human SIRP genomic sequence present at the insertion point: (AGCTCTCCTACCACTAGACTGCTGAGACCCGCTGCTCTGCTCAGGACTCG ATTTCCAGTACACAATCTCCCTCTTTGAAAAGTACCACACATCCTGGGGT) GCTCTTGCATTTGTGTGACACTTTGCTAGCCAAGGCTCAGTCCTGGGTTCCA GGTGGGGACTCAAACACACTGGCACGAGTCTACATTGGATATTCTTGGT (SEQ ID NO: 1) . The nucleotide sequence through the downstream insertion point at the 5' end of the neomycin cassette included the following, indicating the human SIRP genomic sequence contiguous to the cassette sequence downstream of the insertion point (contained in parentheses below with the loxP sequence in italics): GCTCCCCATTCCTCACTGGCCCAGCCCCTCTTCCCTACTCTTTCTAGCCCCT GCCTCATCTCCCTGGCTGCCATTGGGAGCCTGCCCCACTGGAAGCCAG (TC GAGATAACTTCGTATAATGTATGCTATACGAAGTTATATGCATGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGC GGGCGCCCCCCTCCTCACGGCGA) (SEQ ID NO: 2) . The nucleotide sequence through the down-chain insertion point at the 3' end of the neomycin cassette included the following, indicating the cassette sequence contiguous to the mouse genomic sequence at 3' of exon 4 of an endogenous SIRP gene (contained in parentheses below): CATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGACCTCGACCTGC AGCCCCTAGATAACTTCGTATAATGTATGCTATACGAAGTTATGCTAGC (T GTCTCATAGGCTGGCGATCTGGCTCAGGGACAGCCAGTACTGCAAAGA GTATCCTTGTTCATACCTTCTCCTAGTGGCCATCTCCCTGGGACAGTCA) (SEQ ID NO: 3). ME-positive cell clones were then used to implant female mice using the VELOCIMOUSE® method (see, for example, U.S. patent no. 7,294,754 and Poueymirou et al., 2007, F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses, Nature Biotech. 25 (1):91-99) to generate a litter of pups containing an insertion of exons 2 to 4 of a human SIRP gene into an endogenous mouse SIRP gene. The targeted EM cells described above were used as donor EM cells and introduced into an 8-cell stage mouse embryo using the VELOCIMOUSE® method (cited above). Mice carrying the humanization of exons 2 to 4 of an endogenous SIRP gene were identified by genotyping using an allele modification assay (Valenzuela et al., cited above) that detected the presence of the human SIRP gene sequences. Mice carrying the humanized SIRP gene construct (i.e., containing exons 2 to 4 of human SIRP in a mouse SIRP gene) can be crossed with a Cre-delete mouse strain (see, for example, International Patent Application No. WO 2009 / 114400) to remove any neomycin cassettes containing Iox introduced by the targeting vector that are not removed, for example, at the ME cell stage or in the embryo. Optionally, the neomycin cassette is retained in the mice. Heterozygotes are bred to obtain homozygous SIRP mice. Results Mice containing a nucleic acid encoding a humanized version of the mouse SIRP gene as described above (SRG mice) exhibit physiological expression of a humanized SIRP protein (data not shown). These mice also exhibit human immune cell engraftment in the spleen, peripheral lymph nodes (GLs), and thymus comparable to that of NOD scid gamma (NSG) mice (data not shown). Example 2: Generation of inserted humanized SRG IL-15h / h (SRG-15) mice The cytokine IL-15 has been shown to be important for the development of mouse NK cells and for the differentiation and maintenance of CD8+ memory T lymphocytes. To study the effects of human IL-15 on the development, differentiation, and maintenance of human immune cells in the context of an animal model, inserted atons for human SIRP containing human IL-15 were generated, as described in more detail below. Figure 2 shows a schematic representation of the inserted IL-15 construct. Materials and methods Mouse ME cells were modified to replace the mouse IL-15 gene sequence with the human IL-15 gene sequence at the mouse endogenous IL-5 locus, under the control of mouse IL-15 regulatory elements, using VELOCIGENE® genetic engineering technology, to produce a humanized locus as shown in Figure 2. Inserted mice comprising human IL-15 in 129xBalb / c Rag2- / - IL2rY / - genetic environments were generated. The untranslated exons at the 5' end of the mouse gene (exons 1 and 2) are not shown upstream (relative to the direction of IL-15 gene transcription) in Figure 2; the coding exon 1 (exon 3) in Figure 2 shows a small untranslated (unfilled) region upstream of the coding exon.Except as noted below for mouse 1, as shown in the humanization at the bottom of Figure 2, mouse coding exons 1 and 2 (exons 3 and 4) were retained, while mouse coding exons 3 to 6 (exons 5 to 8) were replaced with human coding exons 3 to 6 (exons 5 to 8). At the downstream end, the human coding exon 6 (exon 8) is followed by a stop codon and a human 3'-UTR, and further downstream by a human sequence. For selection purposes, a selection cassette (floxed for Cre removal) was included. The humanized locus in Figure 2 expresses a mature IL-15 protein that is fully human. Specifically, bacterial homology recombination (RHB) was performed to construct a large targeting vector (LTVEC) containing human IL-15 gene sequences to target the mouse IL-15 locus using conventional RHB techniques (see, for example, Valenzuela et al. (2003), cited above) and RHB gap repair. Linear fragments were generated by joining PCR-generated homology boxes with cloned cassettes, followed by gel isolation of the joining products and electroporation into RHB-competent bacteria harboring the target bacterial artificial chromosome (BAC). The mouse BAC PRCI23-203P7 was used as the mouse sequence source; the human BAC RP11-103B12 was used as the human IL-15 gene sequence source.After a selection stage, successfully recombined clones were identified by PCR using novel junctions and by restriction analysis. An LTVEC containing homology arms and sequences of the human IL-15 gene was prepared. The mouse IL-15 gene (mouse GenelD: 103014; RefSeq transcript: NM_008357.2; ensembl eID: 16168) was modified using genomic coordinates for deletion GRCM38: cr 8: 82331173-82343471 (negative strand); genomic coordinates for replacement GRCh37: cr 4: 142642924-142655819 (positive strand). 12299 nucleotides of the mouse sequence were replaced by 12896 nucleotides of the human sequence. The replacement of the mouse IL-15 sequence as described above is presented graphically in Figure 2. The LTVEC that included the humanized IL-15 gene had approximately a 13 kb upstream mouse targeting arm flanked upstream by an MluI site, and a 27 kb downstream mouse targeting arm flanked downstream by an AscI site. The LTVEC was linearized with MluI and AscI by electroporation. Following LTVEC construction, the LTVEC nucleotide sequence across the mouse / human 5' junction and the human / mouse 3' junction is shown in Table 1 below. SEQ ID NO: 4 represents the upstream junction (relative to the direction of IL-15 gene transcription) between the mouse and human sequences; the sequence shown begins with the mouse sequence in uppercase, followed by an AsisI restriction site in lowercase, followed by the human IL-15 nucleic acid sequence in uppercase. SEQ ID NO: 5 indicates the human IL-15 coding and non-coding sequence string down in uppercase (3'UTR human bold and italic), followed by a lowercase XhoI site, followed by a lox site (uppercase, italic and bold), followed by the neo selection cassette sequence string down (uppercase), which extends 2.6 kb string down (not shown).SEQ ID NO: 6 is a nucleic acid sequence that represents the junction between the down-string portion of the neo selection cassette (uppercase), with the lox site (uppercase and bold italic), followed by an NheI site (lowercase), which is followed by the down-string mouse sequence of humanization (uppercase); the selection cassette extends 2.6 kb up-string. Table 1: Humanized IL-15 locus binding sequences continuation Mouse ME cells were electroporated with LTVEC constructs, grown in selection medium, and used as donor ME cells to produce humanized IL-15 mice that included a replacement at the endogenous mouse IL-15 locus by the human sequence as depicted in Figure 2. After ME cell electroporation, a native allele loss assay (see, e.g., Valenzuela et al. (2003), cited above) is performed to detect loss of the endogenous IL-15 sequence due to targeting. The correctly targeted ME cells were further electroporated with a Cre-expressing transient vector to remove the Neo drug selection cassette. Using the VELOCIMOUSE® method, donor mouse embryonic stem cells, including a humanized IL-15 locus, were introduced into early-stage mouse embryos (Poueymirou et al. (2007) F0 generation mice fully derived from gene-targeted embryonic stem cells allowing immediate phenotypic analyses, Nat Biotechnol 25:91-99). Heterozygous mice were generated and bred to obtain homozygotes for humanized IL-15. Two versions of humanized IL-15 mice were generated (referred to here as mouse 1 and mouse 2). Further analysis revealed that mouse 1 contained an exon duplication in its genome. In mouse 2, the endogenous mouse IL-15 locus was replaced with the human sequence, as depicted in Figure 2. Human IL-15 mRNA levels were determined as follows. Reverse transcription (RT) qPCR was performed using a Rapid 7500 Real-Time PCR System (Applied Biosystems) and a SYBR® FAST Universal qPCR Kit (KAPA Biosystems). Sequence-specific oligonucleotide primers were designed using Primer3 software and synthesized by Sigma-Aldrich. The following primers were used: Forward mouse Hprt: 5'-AGGGATTTGAATCACGTTTG-3' (SEQ ID NO: 7), Reverse mouse Hprt: 5'-TTTACTGGCAACATCAACAG-3' (SEQ ID NO: 8); Human direct IL15: 5'-GCCCAGGGAAATCAAAAGAT-3' (SEQ ID NO: 9) , human inverse IL15: 5'-TGGCTCCAACAAATCAACAG-3' (SEQ ID NO: 10) . Relative expression values were calculated using the comparative threshold cycling method and normalized to mouse Hprt. SRG-15 mice are generated by (1) breeding mice comprising the human SIRP replacement with mice comprising the human IL-15 replacement, both with the Rag2- / - IL2rY / - environment, or (2) introducing a large targeted vector comprising human IL-15 into an EM cell harboring the human SIRP replacement in the Rag2- / - IL2rY / - environment (described in Example 1) and generating mice from EM cells harboring human IL-15 and SIRP gene replacements, as well as Rag2- / - IL2rY / - using the VELOCIMOUSE® method. Heterozygous mice are bred to homozygosity. Results As illustrated in Figures 3A and 3B, elevated levels of human IL-15 mRNA expression were found in the liver, lung, bone marrow (BM), small intestine (SI), and colon of non-grafted SRG-15 mice. Similarly, elevated levels of human IL-15 mRNA were found in the liver, lung, and small intestine of non-grafted SRG-15 mice (Figure 3B). As shown in Figure 4, following stimulation with poly(I:C), elevated levels of human IL-15 protein were also detected in the serum of SRG-15 mice, where human exons 5 to 8 replace endogenous mouse exons. Example 3: SRG-15 mouse graft Materials and methods SRG and SRG-15 mice are grafted as described below. Newborn mice are sublethally irradiated without anesthesia 3 to 5 days after birth with 160 cGy and returned to their mothers to rest. 4 to 12 hours after irradiation, these neonates are transplanted into 25 µl of PBS via intrahepatic (ih) injection using a 30G needle. Results To assess the impact of human IL-15 on immune cell development, human CD45+ cell engraftment was compared in NSG, SRG, and SRG-15 mice. Effective engraftment of human hematopoietic cells was observed in the blood of NSG, SRG, and SRG-15 mice (mouse 2) 12 to 14 weeks post-engraftment, as shown in Figure 5A. Figure 5B provides a comparison showing engraftment as evidenced by the number of human CD45+ cells in the bone marrow, spleen, lymph nodes, liver, and lung of SRG and SRG-15 mice (mouse 2) 14 weeks post-engraftment. In mouse 1, although the human CD45+ cell graft was unchanged, a higher percentage and number of human NK cells were found in various tissues in SRG-15 mice compared to SRG mice, as illustrated in Figures 6A and 6B. IL-15 is important not only for NK cell development and survival but also for their maturation. As shown in Figure 6C, human NK cells in the liver of SRG-15 mice (mouse 1) had higher expression levels of CD16 and CD56, indicating greater NK cell maturation in SRG-15 mice compared to SRG mice. Both subsets of human NK cells, CD56brightCD16- and CD56darkCD16+, were found to be present in the blood, spleen, and liver of SRG-15 mice, as shown in Figure 6D (spleen) (and data not shown).Furthermore, as shown in Figure 6D, analysis of the two subsets of human NK cells in the spleen of SRG-15 mice (mouse 1) showed that they had distinct expression levels of cytolytic inhibitory receptors, with the dark CD56CD16+ NK cell population including the highest percentage of cells expressing CD158. This is similar to what is found for NK cell subsets in human blood (data not shown). For the SRG-15 mouse, successful engraftment of human NK cells into lymphoid and non-lymphoid tissues was observed, as shown in Figures 7A to 7D. Figures 7A and 7B show the percentage of NK cells in blood and spleen, respectively. Figures 7C and 7D show the frequency of human NK cells in the blood, spleen (B), liver, and lung of SRG and SRG-15 mice (mouse 2) 14 weeks post-engraftment. Figures 8 and 9A, respectively, provide additional data showing the distribution and percentage of NK cells in the blood and spleen of SRG and SRG-15 mice (mouse 2) from different experiments. Figure 9B shows an increase in the hNKp46 fragment of hCD45+ cells in the blood of SRG-15 mice (mouse 2). Figures 9C to 9E show relative numbers, distribution, and composition of hCD45+ cells in the thymus of SRG and SRG-15 mice (mouse 2). NK cell subsets were characterized in humans and SRG-15 mice (mouse 2). As shown in Figures 10A and 10B, increased levels of bright hCD56hCD16- and dark hCD56hCD16+ were observed in the blood and spleen of SRG-15 mice compared to SRG mice. Similar to humans, cytolytic inhibitory receptor (KIR) expression was observed in NK cell subsets in SRG-15 mice (mouse 2) (Figure 10C). Bright CD56hCD16- NK cells (left inset of each graph) and dark CD56hCD16+ NK cells (right inset of each graph) are shown in Figure 10C. The histogram below shows CD158 expression in these subsets. CD158 (KIR2D) in NK cell subsets in SRG-15 mice is similar to what is observed in NK cells derived from human PBMCs. The distribution of human NK cells in the blood of SRG-15 mice was compared with that of blood obtained from two healthy human donors. Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of two individual donors (obtained from BioreclamationIVT, Westbur, NY) on Ficoll-Paque; although a higher percentage of NK cells in the blood of grafted SRG-15 mice than in PBMCs from human donors, a physiologically comparable distribution of cytotoxic NK cells (CD16+) versus IFN-producing NK cells (CD16-) was observed (Figure 11). Finally, an analysis of bone marrow from SRG and SRG-15 (mouse 2) showed greater development of human NK cells in SRG-15 mice compared to SRG mice (Figure 12). The impact of human IL-15 on human T lymphocyte development in SRG-15 mice was also evaluated. A comparison of SRG-15 mice (mouse 1) with SRG mice showed that the effect of human IL-15 on the percentage, number, and / or proportion of T lymphocytes varied depending on the tissue (Figure 13A). The size and number of lymph nodes at week 16 post-graft did not differ between SRG and SRG-15 mice, confirming the results that the number of human T lymphocytes in the lymph nodes of SRG and SRG-15 mice (mouse 1) was similar (Figure 13A). Figure 13B shows a human CD8+ T lymphocyte phenotype in blood and liver of SRG and SRG-15 mice (mouse 1), with an increase in hCD62L- cells in SRG-15 mice (mouse 1) relative to SRG mice for both blood and liver.Figures 14A and 14B provide additional data characterizing T lymphocytes from SRG-15 mice (mouse 1) relative to SRG mice, showing the expression of the tissue-resident marker CD69 in CD8+ T lymphocytes from the lung (14A) and liver (14B) of SRG and SRG-15 mice. The above data provide evidence of an increase in effector tissue-resident T lymphocytes in SRG-15 mice. For mouse 2, the frequency of hCD3+ T lymphocytes in the spleen, lung, and liver relative to SRG mice was assessed 16 weeks post-graft, as shown in Figures 15A and 15B. Example 4: Development of human tissue-resident lymphocytes in SRG-15 mice Because IL-15 has been shown to be produced by epithelial cells in the intestine and lung and may play an important role in the development and survival of human tissue-resident T lymphocytes and NK cells, human tissue-resident T lymphocytes and NK cells were analyzed in SRG and SRG-15 mice. Materials and methods Newborn mice are sublethally irradiated without anesthesia 3 to 5 days after birth with 160 cGy and returned to their mothers to rest. 4 to 12 hours after irradiation, these neonates are transplanted into 25 µl of PBS via intrahepatic (ih) injection using a 30G needle. Results As shown in Figure 17A, isolation of the small intestinal intraepithelial lymphocyte population under steady-state conditions in mouse 1 revealed a higher frequency of human CD45+ cells in SRG-15 mice compared to SRG mice. As illustrated in Figure 17B, immunohistochemical analysis demonstrated that human CD45+ NL cells were localized to the epithelial cell layer of the small intestine in SRG-15 mice (mouse 1) (as indicated by the arrows in Figure 17B), whereas very few intraepithelial lymphocytes were found in SRG mice. Human CD8+ IELs in SRG-15 mice showed high expression of CD69, the typical marker of tissue-resident T lymphocytes. In contrast to human IELs (Sathaliyawala T, Kubota M, Yudanin N et al. Immunity 2013; 38:187-197), only a subpopulation of human CD8+ IELs in SRG-15 mice expressed the tissue-resident marker CD103 (Figure 17C).As shown in Figures 16A and 16B, the phenotype of increased human CD8+ IELs in SRG-15 mice (mouse 1) was specific, as there was little difference in the number of lamina propria cells in the colon during steady state between SRG and SRG-15 mice. In addition to the increased number of human T lymphocytes in the lung of mouse 1 SRG-15, as shown in Figure 13A, higher CD69 expression was also found on human CD8+ T lymphocytes in the lung of SRG-15 mice compared to SRG mice, as shown in Figure 14A. Furthermore, Figure 14B shows a higher level of hCD69-expressing CD8+ T lymphocytes in the liver of mouse 1 SRG-15 compared to SRG mice. Similar to the grafted SRG-15 mouse 1, in the grafted SRG-15 mouse 2, FACS analysis revealed a higher proportion of human CD45+ cells in the IEL fraction of SRG-15 mice compared to SRG mice (Figure 18A). Furthermore, while the number of LLPs did not change significantly between SRG and SRG-15 mice (mouse 2), a significant increase in IELs was observed in SRG-15 mice (mouse 2) relative to SRG mice (Figure 18B). The composition of hCD3+ cells in the small intestine of SRG-15 mice (mouse 2) is provided in Figure 18C and shows a higher proportion of hCD8+ cells relative to hCD4+ cells. Figure 18D shows the phenotypic characteristics of hCD3+ hCD8+ T lymphocytes in the spleen and small intestine of SRG-15 mice (mouse 2).As illustrated in Figure 18E, immunohistochemical analysis showed that human CD8+ IELs were located in the epithelial cell layer of the small intestine of SRG-15 mice (mouse 2) (as indicated by the arrows in Figure 18E), whereas very few intraepithelial lymphocytes were found in SRG mice. As previously noted in relation to Figures 18A and 18B, in the grafted 2 SRG-15 mouse, greater reconstitution of human intraepithelial lymphocytes (IELs) residing in gut-associated lymphoid tissue (GALT) was observed compared to SRG mice (Figures 19A and 19C). Interestingly, the majority of the human lymphocytes observed were human NK cells. As expected for normal human GALT physiology, most NK cells in the 2 SRG-15 mouse in both the blood and spleen were cytotoxic (CD16+) NK cells, whereas in the IELs there was a comparable distribution of CD16+ versus CD16- NK cells (Figure 19B). There were no changes in the number of lamina propria lymphocytes between the grafted SRG and SRG-15 mice (Figure 19C). Unlike the grafted SRG-15 mouse 1, in the grafted SRG-15 mouse 2, a higher proportion of human CD3+ CD8+ IELs expressed the human CD103 marker.Peyer's patches were completely absent in SRG mice but were present in mouse 2 SRG-15 and were populated with human lymphocytes as shown in Figures 20A and 20B. Example 5: Determination of the functional role of human tissue-resident T lymphocytes in SRG-15 mice during viral infections To test whether tissue-resident T lymphocytes in SRG-15 mice have functional relevance during homeostasis, it was determined whether increasing the number of human CD8+ IELs in SRG-15 mice induced characteristic changes in the composition of the mouse gut microbiota. Materials and methods Newborn mice are sublethally irradiated without anesthesia 3 to 5 days after birth with 160 cGy and returned to their mothers to rest. 4 to 12 hours after irradiation, these neonates are transplanted into 25 µl of PBS via intrahepatic (ih) injection using a 30G needle. Four weeks post-graft, SRG-15 mice were housed together for four weeks with Balb / c SRG and donor mice to equalize the gut microbiota between the different strains. The mice were then separated, and fecal samples were collected and analyzed by 16S rRNA sequencing. A timeline for co-housing and fecal sample collection for gut microbiota sequencing is provided in Figure 21A. Results As illustrated in Figure 21B, for mouse 1, the results show no significant changes between grafted SRG-15 and SRG mice after cohabitation, indicating that developing human CD8+ IELs do not induce significant changes under steady-state conditions. Further experiments were conducted to determine whether CD8+ IELs, which are sufficient to clear acute rotavirus infection, can clear rotavirus infection in grafted SRG-15 mice. As shown in Figure 22, the results indicated that acute rotavirus infection can be cleared in grafted SRG-15 mice but not in non-grafted SRG mice. Example 6: Analysis of NK cell subsets in SRG-15 mice (mouse 2) and humans NK cell subsets in SRG-15 mice (mouse 2) were characterized by several phenotypic markers and compared to humans. Materials and methods NK cell subsets were detected by time-of-flight cytometry (CyTOF), as generally described in Yao et al. J. of Immunological Methods 415 (2014) 1-5, and analyzed by ViSNE (el-AD et al. Nat. Biotechnol. June 2013; 31 (6):545-52 doi: 10, 1038 / nbt.2594. Epub 19 May 2013). Results Figure 23A provides ViSNE diagrams showing CyTOF-based analyses of 33 parameters of CD56bright CD16- and CD56dark CD16+ NK cell subsets in humans (n = 20) and SRG-15 mice (mouse 2) (n = 9). Each dot represents a single cell. Figure 23B provides ViSNE diagrams showing the expression intensity of eight selected markers in bright CD56 CD16- NK cells in humans (n = 20) and SRG-15 mice (mouse 2) (n = 9). ViSNE diagrams in Figure 23C show the expression intensity of eight selected markers in dark CD56 CD16+ NK cells in humans (n = 20) and SRG-15 mice (n = 9). This multidimensional single-cell analysis of 33 key human NK cell molecules indicates that human NK cells that develop in SRG-15 mice are highly comparable to human NK cells in healthy individuals. Example 7: Cytotoxic capacity of NK cells from SRG-15 mice Materials and methods For in vitro studies of NK cell cytotoxicity, splenic NK cells isolated from SRG and SRG-15 mice grafted with human HSCs (mouse 2) were treated overnight with human IL-2. The following day, the NK cells were cultured with CFSE-labeled NK-susceptible K562 target cells in varying effector-to-target (E:D) ratios. After 5 h of co-culture, K562 cell destruction was measured by FACS analysis of Topro3 viability dye uptake by K562 cells (controlled in CFSE+ cells to distinguish K562 and then positive percentage analysis for Topro3). In addition, for in vitro studies of antibody-dependent cell-mediated cytotoxicity (ADCC), splenic NK cells isolated from SRG and SRG-15 mice grafted with human HSCs were treated overnight with human IL-2. The following day, the NK cells were cultured with CFSE-labeled target Raji cells in varying effector-to-target (E:D) ratios. The Raji cells were pretreated with anti-CD20 (Rituximab) or control IgG. After 5 h of co-culture, Raji cell destruction was measured by FACS analysis of Topro3 viability dye uptake by Raji cells (controlled in CFSE+ cells and then by percentage analysis positive for Topro3). For in vivo studies of NK cell activation, 50 µg of poly IC was injected intraperitoneally into SRG and SRG-15 mice grafted with human HSCs (mouse 2). The mice were bled before (before poly IC injection) and 18 hours after poly IC injection. Human CD45+ NKp46+ (NK cells) were analyzed by FACS to determine the expression of the activation marker CD69 before and after poly IC administration. Results In a classic NK cytotoxicity study, K562 cells deficient in the classic NK target HLA class I were subjected to destruction by activated NK cells from SRG or SRG-15 mice (mouse 2). As shown in Figure 24C (left), splenic NK cells from SRG and SRG-15 mice showed comparable cytolytic capacity relative to K562 cells when their number was normalized. NK cells are usually responsible for anti-CD20 antibody-mediated ADCC against B-cell leukemias and lymphomas (see, for example, J. Golay et al. Haematologica 2003; 88:1002-12). In order to demonstrate the ability of NK cells from grafted SRG-15 mice to facilitate anti-CD20-mediated ADCC, splenic NK cells from SRG and SRG-15 mice were tested and shown to exhibit antibody-dependent cell toxicity (ADCC) activity comparable to anti-CD20-treated Raji cells when cell numbers were normalized (Figure 24C (right)). As depicted, for example, in Figures 8 and 9, there is a significant increase in NK cells in both the spleen and blood of SRG-15 animals. The activation capacity of NK cells in SRG-15 mice was tested by measuring CD69 activation marker after poly-IC injection. As shown in Figure 24A, the percentage of NK cells positive for the activation marker CD69 was increased in SRG-15 mice compared to SRG mice. Since SRG-15 NK cells were shown to mediate ADCC comparable to SRG NK cells in vitro under standardized conditions, the ability of SRG-15 NK cells to exhibit a more pronounced activated phenotype in vivo, as well as a higher number of NK cells in SRG-15 mice, suggests that SRG-15 mice may be a suitable in vivo model for studying human NK cell ADCC. Example 8: IFN production from NK cells derived from SRG and SRG-15 Materials and methods NK cells were isolated from pooled splenocytes of SRG or SRG-15 mice (3 spleens per pool) using the EasySep Human NK Enrichment Kit (StemCell Technologies; cat. no. 19055). NK cells were also isolated from healthy human PBMCs. NK cells were treated overnight with 10 ng / ml human IL-2. The following day, cells were either stimulated overnight with 10 ng / ml human IL-12p70 or 2 mg / ml poly I:C, or left untreated. The supernatant was collected the next day, and IFN levels were assessed using the Quantikine Human IFN ELISA Kit (R&D systems; cat. no. DIF50). The purity of NK cells was analyzed using FACS, and IFN levels were normalized as picograms (pg) produced by individual NK cells. Statistical analysis was performed using ANOVA. Results As shown in Figure 24B, NK cells derived from SRG and SRG-15 have comparable but lower IFN secretion than NK cells derived from human PBMCs after treatment with IL-12p70. Example 9: Human NK cells inhibit tumor growth in SRG-15 mice The ability of human NK cells to infiltrate human tumor xenografts and inhibit tumor growth was tested in SRG-15 mice (mouse 2). Materials and methods Rituximab was injected intraperitoneally (ip) every two days (starting on day 14 after subcutaneous injection of 5 million Raji cells). Tumor growth was assessed by measuring caliber, and volume was calculated using the following formula: tumor volume = 0.5 × (length × width^2). Data from two independent experiments were pooled. Statistical analysis was performed using the two-tailed Mann-Whitney U test for independent data comparing grafted and untreated SRG-15 mice with grafted and RTX-treated SRG-15 mice (*P < 0.05). The subcutaneous tumor was shredded and digested using collagenase D (1 hour, 37°C). Recovered cells, including tumor and immune cells, were analyzed using an LSRII flow cytometer. Results As shown in Figure 25A, human NK cells in SRG-15 mice inhibit tumor growth after treatment with rituximab (RTX). Figure 25B shows the frequency of human NK cells and T lymphocytes in human tumor xenografts from untreated (n = 5) and RTX-treated (n = 1) SRG-15 mice. Figure 25C shows subsets of human NK cells in the blood and tumor of untreated (n = 2) and RTX-treated (n = 1) SRG-15 mice. Example 10: Additional materials and methods used in relation to the previous examples. Isolation and injection of human CD34+ cells. The isolation and injection of human CD34+ cells was performed according to the methods described, for example, in Rongvaux A., Willinger T., Martinek J. et al. Nat Biotechnol 2014; 32:364-372. Flow cytometry analysis of human cell populations. Flow cytometry analysis of human cell populations was performed as described in Strowig T., Rongvaux A., Rathinam C. et al. Proc Natl Acad Sci USA 2011; 108:13218-13223, and in Rongvaux A., Willinger T., Martinek J. et al. Nat Biotechnol 2014; 32:364-372. Histology. Tissue was fixed overnight in 4% paraformaldehyde, transfected to 70% ethanol, and embedded in paraffin. Quantitative RT-PCR. Quantitative RT-PCR was performed as described in Rongvaux A., Willinger T., Martinek J. et al. Nat Biotechnol 2014; 32:364-372. 16S rRNA sequencing. 16S rRNA sequencing was performed as described in Palm NW, de Zoete MR, Cullen TW et al. Cell 2014; 158:1000-1010. Viral infections. Rotavirus and influenza viruses were obtained and applied in the methods in question. Statistical analysis. Statistical significance was determined using the Prism 6 (GraphPad) software program, using the two-tailed Student's t-test for independent data. The FACS antibodies were obtained from BD Biosciences and BioLegend. ADDITIONAL SEQUENCE INFORMATION LOCUS NM_001040022 4201 bp linear mRNA PRI 15-MAR-2015 DEFINITION Alpha signaling regulatory protein (SIRPA) of Homo sapiens, variant 1 of transcript, mRNA. RECORD NM_001040022 VERSION NM_001040022.1 GI:91105763 SOURCE Homo sapiens (Human being) [SEQ ID NO: 11] [SEQ ID NO: 12] LOCUS NM_001040023 4109 bp linear mRNA PRI 15-MAR-2015 DEFINITION Signal regulatory protein alpha (SIRPA) of Homo sapiens, transcript variant 2, mRNA. RECORD NM_001040023 VERSION NM_001040023.1 GI:91105766 SOURCE Homo sapiens (Human being) [SEQ ID NO: 13] [SEQ ID NO: 12] LOCUS NM_080792 3868 bp linear mRNA PRI 15-MAR-2015 DEFINITION Signal regulatory protein alpha (SIRPA) of Homo sapiens, transcript variant 3, mRNA. RECORD NM_080792 NM_004648 VERSION NM_080792.2 GI:91105786 SOURCE Homo sapiens (Human being) [SEQ ID NO: 14] [SEQ ID NO: 12] LOCUS NM_007547 4031 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) of Mus musculus, transcript variant 1, mRNA. RECORD NM_007547 NM_011208 VERSION NM_007547.4 GI:597084939 SOURCE Mus musculus (House mouse) [SEQ ID NO: 15] [SEQ ID NO: 16] LOCUS NM_001177647 3377 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) of Mus musculus, variant 3 of transcript, mRNA. RECORD NM_001177647 VERSION NM_001177647.2 GI:597436949 SOURCE Mus musculus (House mouse) [SEQ ID NO: 17] [SEQ ID NO: 18] LOCUS NM_001291019 4043 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) of Mus musculus, variant 4 of transcript, mRNA. REGISTRATION NM_001291019 XM_006498985 VERSION NM_001291019.1 GI:597436868 SOURCE Mus musculus (House mouse) [SEQ ID NO: 19] [SEQ ID NO: 20] LOCUS NM_001291020 3845 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) from Mus musculus, variant 5 of transcript, mRNA. REGISTRATION NM_001291020 XM_006498984 VERSION NM_001291020.1 GI:597436945 KEYWORDS RefSeq. SOURCE Mus musculus (House mouse) [SEQ ID NO: 21] [SEQ ID NO: 20] LOCUS NM_001291021 3389 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) of Mus musculus, transcript variant 6, mRNA. REGISTRATION NM_001291021 XM_006498987 VERSION NM_001291021.1 GI:597436920 SOURCE Mus musculus (House mouse) [SEQ ID NO: 22] [SEQ ID NO: 23] LOCUS NM_001291022 3020 bp linear mRNA ROD 15-FEB-2015 DEFINITION Alpha signaling regulatory protein (Sirpa) of Mus musculus, transcript variant 7, mRNA. RECORD NM_001291022 VERSION NM_001291022.1 GI:597436963 SOURCE Mus musculus (House mouse) [SEQ ID NO: 24] [SEQ ID NO: 25] LOCUS NM_009020 3393 bp linear mRNA ROD 15-FEB-2015 DEFINITION Recombination activator gene 2 (Rag2) of Mus musculus, mRNA. RECORD NM_009020 VERSION NM_009020.3 GI:144227233 SOURCE Mus musculus (House mouse) [SEQ ID NO: 26] [SEQ ID NO: 27] LOCUS NM_013563 mRNA of 1612 linear bp ROD 15-FEB-2015 DEFINITION Interleukin 2 receptor of Mus musculus, gamma chain (I12r), mRNA. REGISTRATION NM_013563 VERSION NM_013563.3 GI:118129799 SOURCE Mus musculus (House mouse) [SEQ ID NO: 28] [SEQ ID NO: 29] LOCUS NM_000585 2012 bp linear mRNA PRI 15-MAR-2015 DEFINITION Homo sapiens interleukin 15 (IL15), transcript variant 3, mRNA. REGISTRATION NM_000585 VERSION NM_000585.4 GI:323098327 SOURCE Homo sapiens (Human being) [SEQ ID NO: 30] [SEQ ID NO: 31] LOCUS NM_172175 2333 bp linear mRNA PRI 15-MAR-2015 DEFINITION Homo sapiens interleukin 15 (IL15), transcript variant 2, mRNA. REGISTRATION NM_172175 VERSION NM_172175.2 GI:323098328 SOURCE Homo sapiens (Human being) [SEQ ID NO: 32] [SEQ ID NO: 33] LOCUS NM_008357 1297 bp linear mRNA ROD 15-FEB-2015 DEFINITION Mus musculus interleukin 15 (IL15), transcript variant 1, mRNA. REGISTRATION NM_008357 VERSION NM_008357.2 GI:363000959 SOURCE Mus musculus (House mouse) [SEQ ID NO: 34] [SEQ ID NO: 35] LOCUS NM_001254747 1287 bp linear mRNA ROD 15-FEB-2015 DEFINITION Interleukin 15 (IL15) from Mus musculus, transcript variant 2, mRNA. REGISTRATION NM_001254747 VERSION NM_001254747.1 GI:363000983 SOURCE Mus musculus (House mouse) [SEQ ID NO: 36] [SEQ ID NO: 35]
Claims
1. A genetically modified rodent comprising in its genome: a humanized alpha signaling regulatory protein (SIRP) gene comprising a nucleic acid sequence encoding a humanized alpha signaling regulatory protein (hSIRP) operatively linked to an endogenous rodent SIRP gene promoter at the rodent SIRP gene locus in the genetically modified rodent genome, wherein the humanized SIRP gene comprises a replacement for a portion of an endogenous rodent SIRP coding sequence, wherein the genetically modified rodent expresses the hSIRP protein, and wherein the hSIRP protein comprises a human SIRP extracellular domain, possesses a wild-type human SIRP receptor function, and comprises a signaling domain of an endogenous mouse SIRP protein; and a humanized interleukin-15 (IL-15) gene comprising a nucleic acid sequence encoding a human IL-15 protein (hIL-15),wherein the nucleic acid sequence includes exons 5 to 8 of a human IL-15 gene, wherein the nucleic acid sequence is operatively linked to a promoter of the endogenous rodent IL-15 gene at the rodent IL-15 gene locus in the genetically modified rodent genome, wherein the humanized IL-15 gene comprises a replacement of part or all of an endogenous rodent IL-15 coding sequence, wherein the genetically modified rodent expresses the hIL-15 protein and wherein the hIL-15 protein has the signaling function of wild-type human IL-15; wherein the genetically modified rodent is a mouse or a rat.
2. The genetically modified rodent of claim 1, wherein the humanized SIRP gene comprises exon 1 of the rodent SIRP gene, exons 2, 3, and 4 of a human SIRP gene, and exons 5, 6, 7, and 8 of the rodent SIRP gene.
3. The genetically modified rodent of claim 1 or 2,wherein the genetically modified rodent is homozygous for the humanized SIRP gene.
4. The genetically modified rodent of any one of claims 1 to 3, wherein the humanized IL-15 gene comprises exons 3 and 4 of a rodent IL-15 gene.
5. The genetically modified rodent of any one of claims 1 to 4, wherein the genetically modified rodent is homozygous for the humanized IL-15 gene.
6. The genetically modified rodent of any one of claims 1 to 5, wherein: the humanized SIRP gene comprises a replacement of exons 2, 3, and 4 of the rodent SIRP gene at the endogenous rodent SIRP locus with exons 2, 3, and 4 of the human SIRP gene; The humanized IL-15 gene comprises a replacement of exons 5, 6, 7, and 8 of the rodent IL-15 gene at the endogenous rodent IL-15 locus with exons 5, 6,7 and 8 of the human IL-15 gene; and the genetically modified rodent is homozygous for the humanized SIRP gene.
7. The genetically modified rodent of any one of claims 1 to 6, wherein the genetically modified rodent is immunodeficient.
8. The genetically modified rodent of claim 7, wherein the genetically modified rodent comprises an inactivation of the Rag2 gene.
9. The genetically modified rodent of claim 7, wherein the genetically modified rodent comprises an inactivation of the IL2rg gene.
10. The genetically modified rodent of claim 7, wherein the genetically modified rodent comprises an inactivation of the Rag2 gene and an inactivation of the IL2rg gene.
11. The genetically modified rodent of claim 7, wherein the genetically modified rodent comprises a human hematopoietic stem cell graft.
12. The genetically modified rodent of claim 11,wherein the genetically modified rodent comprises an infection with a human pathogen.
13. The genetically modified rodent of claim 12, wherein the human pathogen is selected from the group consisting of: a human pathogen that activates, induces, and / or targets T lymphocytes; a human pathogen that activates, induces, and / or targets natural killer (NK) lymphocytes; a human pathogen that infects the human intestine; a human rotavirus; a human pathogen that infects the human lung; and an influenza virus.
14. The genetically modified rodent of any one of claims 7 to 11, wherein the genetically modified rodent comprises a transplanted human tumor.
15. The genetically modified rodent of any one of claims 1 to 14, wherein the genetically modified rodent is a mouse.