Isolated polynucleotides and associated uses, pharmaceutical compositions and kits

GB2634820BActive Publication Date: 2026-08-03THE SEC OF STATE FOR DEFENCE IN HER BRITANNIC MAJESTYS GOVERNMENT OF THE UK OF GREAT BRITAIN & NORTHERN IRELAND +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
THE SEC OF STATE FOR DEFENCE IN HER BRITANNIC MAJESTYS GOVERNMENT OF THE UK OF GREAT BRITAIN & NORTHERN IRELAND
Filing Date
2024-09-04
Publication Date
2026-08-03

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000001_0002
    Figure 00000001_0002
Patent Text Reader

Abstract

Isolated polynucleotides of SEQ ID Nos: 2, 3, 4, 5, or 6 for use as a medicament and also for use in the treatment of bacterial infection, in particular melioidosis or glanders. The sequences relate t
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field of the Invention The invention relates to isolated polynucleotides for use as a medicament. The invention also relates to isolated polynucleotides for use in the treatment of bacterial infection, in particular melioidosis or glanders. The invention also relates to associated pharmaceutical compositions and kits. Background to the Invention To fight infection caused by a microorganism such as bacteria, viruses and fungi, a host immune system may harness a number of potent effector mechanisms to help control and eradicate the causative agent of disease. However, such immune systems can be very capable of causing serious damage to the host if activated without restriction. Indeed, many pathogens dysregulate the immune response during disease, either unintentionally or through the action of specific virulence factors. The Gram-negative bacterium Burkholderia pseudomallei is the causative agent of the disease melioidosis and one such pathogen where the balance and timing of a host inflammatory immune response is thought to be critical to protection. Controlling these effector mechanisms, to find the correct balance between potentially protective pro-inflammatory responses that promote pathogen killing versus the risks of immune pathology, is a significant undertaking. Therefore, therapies that modulate and properly direct the immune response are candidates for the development of alternative antimicrobial candidates. DNAzymes are synthetic, single-stranded DNA sequences that contain catalytic activity. Certain DNAzymes are designed to bind to complementary sequences contained within the mRNA of a target protein and cleave the mRNA at predetermined phosphodiester linkages. This action can act to ‘silence’ the target gene with consequential activity depending on the nature of the gene being silenced. DNAzymes of this type have found particular prominence in the anti-cancer field, though therapeutic application has stalled in recent years. DZ13 is a DNAzyme, consisting of two 9-nucleotide sequences either side of a 15-nucleotide sequence catalytic domain (see Table 1 and Table 2) designed to cleave the mRNA of the human protein c-Jun. c-Jun is identified in humans as forming a component of the pro-inflammatory innate immune transcription factor AP-1 and part of a signalling pathway involved in numerous cell activities such as proliferation, apoptosis, survival and tumorigenesis. c-Jun has been shown to be activated (phosphorylated) by multiple extracellular signals including infection. c-Jun can promote the expression of pro-inflammatory cytokines such as TNF-a, IFN-[3 and IL-6, while also promoting expression of anti-inflammatory cytokines such as IL-10, suggesting c-Jun has a pivotal role in determining the balance of immune responses. As c-Jun has long been identified as an oncoprotein, DZ13 has been examined for anti-tumour therapeutic properties in vivo, progressing to Phase I clinical trials in patients with nodular basal cell carcinoma. However, the potential for DZ13 to be ‘repurposed’ to treat microbial infection has been investigated due to c-Jun’s association with inflammatory transcription. In a study by Xie J. et al., DZ13 was shown to modulate a host immune response by disrupting ‘cytokine storm’ induction and viral replication, markedly improving survival in mice models of infection (Xie J. et al. Regulatory roles of c-Jun in H5N1 influenza virus replication and host inflammation. Biochimica et Biophysica Acta 1842 (2014) 2479-2488). In this study, the action of DZ13 was compared to controls including a ‘scrambled’ version of DZ13 (herein termed ScrDZI; see Table 1 and Table 2) with a modified target sequence. For in vivo studies, mice were challenged via the intranasal route with 3 LDso of H5N1 influenza virus. DZ13 was administered via the intranasal route at day 0 and day 2. Results showed that 55% of DZ13-treated mice survived at termination of experiments (14 days post infection), while PBS-treated mice all died by day 9 and 11% of ScrDZI-treated mice survived. Moreover, the level of pro-inflammatory cytokines IL-6, IFN- [3 and TNF-a were significantly reduced in DZ13-treated animals compared with ScrDZI controls. In contrast, IL-10 showed higher expression level in DZ13-treated mice than in other groups. Both sets of results indicate the effectiveness of DZ13, as well as the ineffectiveness of the ScrDZI control. Compound SEQ ID No. Sequence (5’ -> 3’) DZ13 1 CGGGAGGAA ggctagctacaacga GAGGCGTTG-Ti ScrDZI 2 GCGACGTGA ggctagctacaacga GTGGAGGAG-Ti Table 1. Sequences of DZ13 and ScrDZI as disclosed in Xie J. et al. Key: targeting domain in capital letters; catalytic domain in lowercase; scrambled sequences (relative to DZ13) underlined; CpG dinucleotides in bold; Ti represents a 3’-3’ linked inverted thymidine at the 3’ end of each molecule to inhibit degradation by 3’ exonucleases; sequences are all shown with small gaps between the catalytic and targeting domains to aid visualisation. Compound SEQ ID No. DZ13 Catalytic domain DZ13 Targeting domain Inverted thymidine CpGs DZ13 1 3 ScrDZI 2 X 3 Table 2. Characteristics of DZ13 and ScrDZI as disclosed in Xie J. et al. Key: = functional; * = scrambled. In light of the many complications to the ability to treat infection in a host, including i) antimicrobial resistance remaining a significant threat, and ii) the emergence of new infectious diseases placing further pressure on the availability of effective pathogen-targeting medical countermeasures, there is a continued need for identifying therapeutic compounds as effective medical countermeasures against diseasecausing microbial agents, in particular by re-purposing known agents or producing efficacious derivative compounds. Summary of the Invention According to a first aspect, the invention provides an isolated polynucleotide comprising the sequence of at least one of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 5 4, SEQ ID No. 5 or SEQ ID No. 6 for use as a medicament (see Table 1 -5). Compound SEQ ID No. Sequence (5’ -> 3’) ScrDZ2 3 CGGGAGGAA qtcqtqataqqatcq GAGGCGTTG-Ti ScrDZ3 4 GCGACGTGA qtcqtqataqqatcq GTGGAGGAG-Ti ScrDZ4 5 GCGACGTGA qtcqtqataqqatcq GTGGAGGAG-T Table 3. SEQ D Nos 3-5. Key: targeting domain in capital letters; catalytic domain in lowercase; scrambled sequences (relative to DZ13) underlined; CpG dinucleotides in bold; Ti represents a 3’-3’ linked inverted thymidine at the 3’ end of each molecule to io inhibit degradation by 3’ exonucleases; sequences are all shown with small gaps between the catalytic and targeting domains to aid visualisation. Compound SEQ ID No. DZ13or ScrDZI catalytic domain DZ13 targeting domain ScrDZI targeting domain Inverted thymidine CpGs ScrDZ2 ID NO: 3 X X 4 ScrDZ3 ID NO: 4 X X 4 ScrDZ4 ID NO: 5 X X X 4 Table 4: Characteristics of SEQ ID No. 3-5. Key: = functional; * = scrambled. 15 Initial work conducted by the inventors aimed to evaluate the efficacy of DZ13 when delivered post-exposure against B. pseudomallei in a mouse model of infection. A study determined that DZ13 (SEQ ID No. 1) provided a remarkable level of protection against B. pseudomallei. A second DNA molecule (ScrDZI; SEQ ID No. 2), previously described by Xie J. et al. was used as a control, having the same overall structure as DZ13 with an intact catalytic domain, but the 9 bp flanks having been replaced with scrambled DNA sequences. Thus, ScrDZI cannot bind to its target mRNA and should therefore have no immuno-modulatory activity and, accordingly, not provide protection against infection. Surprisingly, ScrDZI also provided excellent protection. For example, while DZ13 significantly improved survival against a lethal intranasal challenge when given 4h and 48h post-exposure, DZ13 was outperformed by ScrDZI, the latter associated with increased survival and significantly decreased in vivo lung bacterial burden. Following this study, three further scrambled controls were iteratively generated: ScrDZ2 (SEQ ID No. 3); ScrDZ3 (SEQ ID No. 4) and ScrDZ4 (SEQ ID No. 5). Each scrambled control removed a feature or features of the original DZ13 sequence that were crucial to DNAzyme activity (see Table 4). Only the sequence length and GC% were preserved between the compounds, as well as integrity of the scrambled sequences. Without being bound by theory, this research indicated that the protection offered by ScrDZ2, ScrDZ3 or ScrDZ4 is independent of the enzymatic activity that was the supposed source of protection. Surprisingly, all 5 compounds provided similar levels of protection against a subsequent 70 colony forming unit (CFU) challenge of B. pseudomallei in a relevant animal model. Even more unexpectedly, ScrDZ3 (SEQ ID No. 4) and ScrDZ4 (SEQ ID No. 5), which displayed the least resemblance to DZ13 across the initial four scrambled controls, actually exhibited the highest levels of bacterial clearance in the lungs of infected animals, with complete clearance in some ScrDZ4-treated mice. In a further study using DZ13 and ScrDZ4, both compounds exhibited similarly significant protection against an acute aerosol challenge. The inventors have further found that secondary structure may be critical in the activity of these scrambled sequences, and especially that a stem-loop structure, found in ScrDZ3, SCRDZ4 andDZ14 is of importance. Indeed it has been shown that the 14-base pair (bp) stem loop alone (‘DZ14 Loop’; SEQ ID No. 6) is sufficient for activity. A 20 bp structure Oligo20-Loop (‘DZ20 Loop’; SEQ ID NO. 7) comprising the 14 base pair stem loop for example is also active. Indeed, this was also shown to be the case for modified stem loops in an Oligo34 Big Loop sequence (‘DZBig Loop’; SEQ ID No. 8) and an Oligo34-Alternative Loop sequence (‘DZAIt Loop’; SEQ ID No. 9) (Table 5). Compound SEQ ID. No. Sequence (5’ -> 3’) DZ14 Loop 6 GCGACGTGAGTCGT DZ20 Loop 7 GCGACGTGAGTCGTGATAGG DZBig Loop 8 GCGCCGTGAGTCGTGATAGGATCGGTGGAGGAGT DZAIt Loop 9 GCGACTATAGTCGTGATAGGATCGGTGGAGGAGT Table 5: Characteristics of SEQ ID No. 6-9. Preferably, the invention provides an isolated polynucleotide comprising the sequence of at least one of SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6 for use as a medicament. Further preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 4 for use as a medicament. Most preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 5 for use as a medicament. Further preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 6 for use as a medicament. Preferably, the invention provides an isolated polynucleotide consisting of the sequence of at least one of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use as a medicament. Preferably, the invention provides an isolated polynucleotide consisting of the sequence of at least one of SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use as a medicament. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 4 for use as a medicament. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 5 for use as a medicament. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 6 for use as a medicament. These studies demonstrated that the therapeutic DNA molecules of the invention were capable of offering significant protection against aerosolised B. pseudomallei. Delaying the therapy significantly reduced protection, establishing the window of opportunity for this therapeutic. According to a second aspect, the invention provides an isolated polynucleotide comprising the sequence of at least one of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, the invention provides an isolated polynucleotide comprising the sequence of at least one of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, the invention provides an isolated polynucleotide comprising the sequence of at least one of SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 4 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 5 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide comprising the sequence of SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, the invention provides an isolated polynucleotide consisting of the sequence of at least one of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, the invention provides an isolated polynucleotide consisting of the sequence of at least one of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, the invention provides an isolated polynucleotide consisting of the sequence of at least one of SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 4 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 5 for use in the treatment of bacterial infection. Further preferably, the invention provides an isolated polynucleotide consisting of the sequence of SEQ ID No. 6 for use in the treatment of bacterial infection. Preferably, an isolated polynucleotide according to the second aspect is for use in the treatment of melioidosis or glanders. According to a third aspect, the invention provides a pharmaceutical composition comprising the isolated polynucleotide of the first aspect or the second aspect in combination with a pharmaceutically acceptable carrier. Examples of a suitable pharmaceutically acceptable carrier would be understood by the skilled person in the art. Furthermore, it is to be understood that the isolated polynucleotide of the first aspect or the second aspect may be provided in a solubilised form in the pharmaceutically acceptable carrier, or in the form of a dried power which can be re-solubilised in the pharmaceutically acceptable carrier, prior to use. The invention according to the first, second or third aspect may be administered by a route(s) as understood by the person skilled in the art, for example the parenteral route (e.g. intramuscular, intravenous, subcutaneous and so on), the oral route, or the intranasal route. According to a fourth aspect, the invention provides a pharmaceutical kit comprising the isolated polynucleotide of the first aspect or the second aspect, or the pharmaceutical composition of the third aspect. Any feature in one aspect of the invention may be applied to any other aspects of the invention, in any appropriate combination. In particular, isolated polynucleotide for medical use aspects may be applied to pharmaceutical composition aspects or pharmaceutical kit aspects and vice versa. The invention extends to an isolated polynucleotide for medical use, pharmaceutical composition or pharmaceutical kit substantially as herein described, with reference to the Examples. In all aspects, the invention may comprise, consist essentially of, or consist of any feature or combination of features. The present invention will now be described, with reference to the following nonlimiting examples and Figures in which: Brief Description of the Figures Figure 1 shows graphs demonstrating B. pseudomallei colonisation of lungs (panel A), liver (panel B) and spleen (panel C) on day 3 post-challenge via the intranasal route for Study 1; Figure 2 shows a graph of survival in mice treated with DZ13 or control substances for Study 1; Figure 3 shows a graph of B. pseudomallei colonisation of lungs (panel A), liver (panel B) and spleen (panel C) on day 3 post-challenge via the intranasal route for Study 2; Figure 4 shows a graph of survival in mice treated with DZ13 or control substances for Study 2; and Figure 5 shows a graph of survival in mice treated with DZ13 or control substances for Study 3. Detailed Description 5 Methods Preparation of media All culture media was prepared in house. Dulbecco’s phosphate buffered saline (PBS) io was purchased ready-made from Gibco (RTM). Animal care and welfare Investigations involving animals were carried out according to the requirements of the UK Animal (Scientific Procedures) Act 1986. The project licence was approved 15 following an ethical review by Dstl’s (RTM) Animal Welfare and Ethical Review Body. lo Studies were performed using female BALB / cAnNCrl mice (BALB / c; Charles River UK) implanted with a sub-cutaneous Pico transponder (Uno BV, Netherlands) to allow i— individual mice to be tracked through the study. Mice were 6-8 weeks of age at the start of procedures. rSzo For infection with B. pseudomallei, mice were housed in an ACDP containment level 3 animal facility within a rigid-wall half-suit isolator (Howorth Air Technology, UK) supplied with an inward flow of HEPA-filtered air giving 35 to 45 air changes per hour. The room was supplied with double HEPA-filtered air giving 20 to 25 air changes per 25 hour in the room. On arrival into containment level 3 animal facilities, mice were acclimatised to their new surroundings for five days before any procedures were performed. After challenge, mice were checked at least twice daily and clinical signs for each mouse recorded. Humane end-points were used throughout these studies to minimise suffering. 30 Intranasal challenge with B. pseudomallei (Study 1 and Study 2) To prepare challenge material, B. pseudomallei K96243 was inoculated from a frozen glycerol stock into 100 ml LB-broth and incubated for 24 hours at 37 °C with orbital shaking (180 rpm). The OD590 was adjusted to 0.4 (corresponding to approximately 2 x 108 CFU / ml) and diluted to give a count of approximately 2 x 103 CFU / ml in the challenge solution using five sequential dilutions of 1 ml into 9 ml PBS. For counts, the OD590 0.4 solution was sequentially diluted 1 ml into 9 ml PBS, spread as 0.25 ml aliquots onto LB agar, and incubated at 37 °C for >24 hours. For challenges, mice were placed into a glass bell jar containing a small volume of isofluorane until they were lightly anaesthetised (immediately after the mouse tipped onto its side). The mice were then removed from the bell jar and 0.05 ml of the challenge solution was pipetted into the nostrils, split evenly between the two nares. Once the challenge was fully inhaled, the mouse was placed back into its cage and monitored until consciousness was recovered and the mouse was moving freely. Aerosol challenge with B. pseudomallei (Study 3) To prepare challenge material, B. pseudomallei K96243 was inoculated from a frozen glycerol stock onto the surface of a plate of LB agar to obtain single colonies. After incubation at 37 °C for 24 hours, growth was scraped from multiple colonies on the plate into LB broth and adjusted to an OD590 of 0.36 (corresponding to approximately 1 x 108 CFU / ml). A 1 ml aliquot of this solution was inoculated into 100 ml LB broth and incubated for 24 hours at 37 °C with orbital shaking (180 rpm). The OD590 was adjusted to 0.4, diluted 1 ml into 9 ml PBS and then 3 ml into 12 ml PBS to yield the spray fluid. For counts, the OD590 0.36 solution was sequentially diluted 1 ml into 9 ml PBS, spread as 0.25 ml aliquots onto LB agar, and incubated at 37 °C for >24 hours. The aerosol system was controlled by an AeroMP platform (Biaera Technologies LLC) set to run at a negative pressure compared to the air outside of the system. Airflows within the system were directed manually using a Saunders valve after the Piccolo tube. The system was run at ambient temperature (19 °C to 20 °C) and 61-71 % relative humidity (RH). For challenges, mice were restrained in rodent exposure tubes (model CHT247, CH Technologies). These were inserted into a 20-port exposure sow such that the end of the exposure tube and the mouse’s nose extended into the central airflow within the exposure sow. Exposure was thus nose only. Vegetative B. pseudomallei bacteria were aerosolised from 15 ml of spray fluid by a 3-jet Collison nebulizer (CH Technologies, NJ) operating at 7 L / min producing an aerosol with a particle size of 1 -3 pm. The bacteria-laden air from the Collison was mixed with dilution air within the piccolo tube to obtain the final conditioned air at a total flow of 30 L / min. Exposures were for 10 minutes. This was followed by a 2-minute purge where the Collison containing the spray fluid was switched off and a Collison filled with water was switched on. This removed residual aerosolised bacteria from the system before mice were removed from the exposure tubes and returned to their home cages. Samples for bacterial enumeration were taken from a sampling port halfway down the exposure sow starting 4 minutes and 30 seconds into the exposure and sampling for 1 minute. These samples were taken by impingement using all glass impingers at 12 L / min (AGI30, Ace Glass model 7540) filled with 10 ml of PBS. For counts, the impinger samples were sequentially diluted 1 ml into 9 ml PBS, spread as 0.25 ml aliquots onto LB agar, and incubated at 37 °C for >24 hours. Where bacterial counts were taken from impinger samples, an equation was used to transform this value into CFU / L of air: air concentration in CFU / L = (impinger concentration in CFU / ml * liquid volume in ml) I (air flow in L / min * sample time in minutes). Challenges were determined by multiplying the airborne concentration of bacteria by an average mouse breathing rate (0.02 LI min) and then by the duration of challenge (e.g. 10 minutes). It was assumed that 40 % of the inhaled dose was retained in the body. Post-cull organ processing At scheduled culls and with mice culled at the end of the study, the lungs, liver and spleen were aseptically removed from each mouse and weighed. These were then homogenised into 2 ml PBS through a 0.2 pm sieve using the plunger of a 5 ml plastic syringe. These organ homogenates were sequentially diluted using 0.1 ml into 0.9 ml PBS, plated as 0.25 ml aliquots onto LB agar, and incubated at 37 °C for >24 hours. 5 Following incubation, colonies on each plate where the count was in the range of 20-300 were counted, and these counts were used to back-calculate the concentration per ml of bacteria in the organ homogenate. The concentration of bacteria per ml was multiplied by the total volume of the organ homogenate to determine total bacterial load in that organ. The total volume of the organ homogenate was taken to be the 2 io ml of PBS plus the volume contributed by the organ itself. Organ volume was calculated using the organ weight and density, where the density of the tissues of the lungs (without air), liver and spleen were assumed to be similar to the density of the human organs at 1.06 g / cm3 as taken from the No. 46 Report of the International Commission on Radiation Units and Measurements. Where appropriate, count per 15 organ were transformed into counts per mg of organ. CXI Therapeutic regimes i— The sequences of the DNA molecules used in this study can be found in Table 1 and Table 3. Mice treated with DZ13 or scrambled sequences received 2.5 mg / kg ¢^20 DNAzyme at 4 and 48 hours after infection in a 0.05 ml volume via the intra-nasal route under light anaesthesia (see above for details about intra-nasal dosing). DZ13 and scrambled DZ13 controls were prepared as solutions containing 1 mg / ml DNAzyme in PBS with 5% Fugene 6 (Promega (RTM)) and 1mM MgCL. In brief, DZ13 and scrambled DZ13 controls were synthesised as single stranded DNA, 25 purified by high-performance liquid chromatography followed by sodium salt exchange (Integrated DNA Technologies (RTM), Coralville, Iowa USA) and delivered as a dried pellet. For use, the DNAzymes were made up to 10 mg / ml in PBS. In Study 1, for each cage receiving DNAzyme therapy, 30 pl of 10 mg / ml DNAzyme solution was combined with 15 pl Fugene 6, 30 pl of 10 mM MgCL and 225 pl of PBS 30 at room temperature. In Study 2 and Study 3, for each cage receiving therapy, 30 pl of 10 mg / ml DNA solution was combined with 15 pl Fugene 6, 12 pl of 25 mM MgCl2 and 243 pl of PBS at room temperature. Control mice received the same solution but with the DNAzyme replaced with an equal volume of PBS. Data handling and statistical analysis Except where indicated, Microsoft Excel 2016 was used to handle and manipulate data, perform basic calculations and create tables. The program GraphPad Prism v8 was used to draw the graphs in this report and perform statistical tests. Results Study 1 Study design An intra-nasal challenge model in BALB / c mice was chosen to evaluate DZ13 as a treatment for melioidosis. In the inventor’s hands, using B. pseudomallei strain K96243 as the challenge agent, the LDso is around 25 CFU with mortality between days 4 and 10 depending on the exact challenge dose (unpublished). For this study, a challenge dose of 100 CFU was targeted. For Study 1, control treatments included vehicle only and the sequence-scrambled molecule ScrDZI, which retains catalytic activity but lacks regions to target c-Jun. These alterations aimed to demonstrate that any therapeutic activity seen with DZ13 was down to its ability to cleave the c-Jun mRNA. Each treatment group comprised 10 mice to be monitored for survival for just over four weeks after challenge. Alongside the survival part of the study, a scheduled cull was planned for three days after challenge to determine bacterial colonisation of organs one day after the final DNAzyme was delivered. It was decided to focus on those groups receiving DNAzyme treatment in the absence of antibiotic. Thus, additional groups of five mice were treated with DZ13 alone, ScrDZI alone or vehicle alone and culled three days after challenge with lungs, liver and spleen removed for bacteriological assessment. Additionally, a single group of four mice (intended to be five mice but with one mouse not being delivered) was challenged but otherwise received no treatment prior to being culled on day 3 post-challenge. This group would act as the baseline level of infection against which the other treatments could be evaluated. Challenge data The challenge solution was prepared as described above (Intranasal challenge with B. pseudomallei). Samples were plated for counts from the OD5900.4 solution, giving a concentration of 2.51 x 108 CFU / ml. This gave a calculated challenge of 125 CFU per mouse. Given the range in the plate counts (50 to 77 CFU) and assuming a similar range present in the 0.05 ml drawn up for the challenges, a range of 100 to 154 CFU might be expected in the individual challenge doses. Dav 3 cull data Mice were culled three days after infection and the lungs, liver and spleen were removed for bacteriological assessment. The data has been summarised in Figure 1 (data showing B. pseudomallei colonisation of lungs (panel A), liver (panel B) and spleen (panel C) on day 3 post-challenge. Each point represents the count from an individual mouse. The Lower Limit of Quantification (LLoQ) and Limit of Detection (LoD) were determined for each organ assuming 30 or 1 colonies visible on the neat plate and using the average organ weight for these mice (0.18, 0.94 and 0.11 g for lungs, liver, spleen respectively). A hollow circle indicates no colonies were detected for that sample. In the untreated control animals, infection at this cull point was along expected lines. High levels of bacteria (>106 CFU) were present at the site of infection in the lungs, and moderate levels of bacteria (102 - 104 CFU) were evident in both the liver and spleen. The range of counts in these organs, particularly in the spleen, suggest infection of these organs was not well established but actively underway at the time of sampling. As expected, mice treated with vehicle displayed similar levels of bacteria to untreated mice. In contrast, mice treated with DZ13 had significantly lower bacterial counts in all three organs than the untreated and vehicle-treated mice. Unexpectedly, the control mice treated with the sequence-scrambled ScrDZI also had significantly reduced counts in all organs compared to both the untreated and vehicle-treated mice. Survival and clinical signs data Groups of 10 mice were monitored for 31 days after infection, with clinical signs and body weight recorded. At the end of the study, selected survivors were culled and the lungs and spleen removed for bacteriological assessment of the site of infection (lungs) and an organ peripheral to the site of infection (spleen). There was considerable contamination present in the lungs, which made it impossible to determine whether B. pseudomallei was present or absent in those samples. Figure 2 shows the survival in mice treated with DZ13 or control substances. The arrows indicate the DNAzyme treatments at 4 and 48 hours post-infection. Table 6 summarises the infection status of the mice surviving until the end of the study. Mice were considered to have signs of disease where they displayed sustained clinical signs and I or had sustained weight loss of more than 10 % of initial body weight. Bacteriology positive I negative status of mice without signs of disease was based on the presence of bacteria in the spleen. Note that lung bacteriology samples could not be properly assessed given the level of contamination present. No sign of disease Treatment Survivors Signs of disease Bacteriology positive Bacteriology negative DZ13 5 4 1 - ScrDZI 9 5 1 3 Vehicle 0 - - - Table 6: Infection status of mice in Study 1 The control mice treated with vehicle only succumbed to disease by day 11 postinfection, with a median survival of 5.65 days (Figure 2). These mice displayed substantial weight loss and escalating clinical signs beginning on day 2 post-infection. This was in line with the expectations of the model. The survival curve of the mice treated with DZ13 was significantly different to that of the mice treated with vehicle (p<0.0001 using a Log-rank (Mantel-Cox) test) with 50 % of the mice treated with DZ13 surviving to the end of the study (Figure 2). Of the survivors, all but one displayed clinical signs of disease I weight loss indicative of an ongoing relapse that would presumably lead to mortality at some point. The sole mouse without clinical signs had B. pseudomallei present in the spleen, suggesting a relapse was likely at some point. Surprisingly, survival in the control mice treated with the sequence-scrambled ScrDZI molecule was higher than even the mice treated with DZ13. The survival curve of these mice was significantly different to that of the vehicle-treated mice (p<0.0001 using a Log-rank (Mantel-Cox) test) and 90 % of the mice survived to the end of the study. Five of the nine survivors had clinical signs of disease indicative of an ongoing relapse, and one had bacteria in the spleen suggesting a relapse would occur at some point. The remaining three mice had no detectable bacteria in the spleen. Discussion Treatment with DZ13 alone significantly reduced B. pseudomallei colonisation of key organs early in the infection and allowed 50 % of mice to survive to day 31 postinfection. Perhaps the most surprising result was the protection offered by ScrDZI. This molecule has had its targeting sequences scrambled, so it cannot bind to c-Jun mRNA. However, in this study treatment with ScrDZI led to significant reduction in B. pseudomallei colonisation of key organs early in the infection and allowed 90 % of mice to survive to day 31 post-infection i.e. on par with the protection offered by 7 days of antibiotic therapy. It can be said that the active component is not the other components of the treatment i.e. the Fugene 6 transfection reagent or MgCL, since mice treated with vehicle only succumbed to disease. Minimum inhibitory concentration assays indicate there is no inherent antibacterial activity in DZ13 or ScrDZI (unpublished), suggesting that immuno-modulation is still the most likely mechanism through which these molecules impart protection. Study 2 Study design An intranasal challenge model in BALB / c mice was chosen to evaluate DZ13 as a treatment for melioidosis as per Study 1. For this study, a challenge dose of 100 CFU was targeted. A panel of DNA sequences where the active features of DZ13 were inactivated in order was designed. As can be seen in Table 1-4, this resulted in four molecules with the catalytic domain and targeting domains fully active (in DZ13), fully inactive (in ScrDZ3) or with one active and one inactive domain (in ScrDZI and ScrDZ2). Note that ScrDZI was the same scrambled DZ13 from Xie et al. A fifth sequence, ScrDZ4, was designed to understand the role of the inverted thymidine present in the other four sequences. The inverted thymidine protects against exonuclease degradation, but adds significant cost to the synthesis. In ScrDZ4, the 3-3 linked inverted thymidine was replaced with a standard 5-3 linked thymidine. This molecule otherwise has the same sequence as ScrDZ3, so contains no active features from DZ13. The sequence of the inactivated catalytic domain was generated manually using a selected nucleotide sequence but ensuring the GC content and overall size remained the same as the active catalytic domain. Alongside these five treatments, vehicle only was used as a control treatment. Each treatment group comprised 10 mice to be monitored for survival for just over five weeks after challenge. Alongside the survival part of the study, a scheduled cull was planned for three days after challenge to determine bacterial colonisation of organs one day after the final DNAzyme was delivered. Thus, additional groups of five mice were treated with each therapy and culled three days after challenge with lungs, liver and spleen removed for bacteriological assessment. Challenge data The challenge solution was prepared as described above. Samples were plated for counts from the OD5900.4 solution, giving a concentration of 1.41 x 108 CFU / ml. This gave a calculated challenge of 70.5 CFU per mouse. Given the range in the plate counts (25 to 59 CFU) and assuming a similar range present in the 0.05 ml drawn up for the challenges, a range of 50 to 118 CFU might be expected in the individual challenge doses. Day 3 cull data Mice were culled three days after infection and the lungs, liver and spleen were removed for bacteriological assessment. The data has been summarised in Figure 3, showing B. pseudomallei colonisation of lungs (panel A), liver (panel B) and spleen (panel C) on day 3 post-challenge. Each point represents the count from an individual mouse. The LLoQ and LoD were determined for each organ assuming 30 or 1 colonies visible on the neat plate and using the average organ weight for these mice (0.21,0.89 and 0.12 g for lungs, liver, spleen respectively). A hollow circle indicates no colonies were detected for that sample. In the control animals treated with vehicle only, infection at this cull point was along expected lines. High levels of bacteria (>105 CFU) were present at the site of infection in the lungs, and moderate levels of bacteria (102 - 105 CFU) were evident in both the liver and spleen. As observed in the previous study, mice treated with DZ13 (targeting +, catalytic +) and ScrDZI (targeting -, catalytic +) had significantly lower bacterial numbers in the lungs and liver than the mice treated with vehicle only. Interestingly, mice treated with ScrDZ2 (targeting +, catalytic -) also had significantly lower bacterial numbers in the lungs and liver, with counts very similar to mice treated with DZ13 and ScrDZI. Surprisingly, ScrDZ3 and ScrDZ4 (targeting -, catalytic -) not only had counts that were significantly lower than mice treated with vehicle, but their counts were lower even than those mice treated with DZ13, ScrDZI or ScrDZ2. Survival and clinical signs data Groups of 10 mice were monitored for 37 days after infection, with clinical signs and body weight recorded. At the end of the study, selected survivors were culled and the lungs and spleen removed for bacteriological assessment of the site of infection (lungs) and an organ peripheral to the site of infection (spleen). Figure 4 shows the survival of mice treated with various DNA molecules. The arrows indicate the DNAzyme treatments at 4 and 48 hours post-infection. Table 7 summarises the infection status of the mice surviving until the end of the study. Mice were considered to have signs of disease where they displayed sustained clinical signs and I or had sustained weight loss of more than 10 % of initial body weight and I or had high levels of bacteria in their organs at the end of the study. Mice with no signs of infection displayed no sustained clinical signs or weight loss and had very limited or no bacteria present in lungs and spleen at the end of the study. Of the control mice treated with vehicle only, nine of ten succumbed to disease by day 16 post-challenge (Figure 4), with a median survival of 9.65 days. These mice displayed substantial weight loss and escalating clinical signs beginning on day 2 postinfection. The sole surviving mouse displayed overt clinical signs of disease, including weight loss, and was heavily colonised by B. pseudomallei at the end of the study. This was in line with the expectations of the model given the slightly lower than desired challenged dose. In contrast, mice treated with any of the DNA molecules had survival curves that were significantly different to that of the control mice treated with vehicle only (DZ13 p=0.0011, ScrDZI p=0.0001, ScrDZ2 p=0.0001, ScrDZ3 p=0.0039, ScrDZ4 using a Log rank (Mantel-Cox) test), with between 60-80% of mice surviving to the end of the study. Many of these surviving mice displayed overt clinical signs of disease through the study, including substantial weight loss. It is assumed that this indicates a treatment failure and ongoing relapse to disease, which would probably have been fatal at some point. As would be expected, these mice had considerable numbers of bacteria present in the spleen and lungs at the end of the study. Interestingly, not all mice displayed signs of disease in this study (beyond some minor weight loss in the first couple of days after infection), and these mice had limited or no bacteria colonising lungs and spleen at the end of the study. These mice can be considered to represent a full treatment success. Survived Treatment Died / culled Signs of disease No signs of infection Limited bacteria No bacteria Vehicle 9 1 - - DZ13 3 5 - 2 ScrDZI 2 7 - 1 ScrDZ2 2 5 3 - ScrDZ3 4 2 2 2 ScrDZ4 3 - 2 5 Table 7: Infection status of mice in Study 2 Discussion As in Study 1, treatment of mice with DZ13 and the scrambled control molecule ScrDZI offered excellent protection against a lethal infection with B. pseudomallei. There was a clear reduction in bacterial counts in organs shortly after the end of treatment and high levels of survival to the end of the study. Then, as now, the majority of surviving mice had not cleared the bacteria and were showing clear signs of ongoing disease that in these mice would likely be fatal at some point. Recapitulating the results from the first study, but with freshly manufactured DNA used to prepare fresh doses of treatment, this fully validates the unexpected protection offered by the sequence-scrambled ScrDZI and excludes experimental artefact or error as a possible cause of that result. The protection offered by ScrDZ2 (catalytic -, targeting +) was virtually indistinguishable from that offered by DZ13 and ScrDZI. Whilst this demonstrates that protection is not because of immuno-modulation through cleavage of the c-Jun mRNA (leaving aside the highly improbable scenario where the scrambled sequence used to replace the catalytic domain also has nuclease activity), this molecule does have the ability to bind to c-Jun mRNA. It is therefore possible for ScrDZ2 to act to silence c-Jun simply by binding to its mRNA (as opposed to binding and cleaving the mRNA). The protection offered by ScrDZ3 and ScrDZ4 would tend towards eliminating this as a possibility. These molecules have scrambled targeting and catalytic domains, so should not be able to bind to c-Jun mRNA or to cleave it. Indeed ScrDZ4 is a 33 bp length of DNA lacking even a 3-3 linked inverted thymidine to protect against nuclease degradation. So clearly, there is another mechanism at play to explain the protection afforded by these DNA molecules. The lack of inherent antimicrobial activity in DZ13 and ScrDZI would suggest that immuno-modulation is still the most likely mechanism through which these molecules impart protection. Whilst DZ13, ScrDZI and ScrDZ2 offer protection that is virtually indistinguishable from each other (particularly looking at the day 3 cull counts), the protection offered by ScrDZ3 and ScrDZ4 is different and better than that offered by DZ13, ScrDZI and ScrDZ2. These two molecules have the same sequence, only varying in that ScrDZ3 has an inverted thymidine at the 3’ end of the molecule whilst ScrDZ4 has a regular thymidine. Aside from immediately reducing the cost of producing these treatments by a significant margin through the lack of requirement for a 3-3 linked inverted thymidine, this suggests that the sequence of the DNA is important for determining level of protection. Study 3 Study design Studies 1 and 2 made use of an intranasal model of infection. This model is well established for B. pseudomallei as a route of infection delivered to the airways that simulates an aerosol infection without the need for undertaking more technically demanding aerosol exposures. Prior to undertaking further studies, it was decided to perform a small study to confirm that protection could be observed when using a true aerosol challenge. Additionally, the inventors sought to understand whether it was possible to delay treatment and achieve the same therapeutic efficacy. This was felt to be particularly necessary to examine any possible interactions between challenge and therapy given both were delivered via the intranasal route in fairly short order, as well as better modelling situations where the exposure event is not detected and treatment is thus delayed. For Study 3, a challenge dose of around 100 CFU was targeted to examine to protective efficacy of selected DNA molecules against inhalational melioidosis, with treatment at 4 and 48 hours after challenge. DZ13 and ScrDZ4 were chosen as the treatment molecules. Control treatment was vehicle only and PBS only delivered on the same schedule. The second part of the study aimed to examine the impact of delaying the initial treatment to 24 hours after challenge, instead of starting 4 hours after infection. With antibiotics, there is a window of opportunity where delaying treatment has relatively minimal impact. Beyond that window, delaying treatment significantly reduces treatment efficacy. The inventors hoped to determine whether 24 hours is within the window of opportunity for these DNA molecules. Each treatment group comprised 10 mice to be monitored for survival for just over three weeks after challenge. Alongside the survival part of the study, a scheduled cull was planned for three days after challenge to determine bacterial colonisation of organs one day after the final treatment was delivered. Thus, additional groups of five mice were treated with each therapy with the plan being to cull three days after challenge for bacteriological assessment of organs. However, it became apparent shortly after challenge that the actual challenge was higher than targeted with the result that disease was much more acute than desired. Few of the control mice survived to day 3 post-challenge, and rather than perform the scheduled cull which would yield bacteriology data without a non-treated control, it was decided to instead use all of the cages for survival. Thus, the actual n for survival was 15 and no mice were culled at day 3 post-challenge. Challenge data The challenge solution was prepared as described above. There were four sprays, with spray fluid being made twice from separate cultures of B. pseudomallei. Samples were plated for counts from the two OD590 0.36 solutions, giving concentrations of 2.39 x 108 CFU / ml and 2.66 x 108 CFU / ml respectively. Calculated challenge doses for the four sprays were 292, 254, 284 and 262 CFU respectively. These values were approximately 2.5 x the target challenge dose. Survival and clinical data signs Mice were monitored for 21 days after the final treatment dose (23 days after challenge) and clinical signs and weight were monitored. The survival data is summarised in Figure 5. The number in brackets after the treatment indicate the timing of treatment. The control mice (treated with PBS and vehicle) succumbed to disease rapidly (median survival 2.58 and 3 days respectively), as might be expected with the high challenge dose. In mice where treatment started after 24 hours, clinical signs and weight loss progressed in a similar manner to the control mice and they succumbed to disease rapidly, with survival curves essentially identical to the control mice (median survival of 2.58 days for both treatments). Those mice starting treatment after 4 hours fared better, with clinical signs starting approximately 12 hours later than the control mice and signs progressing less rapidly. Although the majority of these mice succumbed to disease before the end of the study, the mice survived for significantly longer (median survival of 8 and 7 days for the DZ13 and ScrDZ4 treated mice respectively, p <0.0001 using a Log-rank (Mantel-Cox) test). Three of the mice treated with DZ13 and one mouse treated with ScrDZ4 survived to the end of the study. These mice displayed persistent clinical signs and moderate weight loss, suggesting the establishment of chronic disease that would ultimately be fatal. Discussion Firstly, there is a clear benefit to treatment with DZ13 and ScrDZ4 starting at 4 hours after infection. This is particularly pleasing given the high challenge and one might expect higher survival with a less stringent but still lethal challenge. As in previous studies, there is no real difference in survival between the two DNA molecules, confirming that protection is independent of the activity of DZ13 on c-Jun. In terms of the window of opportunity, there was a drop-off in protection where treatment was delayed to 24 hours after infection, relative to treatment starting at 4 hours after infection. Study 4 Investigation of the relevance of secondary structure on activity A further study was undertaken to test whether the activity of the scrambled DZ13 sequences is a universal property of single stranded DNA oligonucleotides. A number of ScrDZ4 variants were created and tested each with their own changes to the original ScrDZ4 sequence, in terms of GC content, length, and secondary structure (see Table 8). Compound SEQ ID. No. Sequence (5’ -> 3’) ScrDZ4 5 GCGACGTGAGTCGTGATAGGATCGGTGGAGGAGT DZ14 Loop 6 GCGACGTGAGTCGT DZ20 Loop 7 GCGACGTGAGTCGTGATAGG DZBig Loop 8 GCGCCGTGAGTCGTGATAGGATCGGTGGAGGAGT DZAIt Loop 9 GCGACTATAGTCGTGATAGGATCGGTGGAGGAGT Oligo35-GC 10 GCGGCGTGCGTCGTGATAGGCGCGGTGGAGGAGT Oligo35-AT 11 ATGACGTGAGTCGTTATAATATCGG I I IAIAAGT OligolO 12 GGTGTGGAGT Oligo20A 13 AGTGAGTGGGGGGTGGAAGT Oligo20B 14 AGTGGAGGGTGGGTGGAAGT Table 8: Table of additional ScrDZ4 oligonucleotide names and sequences The first variants changed the AT content of the original DZ4 sequence (SEQ ID No. 5) from 41% (‘Oligo35-GC’) to 29% and 68% (‘Oligo35-AT’). These sequences were unable to reduce CXCL10 production in HtDNA-stimulated THP1 cells in the same manner as ScrDZ4 suggesting that the inhibitory function of the io DZ4 oligonucleotide is not entirely sequence independent. Indeed, the GC-rich ssDNA oligonucleotide was immunostimulatory in the absence of HtDNA rather than being inhibitory. The size of ScrDZ4 was varied by truncating the sequence from 34 bp to 10 bp 15 (‘OligolO’) and 20 bp (‘Oligo20A’; ‘Oligo20B’) respectively, while also keeping the AT / GC content consistent. These sequences also did not display the same behaviour as ScrDZ4 and did not reduce the amount of CXCL10 produced by HtDNA stimulation. The inventors analysed the secondary structures of the oligonucleotide sequences using mfold. This analysis revealed that the ScrDZ4 sequence contains a short (approximately 14bp) stem loop structure that forms between the 2nd and 14th base in the sequence, and that this sequence was not present on the truncated OligolO or Oligo20 sequences. Therefore, another set of sequences was created which changed the predicted secondary structure. DZ14 Loop (SEQ ID No. 6) only contained the 14 bases needed in ScrDZ4 to form a stem loop. DZ20 Loop (SEQ ID No. 7) had the same stem loop as ScrDZ4 but lacking the remaining 14 bases found in ScrDZ4. To further test whether secondary structure was an important factor in ScrDZ4 activity two more sequences were created: DZBig Loop (SEQ ID No. 8) which has the same number of bases as ScrDZ4 but the sequence was changed in such a way that the loop formed was larger than the loop in the ScrDZ4 sequence, whilst retaining a stem loop structure; and DZAIt Loop which contained the same number of bases as ScrDZ4 but the bases in the loop of the stem-loop were altered. When tested in the context of HtDNA stimulation, only sequences with a stem-loop structure (DZ20 Loop, DZ14 Loop, DZBig Loop and DZAIt Loop) displayed the same behaviour as ScrDZ4, whereas a control sequence lacking a stem loop did not reduce CXCL10 production in HtDNA stimulated THP1 cells. The oligonucleotides containing stem loop structures were also able to inhibit CXCL10 production stimulated by poly(l:C) whereas Qligo20 control lacking a stem-loop did not affect CXCL10 production. This suggests that the ssDNA secondary structure and specifically the presence of a short stem-loop structure in the oligonucleotide sequence is important in governing its activity in both HtDNA and poly(l:C) stimulation ofTHPI cells. It will be understood that the present invention has been described above purely by way of example, and modification of detail can be made within the scope of the invention. Each feature disclosed in the description, and (where appropriate) the claims may be provided independently or in any appropriate combination. Moreover, the invention has been described with specific reference to polynucleotides and their medical uses, and an associated pharmaceutical compositions and kits, and more specifically with reference to use against melioidosis (caused by B. 5 pseudomallei) and glanders (caused by B. mallei). Additional applications of the invention will occur to the skilled person. 04 11 25

Claims

1. An isolated polynucleotide comprising the sequence of at least one of, SEQ ID No.3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6 for use as a medicament.

2. An isolated polynucleotide according to Claim 1 comprising the sequence of at 5 least one of SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6.

3. An isolated polynucleotide according to Claim 1 to Claim 2 comprising the sequence of SEQ ID No. 4.

4. An isolated polynucleotide according to Claim 1 to Claim 2 comprising the sequence of SEQ ID No. 5.io 5. An isolated polynucleotide according to Claim 1 to Claim 2 comprising the sequence of SEQ ID No. 6.

6. An isolated polynucleotide according to Claim 1 consisting of the sequence of at least one of SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6.

7. An isolated polynucleotide according to Claim 2 consisting of the sequence of at 15 least one of SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6.

8. An isolated polynucleotide according to Claim 3 consisting of the sequence of SEQ ID No. 4.

9. An isolated polynucleotide according to Claim 4 consisting of the sequence of SEQ ID No. 5.20 10. An isolated polynucleotide according to Claim 5 consisting of the sequence of SEQID No.

611. An isolated polynucleotide according to Claims 1 to 10, for use in the treatment of bacterial infection.25 12. An isolated polynucleotide according to Claims 1 to 11 for use in the treatment ofmelioidosis.

13. A pharmaceutical composition comprising the isolated polynucleotide according to Claim 1 to Claim 12 in combination with a pharmaceutically acceptable carrier.

14. A pharmaceutical kit comprising the isolated polynucleotide according to Claim 1 to Claim 12, or the pharmaceutical composition according to Claim 13.04 11 25