Recombinant collagen and use thereof
A recombinant collagen with defined N-terminal, Gly-Xaa-Yaa, and C-terminal peptide sequences addresses immunogenicity and activity issues, offering enhanced cell interactions and therapeutic benefits for biomedicine and cosmetics.
Patent Information
- Authority / Receiving Office
- HK · HK
- Patent Type
- Applications
- Current Assignee / Owner
- IMEIK TECH DEV CO LTD
- Filing Date
- 2026-05-22
- Publication Date
- 2026-07-10
AI Technical Summary
Existing collagen extraction methods from animal sources result in immunogenicity, poor uniformity, and inferior biological activity, with limited research on the functional potential of N-terminal and C-terminal sequences in recombinant collagen.
A recombinant collagen protein comprising AXBYCZ domains, where A is an N-terminal peptide, B is Gly-Xaa-Yaa, and C is a C-terminal peptide, with specific amino acid sequences and configurations to enhance cell viability, adhesion, migration, anti-inflammatory, and melanin inhibition effects.
The recombinant collagen achieves high cell viability, adhesion, and migration rates, along with anti-inflammatory and melanin inhibition properties, suitable for biomedicine, medical devices, and cosmetics applications.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202411042637.7 (22) Application Date 2024.07.31 (71) Applicant: Aimeike Technology Development Co., Ltd. Address: 22nd Floor, Block C, Shimao Building, No. 92, Jianguo Road, Chaoyang District, Beijing 100022 (72) Inventors: She Chaomin, Chen Xiongwei, Ying Haoyan (74) Patent Agency: Beijing Linke Intellectual Property Agency (Special General Partnership) 11690 Patent Attorneys: Xu Dandan, Zhang Dan (51) Int.Cl. C07K 14 / 78 (2006.01) C12N 15 / 12 (2006.01) C12N 15 / 70 (2006.01) C12N 1 / 21 (2006.01) A23L 33 / 17(2016.01) A61K 8 / 65(2006.01) A61Q 19 / 00(2006.01) A61Q 19 / 02(2006.01) A61P 29 / 00(2006.01) A61K 38 / 39(2006.01) A61K 47 / 42(2017.01) A61P 17 / 00(2006.01) A61L 17 / 10(2006.01) A61L 24 / 10(2006.01) A61L 15 / 32(2006.01) A61L 26 / 00(2006.01) A61L 27 / 24(2006.01) C12R 1 / 19 (2006.01) (54) Invention Title: A Recombinant Collagen and Its Application (57) Abstract: This invention relates to the field of collagen technology, specifically to a recombinant collagen and its application. The recombinant collagen comprises AXBYCZ; wherein X and Z are independently selected from 0 or 1, Y is an integer ≥ 0; and when Y is 0, X and Z are not simultaneously 0; the A domain is an N-terminal peptide of collagen or a peptide segment thereof, the B domain is Gly-Xaa-Yaa, and the C domain is a C-terminal peptide of collagen or a peptide segment thereof; the recombinant collagen can not only maintain high cell viability, cell adhesion rate and cell migration rate, but also has anti-inflammatory effects and the effect of inhibiting melanin production, and can be widely used in the fields of biomedicine, medical devices, cosmetics and bioengineering technology. Claims (2 pages), Description (36 pages), Sequence List (electronic publication), Drawings (5 pages), CN 121449726 A 2026.02.03 CN 1 21 44 97 26 A 1. A recombinant collagen protein, characterized in that the recombinant collagen protein comprises AXBYCZ; wherein X and Z are independently selected from 0 or 1, and Y is an integer ≥ 0;When Y is 0, X and Z are not simultaneously 0; Domain A is an N-terminal telopeptide of collagen or a peptide segment thereof, preferably an N-terminal telopeptide of human type I, II, or III collagen or a peptide segment thereof; Domain B is Gly-Xaa-Yaa; Domain C is a C-terminal telopeptide of collagen or a peptide segment thereof, preferably a C-terminal telopeptide of human type I, II, or III collagen or a peptide segment thereof. 2. The recombinant collagen according to claim 1, characterized in that X, Y, and Z are selected from any one of the following groups: i) x is 0, Y is an integer ≥ 1, Z is 1; ii) x is 1, Y is an integer ≥ 1, Z is 0; iii) x is 1, Y is an integer ≥ 1, Z is 1; iv) x is 1, Y is 0, Z is 1; v) x is 0, Y is an integer ≥ 1, Z is 0; vi) x is 1, Y is 0, Z is 0. 3. The recombinant collagen according to claim 1 or 2, characterized in that the amino acid sequence of the C-domain comprises at least 1 to 25 consecutive amino acids of human type III collagen C-terminal telopeptide, preferably at least 2 to 25 consecutive amino acids, more preferably at least 5 to 25 consecutive amino acids; preferably, the amino acid sequence of the C-domain comprises at least 1 to 25 consecutive amino acids of human type III collagen C-terminal telopeptide starting from the N-terminus, preferably at least 2 to 25 consecutive amino acids starting from the N-terminus, more preferably at least 5 to 25 consecutive amino acids starting from the N-terminus. 4. The recombinant collagen according to claim 1, characterized in that the amino acid sequence of the C-domain is selected from cysteine or SEQ ID NO: 56-58, 65-69. 5. The recombinant collagen according to claim 1, characterized in that the amino acid sequence of the A domain comprises at least 9 to 19 consecutive amino acids of human type III collagen N-terminal telopeptide; preferably, the amino acid sequence of the A domain comprises at least 9 to 19 consecutive amino acids of human type III collagen N-terminal telopeptide starting from the C-terminus. 6. The recombinant collagen according to claim 5, characterized in that the amino acid sequence of the A domain comprises any one of SEQ ID NO: 53-55 and 70-77. 7. The recombinant collagen according to claim 1, characterized in that the amino acid sequence of the B domain includes Gly-Xaa-Yaa of human collagen; the human collagen is preferably one or more of type I, type II, type III, type IV, type V, type VI, type VII, type VIII, type IX, or type X collagen; further, the human collagen is preferably one or more of type I, type II, or type III collagen. 8. The recombinant collagen according to claim 1, characterized in that Y is an integer from 0 to 100, preferably an integer from 3 to 50; preferably, the amino acid sequence of the B domain includes SEQSEQ ID NO: 78-80, one or more. Claims 1 / 2 page 2 CN 121449726 A 9. The recombinant collagen according to any one of claims 1-8, characterized in that the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-26. 10. The recombinant collagen according to claim 9, characterized in that the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-8, 11-18, 20, 22-26. 11. A nucleic acid, characterized in that the nucleic acid comprises a nucleotide sequence encoding the recombinant collagen according to any one of claims 1-10. 12. An expression vector, characterized in that the expression vector comprises the nucleic acid according to claim 11, and / or, the expression vector expresses the recombinant collagen according to any one of claims 1-10; preferably, the backbone vector of the expression vector comprises a prokaryotic vector backbone or a eukaryotic vector backbone. 13. A host cell, characterized in that the host cell comprises the expression vector of claim 12; preferably, the host cell comprises a eukaryotic cell or a prokaryotic cell; more preferably, the eukaryotic cell comprises one or more of yeast (e.g., Pichia pastoris or Saccharomyces cerevisiae), animal cells or plant cells; more preferably, the prokaryotic cell comprises Escherichia coli or Bacillus (e.g., Bacillus subtilis or Bacillus licheniformis). 14. An application of the recombinant collagen of any one of claims 1-10, the nucleic acid of claim 11, the expression vector of claim 12, or the host cell of claim 13, characterized in that the application includes: 1) application in the preparation of a drug for treating a disease; preferably, the disease includes inflammation or a disease for which inhibiting melanin is beneficial for treatment; 2) application in the preparation of medical materials, preferably, the medical materials include one or more of surgical sutures, medical sponges, medical dressings, hemostatic materials, artificial organs, filling materials, biological scaffolds, and drug carriers; 3) application as an active ingredient in cosmetics, a food additive, a health product, or animal feed; the active ingredient in cosmetics preferably includes whitening ingredients or anti-inflammatory ingredients. Claims 2 / 2 pages 3 CN 121449726 A Recombinant Collagen and Its Application Technical Field
[0001] This invention relates to the field of collagen technology, specifically to a recombinant collagen and its application. Background Art
[0002] Collagen (abbreviated as collagen) is the main protein that makes up the structural tissues of the human body, accounting for about 30-40% of the total protein in the human body. It is a major component of human tissues and organs and is also known as the "framework of life". As a medical material, collagen...Proteins have been widely used in the medical and health field for the repair of human skin, bones, cartilage, cardiovascular system, oral cavity and luminal tissues, as well as in cosmetic surgery.
[0003] Currently, collagen is mainly obtained from animal skin, bones and other tissues through acid, alkaline hydrolysis and enzymatic hydrolysis. Although there are various methods for extracting collagen, animal-derived collagen is all type I and has several drawbacks such as immunogenicity, poor uniformity, and the risk of infectious diseases. More importantly, animal-derived collagen is usually obtained through acid, alkali and enzymatic hydrolysis, and its biological activity is far inferior to that of natural human collagen.
[0004] The amino acid sequence of collagen is divided into five parts, including N-terminal propeptide, N-terminal telopeptide, Gly-Xaa-Yaa repeat domain, C-terminal telopeptide, and C-terminal propeptide. Current research on recombinant collagen mainly focuses on the Gly-Xaa-Yaa repeat domain. For example, patent document (CN117229386A) discloses a small molecule collagen C3T1, which has good cell adhesion activity, cell migration-promoting activity, and transdermal penetration rate, and exhibits low cytotoxicity, as well as anti-wrinkle, oil-controlling, and repair functions. However, existing technologies have limited research on the functions of the N-terminal and / or C-terminal sequences connected to the Gly-Xaa-Yaa repeat domain, especially the C-terminal telopeptide and / or N-terminal telopeptide. How to combine the intermediate repeat region with the telopeptide functional region to construct recombinant collagen with low immunogenicity and high activity, and to develop novel recombinant collagen sequences, is a technical problem urgently needing to be solved in this field.
[0005] The present invention provides a recombinant collagen protein comprising AXBYCZ. This recombinant collagen protein not only possesses high cell viability, cell adhesion rate, and cell migration rate, but also exhibits anti-inflammatory effects and melanin inhibition effects, and can be widely applied in the fields of biomedicine, medical devices, cosmetics, and bioengineering technology. Specifically:
[0006] In a first aspect, the present invention provides a recombinant collagen protein comprising AXBYCZ;
[0007] Wherein, domain A is an N-terminal peptide of collagen or a peptide segment thereof, domain B is Gly-Xaa-Yaa, and domain C is a C-terminal peptide of collagen or a peptide segment thereof.
[0008] Wherein, X and Z are independently selected from 0 or 1, and Y is an integer ≥ 0;
[0009] When X and Z are both 0, Y is not 0;
[0010] Preferably, when Y is 0, X and Z are not both 0.
[0011] More preferably, the recombinant collagen includes AXBYCZ, where z = 1, and x and Y are both integers ≥ 0.
[0012] In a specific embodiment of the present invention, X, Y, and Z are selected from any one of the following groups:
[0013] i) x is 0, Y is an integer ≥ 1, and Z is 1;
[0014] ii) x is 1, Y is an integer ≥ 1, and Z is 0; (Note)Page 1 / 36, CN 121449726 A
[0015] iii) x is 1, Y is an integer ≥ 1, Z is 1;
[0016] iv) x is 1, Y is 0, Z is 1;
[0017] v) x is 0, Y is an integer ≥ 1, Z is 0;
[0018] vi) x is 1, Y is 0, Z is 0.
[0019] In a preferred embodiment of the present invention, X, Y, and Z are selected from any group of i), iii), and iv).
[0020] The C-domain is selected from one or more of the C-terminal telopeptides or peptide segments of human type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, type VI collagen, type VII collagen, type VIII collagen, type IX collagen, or type X collagen.
[0021] In one specific embodiment of the present invention, the C domain is one or more of the C-terminal peptides or peptide segments of human type I collagen, type II collagen, or type III collagen.
[0022] Preferably, the C domain is the C-terminal peptide of human type III collagen or a peptide segment thereof.
[0023] Preferably, the human type III collagen C-terminal telopeptide or its peptide segment comprises at least 1 to 25 consecutive amino acids, at least 2 to 25 consecutive amino acids, for example at least 5 to 25 consecutive amino acids, at least 5 to at least 21 consecutive amino acids, at least 5 to at least 17 consecutive amino acids, at least 5 to at least 13 consecutive amino acids, at least 5 to at least 9 consecutive amino acids, at least 9 to 25 consecutive amino acids, at least 9 to at least 21 consecutive amino acids, at least 9 to at least 17 consecutive amino acids, at least 9 to at least 13 consecutive amino acids, at least 13 to at least 21 consecutive amino acids, at least 13 to at least 25 consecutive amino acids, at least 13 to at least 17 consecutive amino acids, at least 17 to at least 21 consecutive amino acids, at least 17 to at least 25 consecutive amino acids, at least 21 to 25 consecutive amino acids; human type III Type III collagen C-terminal telopeptide or its peptide segment, for example, comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive amino acids from the N-terminus of human type III collagen.
[0024] Preferably, the human type III collagen C-terminal telopeptide or its peptide segment comprises at least 1 to 25 consecutive amino acids, at least 2 to 25 consecutive amino acids from the N-terminus of human type III collagen, for example, at least 5 to 25 consecutive amino acids from the N-terminus, at least 5 to at least 21 consecutive amino acids from the N-terminus, at least 5 to at least 17 consecutive amino acids from the N-terminus, at least 5 to at least 13 consecutive amino acids from the N-terminus, at least 5 to at least 9 consecutive amino acids from the N-terminus, and so on.The following are examples of amino acids: at least 9 to 25 consecutive amino acids from the N-terminus; at least 9 to 21 consecutive amino acids from the N-terminus; at least 9 to 17 consecutive amino acids from the N-terminus; at least 9 to 13 consecutive amino acids from the N-terminus; at least 13 to 21 consecutive amino acids from the N-terminus; at least 13 to 25 consecutive amino acids from the N-terminus; at least 13 to 17 consecutive amino acids from the N-terminus; at least 17 to 21 consecutive amino acids from the N-terminus; at least 17 to 25 consecutive amino acids from the N-terminus; at least 21 to 25 consecutive amino acids from the N-terminus; human type III collagen C-terminal telopeptide or its peptide segments, for example, containing human type III collagen C-terminal telopeptide starting from the N-terminus with amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. 23, 24, or 25 consecutive amino acids.
[0025] In one specific embodiment of the present invention, the amino acid sequence of the C domain includes cysteine or any one of SEQ ID NO: 56-58, 65-69.
[0026] Preferably, the amino acid sequence of the C domain includes any one of SEQ ID NO: 58, 66-69.
[0027] The A domain is selected from one or more of the N-terminal telopeptides or peptide segments of human type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, type VI collagen, type VII collagen, type VIII collagen, type IX collagen, or type X collagen.
[0028] In one specific embodiment of the present invention, the A domain is one or more of the N-terminal telopeptides or peptide segments of human type I collagen, type II collagen, or type III collagen. Instruction manual, page 2 / 36, CN 121449726 A
[0029] Preferably, the A domain is the N-terminal peptide of human type III collagen or a peptide segment thereof.
[0030] Preferably, the human type III collagen N-terminal peptide or its peptide segment comprises at least 9 to 19 consecutive amino acids, such as at least 10 to 19 consecutive amino acids, at least 11 to 19 consecutive amino acids, at least 12 to 19 consecutive amino acids, at least 13 to 19 consecutive amino acids, at least 14 to 19 consecutive amino acids, at least 15 to 19 consecutive amino acids, at least 16 to 19 consecutive amino acids, at least 17 to 19 consecutive amino acids, at least 18 to 19 consecutive amino acids, at least 13 to at least 18 consecutive amino acids, at least 13 to at least 17 consecutive amino acids, at least 14 to at least 17 consecutive amino acids, at least 13 to at least 15 consecutive amino acids, and the human type III collagen N-terminal peptide...The peptide or peptide segment thereof, for example, comprises 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive amino acids from the N-terminus of human type III collagen.
[0031] Preferably, the human type III collagen N-terminus peptide or peptide segment thereof comprises at least 9 to 19 consecutive amino acids from the C-terminus of the human type III collagen N-terminus peptide, for example, at least 10 to 19 consecutive amino acids from the C-terminus, at least 11 to 19 consecutive amino acids from the C-terminus, at least 12 to 19 consecutive amino acids from the C-terminus, at least 13 to 19 consecutive amino acids from the C-terminus, at least 14 to 19 consecutive amino acids from the C-terminus, at least 15 to 19 consecutive amino acids from the C-terminus, at least 16 to 19 consecutive amino acids from the C-terminus, at least 17 to 19 consecutive amino acids from the C-terminus, at least 18 to 19 consecutive amino acids from the C-terminus. A continuous amino acid, at least 13 to at least 18 consecutive amino acids from the C-terminus, at least 13 to at least 17 consecutive amino acids from the C-terminus, at least 14 to at least 17 consecutive amino acids from the C-terminus, at least 13 to at least 15 consecutive amino acids from the C-terminus, and human type III collagen N-terminal telopeptide or its peptide segments, for example, comprising 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive amino acids from the C-terminus of human type III collagen N-terminal telopeptide.
[0032] In one specific embodiment of the invention, the amino acid sequence of the A domain includes any one of SEQ ID NO: 53-55, 70-77.
[0033] Preferably, the amino acid sequence of the A domain includes any one of SEQ ID NO: 55, 72-77.
[0034] Preferably, Xaa and Yaa in the B domain may be the same or different.
[0035] Preferably, Xaa and Yaa can be any amino acid (see non-patent literature: consensus on characterization and quality evaluation technology of medical collagen products. Chinese Pharmacy, 2019, 33(11):1223-1234.), for example, Xaa or Yaa can be independently selected from Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val, or Hyp.
[0036] Preferably, Xaa is selected from Glu, Lys, Ala, Pro, Leu, or Asp.
[0037] Preferably, Yaa is selected from Pro, Asn, Lys, Arg, Ala, Val, Glu, or Asp.
[0038] Preferably, the amino acid sequence of the B domain includes Gly-Xaa-Yaa of human collagen;
[0039] Preferably, the human collagen is type I collagen, type II collagen, or type III collagen.One or more of type IV collagen, type V collagen, type VI collagen, type VII collagen, type VIII collagen, type IX collagen, or type X collagen; further, the human-derived collagen is preferably one or more of type I collagen, type II collagen, or type III collagen.
[0040] Preferably, Y is an integer from 0 to 100, more preferably an integer from 3 to 50, for example 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100.
[0041] In a specific embodiment of the present invention, Xaa is selected from Glu, Lys, Ala, or Pro, and Yaa is selected from Pro, Asn, Lys, Arg, or Ala.
[0042] In one specific embodiment of the present invention, Xaa is selected from Glu, Ala, Leu, Pro or Asp, and Yaa is selected from Arg, Ala, Pro or Lys. Specification 3 / 36 pages 6 CN 121449726 A
[0043] In one specific embodiment of the present invention, Xaa is selected from Pro, Asp, Glu, Ala or Lys, and Yaa is selected from Lys, Arg, Val Glu, Pro or Asp.
[0044] Preferably, the N-terminus of the B domain is connected to the C-terminus of the A domain, and the C-terminus of the B domain is connected to the N-terminus of the C domain.
[0045] In one specific embodiment of the present invention, the amino acid sequence of the B domain includes any one or more of SEQ ID NO: 78-80, or includes having more than 80%, more than 85%, more than 90%, more than 95%, or more than 99% homology with any one or more of the amino acid sequences shown in SEQ ID NO: 78-80.
[0046] Preferably, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-26, or includes amino acid sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 1-26.
[0047] In a specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-8, 11-26, or includes amino acid sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 1-8, 11-26.
[0048] Preferably, the amino acid sequence of the recombinant collagen includes amino acid sequences from SEQ ID NO: 3, 5-18, 20, 22-26.The amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-18, 20, 22-23, 25-26, or includes having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 3, 5-18, 20, 22-23, 25-26.
[0049] In a specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-18, 20, 22-23, 25-26, or includes having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 3, 5-18, 20, 22-23, 25-26.
[0050] In one specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-8, 11-18, 20, 22-26, or includes having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 3, 5-8, 11-18, 20, 22-26.
[0051] In a second aspect, the present invention provides a recombinant collagen comprising a B domain, wherein the amino acid sequence of the B domain includes any one or more of SEQ ID NO: 78-80, or includes having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 78-80.
[0052] Preferably, the B domain in the recombinant collagen is repeated Y times, where Y is an integer from 0 to 100, preferably an integer from 3 to 50.
[0053] In a specific embodiment of the present invention, the amino acid sequence of the B domain is SEQ ID NO: 78.
[0054] Preferably, the recombinant collagen further includes an A domain and / or a C domain;
[0055] Preferably, the N-terminus of the B domain is connected to the C-terminus of the A domain.
[0056] Preferably, the C-terminus of the B domain is connected to the N-terminus of the C domain.
[0057] Preferably, the A domain is an N-terminal telopeptide or peptide segment of human collagen. For example, one or more of the N-terminal telopeptides or peptide segments of human type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, type VI collagen, type VII collagen, type VIII collagen, type IX collagen or type X collagen.
[0058] In one specific embodiment of the present invention, the A domain is one or more of the N-terminal peptides or peptide segments of human type I collagen, type II collagen, or type III collagen.
[0059] Preferably, the C domain is a C-terminal peptide or peptide segment of human collagen. For example, one or more of the C-terminal peptides or peptide segments of human type I collagen, type II collagen (see page 4 / 36, CN 121449726 A), type III collagen, type IV collagen, type V collagen, type VI collagen, type VII collagen, type VIII collagen, type IX collagen, or type X collagen.
[0060] In a specific embodiment of the present invention, the C domain is one or more of the C-terminal peptides or peptide segments of human type I collagen, type II collagen, or type III collagen.
[0061] Preferably, the recombinant collagen includes AXBYCZ.
[0062] In one specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-8, 11-26, or includes amino acid sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 1-8, 11-26.
[0063] In one specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-4, 11-26, or includes amino acid sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 1-4, 11-26.
[0064] In a third aspect, the present invention provides a polypeptide comprising an A domain and a C domain, wherein the A domain is a human type III collagen N-terminal peptide or a peptide segment thereof, and the C domain is a human type III collagen C-terminal peptide or a peptide segment thereof.
[0065] Preferably, the A domain and the C domain are directly connected or connected through Y B domains, wherein the B domains are Gly-Xaa-Yaa, and Y is an integer ≥ 0.
[0066] Preferably, the amino acid sequence of the recombinant collagen comprises any one or more of SEQ ID NO: 3, 5-18, 20, 22-26, or comprises having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 3, 5-18, 20, 22-26.
[0067] In one specific embodiment of the present invention, the amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-18, 20, 22-23, 25-26, or includes sequences similar to SEQ ID NO: 3, 5-18, 20, 22-23, 25-26.The amino acid sequences 25-26, or more, have 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology.
[0068] In a fourth aspect, the present invention provides a nucleic acid comprising a nucleotide sequence encoding the recombinant collagen or the polypeptide described above.
[0069] Preferably, the nucleotide sequence of the nucleic acid comprises any one or more of SEQ ID NO: 27-52, or comprises sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 27-52.
[0070] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 27-34, 37-52, or includes nucleotide sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 27-34, 37-52.
[0071] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 27-30, 37-52, or includes nucleotide sequences having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 27-30, 37-52.
[0072] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 29, 31-44, 46, 48-52, or includes nucleotide sequences having more than 80%, more than 85%, more than 90%, more than 95%, or more than 99% homology with any one or more of SEQ ID NO: 29, 31-44, 46, 48-52.
[0073] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 29, 31-44, 46, 48-49, 51-52, or includes nucleotide sequences having homology of 80% or more, 85% or more, 90% or more, 95% or more, or 99% as specified in the specification (page 5 / 36, CN 121449726 A).
[0074] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 29, 31-34, 37-44, 46, 48-52, or includes nucleotide sequences having homology of SEQ ID NO: 29, 31-34, 37-44, 46, 48-52 as specified in the specification (page 5 / 36, CN 121449726 A).The nucleotide sequence of the nucleic acid has 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology.
[0075] In a specific embodiment of the present invention, the nucleotide sequence of the nucleic acid includes any one or more of SEQ ID NO: 29, 37-42, 46, 48-49, 51-52, or includes 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with any one or more of SEQ ID NO: 29, 37-42, 46, 48-49, 51-52.
[0076] In a fifth aspect of the present invention, an expression vector is provided, the expression vector comprising the above-mentioned nucleic acid, and / or, the expression vector expressing the above-mentioned recombinant collagen or the above-mentioned polypeptide;
[0077] Preferably, the backbone vector of the expression vector includes a prokaryotic vector backbone or a eukaryotic vector backbone.
[0078] Preferably, the expression vector includes one or more of pET29a, pPIC9k, pPICZαA, pHIL-S1, or pYAM75P.
[0079] In a sixth aspect, the present invention provides a method for preparing the above-mentioned recombinant collagen or the above-mentioned polypeptide, wherein the preparation method includes chemical synthesis or biosynthesis;
[0080] Preferably, the biosynthesis includes prokaryotic expression or eukaryotic expression.
[0081] In a specific embodiment of the present invention, the preparation method includes:
[0082] 1) obtaining the above-mentioned nucleic acid;
[0083] 2) linking the nucleic acid obtained in 1) to a backbone vector to obtain an expression vector;
[0084] 3) transforming the expression vector obtained in 2) into a host cell to induce expression;
[0085] Preferably, the preparation method further includes a purification step.
[0086] Preferably, the nucleic acid in step 1) is tagged, such as a histidine tag, a fusion tag, or a protease cleavage site sequence, preferably including a 6*His tag, a GST tag, an MBP tag, or a SUMO tag.
[0087] Preferably, step 2) includes codon optimization of the obtained nucleic acid, followed by splicing and recombination into a backbone vector to obtain an expression vector, preferably including Xba I and HindIII enzyme cleavage sites on the backbone vector.
[0088] Preferably, the preparation method further includes obtaining collagen after enzyme digestion.
[0089] Preferably, the host cell includes eukaryotic cells or prokaryotic cells.
[0090] Preferably, the eukaryotic cell includes one or more of yeast (e.g., Pichia pastoris or Saccharomyces cerevisiae), animal cells, or plant cells.
[0091] Preferably, the prokaryotic cell includes Escherichia coli or Bacillus (e.g., Bacillus subtilis or Bacillus licheniformis).
[0092] In one specific embodiment of the present invention, the host cell is *Escherichia coli*.
[0093] In a seventh aspect of the present invention, a host cell is provided, the host cell comprising the above-described expression vector.
[0094] Preferably, the host cell comprises eukaryotic cells or prokaryotic cells.
[0095] Preferably, the eukaryotic cells comprise one or more of yeast (e.g., *Pichia pastoris* or *Saccharomyces cerevisiae*), animal cells, or plant cells.
[0096] Preferably, the prokaryotic cells comprise *Escherichia coli* or Bacillus (e.g., *Bacillus subtilis* or *Bacillus licheniformis*). Specification 6 / 36 pages 9 CN 121449726 A
[0097] In one specific embodiment of the present invention, the host cell is *Escherichia coli*.
[0098] In an eighth aspect of the present invention, an application is provided for the above-described recombinant collagen, the above-described polypeptide, the above-described nucleic acid, the above-described expression vector, or the above-described host cell, the application comprising one or more of the applications in the fields of biomedicine, medical devices, cosmetics, or bioengineering technology.
[0099] In a ninth aspect, the present invention provides an application of the above-described recombinant collagen, the above-described polypeptide, the above-described nucleic acid, the above-described expression vector, or the above-described host cell, the application comprising:
[0100] 1) application in the preparation of a medicament for treating a disease. Preferably, the disease includes inflammation or a disease for which inhibition of melanin is beneficial for treatment.
[0101] 2) application in the preparation of medical materials, preferably, the medical materials comprising one or more of the following: surgical sutures, medical sponges (e.g., collagen sponges), dressings (e.g., wound dressings, healing dressings, or repair dressings), hemostatic materials, repair materials (e.g., skin repair, tissue repair), artificial organs (e.g., artificial skin, artificial bones, artificial cartilage, artificial blood vessels, artificial tendons), filler materials (e.g., skin filler materials or tissue filler materials), biological scaffolds, hydrogels, and drug carriers;
[0102] 3) application as an active ingredient in cosmetics, a food additive, a health product, or animal feed, wherein the active ingredient in cosmetics preferably includes whitening ingredients or anti-inflammatory ingredients.
[0103] Preferably, the inflammation includes degenerative inflammation, exudative inflammation (e.g., one or more of serous inflammation, fibrinous inflammation, purulent inflammation, hemorrhagic inflammation, necrotizing inflammation, and catarrhal inflammation), proliferative inflammation, or specific inflammation (e.g., one or more of tuberculosis, syphilis, leprosy, or lymphogranuloma).
[0104] Preferably, treating the inflammation includes inhibiting inflammatory factors. Preferably, the inflammatory factors include TNF-α.
[0105] Preferably, treating the inflammation includes inhibiting inflammatory factors through the above-described recombinant collagen or the above-described polypeptide.
[0106] Preferably, the diseases for which melanin inhibition is beneficial for treatment include pigmentation, melasma, and melanoma (e.g., acral melanoma, mucosal melanoma, chronic sun-induced keratosis (CSD), and non-chronic sun-induced keratosis).
[0107] Preferably, the treatment of diseases for which melanin inhibition is beneficial for treatment includes inhibiting melanin production through the above-mentioned recombinant collagen or the above-mentioned polypeptide.
[0108] In a specific embodiment of the present invention, the application includes the preparation of repair materials (e.g., skin repair, tissue repair), filler materials (e.g., skin filler, tissue filler), hemostatic materials, or dressings (e.g., wound dressings, healing dressings, or repair dressings).
[0109] In a specific embodiment of the present invention, the application includes its use in the preparation of medicaments for treating diseases. Preferably, the diseases include inflammation or diseases for which melanin inhibition is beneficial for treatment.
[0110] In one specific embodiment of the present invention, the application includes applications in whitening, skin care, repair, and anti-inflammatory scenarios, such as in the medical aesthetics or skin care product field that specifically improves or solves skin problems such as dull skin, skin aging, sagging, inflammation, wrinkles, etc.
[0111] In one specific embodiment of the present invention, the application includes applications in the preparation of repair materials, filling materials (e.g., skin fillers, tissue fillers), hemostatic materials or dressings (e.g., wound dressings, healing dressings, etc.), in the preparation of drugs for treating diseases (preferably, the diseases include inflammation or diseases that are beneficial to treatment by inhibiting melanin), and applications in whitening, skin care, repair, and anti-inflammatory scenarios.
[0112] In a tenth aspect of the present invention, a drug is provided, the drug comprising the above-mentioned recombinant collagen, the above-mentioned polypeptide, the above-mentioned nucleic acid, the above-mentioned expression vector, or the above-mentioned host cell.
[0113] Preferably, the drug further comprises pharmaceutically acceptable excipients. Instructions for Use, Page 7 / 36, 10 CN 121449726 A
[0114] Preferably, the pharmaceutically acceptable excipients include one or more combinations of excipients, diluents, lubricants, wetting agents, emulsifiers, preservatives, antioxidants, buffers, antibacterial agents, suspending agents, fillers, binders, humectants, disintegrants, absorption enhancers, surfactants, suspending agents, solubilizers, thickeners, or stabilizers.
[0115] Preferably, the formulation of the drug can be any one or more combinations of syrups, elixirs, suspensions, powders, granules, tablets, capsules, pills, lozenges, rectal suppositories or rectal enemas, injections, aqueous solutions, creams, ointments, lotions, gels, or emulsions (e.g., water-in-oil or oil-in-water emulsions).
[0116] Preferably, the formulation type of the drug is preferably a unit dose formulation. The drug activity in the unit dose formulation...The amount of the component can be varied or adjusted from 0.001 mg to 1000 mg (preferably from 0.1 mg to 500 mg, more preferably from 30 mg to 100 mg, for example 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 mg), depending on the specific application and efficacy of the active pharmaceutical ingredient.
[0117] Depending on the needs of the specific embodiment, the drug may also contain other suitable therapeutic agents. For example, therapeutic agents with anti-inflammatory effects or therapeutic agents with melanin-inhibiting effects.
[0118] Preferably, the drug is suitable for gastrointestinal or non-gastrointestinal administration.
[0119] Preferably, the administration route of the drug includes gastrointestinal administration (e.g., oral administration, enteral administration, or catheter administration) or non-gastrointestinal administration (e.g., topical, intravenous, intramuscular, intradermal, and subcutaneous routes).
[0120] In an eleventh aspect of the present invention, a cosmetic is provided, the cosmetic comprising the above-described recombinant collagen, the above-described polypeptide, the above-described nucleic acid, the above-described expression vector, or the above-described host cell.
[0121] Preferably, the cosmetic further comprises cosmetically acceptable excipients.
[0122] Preferably, the cosmetically acceptable excipients include one or more combinations of solvents, solubilizers, preservatives, antioxidants, pH adjusters, penetration enhancers, oils, humectants, thickeners, chelating agents, skin feel modifiers, surfactants, emulsifiers, amino acids, propellants / projectiles, fragrances, pigments, and other functional additives.
[0123] Preferably, the dosage form of the cosmetic includes one or more of the following: suspension, emulsion, paste, gel, cream, lotion, powder, soap, facial cleanser, liquid foundation (e.g., powder foundation, emulsion foundation, or wax foundation), mask, massage cream, or spray.
[0124] In a twelfth aspect of the invention, a method for treating a disease is provided, the method comprising administering to a subject in need an effective amount of the above-mentioned recombinant collagen, the above-mentioned polypeptide, the above-mentioned nucleic acid, the above-mentioned expression vector, the above-mentioned host cell, or the above-mentioned drug.
[0125] Preferably, the method of administration includes gastrointestinal administration (e.g., oral administration, enteral administration, or catheter administration) or non-gastrointestinal administration (e.g., topical, intravenous, intramuscular, intradermal, and subcutaneous routes).
[0126] Preferably, the disease includes the disease described in the ninth aspect above.
[0127] In a thirteenth aspect, the present invention provides a whitening or skincare method, said whitening or skincare method comprising using the above-described recombinant collagen, the above-described polypeptide, the above-described nucleic acid, the above-described expression vector, the above-described host cell, the above-described drug, or the above-described cosmetic.
[0128] Preferably, the whitening and / or skincare effects are achieved by inhibiting melanin production.
[0129] Preferably, the whitening and / or skincare effects are achieved by inhibiting melanin production through the above-mentioned collagen, the above-mentioned polypeptide, the above-mentioned nucleic acid, the above-mentioned expression vector, the above-mentioned host cell, or the above-mentioned drug.
[0130] The "subject" mentioned in this invention can be a human or a non-human mammal, or a cell, tissue, or organ of a human or non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, minks, jackals, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.
[0131] The "effective amount" mentioned in this invention refers to the amount or dose of the product of this invention that provides the desired treatment after being given to an individual or organ in a single dose or multiple doses.
[0132] The term "pharmaceutically acceptable" or "cosmetically acceptable" as used in this invention refers to the biological activity and properties of the pharmaceutically active substance in the applied product that neither significantly irritates the organism nor inhibits it.
[0133] The term "treatment" as used in this invention means delaying, terminating, blocking, controlling, stopping, reducing, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the onset of the disease, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.
[0134] The term "prevention" as used in this invention refers to all behaviors that suppress symptoms or delay the stress of specific symptoms by applying the product described in this invention.
[0135] The "homology" mentioned in this invention refers to the ability of those skilled in the art, in using amino acid or nucleotide sequences, to adjust the sequence according to actual work needs, while ensuring similar structure or function to known sequences, so that the sequence used has (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, and 51% homology compared to sequences obtained by existing technologies. 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity.
[0136] The term “and / or” as used in this invention includes all combinations of the items connected by the term and should be regarded as each combination having been individually listed herein. For example, “A and / or B” includes “A,” “A and B,” and “B.” As another example, “A, B, and / or C” includes “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”
[0137] The term “comprising” or “including” as used in this invention is an open-ended description that includes the specified ingredients or steps described, as well as other specified ingredients or steps that do not materially affect the description.
[0138] The beneficial effects of the present invention are as follows:
[0139] 1) The present invention selects the N-terminal or C-terminal region sequence of human collagen for recombinant expression, and obtains recombinant collagen by combining it with the amino acid sequence of the middle region. According to the optimization of the C-terminal region, the recombinant collagen or polypeptide can have significant in vitro anti-inflammatory and melanin production inhibition effects, and can be effectively applied to the treatment of related diseases such as melanin inhibition and anti-inflammation, as well as in the fields of medical and skin care. At the same time, with the help of the expression of the N-terminal and C-terminal regions, the recombinant collagen is non-cytotoxic, has good cell viability, cell proliferation rate, cell adhesion rate, antioxidant and cell migration promotion capabilities, and has good tissue repair effects. It can be used in a variety of medical products and skin care products.
[0140] 2) The present invention screens suitable amino acid sequences of the N-terminal, C-terminal and middle regions, and can obtain recombinant collagen that simultaneously has cell proliferation rate, cell adhesion rate, antioxidant and cell migration promotion capabilities, as well as significant anti-inflammatory and melanin production inhibition effects, and has extremely high application value.
[0141] 3) The recombinant collagen or polypeptide produced by this invention has very good hydrophilicity and stability. Its amino acid composition is 100% identical to the corresponding part of the amino acid sequence of natural collagen. It will not produce immune rejection or allergic reactions when applied to the human body, and can be widely used in the fields of biomedicine, medical devices, cosmetics and bioengineering technology. Specification 9 / 36 pages 12 CN 121449726 A Brief Description of the Drawings
[0142] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, wherein:
[0143] Figure 1: Effect of different types of collagen telopeptides on the bioactivity of recombinant collagen;
[0144] Figure 2: Effect of different lengths of type III collagen C-terminal peptides on the bioactivity of recombinant collagen;
[0145] Figure 3: Effect of different lengths of type III collagen N-terminal peptides on the bioactivity of recombinant collagen;
[0146] Figure 4: Exploration of the influence of amino acid sequences of different lengths and types of intermediate regions on the bioactivity of recombinant collagen;
[0147] Figure 5: Exploration of the influence of type III collagen telopeptide on the bioactivity of recombinant collagen. Detailed Implementation
[0148] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present invention.
[0149] Example 1: Gene Design and Synthesis
[0150] 1) Gene Design:
[0151] According to the sequence characteristics of human type I collagen and human type III collagen, a recombinant collagen sequence COL-1 was designed. Its amino acid sequence is shown in SEQ ID NO: 1. Its N-terminus contains the human type I collagen N-terminal peptide sequence; its C-terminus contains the human type I collagen C-terminal peptide sequence. The amino acid sequence of the recombinant collagen fragment is shown in SEQ ID NO: 1:
[0152] SEQ ID NO: 1
[0153] QLSYGYDEKSTGGISVP
[0154] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGE AGEPGKNGAKGEPGPRGERGEA
[0155] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0156] SAGFDFSFLPQPPQEKAHDGGRYYRA
[0157] 2) Codon optimization
[0158] The encoding nucleic acid sequence was reverse-engineered using the online design tool Jcat (http: / / www.jcat.de / ), and codon optimization was performed for expression in the host *E. coli*. After the above optimization, the corresponding nucleic acid fragment encoding recombinant collagen was obtained, and the nucleotide sequence of the nucleic acid fragment is shown in SEQ ID NO: 27.
[0159] SEQ ID NO: 27:
[0160] CAACTGAGCTACGGCTACGACGAAAAATCTACCGGTGGCATTTCCGTTCCAGGTGAACCAGGCAAGAACGGTGCTAAAGGCGAACCTGGTCCGCGTGGCGAACGTGGTGAAGCTGGCGAACCAGGCAAGAACGGCGCGAAAGGCGA GCCTGGTCCACGTGGTGAGCGTGGTGAAGCCGGTGAGCCGGGTAAAAACGGCGCGAAAGGTGAACCAGGTCCACGCG GTGAACGTGGCGAAGCGGGTGAACCGGGTAAAAACGGTGCGAAAGGTGAGCCGGGTCCACGTGGCGAACGTGGTGAG GCTGGTGAACCGGGTAAGAACGGTGCCAAAGGTGAACCGGGTCCACGTGGTGAACGTGGTGAAGCTGGTGAACCGGG CAAAAATGGTGCTAAAGGTGAACCTGGTCCACGTGGTGAACGCGGTGAGGCAGGTGAACCTGGTAAGAACGGTGCAA AGGGCGAACCGGGTCCTCGCGGTGAACGTGGTGAAGCCGGTGAACCGGGCAAAAACGGTGCTAAAGGTGAGCCTGGT CCTCGTGGTGAACGTGGCGAAGCTGGCGAACCAGGTAAAAACGGTGCAAAGGGTGAACCGGGTCCACGCGGTGAACG Instruction Manual 10 / 36 pages 13 CN 121449726 A CGGTGAAGCAGGTGAACCAGGTAAAAACGGCGCAAAAGGTGAACCGGGTCCTCGTGGTGAACGCGGTGAAGCTTCTG CCGGTTTCGACTTTTCTTTCCTGCCACAGCCGCCGCAGGAGAAAGCTCACGACGGCGGTCGTTACTATCGTGCG
[0161] 3) Gene Synthesis
[0162] According to the nucleic acid sequence shown in SEQ ID NO: 27, the nucleic acid fragment encoding the recombinant collagen fragment was synthesized by BGI Genomics or constructed by PCR.
[0163] Example 2: Recombinant Collagen Expression and Purification
[0164] 1) Construction of Expression Strains
[0165] Construction of pET29a-COL: The nucleic acid fragment synthesized in Example 1 was directly ligated to the pET29a plasmid to obtain pET29a-COL. pET29a-COL was transformed into BL21(DE3) competent cells by heat shock, plated on kanamycin resistance plates, and single colonies were picked from the plates to obtain the expression strain.
[0166] 2) Induction of Target Protein Expression
[0167] Single colonies of the expression strain were picked and inoculated into test tubes containing 2.5 mL of LB medium (with added kanamycin antibiotics) and cultured overnight at 37°C. The seed culture culture after overnight culture was transferred to 100 mL of LB liquid medium at an inoculation rate of 1% and cultured at 37°C and 200 rpm until the OD value was about 2-3. IPTG was added to a final concentration of 1.5 mM for induction culture and induction was carried out for 4 h. The bacterial cells were collected by centrifugation.
[0168] 3) Crude purification of target protein
[0169] A 10% (wet weight of bacterial cells / volume of PB) bacterial suspension was prepared with PB buffer at pH 7.0. The suspension was homogenized three times under high pressure at 800 bar. The supernatant was collected by centrifugation and was the crude protein expression solution. It was identified by electrophoresis: DE3 competent cells without plasmid were used as the induction control. After induction, the cell wall breaking control group and the constructed expression strain group were simultaneously detected by SDS-PAGE protein electrophoresis.
[0170] 4) Purification of the target protein
[0171] The SP column (Qianchun Biotechnology Co., Ltd., catalog number: A20504) was equilibrated with 5 column volumes of equilibration buffer (10 mM NaH2PO3, pH 3.0). Then, the above crude protein expression solution was used for loading to ensure that the target protein was fully bound to the column. The SP column was then equilibrated with 5 column volumes of equilibration buffer (10 mM NaH2PO3, 500 mM NaCl, pH 3.0). Then, impurities were eluted with 5 column volumes of elution buffer (10 mM NaH2PO3, 150 mM NaCl, pH 3.0). Then, the target protein was eluted with 2 column volumes of elution buffer (10 mM NaH2PO3, 500 mM NaCl, pH 3.0).
[0172] The obtained product was dialyzed overnight and lyophilized into a dry powder for later use.
[0173] Other different recombinant collagen sequences were designed and prepared in accordance with Example 1. The amino acid sequences and corresponding nucleotide sequences are shown in Table 1.
[0174] Table 1: Collagen Sequence (COL Sequence)
[0175] Specification 11 / 36 pages 14 CN 121449726 A
[0176]
[0177]
[0178] Note: N Ⅰ represents the N-terminal telopeptide sequence of type I collagen (amino acid sequence: SEQ ID NO: 53, nucleotide sequence encoding it: SEQ ID NO: 59); C Ⅰ represents the C-terminal telopeptide sequence of type I collagen (amino acid sequence: SEQ ID NO: 56, nucleotide sequence encoding it: SEQ ID NO: 62); N Ⅱ represents the N-terminal telopeptide sequence of type II collagen (amino acid sequence: SEQ ID NO: 54, nucleotide sequence encoding it: SEQ ID NO: 60); C Ⅱ represents the C-terminal telopeptide sequence of type II collagen (amino acid sequence: SEQ ID NO: 59, nucleotide sequence encoding it ...69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it: SEQ ID NO: 69, nucleotide sequence encoding it:SEQ ID NO: 57, encoding its nucleotide sequence: SEQ ID NO: 63); N Ⅲ represents the N-terminal telopeptide sequence of type III collagen (amino acid sequence: SEQ ID NO: 55, encoding its nucleotide sequence: SEQ ID NO: 61); C Ⅲ represents the C-terminal telopeptide sequence of type III collagen (amino acid sequence: SEQ ID NO: 58, encoding its nucleotide sequence: SEQ ID NO: 64); Type I collagen 10 represents SEQ ID NO: 79 of type I collagen repeated 10 times; Type II collagen 10 represents SEQ ID NO: 80 of type II collagen repeated 10 times; Type III collagen 10 represents SEQ ID NO: 78 of type III collagen repeated 10 times; C Ⅲ-4 (SEQ ID NO: 69), C Ⅲ-8 (SEQ ID NO: 68), C Ⅲ-12 (SEQ ID NO: 67), C Ⅲ-16 (SEQ ID NO: 66), C Ⅲ-20 ...16 (SEQ ID NO: 66), C Ⅲ-20 (SEQ ID NO: 69), C Ⅲ-16 (SEQ ID NO: 67), C Ⅲ-12 (SEQ ID NO: 67), C Ⅲ-16 (SEQ ID NO: 66), C Ⅲ-20 (SEQ ID NO: 69), C Ⅲ-12 (SEQ ID NO: 67), C Ⅲ-16 (SEQ ID NO: 66), C Ⅲ-2 NO: 65), C Ⅲ-24(C) represent the C-terminal telopeptide sequences of type III collagen, which are reduced by 4, 8, 12, 16, 20, and 24 amino acids from the C-terminus to the N-terminus, respectively; N Ⅲ-1 (SEQ ID NO: 77), N Ⅲ-2 (SEQ ID NO: 76), N Ⅲ-3 (SEQ ID NO: 75), N Ⅲ-4 (SEQ ID NO: 74), N Ⅲ-5 (SEQ ID NO: 73), N Ⅲ-6 (SEQ ID NO: 72), N Ⅲ-8 (SEQ ID NO: 71), and N Ⅲ-10 (SEQ ID NO: 70) represent the N-terminal telopeptide sequences of type III collagen, which are reduced by 1, 2, 3, 4, 5, 6, 8, and 10 amino acids from the N-terminus to the C-terminus, respectively.
[0179] Recombinant collagen performance testing method:
[0180] The recombinant collagen sequence designed according to Table 1 of Example 1 was constructed and prepared according to the method of Example 2 to obtain the corresponding collagen freeze-dried products COL-1 to COL-26. Recombinant collagen cytotoxicity experiment, cell adhesion activity experiment, cell proliferation experiment, cell migration promotion experiment, in vitro anti-inflammatory experiment and melanin production inhibition experiment were performed respectively. The specific testing methods of the relevant experiments are as follows:
[0181] 1. Recombinant collagen cytotoxicity experiment
[0182] According to the requirements of GB / T16886.5-2017, mammalian L929 cells were cultured in vitro to test the potential cytotoxic effects of recombinant collagen.
[0183] 1) Experimental materials
[0184] Mouse fibroblasts (L929), MEM medium, PBS, Hank balanced salt solution (HBSS), penicillin and streptomycin and fetalBovine serum (FBS), 0.25% trypsin (containing EDTA), isopropanol, MTT assay kit, high-density polyethylene, DMSO.
[0185] The experimental group was selected from recombinant collagen samples of COL-1 to COL-26.
[0186] The control group included blank control group, negative control group (high-density polyethylene) and positive control group (DMSO).
[0187] 2) Experimental steps
[0188] Prepare 100 μl of cell suspension in a 96-well plate. Pre-culture the plate in an incubator for 24 hours (37℃, 5% CO2). Add different concentrations of the above experimental group and control group to the plate. Incubate the plate in an incubator for 24 hours. Then add 50 μl of MTT solution to each well, incubate in an incubator for 2 hours, then discard the MTT solution, add 100 μl of isopropanol solution to each well, shake the plate, and measure the absorbance at 570 nm (reference wavelength 650 nm) using a microplate reader.
[0189] 3) Cell viability calculation formula:
[0190] Cell viability (%) = (average OD value of experimental group / average OD value of blank control group) × 100
[0191] Generally speaking, cell viability above 70% can be considered to have no cytotoxicity and be safe for the human body; if cell viability drops below 70%, it has potential cytotoxicity.
[0192] The results showed that the cell viability of the blank control group was 100%, the cell viability of the positive control group was 1.82%, and the cell viability of the negative control group was 98.2%. The cells in the blank control group and the negative control group (high-density polyethylene) maintained normal morphology throughout the experiment and did not show cytotoxic reactions. The positive control group (DMSO) showed severe cytotoxic reactions, which indicates that the experiment was successful. See Examples 3-7 for specific experimental group results. Instructions 13 / 36 pages 16 CN 121449726 A
[0193] 2. Recombinant collagen cell adhesion activity experiment
[0194] 1) Experimental materials
[0195] Normal culture of NIH / 3T3 cells, MEM medium, PBS, Hank balanced salt solution (HBSS), penicillin and fetal bovine serum (FBS), 0.25% trypsin (containing EDTA), DMSO, MTT assay kit
[0196] Take COL-1 to COL-26 and control group (bovine serum albumin (BSA) solution), and then dilute with PBS (pH 7.4) to 0.5 mg / mL.
[0197] 2) Experimental steps
[0198] Add 100 μL of COL-1 to COL-26 solution and control group bovine serum albumin solution to a 96-well cell culture plate, and set up 3 replicates for each group. Let stand at room temperature for 60 minutes; then add 10⁵ NIH / 3T3 cells in good culture condition to each well.Cells were incubated at 37°C and 5% CO2 for 60 min. Cells in the wells were washed 4 times with PBS. The absorbance at 570 nm was detected using an MTT assay kit (specific operation is performed according to the instruction manual).
[0199] The higher the cell adhesion rate, the more cells the protein adheres to, and the more quickly the recombinant collagen can help cells adhere to the wall or the extracellular matrix, which is more conducive to building a suitable extracellular environment.
[0200] The cell adhesion rate of the control group bovine serum albumin was 100%, indicating that the experiment was successful. The specific experimental group results are shown in Examples 3-7.
[0201] 3. Recombinant collagen cell proliferation experiment
[0202] 1) Experimental materials
[0203] Mouse fibroblasts (L929), MEM medium, PBS, Hank balanced salt solution (HBSS), penicillin and streptomycin and fetal bovine serum (FBS), 0.25% trypsin (containing EDTA), isopropanol, MTT assay kit.
[0204] The experimental group was selected from recombinant collagen samples COL-1 to COL-26.
[0205] The control group included a blank control group and a positive control group (complete culture medium).
[0206] 2) Experimental steps
[0207] L929 cell suspension with a cell concentration of 4×104 cells / mL was added to a 96-well plate, 100μl per well, for a total of 4000 cells / well, and cultured at 37℃ and 5% CO2 for 24 hours. After the culture was completed, the culture medium in the culture plate was discarded, and 1640 starvation medium was added and cultured for 24 hours. After the culture was completed, the experimental group, blank control group, positive control group, and COL-1 to COL-26 experimental samples were added to the plate, with 6 wells in each group, and cultured in a 37℃ and 5% CO2 saturated humidity incubator for 48 hours. After the culture was completed, the cell culture plate was removed, the culture medium was discarded, 50μl of 1mg / mL MTT solution was added to each well, and cultured in a 37℃ and 5% CO2 saturated humidity incubator for 2 hours.
[0208] After the culture was completed, the liquid in the culture plate was discarded, 100 μl of isopropanol was added to each well, the plate was shaken and mixed, and the plate was placed in a microplate reader. The readings were taken at wavelengths of 570 nm and 650 nm. The relative cell viability of each experimental group was calculated by comparing the OD value of the blank control group. The blank control group was recorded as 100%.
[0209] 3) Result evaluation
[0210] The OD value of each group was measured, and the cell proliferation rate was calculated according to the following formula. A cell proliferation rate ≥ 100% was considered to have a proliferation effect.
[0211] Cell proliferation rate (%) = (average OD value of the test group / average OD value of the blank control group) × 100.
[0212] The results showed that the cell proliferation rate of the positive control group was 130%, and the experiment was successful. The specific experimental group results are shown in Examples 3-7.
[0213] 4. Recombinant collagen promotes cell migration experiment
[0214] 1) Experimental materials instruction manual 14 / 36 pages 17 CN 121449726 A
[0215] Mouse fibroblasts (L929), MEM medium, PBS, Hank balanced salt solution (HBSS), penicillin and fetal bovine serum (FBS), 0.25% trypsin (containing EDTA).
[0216] The experimental group was selected from recombinant collagen samples of COL-1 to COL-26.
[0217] 2) Experimental steps
[0218] ① Cell culture
[0219] First, mark each well of the 6-well plate with a marker pen, dividing each well into three equal parts horizontally and vertically. Seed cells at approximately (5-15) × 10⁵ cells per well. Each group had 3 replicate wells.
[0220] ② Scratch test
[0221] Using a marker pen and a ruler, draw three horizontal lines on the bottom of the well plate. After culturing the cells for 24 hours, use a 10 μL pipette tip, aligned vertically with the ruler (or a special cell culture dish for scratch testing), to gently push down the vertical lines to form scratches. Wash the cells three times with PBS to remove the scratched cells. Add 2 mL of serum-free medium containing COL-1 to COL-26 recombinant collagen samples to the experimental group, with a final concentration of 0.5 mg / mL. The blank control group only added serum-free medium.
[0222] Incubate at 37℃ in a 5% CO2 incubator. After 0 h and 24 h, take pictures under a 40x microscope with the intersection of the horizontal and vertical scratches as the core. Obtain pictures of 9 sites per well, for a total of 27 data points per group.
[0223] ③ Data Processing
[0224] The area of the scratched area was measured, and the cell migration rate of each group was calculated by dividing the total area of the migrating cells in the fixed scratched area by the initial area of the fixed scratched area. The specific experimental group results are shown in Examples 3-7.
[0225] 5. Study on the in vitro anti-inflammatory effect of recombinant collagen
[0226] 1) Experimental materials
[0227] Mouse macrophages (RAW264.7 cells), DMEM (high glucose) medium, PBS, Hank balanced salt solution (HBSS), penicillin and fetal bovine serum (FBS), 0.25% trypsin (containing EDTA), Mouse TNF-α ELISA Kit, bacterial lipopolysaccharide LPS, dexamethasone.
[0228] The experimental group was selected from recombinant collagen samples from COL-1 to COL-26.
[0229] 2) Experimental steps
[0230] Take well-grown RAW264.7 cells and seed them into 96-well plates at 1×104 cells / well. Add 100 μl of the above-mentioned recombinant collagen COL-1 to COL-26 working solution to each well. After cell seeding, incubate in a CO2 incubator for 24 h. Discard the culture medium in the cell culture wells;
[0231] Add culture medium containing LPS (final concentration 1 μg / ml) to the negative control wells. Add culture medium containing dexamethasone (final concentration 100 μg / ml) and LPS (final concentration 1 μg / ml) to the positive control wells. Add DMEM to the blank control wells.Apply 100 μl of culture medium per well, with two replicates per group. After administration, incubate the 96-well plate in a CO2 incubator for 24 hours. See Table 2 for specific administration methods.
[0232] Table 2: Induction drug administration method
[0233] Sample name Blank control (μl) Positive control (μl) Negative control (μl) Experimental group (μl) LPS working solution (1μg / ml) 0 0 100 0 LPS working solution (2μg / ml) 0 50 0 50 Dexamethasone working solution (200μg / ml) 0 50 0 0 Recombinant collagen working solution 0 0 0 50 DMEM starvation medium 100 0 0 0 Total 100 100 100 100 Instruction manual 15 / 36 pages 18 CN 121449726 A
[0234] After the incubation culture was completed, 100μl of cell culture supernatant was collected in a 1.5ml sterile centrifuge tube and detected according to the operation instructions of the TNF-α ELISA detection kit.
[0235] 3) Calculation of TNF-α content
[0236] Using the concentration of the standard as the vertical axis and the OD value (OD450-OD570) as the horizontal axis, a standard curve regression equation was constructed. The OD value of the sample was substituted into the equation to calculate the TNF-α content of the sample. Finally, the average value of each group was taken as the final TNF-α content result.
[0237] Calculation formula:
[0238]
[0239] Where: T is the average TNF-α content of the experimental group;
[0240] C is the average TNF-α content of the negative control group
[0241] The results showed that the TNF-α content inhibition rate of the positive control group (59%) was above 20%, and the result of the blank control group was 0%, indicating that the experiment was successful. For specific experimental group results, see Examples 3-7.
[0242] 6. Melanin Production Inhibition Assay
[0243] 1) Experimental Materials
[0244] Mouse melanoma cells (B16), DMEM (high glucose) medium, PBS, Hank balanced salt solution (HBSS), penicillin and fetal bovine serum (FBS), 0.25% trypsin (containing EDTA), dimethyl sulfoxide (DMSO), and thiazolyl blue (MTT) assay kit.
[0245] The experimental group was selected from COL-1 to COL-26 recombinant collagen samples.
[0246] 2) Experimental Procedure
[0247] Take well-grown B16 cells, passage them into 6 mm petri dishes, and seed them at a density of 250,000 cells / well, with a volume of 4 ml per well. After seeding, place the cells in a carbon dioxide incubator for 24 h and discard the culture medium in the cell culture wells. Experimental group: COL collagen sample was prepared using DMEM complete medium; blank group: DMEM complete medium; culture conditions: 37 ℃, 5% CO2.
[0248] Add 4 ml of culture medium for the experimental group (concentration of 2 mg / mL), the blank group, and kojic acid solution (1 mg / mL), a commonly used tyrosinase inhibitor, to the control group. Incubate the 6-well plates at 37℃ and continue culturing. Stop culturing at 48 h, collect the supernatant, centrifuge at 4000 r / min for 10 min, add 500 μl of trypsin to the cells, let stand for 2 min, collect the cells with 1 ml of PBS, centrifuge at 4000 r / min for 10 min, add 500 μl of NaOH solution (1 mol / L) containing 10% DMSO to the cells, blow up the precipitate thoroughly, and place in an 80℃ water bath for 1 h to completely dissolve the melanin granules. Transfer 150 μl to a 96-well plate and measure the absorbance at OD390 using a microplate reader.
[0249] 3) Calculation of relative melanin content:
[0250] Relative melanin content = OD390 value of experimental group / OD390 value of blank group × 100%
[0251] The results showed that the melanin production inhibition rate of kojic acid solution (49.6%) was above 20%, indicating that the experiment was successful. The specific experimental group results are shown in Examples 3-7.
[0252] Example 3 Bioactivity of different types of collagen telopeptides on recombinant collagen
[0253] The COL collagen samples in Table 3 were subjected to bioactivity tests according to test methods 1-6. The experimental results are shown in Table 3 and Figure 1.
[0254] Table 3 Effect of different types of collagen telopeptides on the bioactivity of recombinant collagen Specification 16 / 36 pages 19 CN 121449726 A
[0255]
[0256] As can be seen from Table 3 and Figure 1, the cell viability of the four recombinant collagen samples is greater than 90%, and the cell adhesion rate and cell proliferation rate are both greater than 100%, indicating that the recombinant collagen has good cell viability, cell adhesion and cell proliferation, and has a good cell proliferation and adhesion promotion effect. The cell migration rates of the four recombinant collagens are 38%, 32%, 82% and 25%, respectively, indicating that the four recombinant collagens all have certain cell migration promotion properties, especially COL-3 (i.e., recombinant collagen using type III collagen telopeptides, SEQ ID NO: 3) has a significantly higher cell migration rate than other recombinant collagen samples.
[0257] Moreover, COL-3 also showed significant anti-inflammatory effects, with a TNF-α inhibition rate of 56% (TNF-α is an important inflammatory mediator, and its reduction indicates that COL-3 can effectively alleviate the inflammatory response); in contrast, COL-4 (without telopeptides), COL-1 (using type I collagen telopeptides), and COL-2 (using type II collagen telopeptides) had anti-inflammatory rates of less than 5%, indicating weak anti-inflammatory effects. This suggests that the telopeptide structure of collagen has a certain influence on its anti-inflammatory properties, and collagen samples with type III collagen telopeptides perform well in anti-inflammatory aspects.
[0258] COL-3 also showed a significant effect in inhibiting melanin production, with a melanin production inhibition rate of 31%. COL-4, COL-1, and COL-2 not only had no melanin production inhibition effect, but even promoted melanin production. This indicates that type III collagen telopeptides have a unique role in regulating melanin production.
[0259] In summary, recombinant collagen samples using different types of collagen telopeptides all exhibited good cell activity, cell proliferation, and cell adhesion, meeting the needs of medical applications (such as medical dressings, sponges, tissue repair, etc.). Among them, recombinant collagen using type III collagen telopeptides (COL-3) showed significant advantages in promoting cell migration, in vitro anti-inflammatory effects, and inhibiting melanin production, significantly outperforming recombinant collagen without telopeptides or using other types of collagen telopeptides (types I and II), making it particularly suitable for whitening and anti-inflammatory medical devices, drugs, or skincare products.
[0260] Example 4: Bioactivity of recombinant collagen with C-terminal peptides of different lengths of type III collagen
[0261] COL collagen designed according to the amino acid sequence in Table 1 of Example 1 was constructed and prepared according to the method in Example 2 to obtain the corresponding lyophilized collagen products COL-3, COL-5 to COL-10. Bioactivity tests were performed according to the above test methods 1 to 6. The experimental results are shown in Table 4 and Figure 2.
[0262] Table 4 Effect of C-terminal peptides of different lengths of type III collagen on the bioactivity of recombinant collagen Specification 17 / 36 pages 20 CN 121449726 A
[0263]
[0264]
[0265] When the amino acids in the middle region and N-terminal region remained unchanged, the effect of truncation of C-terminal amino acids on collagen activity was investigated. As can be seen from Table 4 and Figure 2, as the number of C-terminal amino acids decreased, the cell viability of the recombinant collagen samples showed a gradual decreasing trend. This indicates that the C-terminal amino acid sequence is crucial for maintaining normal cell function and survival. When the number of C-terminal amino acids decreased by 12 to 16, the downward trend in cell viability stabilized and still reached 70%, indicating that high cell viability could be maintained. However, when the number of C-terminal amino acids decreased further (20 or more), cell viability dropped to below 65% (below 70%), indicating that collagen may begin to have a negative impact on cells at this point.
[0266] The cell proliferation rate of recombinant collagen samples also showed the same trend as cell viability. When the number of C-terminal amino acids decreased by less than 20, the cell proliferation rate of the samples was greater than or close to 100%, indicating that the recombinant collagen samples had a certain cell proliferation effect and the proliferation ability was relatively stable. However, when the number of C-terminal amino acids decreased to 24, the cell proliferation rate decreased significantly to 38%.
[0267] Similarly, cell adhesion rate and cell migration rate showed the same trend as cell viability and cell proliferation rate.Therefore, when the number of C-terminal amino acids is reduced to within 0-16, the collagen samples all exhibit good cell viability, cell proliferation rate, cell adhesion rate, and cell migration rate.
[0268] Furthermore, as the number of C-terminal amino acids decreases, the in vitro anti-inflammatory effect and melanin production inhibition rate of the recombinant collagen samples both show an upward trend. When the number of amino acids is reduced by 12 to 16, the changes in the in vitro anti-inflammatory effect and melanin production inhibition rate tend to stabilize. However, if the number of C-terminal amino acids is further reduced (to 20-24), the in vitro anti-inflammatory effect and melanin production inhibition rate will drop sharply. Therefore, in order to optimize the performance of collagen samples, the number of amino acids in the C-terminal region can be controlled.
[0269] In summary, when the number of C-terminal amino acids is reduced by 0 to 16 (including SEQ ID NO: 58, 66-69), the recombinant collagen samples have good cell viability, cell proliferation, cell adhesion, cell migration, and in vitro anti-inflammatory and melanin production inhibition capabilities. Among them, when the number of C-terminal amino acids is reduced by 4 to 16, the in vitro anti-inflammatory effect and melanin production inhibition capability are the strongest, and the recombinant collagen is more suitable for use in whitening and anti-inflammatory related products. Specification 18 / 36 pages 21 CN 121449726 A
[0270] Example 5: Bioactivity of recombinant collagen with N-terminal peptides of different lengths of type III collagen
[0271] COL collagen designed according to the amino acid sequence in Table 1 of Example 1 was constructed and prepared according to the method of Example 2 to obtain the corresponding collagen freeze-dried products COL-8, COL-11 to COL-18, and bioactivity was tested according to test methods 1 to 6. The experimental results are shown in Table 5 and Figure 3.
[0272] Table 5 Effects of N-terminal peptides of different lengths of type III collagen on the bioactivity of recombinant collagen
[0273]
[0274] The effect of truncation of N-terminal amino acids on collagen activity was investigated while keeping the amino acids in the middle and C-terminal regions unchanged. As can be seen from Table 5 and Figure 3, when the N-terminal amino acids were truncated, the cell viability, cell adhesion rate, cell proliferation rate and cell migration rate of the recombinant collagen samples were all improved; when the number of N-terminal amino acids was reduced by 0 to 10, the recombinant collagen samples all had high cell viability, proliferation activity and adhesion performance; and showed an upward trend as the number of N-terminal amino acids decreased (within 1 to 5 amino acids); when the number of N-terminal amino acids was reduced by 5 to 6 amino acids, the changes of each indicator tended to stabilize, while after further reduction of amino acids (8 to 10 amino acids), each indicator showed a downward trend, but still maintained a high level.
[0275] In addition, both the in vitro anti-inflammatory effect and the melanin production inhibition rate showed a decreasing trend with the reduction of N-terminal amino acids. When the N-terminus was reduced by 5-6 amino acids, the changes in the in vitro anti-inflammatory and melanin production inhibition rates of collagen samples tended to stabilize.And it can maintain a very high level. However, when the number of N-terminal amino acids is further reduced, the in vitro anti-inflammatory and melanin production inhibition rates show a downward trend.
[0276] In summary, the reduction of the number of N-terminal amino acids can significantly improve the cell vitality, cell adhesion, cell proliferation and cell migration ability of collagen, but at the same time it will lead to a decrease in the in vitro anti-inflammatory effect and melanin production inhibition ability. When the number of N-terminal amino acids is reduced by 0 to 10 (including SEQ ID NO: 55, 70-77), the recombinant collagen sample has good cell vitality, cell adhesion, cell proliferation and cell migration ability, and is suitable for medical dressings, hemostasis, tissue repair, tissue filling and other medical fields; when the number of N-terminal amino acids is reduced by 0 to 6 (including SEQ ID NO: 55, 72-77), in addition to the above activities, it also has obvious in vitro anti-inflammatory effect and melanin production inhibition effect, and can also be used in whitening, anti-inflammatory and other medical, beauty and skin care products and other fields, giving recombinant collagen diversified use needs.
[0277] Example 6: Bioactivity of recombinant collagen with amino acid sequences of different lengths and types in the middle region
[0278] COL collagen designed according to the amino acid sequence in Table 1 of Example 1 was constructed and prepared according to the method of Example 2 to obtain the corresponding lyophilized collagen products COL-4, COL-15, COL-19-23, and COL-26. Bioactivity tests were performed according to test methods 1 to 6. The experimental results are shown in Table 6 and Figure 4.
[0279] Table 6 Effect of amino acid sequences of different lengths and types in the middle region on the bioactivity of recombinant collagen
[0280]
[0281]
[0282] In order to investigate the effect of the N, C-terminal and middle region amino acid sequences on the activity of collagen, this example tested the performance of recombinant collagen samples without type III N and C-terminals, without the middle region, and with amino acids replaced in the middle region, based on COL15. Table 6 and Figure 4 show that all recombinant collagen groups had high cell viability (>85%), cell adhesion rate (>100%), and cell proliferation rate (>130%).
[0283] Compared with the simple intermediate region collagen sequences (COL-4, COL-19, COL-21), the addition of type III collagen telopeptides (COL-15, COL-20, COL-22) significantly improved the cell migration ability of the recombinant collagen samples. Furthermore, the anti-inflammatory effect and melanin inhibition effect of collagen were also significantly improved, indicating that telopeptides have a certain influence on the performance of collagen.
[0284] Different types of intermediate region amino acid sequences were used, specifically type III (COL15), type I (COL20), and type II.After (COL22), the anti-inflammatory effects of each collagen group were 60%, 50%, and 50%, respectively, and the melanin production inhibition rates were 41%, 40%, and 40%, respectively. Its melanin inhibition effect was close to that of kojic acid (kojic acid can effectively inhibit tyrosinase and chelate copper ions, thereby reducing melanin production, and is a substance commonly used in the prior art to inhibit melanin), indicating that COL15, COL20, and COL22 all have good anti-inflammatory and melanin production inhibition capabilities.
[0285] In addition, compared with COL-15, when the length of the amino acid sequence in the middle region was shortened, the anti-inflammatory effect (50%) and melanin production inhibition rate (43%) of collagen COL-23 (repeated 3 times on page 23 of the specification, CN 121449726 A) could still maintain a high level.
[0286] Furthermore, compared with COL-15, after completely removing the amino acid sequence of the middle region, the anti-inflammatory effect (57%) and melanin production inhibition rate (36%) of recombinant collagen COL-26 can still maintain a good level.
[0287] In summary, when the amino acid sequence of the telopeptide is appropriately shortened, the recombinant collagen samples (COL15, COL20, COL22, COL-23 and COL-26) of this application have good biological activities, especially good effects of promoting cell migration, anti-inflammation and inhibiting melanin production.
[0288] Example 7: Functional study of N-terminal and C-terminal telopeptides of type III collagen
[0289] COL collagen designed according to the amino acid sequence in Table 1 of Example 1 was constructed and prepared according to the method of Example 2 to obtain the corresponding collagen freeze-dried products COL-23 to COL-25, and the bioactivity was tested according to test methods 1 to 6. The experimental results are shown in Table 7 and Figure 5.
[0290] Table 7 Effect of telopeptides on the bioactivity of recombinant collagen
[0291]
[0292] As can be seen from Table 7 and Figure 5, the recombinant collagens prepared in this embodiment all have high cell viability (>70%), cell adhesion rate (>100%), cell proliferation rate (>100%), and cell migration rate.
[0293] Further, compared with recombinant collagen (COL-23) containing both N-terminal and C-terminal telopeptide sequences, the in vitro anti-inflammatory effect and melanin production inhibition rate of recombinant collagen (COL-24) containing only N-terminal telopeptide sequences decreased, from 50% and 43% to 20% and 20%, respectively. However, the in vitro anti-inflammatory effect (55%) and melanin production inhibition rate (36%) of recombinant collagen (COL-25) containing only C-terminal telopeptide sequences remained at a high level. This indicates that C-terminal telopeptides have a significant impact on the anti-inflammatory and melanin production inhibition functions of recombinant collagen.
[0294] Therefore, recombinant collagen with type III collagen C-terminal peptides showed significant advantages in in vitro anti-inflammatory effects and melanin inhibition. Meanwhile, considering COL4, COL23-COL26, it can be seen that collagen containing only N-terminal telopeptides also has certain anti-inflammatory and melanin inhibition effects, indicating that N-terminal telopeptides can also endow recombinant collagen with certain anti-inflammatory and melanin inhibition effects.
[0295] In summary, by selecting suitable types of N-terminal peptides, C-terminal telopeptides, the number of truncations, and suitable amino acid sequences in the middle region, this application can obtain recombinant collagen with superior biological activity. Using appropriate N-terminal telopeptides (such as type III) and truncated amounts (such as 0-10 amino acids, preferably 0-6) is beneficial to improving the cell proliferation, adhesion, and migration effects of collagen products, making them suitable for medical or medical device products such as dressings that promote tissue growth and tissue repair; controlling appropriate AC telopeptides (such as type III) and truncated amounts (such as 0-16 amino acids, preferably 4-16) is beneficial to improving the anti-inflammatory and melanin-inhibiting effects of collagen products, making them suitable for whitening, anti-inflammatory, and other medical, medical device, or skincare product fields.
[0296] The recombinant collagen SEQ ID NO: 3, 5-8, 11-18, 20, 22-26 of this application can take into account both of the above-mentioned effects, and at the same time have excellent properties of promoting cell proliferation, promoting cell adhesion and migration, anti-inflammation, and inhibiting melanin production, and can be applied to application scenarios such as promoting repair, whitening, and anti-inflammation, meeting the needs of use.
[0297] Partial sequences involved in the present invention:
[0298] SEQ ID NO: 1
[0299] QLSYGYDEKSTGGISVP
[0300] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN SEQ ID NO:2
[0304] QMAGGFDEKAGGAQLGVMQ
[0305] GEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGEAGEPGKNGAKEGPGRGERGEAGEAGEPGKNGAKEGPGRGERGEAGEAGEPGKNGAKEGPGRGERGEAGEAGEPGKNGAKEGPGRGERGEAGEAGEPGKNGAKEGPGRGERGEAGE
[0306] GEPGKNGAKEGPGRGERGEAGEPGKNGAKEGPGRGERGEAGE
[0307] GPGIDMSAFAGLGPREKGPDPLQYMRA
[0308] SEQ ID NO:3
[0309] QNYSPQYDSYDVKSGVAVG
[0310] GEPGKNGAKEGPGRGERGEAGE
[0311] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0312] CGGVGAAAIAIGGEKAGGFAPYYG
[0313] SEQ ID NO:4
[0314] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGE
[0315] SEQ ID NO:5
[0316] QNYSPQYDSYDVKSGVAVG
[0317] GEPGKNGAKGEPGPRGERGEAGEGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0318] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0319] CGGVGAAAIAGIGGEKAGGFA
[0320] SEQ ID NO:6 Specification Page 22 / 36 25 CN 121449726 A
[0321] QNYSPQYDSYDVKSGVAVG
[0322] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0323] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0324] CGGVGAAAIAGIGGEKA
[0325] SEQ ID NO:7
[0326] QNYSPQYDSYDVKSGVAVG
[0327] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0328] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0329] CGGVGAAAIAGIG
[0330] SEQ ID NO:8
[0331] QNYSPQYDSYDVKSGVAVG
[0332] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGE
[0333] GEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGE
[0334] CGGVGAAAI
[0335] SEQ ID NO:9
[0336] QNYSPQYDSYDVKSGVAVG
[0337] GEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGEAGEPGKNGAKEGEPGPRGERGEAGE
[0338] GEPGKNGAKEGEPGPRGERGEAGEPGKNGAKEGEPGPRGERGEAGE
[0339] CGGVG
[0340] SEQ ID NO:10
[0341] QNYSPQYDSYDVKSGVAVG
[0342] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEAGEPGKNGAKGEPGPRGERGEAGEAGEPGKNGAKGEPGPRGERGEAGE
[0343] C
[0344] SEQ ID NO:11
[0345] NYSPQYDSYDVKSGVAVG
[0346] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEAGEPGKNGAKGEPGPRGERGEAGE
[0347] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA Page 23 / 36 of the specification 26 CN 121449726 A
[0348] CGGVGAAAI
[0349] SEQ ID NO:12
[0350] YSPQYDSYDVKSGVAVG
[0351] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0352] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0353] CGGVGAAAI
[0354] SEQ ID NO:13
[0355] SPQYDSYDVKSGVAVG
[0356] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0357] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0358] CGGVGAAAI
[0359] SEQ ID NO:14
[0360] PQYDSYDVKSGVAVG
[0361] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0362] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0363] CGGVGAAAI
[0364] SEQ ID NO:15
[0365] QYDSYDVKSGVAVG
[0366] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0367] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0368] CGGVGAAAI
[0369] SEQ ID NO:16
[0370] YDSYDVKSGVAVG
[0371] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA [第24 / 36页 27 CN 121449726 A]
[0372] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0373] CGGVGAAAI
[0374] SEQ ID NO:17
[0375] SYDVKSGVAVG
[0376] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0377] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0378] CGGVGAAAI
[0379] SEQ ID NO:18
[0380] DVKSGVAVG
[0381] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKN It should be noted that there are some unclear parts in the original text, especially the "说 明 书 24 / 36页 27 CN 121449726 A" which is not in a standard format for translation. The above translation tries to make sense of the overall context while keeping the original tags and text structure as much as possible. If there are any further clarifications or corrections needed, please let me know.GAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGE AGEPGKNGAKGEPGPRGERGEA
[0382] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0383] CGGVGAAAI
[0384] SEQ ID NO:19
[0385] GERGAAGLPGPKGDRGDAGPKGERGAAGLPGPKGDRGDAGPKGERGAAGLPGPKGDRGDAGPKGERGAA GLPGPKGDRGDAGPKGERGAAGLPGPKGDRGDAGPKGERGAAGLPPGDRGDAGPKGERGAAGLPGPKGDRGDAGP KGERGAAGLPGPKGDRGDAGPKGERGAAGLPGPKGDRGDAGPKGERGAAGLPPGDRGDAGPK
[0386] SEQ ID NO:20
[0387] QYDSYDVKSGVAVG
[0388] SEQ ID NO:21
[0392] GPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGVGEKGPEGAPGKDGPKGDR GDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGK DGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKD
[0393] SEQ ID NO:22
[0394] QYDSYDVKSGVAVG
[0395] GPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDR GDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGK DGPKGDRGDVGEKGPEGAP
[0396] GKDGPKGDRGDVGEKGPEGAPGKDGPKGDRGDVGEKGPEGAPGKD
[0397] CGGVGAAAI
[0398] SEQ ID NO:23
[0399] QYDSYDVKSGVAVG
[0400] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEP
[0401] GPRGERGEA
[0402] CGGVGAAAI
[0403] SEQ ID NO:24 Specification Page 25 / 36 28 CN 121449726 A
[0404] QYDSYDVKSGVAVG
[0405] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEA
[0406] SEQ ID NO:25
[0407] GEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEPGPRGERGEAGEPGKNGAKGEP
[0408] GPRGERGEA
[0409] CGGVGAAAI
[0410] SEQ ID NO:26
[0411] QYDSYDVKSGVAVG
[0412] CGGVGAAAI
[0413] SEQ ID NO:27
[0414] CAACTGAGCTACGGCTACGACGAAAAATCTACCGGTGGCATTTCCGTTCCAGGTGAACCAGGCAAGAAC GGTGCTAAAGGCGAACCTGGTCCGCGTGGCGAACGTGGTGAAGCTGGCGAACCAGGCAAGAACGGCGCGAAAGGCGA GCCTGGTCCACGTGGTGAGCGTGGTGAAGCCGGTGAGCCGGGTAAAAACGGCGCGAAAGGTGAACCAGGTCCACGCGGTGAACGTGGCGAAGCGGGTGAACCGGGTAAAAACGGTGCGAAAGGTGAGCCGGGTCCACGTGGCGAACGTGGTGAG GCTGGTGAACCGGGTAAGAACGGTGCCAAAGGTGAACCGGGTCCACGTGGTGAACGTGGTGAAGCTGGTGAACCGGG CAAAAATGGTGCTAAAGGTGAACCTGGTCCACGTGGTGAACGCGGTGAGGCAGGTGAACCTGGTAAGAACGGTGCAA AGGGCGAACCGGGTCCTCGCGGTGAACGTGGTGAAGCCGGTGAACCGGGCAAAAACGGTGCTAAAGGTGAGCCTGGT CCTCGTGGTGAACGTGGCGAAGCTGGCGAACCAGGTAAAAACGGTGCAAAGGGTGAACCGGGTCCACGCGGTGAACG CGGTGAAGCAGGTGAACCAGGTAAAAACGGCGCAAAAGGTGAACCGGGTCCTCGTGGTGAACGCGGTGAAGCTTCTG CCGGTTTCGACTTTTCTTTCCTGCCACAGCCGCCGCAGGAGAAAGCTCACGACGGCGGTCGTTACTATCGTGCG
[0415] SEQ ID NO:28
[0416] CAAATGGCAGGCGGTTTTGATGAAAAAGCAGGCGGCGCACAGCTGGGCGTTAT
[0417] GCAGGGCGAACCGGGCAAAAATGGCGCCAAAGGTGAACCGGGCCCGCGCGGCGAA
[0418] CGCGGCGAAGCGGGCGAACCGGGCAAGAACGGCGCGAAAGGCGAACCGGGCCCG
[0419] CGTGGTGAACGCGGCGAAGCAGGTGAACCGGGCAAAAATGGGGCGAAAGGCGAA
[0420] CCGGGTCCACGCGGTGAACGTGGTGAAGCCGGCGAACCGGGCAAAAACGGCGCCA
[0421] AAGGCGAACCGGGCCCGCGTGGCGAACGCGGAGAAGCCGGCGAACCGGGTAAAAA
[0422] TGGCGCGAAAGGCGAACCGGGTCCGCGTGGTGAACGCGGCGAAGCCGGCGAACCG
[0423] GGCAAAAATGGTGCGAAAGGCGAACCGGGCCCGCGTGGCGAACGCGGCGAAGCCG
[0424] GCGAACCGGGCAAGAACGGCGCGAAAGGCGAACCTGGCCCGCGTGGCGAACGCG
[0425] GCGAAGCGGGCGAACCGGGCAAAAACGGCGCCAAAGGTGAACCTGGCCCGCGTGG
[0426] CGAACGTGGGGAAGCGGGTGAACCGGGCAAAAATGGTGCGAAAGGCGAACCGGGT
[0427] CCGCGTGGCGAACGCGGCGAAGCGGGCGAACCGGGTAAAAACGGTGCGAAAGGC
[0428] GAACCGGGTCCGCGTGGCGAACGTGGCGAAGCGGGTCCGGGCATCGATATGAGCGC
[0429] CTTTGCGGGCCTGGGCCCGCGCGAAAAAGGTCCGGATCCGCTGCAGTATATGCGCG
[0430] CA
[0431] SEQ ID NO:29
[0432] CAGAATTATAGTCCGCAATATGATTCATATGATGTGAAAAGCGGCGTTGCGGTTG
[0433] GTGGCGAACCGGGCAAAAACGGTGCGAAAGGGGAACCGGGCCCGCGTGGAGAAC Description 26 / 36 pages 29 CN 121449726 A
[0434] GCGGCGAAGCGGGTGAACCGGGCAAAAATGGTGCGAAAGGCGAACCGGGCCCGCG
[0435] CGGTGAACGCGGTGAAGCGGGCGAACCTGGCAAAAATGGCGCGAAAGGCGAACCG
[0436] GGCCCGCGTGGCGAACGCGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCCAAAG
[0437] GCGAACCTGGTCCGCGCGGCGAACGTGGTGAAGCCGGCGAACCAGGCAAAAACGG
[0438] TGCGAAAGGAGAACCGGGTCCGCGCGGTGAACGTGGCGAAGCGGGCGAACCGGGT
[0439] AAAAACGGTGCAAAAGGCGAACCGGGCCCGCGCGGTGAACGCGGCGAAGCGGGC
[0440] GAACCGGGTAAAAATGGTGCCAAAGGCGAACCGGGCCCGCGCGGCGAACGTGGCG
[0441] AAGCGGGTGAGCCGGGCAAAAACGGCGCCAAAGGCGAGCCGGGCCCGCGTGGCG
[0442] AACGCGGTGAAGCCGGCGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCC
[0443] GCGTGGCGAACGCGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGA
[0444] ACCGGGCCCGCGCGGTGAACGTGGCGAAGCATGCGGCGGCGTGGGCGCGGCGGCC
[0445] ATTGCCGGTATTGGCGGTGAAAAAGCGGGCGGTTTTGCCCCGTATTATGGT
[0446] SEQ ID NO:30
[0447] GGCGAACCGGGTAAAAATGGCGCCAAAGGCGAACCGGGTCCGCGTGGTGAAC
[0448] GCGGCGAAGCCGGTGAACCGGGCAAAAATGGCGCGAAGGGTGAACCGGGCCCGCG
[0449] CGGCGAACGTGGCGAAGCAGGCGAACCGGGCAAAAACGGTGCAAAAGGTGAACC
[0450] GGGCCCGCGTGGTGAACGCGGAGAGGCAGGCGAACCGGGTAAAAATGGTGCGAAA
[0451] GGTGAACCGGGCCCGCGTGGCGAGCGTGGCGAAGCCGGCGAACCGGGCAAAAACG
[0452] GCGCGAAAGGCGAACCGGGCCCGCGTGGCGAACGCGGTGAAGCCGGCGAGCCGG
[0453] GCAAAAACGGTGCGAAAGGCGAACCGGGCCCGCGTGGCGAACGCGGCGAAGCCG
[0454] GTGAACCGGGCAAAAACGGTGCGAAAGGCGAACCGGGTCCGCGTGGCGAACGTGG
[0455] CGAAGCCGGAGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGTCCGCGTGGC
[0456] GAACGCGGCGAAGCAGGCGAACCGGGTAAAAATGGCGCGAAAGGCGAACCGGGTC
[0457] CGCGTGGTGAACGCGGCGAAGCCGGCGAACCGGGCAAAAACGGTGCGAAAGGCG
[0458] AACCGGGTCCGCGTGGCGAACGTGGCGAAGCG
[0459] SEQ ID NO:31
[0460] CAAAATTATAGCCCTCAGTACGATAGCTACGATGTAAAAAGCGGCGTGGCAGTG
[0461] GGTGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGCGGTGAAC
[0462] GCGGTGAAGCGGGCGAACCGGGCAAAAATGGTGCCAAAGGTGAACCGGGTCCGCG
[0463] CGGTGAACGCGGCGAAGCTGGTGAACCGGGCAAAAACGGTGCGAAAGGCGAACC
[0464] GGGCCCGCGCGGTGAACGTGGCGAAGCGGGCGAACCGGGTAAAAACGGCGCGAA
[0465] AGGCGAACCGGGTCCGCGCGGCGAACGTGGTGAAGCGGGCGAACCGGGCAAAAA
[0466] CGGTGCGAAAGGTGAACCGGGTCCGCGCGGCGAACGCGGCGAAGCCGGCGAACCT
[0467] GGCAAAAACGGCGCGAAAGGCGAACCGGGTCCGCGCGGTGAACGTGGCGAAGCG
[0468] GGTGAACCGGGCAAAAATGGGGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGCG
[0469] GCGAAGCCGGCGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCCGCGTGG
[0470] CGAACGTGGCGAAGCGGGCGAACCTGGCAAAAATGGCGCCAAAGGCGAACCGGGC
[0471] CCGCGTGGCGAACGCGGCGAAGCCGGTGAACCCGGTAAAAACGGCGCCAAAGGTG
[0472] AACCGGGCCCGCGCGGTGAACGCGGCGAAGCGTGCGGTGGCGTGGGTGCGGCGGC Page 27 / 36 of the specification 30 CN 121449726 A
[0473] GATTGCAGGCATTGGTGGCGAAAAAGCGGGTGGCTTTGCT
[0474] SEQ ID NO:32
[0475] CAGAATTATAGTCCGCAATATGATTCATATGATGTGAAAAGCGGCGTTGCGGTTG
[0476] GTGGCGAACCGGGCAAAAACGGTGCGAAAGGGGAACCGGGCCCGCGTGGAGAAC
[0477] GCGGCGAAGCGGGTGAACCGGGCAAAAATGGTGCGAAAGGCGAACCGGGCCCGCG
[0478] CGGTGAACGCGGTGAAGCGGGCGAACCTGGCAAAAATGGCGCGAAAGGCGAACCG
[0479] GGCCCGCGTGGCGAACGCGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCCAAAG
[0480] GCGAACCTGGTCCGCGCGGCGAACGTGGTGAAGCCGGCGAACCAGGCAAAAACGG
[0481] TGCGAAAGGAGAACCGGGTCCGCGCGGTGAACGTGGCGAAGCGGGCGAACCGGGT
[0482] AAAAACGGTGCAAAAGGCGAACCGGGCCCGCGCGGTGAACGCGGCGAAGCGGGC
[0483] GAACCGGGTAAAAATGGTGCCAAAGGCGAACCGGGCCCGCGCGGCGAACGTGGCG
[0484] AAGCGGGTGAGCCGGGCAAAAACGGCGCCAAAGGCGAGCCGGGCCCGCGTGGCG
[0485] AACGCGGTGAAGCCGGCGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCC
[0486] GCGTGGCGAACGCGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGA
[0487] ACCGGGCCCGCGCGGTGAACGTGGCGAAGCATGCGGCGGCGTGGGCGCGGCGGCC
[0488] ATTGCCGGTATTGGCGGTGAAAAAGCG
[0489] SEQ ID NO:33
[0490] CAAAATTATAGCCCTCAGTACGATAGCTACGATGTAAAAAGCGGCGTGGCAGTG
[0491] GGTGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGCGGTGAAC
[0492] GCGGTGAAGCGGGCGAACCGGGCAAAAATGGTGCCAAAGGTGAACCGGGTCCGCG
[0493] CGGTGAACGCGGCGAAGCTGGTGAACCGGGCAAAAACGGTGCGAAAGGCGAACC
[0494] GGGCCCGCGCGGTGAACGTGGCGAAGCGGGCGAACCGGGTAAAAACGGCGCGAA
[0495] AGGCGAACCGGGTCCGCGCGGCGAACGTGGTGAAGCGGGCGAACCGGGCAAAAA
[0496] CGGTGCGAAAGGTGAACCGGGTCCGCGCGGCGAACGCGGCGAAGCCGGCGAACCT
[0497] GGCAAAAACGGCGCGAAAGGCGAACCGGGTCCGCGCGGTGAACGTGGCGAAGCG
[0498] GGTGAACCGGGCAAAAATGGGGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGCG
[0499] GCGAAGCCGGCGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCCGCGTGG
[0500] CGAACGTGGCGAAGCGGGCGAACCTGGCAAAAATGGCGCCAAAGGCGAACCGGGC
[0501] CCGCGTGGCGAACGCGGCGAAGCCGGTGAACCCGGTAAAAACGGCGCCAAAGGTG
[0502] AACCGGGCCCGCGCGGTGAACGCGGCGAAGCGTGCGGTGGCGTGGGTGCGGCGGC
[0503] GATTGCAGGCATTGGT
[0504] SEQ ID NO:34
[0505] CAGAACTATTCTCCGCAGTATGATAGCTATGATGTTAAAAGCGGTGTTGCGGTGG
[0506] GCGGTGAACCGGGCAAAAATGGCGCGAAAGGCGAGCCGGGCCCGCGCGGCGAACG
[0507] TGGTGAAGCAGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGC
[0508] GGCGAACGTGGTGAAGCAGGCGAACCGGGCAAGAATGGTGCCAAAGGTGAACCAG
[0509] GACCGCGTGGTGAACGTGGCGAAGCCGGGGAACCGGGTAAAAACGGCGCGAAAG
[0510] GCGAACCGGGCCCGCGCGGCGAACGTGGCGAAGCAGGTGAACCGGGCAAAAATGG
[0511] AGCGAAAGGCGAACCGGGTCCGCGCGGCGAACGCGGCGAAGCAGGCGAACCGGG Specification 28 / 36 pages 31 CN 121449726 A
[0512] CAAAAATGGCGCGAAAGGCGAACCCGGCCCGCGCGGTGAACGCGGCGAAGCGGGC
[0513] GAGCCGGGTAAAAATGGTGCGAAAGGCGAACCGGGTCCGCGTGGTGAACGTGGCG
[0514] AAGCCGGCGAACCGGGTAAAAACGGCGCCAAAGGCGAACCGGGCCCGCGTGGCGA
[0515] ACGTGGGGAAGCCGGTGAACCGGGCAAAAATGGCGCTAAAGGCGAACCGGGTCCG
[0516] CGCGGCGAACGTGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAA
[0517] CCGGGCCCGCGCGGTGAACGCGGTGAAGCCTGCGGCGGCGTAGGCGCCGCGGCGA
[0518] TC
[0519] SEQ ID NO:35
[0520] CAGAACTATTCTCCGCAGTATGATAGCTATGATGTTAAAAGCGGTGTTGCGGTGG
[0521] GCGGTGAACCGGGCAAAAATGGCGCGAAAGGCGAGCCGGGCCCGCGCGGCGAACG
[0522] TGGTGAAGCAGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGC
[0523] GGCGAACGTGGTGAAGCAGGCGAACCGGGCAAGAATGGTGCCAAAGGTGAACCAG
[0524] GACCGCGTGGTGAACGTGGCGAAGCCGGGGAACCGGGTAAAAACGGCGCGAAAG
[0525] GCGAACCGGGCCCGCGCGGCGAACGTGGCGAAGCAGGTGAACCGGGCAAAAATGG
[0526] AGCGAAAGGCGAACCGGGTCCGCGCGGCGAACGCGGCGAAGCAGGCGAACCGGG
[0527] CAAAAATGGCGCGAAAGGCGAACCCGGCCCGCGCGGTGAACGCGGCGAAGCGGGC
[0528] GAGCCGGGTAAAAATGGTGCGAAAGGCGAACCGGGTCCGCGTGGTGAACGTGGCG
[0529] AAGCCGGCGAACCGGGTAAAAACGGCGCCAAAGGCGAACCGGGCCCGCGTGGCGA
[0530] ACGTGGGGAAGCCGGTGAACCGGGCAAAAATGGCGCTAAAGGCGAACCGGGTCCG
[0531] CGCGGCGAACGTGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAA
[0532] CCGGGCCCGCGCGGTGAACGCGGTGAAGCCTGCGGCGGCGTAGGC
[0533] SEQ ID NO:36
[0534] CAGAACTATTCTCCGCAGTATGATAGCTATGATGTTAAAAGCGGTGTTGCGGTGG
[0535] GCGGTGAACCGGGCAAAAATGGCGCGAAAGGCGAGCCGGGCCCGCGCGGCGAACG
[0536] TGGTGAAGCAGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGC
[0537] GGCGAACGTGGTGAAGCAGGCGAACCGGGCAAGAATGGTGCCAAAGGTGAACCAG
[0538] GACCGCGTGGTGAACGTGGCGAAGCCGGGGAACCGGGTAAAAACGGCGCGAAAG
[0539] GCGAACCGGGCCCGCGCGGCGAACGTGGCGAAGCAGGTGAACCGGGCAAAAATGG
[0540] AGCGAAAGGCGAACCGGGTCCGCGCGGCGAACGCGGCGAAGCAGGCGAACCGGG
[0541] CAAAAATGGCGCGAAAGGCGAACCCGGCCCGCGCGGTGAACGCGGCGAAGCGGGC
[0542] GAGCCGGGTAAAAATGGTGCGAAAGGCGAACCGGGTCCGCGTGGTGAACGTGGCG
[0543] AAGCCGGCGAACCGGGTAAAAACGGCGCCAAAGGCGAACCGGGCCCGCGTGGCGA
[0544] ACGTGGGGAAGCCGGTGAACCGGGCAAAAATGGCGCTAAAGGCGAACCGGGTCCG
[0545] CGCGGCGAACGTGGCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAA
[0546] CCGGGCCCGCGCGGTGAACGCGGTGAAGCCTGC
[0547] SEQ ID NO:37
[0548] AACTATAGCCCGCAGTATGATAGTTATGATGTAAAAAGCGGCGTCGCGGTGGGT
[0549] GGCGAGCCGGGAAAAAATGGCGCCAAAGGCGAACCGGGCCCGCGCGGCGAACGTG
[0550] GTGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGTGAACCGGGCCCGCGCGG Description 29 / Page 36, Sheet 32 CN 121449726 A
[0551] CGAACGTGGTGAAGCGGGCGAACCGGGTAAAAATGGTGCGAAAGGCGAACCGGGT
[0552] CCGCGTGGCGAACGCGGCGAAGCAGGTGAACCGGGCAAAAACGGCGCGAAAGGC
[0553] GAACCGGGCCCGCGTGGCGAACGTGGCGAAGCGGGCGAACCGGGCAAAAACGGC
[0554] GCGAAAGGCGAACCGGGCCCGCGCGGAGAACGTGGCGAAGCAGGCGAACCGGGT
[0555] AAAAATGGCGCAAAAGGCGAACCGGCCCTCGTGGCGAACGTGGTGAAGCGGGTG
[0556] AACCGGGCAAAAATGGCGCGGAAAAGGTGAACCGGGCCCGCGGTGGTGAACGGTGA
[0557] AGCGGGCGAACCGGGGCAAAAACGGCGCGGCGA
[0558] ACGTGGTGAAGCGGGTGAAACCGGGCAAAAACGGCGCAAAAGGTGAACCGGCC
[0559] GCGTGGCGGAACGTGGCGGAAGCCGGCGGAACCGGGCAAAAACGGCGCGCAAAGGCGA
[0560] ACCGGGCCCGCGCGGCGGAGCCGGAGAAGCCTGTGGCGGCGGTGGCGCGCGCAGCT
[0561] ATT
[0562] SEQ ID NO:38
[0563] TATAGCCCGCAGTACGATTCATACGATGTGGAAAAGCGGTTGCAGTTGGGCGGC
[0564] GAACCGGGCAAAAATGGTGCGAAAGGCGAACCTGGCCCGCGTGGCGAACGTGGCG
[0565] AGGCCGGCGAACCGGGGCAAAACGGTGCGAAAGGCGAACCGGGCCCGGCGGCG
[0566] AACGTGGTGAAGCAGGTGAACCGGGCAAAAATGGTGCGAAAGGCGAACCGGGAC
[0567] TCGCGGGGAACGTGGCGAGGCGGCGAGCCGGGGCAAAAATGGCCAAAGGCGA
[0568] ACCGGGCCCGCGCGGTGAACGTGGCGAGGCGGGCGAACCGGGCAAAAATGGCGCA
[0569] AAAGGCGAACCGGGCCCGCGTGGTGAACGCGGTGAGGCAGGCGAACCGGGCAAA
[0570] AACGGGGCGAAAGGTGAACCGGGCCCGCGCGGTGAACGTGGTGAAAGCAGGCGAA
[0571] CCGGGTAAAAACGGCGCCAAAGGTGAACCGGGTCCGCGCGGAGAACGCGGTGAAAG
[0572] CGGGTGAACCGGGCAAAAACGGCGCAAAAGGCGAACCGGGCCCGCGCGGCGAAC
[0573] GTGGCGAAGCAGGCGAACCGGGCAAAAATGGTGCAAAAGGTGAACCGGGCCCGCG
[0574] TGGCGAACGCGGCGAAGCTGGCGAACCGGGCAAAAACGGCGCGAAAGGCGAACC
[0575] GGGTCCGCGCGGTGAACGCGGCGAAGCGTGCGGTGGTGTTGGCGCCGCCGCAATTSEQ ID NO:39
[0576] AGCCCGCAGTATGACAGCTATGATGTGAAATCTGGCGTAGCGGTAGGTGGTGAA
[0577] CCGGGTAAAAACGGCGCGAAAGGTGAACCCGGCCCGCGCGGCGAACGTGGCGAAG
[0578] CGGGTGAACCGGGCAAAAACGGTGCAAAAGGCGAACCGGGCCCGCGTGGTGAACG
[0579] TGGCGAAGCAGGTGAACCGGGAAAAAATGGTGCCAAAGGCGAACCGGGTCCGCGT
[0580] GGCGAACGCGGCGAAGCGGGTGAACCGGGCAAAAATGGTGCCAAAGGCGAACCG
[0581] GGCCCGCGCGGTGAACGCGGTGAAGCGGGTGAACCGGGTAAAAACGGCGCGAAAG
[0582] GTGAACCGGGTCCGCGTGGTGAACGCGGTGAAGCGGGCGAACCGGGCAAAAACGG
[0583] CGCGAAAGGTGAGCCGGGTCCGCGCGGTGAACGCGGCGAAGCAGGCGAACCGGGC
[0584] AAAAACGGCGCGAAAGGTGAACCGGGCCCGCGCGGTGAACGTGGCGAAGCCGGTG
[0585] AACCGGGAAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGCGGCGAACGCGGTG
[0586] AAGCGGGCGAACCGGGTAAAAACGGCGCGAAAGGCGAACCAGGCCCGCGTGGCG
[0587] AACGCGGAGAAGCAGGCGAGCCGGGTAAAAATGGCGCGAAAGGCGAACCGGGCC
[0588] CCCGCGGGGAACGCGGTGAAGCGTGCGGCGGTGTGGGCGCGGCGGCGATT
[0589] SEQ ID NO:40 Specification Page 30 / 36, 33 CN 121449726 A
[0590] CCGCAGTACGATTCATATGATGTTAAAAGCGGTGTGGCCGTGGGCGGTGAACCG
[0591] GGAAAAAACGGCGCGAAAGGCGAACCGGGCCCGCGTGGCGAACGTGGTGAAGCC
[0592] GGTGAACCGGGTAAAAATGGTGCCAAAGGCGAACCGGGTCCGCGTGGCGAACGTG
[0593] GCGAAGCGGGCGAACCGGGCAAAAATGGCGCGAAAGGCGAACCGGGCCCGCGCG
[0594] GCGAACGCGGCGAGGCAGGCGAACCGGGTAAAAACGGCGCCAAAGGCGAACCGG
[0595] GTCCGCGCGGCGAACGCGGCGAAGCCGGTGAACCGGGTAAAAATGGCGCAAAAGG
[0596] AGAACCGGGCCCGCGCGGCGAACGCGGCGAAGCGGGCGAACCGGGCAAAAACGG
[0597] CGCGAAAGGCGAACCAGGCCCGCGCGGCGAACGTGGGGAGGCCGGTGAACCGGG
[0598] CAAAAACGGTGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGTGGCGAAGCGGG
[0599] AGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCCGCGTGGCGAACGTGGC
[0600] GAAGCGGGTGAACCGGGCAAAAATGGTGCAAAAGGCGAACCGGGCCCGCGTGGTG
[0601] AACGCGGTGAAGCAGGCGAACCGGGCAAAAACGGAGCCAAAGGTGAACCGGGTC
[0602] CGCGCGGCGAACGCGGCGAAGCCTGCGGCGGCGTGGGCGCGGCCGCCATT
[0603] SEQ ID NO:41
[0604] CAGTATGATAGCTATGATGTTAAAAGCGGTGTGGCCGTGGGTGGCGAACCGGGC
[0605] AAAAATGGTGCCAAAGGCGAACCGGGTCCGCGTGGCGAACGCGGCGAAGCGGGTG
[0606] AACCGGGTAAAAATGGTGCCAAAGGCGAACCGGGTCCGCGCGGCGAACGCGGCGA
[0607] AGCCGGTGAACCGGGCAAAAATGGCGCGAAAGGTGAACCGGGCCCCCGCGGCGAG
[0608] CGTGGCGAAGCCGGTGAACCGGGCAAAAATGGTGCAAAAGGCGAACCGGGTCCGC
[0609] GCGGTGAACGCGGCGAGGCCGGCGAACCTGGCAAAAACGGTGCCAAAGGCGAACC
[0610] CGGCCCGCGCGGCGAACGTGGCGAAGCGGGTGAACCGGGTAAAAATGGAGCCAAA
[0611] GGCGAACCGGGCCCGCGCGGCGAACGCGGCGAAGCAGGCGAACCTGGCAAAAAC
[0612] GGTGCGAAAGGCGAACCGGGTCCGCGTGGCGAACGCGGCGAAGCGGGCGAACCG
[0613] GGCAAAAATGGCGCGAAAGGCGAACCTGGCCCTCGCGGCGAACGTGGCGAAGCGG
[0614] GCGAACCGGGTAAAAACGGTGCCAAAGGCGAACCGGGCCCGCGCGGTGAACGTGG
[0615] CGAAGCGGGAGAACCGGGCAAAAATGGCGCCAAAGGCGAACCGGGTCCGCGTGGT
[0616] GAACGCGGCGAAGCGTGCGGTGGCGTGGGCGCGGCAGCGATT
[0617] SEQ ID NO:42
[0618] TATGATTCCTATGATGTTAAAAGTGGTGTTGCGGTGGGTGGTGAACCTGGTAAA
[0619] AACGGCGCCAAAGGCGAACCGGGCCCGCGTGGTGAACGCGGTGAGGCAGGCGAAC
[0620] CGGGCAAAAATGGCGCAAAAGGCGAACCGGGCCCGCGTGGCGAACGTGGTGAAGC
[0621] GGGTGAACCGGGCAAGAATGGCGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGC
[0622] GGCGAAGCCGGCGAACCGGGCAAAAACGGTGCAAAAGGTGAACCGGGCCCGCGT
[0623] GGCGAACGTGGCGAAGCAGGCGAACCGGGTAAAAACGGCGCGAAAGGCGAACCG
[0624] GGCCCGCGCGGCGAACGTGGCGAAGCCGGTGAACCGGGCAAAAACGGTGCGAAA
[0625] GGCGAACCGGGCCCGCGTGGTGAACGCGGTGAAGCCGGTGAACCGGGTAAAAATG
[0626] GCGCGAAAGGTGAACCGGGTCCGCGCGGCGAGCGCGGCGAAGCGGGCGAACCGG
[0627] GCAAAAATGGCGCCAAAGGCGAACCGGGGCCGCGCGGTGAACGCGGCGAAGCGG
[0628] GCGAACCGGGGAAAAACGGCGCGAAAGGTGAACCGGGCCCGCGTGGTGAACGCG Specification 31 / 36 Page 34 CN 121449726 A
[0629] GTGAAGCGGGCGAACCGGGTAAAAATGGAGCGAAAGGCGAACCGGGCCCGCGCGG
[0630] CGAACGTGGTGAAGCGTGCGGCGGCGTGGGCGCGGCCGCCATT
[0631] SEQ ID NO:43
[0632] TCCTATGATGTTAAAAGTGGTGTTGCGGTGGGTGGTGAACCTGGTAAAAACGGC
[0633] GCCAAAGGCGAACCGGGCCCGCGTGGTGAACGCGGTGAGGCAGGCGAACCGGGCA
[0634] AAAATGGCGCAAAAGGCGAACCGGGCCCGCGTGGCGAACGTGGTGAAGCGGGTGA
[0635] ACCGGGCAAGAATGGCGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGCGGCGAA
[0636] GCCGGCGAACCGGGCAAAAACGGTGCAAAAGGTGAACCGGGCCCGCGTGGCGAAC
[0637] GTGGCGAAGCAGGCGAACCGGGTAAAAACGGCGCGAAAGGCGAACCGGGCCCGC
[0638] GCGGCGAACGTGGCGAAGCCGGTGAACCGGGCAAAAACGGTGCGAAAGGCGAAC
[0639] CGGGCCCGCGTGGTGAACGCGGTGAAGCCGGTGAACCGGGTAAAAATGGCGCGAA
[0640] AGGTGAACCGGGTCCGCGCGGCGAGCGCGGCGAAGCGGGCGAACCGGGCAAAAAT
[0641] GGCGCCAAAGGCGAACCGGGGCCGCGCGGTGAACGCGGCGAAGCGGGCGAACCG
[0642] GGGAAAAACGGCGCGAAAGGTGAACCGGGCCCGCGTGGTGAACGCGGTGAAGCG
[0643] GGCGAACCGGGTAAAAATGGAGCGAAAGGCGAACCGGGCCCGCGCGGCGAACGTG
[0644] GTGAAGCGTGCGGCGGCGTGGGCGCGGCCGCCATT
[0645] SEQ ID NO:44
[0646] GATGTTAAAAGTGGTGTTGCGGTGGGTGGTGAACCTGGTAAAAACGGCGCCAA
[0647] AGGCGAACCGGGCCCGCGTGGTGAACGCGGTGAGGCAGGCGAACCGGGCAAAAAT
[0648] GGCGCAAAAGGCGAACCGGGCCCGCGTGGCGAACGTGGTGAAGCGGGTGAACCGG
[0649] GCAAGAATGGCGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGCGGCGAAGCCGG
[0650] CGAACCGGGCAAAAACGGTGCAAAAGGTGAACCGGGCCCGCGTGGCGAACGTGGC
[0651] GAAGCAGGCGAACCGGGTAAAAACGGCGCGAAAGGCGAACCGGGCCCGCGCGGC
[0652] GAACGTGGCGAAGCCGGTGAACCGGGCAAAAACGGTGCGAAAGGCGAACCGGGC
[0653] CCGCGTGGTGAACGCGGTGAAGCCGGTGAACCGGGTAAAAATGGCGCGAAAGGTG
[0654] AACCGGGTCCGCGCGGCGAGCGCGGCGAAGCGGGCGAACCGGGCAAAAATGGCGC
[0655] CAAAGGCGAACCGGGGCCGCGCGGTGAACGCGGCGAAGCGGGCGAACCGGGGAA
[0656] AAACGGCGCGAAAGGTGAACCGGGCCCGCGTGGTGAACGCGGTGAAGCGGGCGA
[0657] ACCGGGTAAAAATGGAGCGAAAGGCGAACCGGGCCCGCGCGGCGAACGTGGTGAA
[0658] GCGTGCGGCGGCGTGGGCGCGGCCGCCATT
[0659] SEQ ID NO:45
[0660] GGTGAACGTGGCGCGGCAGGTCTGCCGGGTCCGAAAGGCGATCGCGGCGATGC
[0661] CGGCCCGAAAGGCGAACGTGGTGCGGCGGGCCTTCCGGGCCCGAAAGGCGATCGC
[0662] GGTGATGCGGGCCCGAAAGGTGAACGTGGTGCGGCCGGCCTGCCGGGCCCGAAAG
[0663] GTGATCGCGGCGATGCGGGCCCGAAAGGTGAACGTGGCGCGGCGGGTCTGCCGGG
[0664] CCCGAAAGGCGATCGCGGCGATGCGGGCCCGAAAGGTGAACGTGGCGCGGCGGGC
[0665] CTGCCGGGCCCGAAAGGCGATCGCGGCGATGCGGGCCCGAAAGGTGAACGCGGCG
[0666] CAGCGGGTCTGCCGGGTCCGAAAGGCGATCGTGGTGATGCAGGTCCGAAAGGCGA
[0667] ACGTGGTGCAGCGGGCCTGCCGGGCCCGAAAGGTGATCGCGGCGATGCGGGCCCG Specification 32 / 36 pages 35 CN 121449726 A
[0668] AAAGGCGAACGTGGCGCAGCCGGCCTGCCGGGACCGAAAGGTGATCGTGGTGATG
[0669] CGGGCCCGAAAGGTGAACGTGGCGCCGCGGGCCTGCCGGGCCCGAAAGGTGATCG
[0670] CGGTGATGCGGGTCCGAAGGGCGAACGTGGCGCGGCGGGTCTGCCGGGCCCGAAA
[0671] GGCGATCGCGGCGATGCGGGCCCGAAA
[0672] SEQ ID NO:46
[0673] CAGTATGATAGCTATGATGTGAAAAGCGGGGTGGCGGTAGGCGGTGAACGTGG
[0674] CGCCGCGGGTCTGCCGGGCCCGAAGGGCGATCGTGGTGATGCGGGCCCGAAAGGA
[0675] GAGCGCGGCGCCGCGGGCCTGCCAGGCCCGAAAGGAGATCGCGGTGATGCGGGCC
[0676] CGAAAGGTGAACGTGGTGCCGCCGGCCTGCCGGGCCCGAAAGGCGATCGTGGCGA
[0677] TGCAGGCCCGAAAGGTGAACGTGGTGCCGCGGGTCTGCCGGGTCCGAAAGGCGAC
[0678] CGTGGCGATGCCGGCCCGAAAGGCGAACGCGGCGCGGCGGGCCTGCCGGGCCCGA
[0679] AAGGTGATCGTGGCGATGCAGGCCCGAAAGGCGAACGTGGCGCCGCCGGCCTGCC
[0680] GGGCCCTAAAGGCGACCGTGGTGATGCGGGCCCGAAAGGCGAACGCGGCGCCGCG
[0681] GGTCTGCCTGGCCCGAAAGGCGATCGTGGCGATGCGGGCCCGAAAGGCGAACGCG
[0682] GTGCGGCCGGTCTGCCGGGTCCGAAAGGCGATCGCGGCGATGCTGGCCCGAAAGGC
[0683] GAACGCGGCGCGGCAGGCCTGCCGGGCCCGAAAGGTGATCGTGGCGATGCAGGCC
[0684] CGAAAGGTGAACGCGGCGCGGCGGGCCTGCCGGGTCCGAAAGGTGATCGTGGCGA
[0685] TGCGGGTCCGAAATGCGGTGGCGTAGGCGCCGCGGCAATT
[0686] SEQ ID NO:47
[0687] GGCCCGAAAGGCGATCGCGGCGATGTTGGTGAAAAAGGCCCGGAAGGTGCGC
[0688] CGGGCAAAGATGGCCCGAAAGGTGATCGCGGTGATGTGGGCGAAAAAGGTCCGGA
[0689] AGGCGCCCCGGGCAAAGATGGCCCGAAAGGTGATCGTGGTGATGTGGGTGAAAAA
[0690] GGCCCGGAAGGCGCCCCGGGCAAAGATGGCCCGAAAGGCGATCGCGGCGATGTAG
[0691] GTGAAAAAGGTCCGGAAGGCGCGCCGGGAAAAGACGGCCCTAAAGGTGATCGTGG
[0692] TGATGTGGGTGAAAAAGGCCCGGAAGGCGCCCCGGGCAAAGATGGTCCGAAAGGC
[0693] GATCGCGGTGATGTGGGTGAAAAAGGCCCGGAAGGTGCACCGGGTAAGGATGGCC
[0694] CGAAAGGCGATCGTGGTGATGTTGGCGAAAAAGGCCCGGAAGGCGCACCGGGTAA
[0695] AGATGGTCCGAAAGGTGATCGCGGAGACGTGGGCGAAAAAGGCCCGGAAGGCGCG
[0696] CCGGGTAAAGACGGCCCGAAAGGCGATCGCGGCGATGTGGGCGAAAAAGGCCCGG
[0697] AAGGCGCGCCGGGCAAAGATGGCCCGAAAGGCGATCGCGGCGATGTGGGCGAAAA
[0698] AGGTCCGGAAGGCGCACCGGGCAAAGAT
[0699] SEQ ID NO:48
[0700] CAGTACGATAGTTATGATGTGAAATCGGGAGTAGCAGTGGGCGGTCCGAAAGG
[0701] CGATCGTGGCGATGTGGGCGAAAAGGGCCCGGAAGGCGCACCGGGCAAAGATGGC
[0702] CCGAAAGGCGATCGCGGTGATGTGGGCGAAAAAGGCCCGGAAGGTGCCCCGGGCA
[0703] AAGATGGCCCGAAAGGCGATCGCGGCGATGTGGGTGAAAAAGGCCCGGAAGGTGC
[0704] GCCGGGCAAAGATGGCCCGAAAGGTGATCGCGGCGATGTGGGTGAAAAAGGTCCG
[0705] GAAGGCGCACCGGGCAAAGATGGTCCGAAAGGCGATCGCGGTGATGTAGGCGAAA
[0706] AAGGACCGGAAGGTGCGCCGGGCAAAGATGGCCCGAAAGGTGATCGTGGTGATGT Specification Page 33 / 36, 36 CN 121449726 A
[0707] GGGTGAAAAAGGCCCGGAAGGCGCCCCGGGCAAAGATGGTCCGAAAGGCGATCGT
[0708] GGCGATGTGGGGGAAAAAGGCCCGGAAGGCGCCCCGGGCAAAGATGGCCCGAAAG
[0709] GCGATCGCGGCGATGTGGGCGAAAAAGGCCCGGAAGGCGCACCGGGCAAAGATGG
[0710] CCCGAAAGGTGATCGCGGTGATGTGGGCGAAAAAGGCCCCGAAGGTGCCCCGGGT
[0711] AAAGATGGCCCGAAAGGTGATCGTGGCGATGTAGGCGAAAAAGGTCCGGAAGGCG [X] CGCCTGGCAAAGATTGCGGTGGCGTGGGTGCAGCCGCCATT
[0713] SEQ ID NO:49
[0714] CAGTATGATTCATATGATGTTAAAAGTGGCGTAGCGGTGGGCGGTGAACCGGGC
[0715] AAAAATGGTGCGAAAGGCGAACCGGGCCCGCGTGGCGAACGTGGTGAAGCGGGCG
[0716] AACCGGGCAAAAATGGTGCCAAAGGCGAACCGGGCCCGCGTGGCGAACGCGGGGA
[0717] AGCGGGTGAACCCGGTAAAAATGGCGCCAAAGGCGAACCGGGCCCGCGCGGTGAA
[0718] CGTGGTGAAGCGTGTGGTGGCGTTGGCGCGGCCGCGATT
[0719] SEQ ID NO:50
[0720] CAGTATGATTCCTATGATGTTAAAAGTGGTGTTGCGGTGGGTGGTGAACCTGGTAAAAACGGCGCCAAA It should be noted that the "X" in the translation is just a placeholder for the original text which seems to be garbled or incomplete in the provided source. If there is a correct version of that part, it needs to be adjusted accordingly.GGCGAACCGGGCCCGCGTGGTGAACGCGGTGAGGCAGGCGAACCGGGCAAAAATGGCGCAAAAGGCGAACCGGGCCC GCGTGGCGAACGTGGTGAAGCGGGTGAACCGGGCAAGAATGGCGCGAAAGGCGAACCGGGCCCGCGTGGTGAACGCG GCGAAGCC
[0721] SEQ ID NO:51
[0722] GGCGAACCTGGCAAAAACGGCGCGAAAGGCGAACCTGGCCCGCGTGGTGAACGCGGCGAAGCGGGTGA ACCGGGCAAAAATGGCGCGAAAGGTGAACCGGGCCCGCGTGGTGAACGCGGCGAAGCCGGTGAACCGGGCAAAAAT GGTGCAAAAGGTGAACCGGGTCCGCGCGGCGAACGCGGTGAAGCATGCGGCGGCGTGGGTGCGGCGGCAATTSEQ ID NO:52
[0723] CAGTATGATAGCTATGATGTGAAAAGCGGTGTGGCCGTGGGCTGTGGCGGCGTGGGCGCGGCGGCGATT
[0724] SEQ ID NO:53
[0725] QLSYGYDEKSTGGISVP
[0726] SEQ ID NO:54
[0727] QMAGGFDEKAGGAQLGVMQ
[0728] SEQ ID NO:55
[0729] QNYSPQYDSYDVKSGVAVG
[0730] SEQ ID NO:56
[0731] SAGFDFSFLPQPPQEKAHDGGRYYRA
[0732] SEQ ID NO:57
[0733] GPGIDMSAFAGLGPREKGPDPLQYMRA
[0734] SEQ ID NO:58
[0735] CGGVGAAAIAGIGGEKAGGFAPYYG
[0736] SEQ ID NO:59
[0737] CAGCTGAGCTATGGCTATGATGAAAAAAGCACCGGCGGCATTAGCGTGCCG
[0738] SEQ ID NO:60
[0739] CAGATGGCGGGCGGTTTTGATGAAAAAGCGGGCGGTGCGCAGCTGGGTGTGATGCAG Specification 34 / 36 Page 37 CN 121449726 A
[0740] SEQ ID NO:61
[0741] CAGAACTATAGCCCGCAGTATGATAGCTATGATGTGAAAAGCGGCGTGGCGGTGGGC
[0742] SEQ ID NO:62
[0743] AGCGCGGGCTTTGATTTTAGCTTTCTGCCGCAGCCGCCGCAGGAAAAAGCGCATGATGGCGGCCGCTAT TATCGCGCG
[0744] SEQ ID NO:63
[0745] GGCCCGGGTATTGATATGTCAGCGTTTGCCGGCCTGGGTCCGCGTGAAAAAGGCCCGGATCCGCTGCAG TATATGCGTGCG
[0746] SEQ ID NO:64
[0747] TGTGGCGGCGTTGGTGCGGCCGCGATTGCAGGCATTGGTGGTGAAAAAGCGGGCGGCTTTGCACCGTAT TATGGC
[0748] SEQ ID NO:65
[0749] CGGVG
[0750] SEQ ID NO:66
[0751] CGGVGAAAI
[0752] SEQ ID NO:67
[0753] CGGVGAAAIAGIG
[0754] SEQ ID NO:68
[0755] CGGVGAAAIAGIGGEKA
[0756] SEQ ID NO:69
[0757] CGGVGAAAIAGIGGEKAGGFA SEQ ID NO:70
[0758] DVKSGVAVG
[0759] SEQ ID NO:71
[0760] SYDVKSGVAVG
[0761] SEQ ID NO:72
[0762] YDSYDVKSGVAVG
[0763] SEQ ID NO:73
[0764] QYDSYDVKSGVAVG
[0765] SEQ ID NO:74
[0766] PQYDSYDVKSGVAVG
[0767] SEQ ID NO:75
[0768] SPQYDSYDVKSGVAVG
[0769] SEQ ID NO:76
[0770] YSPQYDSYDVKSGVAVG
[0771] SEQ ID NO:77
[0772] NYSPQYDSYDVKSGVAVG
[0773] SEQ ID NO:78
[0774] GEPGKNGAKGEPGPRGERGEASEQ IDNO:79
[0775] GERGAAGLPGPKGDRGDAGPKSEQ ID NO:80 Specification 35 / 36 pages 38 CN 121449726 A
[0776] GPKGDRGDVGEKGPEGAPGKD
[0777] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0778] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately. Instruction manual, pages 36 / 36, 39 CN 121449726 A, Figure 1, Appendix 1 / 5, 40 CN 121449726 A, Figure 2, Appendix 2 / 5, 41 CN 121449726 A, Figure 3, Appendix 3 / 5, 42 CN 121449726 A, Figure 4, Appendix 4 / 5, 43 CN 121449726 A, Figure 5, Appendix 5 / 5, 44 CN 121449726 A. Abstract: The present invention relates to the technical field of collagen, and in particular to a recombinant collagen and its use. The recombinant collagen comprises AXBYCZ, wherein X and Z are each independently selected from 0 or 1, and Y is an integer greater than or equal to 0; when Y is 0, X and Z are not 0 at the same time; domain A is an N-terminal telopeptide of the collagen or a peptide segment thereof. domain B is Gly-Xaa-Yaa, and domain C is aC-terminal telopeptide of the collagen or a peptide segment thereof. The recombinant collagen can not only maintain high cell viability, cell adhesion rate, and cell migration rate, but also has an anti-inflammatory effect and a melanogenesis inhibitory effect, and can be widely applied to the fields of biomedicine, medical instruments and cosmetics, and the technical field of bioengineering.
Claims
1. A recombinant collagen, characterized in that, The recombinant collagen includes A X B Y C Z ; in, X and Z Independently selected from 0 or 1, Y Integers ≥ 0; when Y When it is 0, X and Z Not both are 0; Domain A is an N-terminal peptide of collagen or a peptide segment thereof, preferably an N-terminal peptide of human type I, II or III collagen or a peptide segment thereof. The B domain is Gly-Xaa-Yaa; The C domain is a C-terminal peptide of collagen or a peptide segment thereof, preferably a C-terminal peptide of human type I, II or III collagen or a peptide segment thereof.
2. The recombinant collagen according to claim 1, characterized in that, X , Y , Z Choose from any of the following groups: i)x is 0, Y For integers ≥ 1 Z =1; ii) x is 1, Y For integers ≥ 1 Z =0; iii) x is 1, Y For integers ≥ 1 Z =1; iv)x is 1, Y =0, Z =1; v)x is 0, Y For integers ≥ 1 Z =0; vi)x is 1, Y =0, Z It is 0.
3. The recombinant collagen according to claim 1 or 2, characterized in that, The amino acid sequence of the C domain contains at least 1 to 25 consecutive amino acids of human type III collagen C-terminal telopeptide, preferably at least 2 to 25 consecutive amino acids, and more preferably at least 5 to 25 consecutive amino acids; Preferably, the amino acid sequence of the C domain comprises at least 1 to 25 consecutive amino acids from the N-terminus of the human type III collagen C-terminal peptide, more preferably at least 2 to 25 consecutive amino acids from the N-terminus, and even more preferably at least 5 to 25 consecutive amino acids from the N-terminus.
4. The recombinant collagen according to claim 1, characterized in that, The amino acid sequence of the C domain is selected from cysteine or any one of SEQ ID NO: 56-58, 65-69.
5. The recombinant collagen according to claim 1, characterized in that, The amino acid sequence of the A domain contains at least 9 to 19 consecutive amino acids of the N-terminal telopeptide of human type III collagen. Preferably, the amino acid sequence of the A domain contains at least 9 to 19 consecutive amino acids from the C-terminus of the N-terminal telopeptide of human type III collagen.
6. The recombinant collagen according to claim 5, characterized in that, The amino acid sequence of domain A includes any one of SEQ ID NO: 53-55 and 70-77.
7. The recombinant collagen according to claim 1, characterized in that, The amino acid sequence of the B domain includes Gly-Xaa-Yaa from human collagen; The human-derived collagen is preferably one or more of type I, type II, type III, type IV, type V, type VI, type VII, type VIII, type IX, or type X collagen. Furthermore, the human-derived collagen is preferably one or more of type I collagen, type II collagen, or type III collagen.
8. The recombinant collagen according to claim 1, characterized in that, Y It can be an integer from 0 to 100, preferably an integer from 3 to 50; Preferably, the amino acid sequence of the B domain includes one or more of the amino acids in SEQ ID NO: 78-80.
9. The recombinant collagen according to any one of claims 1-8, characterized in that, The amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 1-26.
10. The recombinant collagen according to claim 9, characterized in that, The amino acid sequence of the recombinant collagen includes any one or more of SEQ ID NO: 3, 5-8, 11-18, 20, 22-26.
11. A nucleic acid, characterized in that, The nucleic acid comprises a nucleotide sequence encoding the recombinant collagen of any one of claims 1-10.
12. An expression carrier, characterized in that, The expression vector comprises the nucleic acid of claim 11, and / or the expression vector expresses the recombinant collagen of any one of claims 1-10; Preferably, the backbone of the expression vector includes a prokaryotic vector backbone or a eukaryotic vector backbone.
13. A host cell, characterized in that, The host cell comprises the expression vector of claim 12; Preferably, the host cell includes a eukaryotic cell or a prokaryotic cell; More preferably, the eukaryotic cells include one or more of yeast (e.g., Pichia pastoris or Saccharomyces cerevisiae), animal cells, or plant cells; More preferably, the prokaryotic cells include Escherichia coli or Bacillus (e.g., Bacillus subtilis or Bacillus licheniformis).
14. The application of any one of the recombinant collagen according to claims 1-10, the nucleic acid according to claim 11, the expression vector according to claim 12, or the host cell according to claim 13, characterized in that, The applications include: 1) Use in the preparation of medicaments for treating diseases; preferably, the diseases include inflammation or diseases for which inhibition of melanin is beneficial for treatment; 2) Application in the preparation of medical materials, preferably, the medical materials include one or more of the following: surgical sutures, medical sponges, medical dressings, hemostatic materials, artificial organs, filling materials, biological scaffolds, and drug carriers; 3) Used as an active ingredient in cosmetics, food additives, health products, or animal feed; The active ingredients in the cosmetic product preferably include whitening or anti-inflammatory ingredients.