Gene therapies for the front of the eye

Abstract

The present invention relates to therapies for ocular diseases or disorders in an individual. Provided herein are methods of delivering nucleic acid vectors to ocular cells (e.g., corneal endothelium, trabecular meshwork, etc.) in an anterior segment of an eye involving methods of administering nucleic acid vectors to an individual and methods of electrotransferring nucleic acid vectors to express a therapeutic transgene. Nucleic acid vectors for use in ocular diseases, such as Fukes dystrophy, are also provided.

Description

(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480024685.5 (22) Application Date 2024.02.09 (30) Priority Data 63 / 444,740 2023.02.10 US (85) PCT International Application Entering National Phase Date 2025.10.10 (86) PCT International Application Application Data PCT / US2024 / 015101 2024.02.09 (87) PCT International Application Publication Data WO2024 / 168210 EN 2024.08.15 (71) Applicant Alderflon LLC Address North Dakota, USA (72) Inventor Kenneth Mandel (74) Patent Agency Shenzhen Eagle Wing Intellectual Property Agency Co., Ltd. 44658 Patent Attorney Wang Yijin Ye Huanbiao (51) Int.Cl. C12N 15 / 85 (2006.01) A61K 48 / 00 (2006.01) (54) Invention Title Gene Therapy for the Anterior Segment of the Eye (57) Abstract This invention relates to a therapy for an individual's eye disease or disorder. This document provides methods for delivering nucleic acid vectors to ocular cells (e.g., corneal endothelium, trabecular meshwork, etc.) in the anterior segment of the eye, methods relating to the application of nucleic acid vectors to an individual and methods for electrotransferring nucleic acid vectors to express therapeutic transgenes. Nucleic acid vectors for ocular diseases, such as Fuchs dystrophy, are also provided. Claims (3 pages), Description (21 pages), Sequence Listing (electronic publication), Drawings (4 pages) CN 121002188 A 2025.11.21 CN 1 21 00 21 88 A 1. A method of expressing a transgene in ocular cells of the anterior segment of an eye in an individual, the method comprising: (a) administering a circular DNA vector to the anterior segment of the eye, wherein the circular DNA vector lacks one or more components of a plasmid backbone and encodes the transgene; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the circular DNA vector to the ocular cells of the anterior segment, thereby expressing the transgene in the ocular cells of the anterior segment. 2. The method of claim 1, wherein the circular DNA vector is expressed in the ocular cells of the anterior segment eight days after administration. 3. The method of claim 1 or 2, wherein the transgene expressed by the circular DNA vector in the ocular cells of the anterior segment is more persistent than the transgene encoded by a plasmid DNA vector encoding the transgene. 4. The method as described in any one of claims 1-3,5. The method of any one of claims 1-4, wherein one or more components of the plasmid backbone missing in the circular DNA vector contain a resistance gene and / or an origin of replication. 6. The method of any one of claims 1-5, wherein the circular DNA vector is a non-viral circular DNA vector. 7. The method of claim 6, wherein the non-viral circular DNA vector is a naked circular DNA vector. 8. The method of claim 6 or 7, wherein the DNA vector is a synthetic circular DNA vector. 9. The method of any one of claims 1-7, wherein the DNA vector contains an origin of replication. 10. The method of any one of claims 1-9, wherein the DNA vector lacks a selectivity marker. 11. The method of claim 9, wherein the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof. 12. The method of any one of claims 1-11, wherein step (a) comprises administering the circular DNA vector into the anterior chamber or administering the circular DNA vector into the corneal stroma. 13. The method of any one of claims 1-12, wherein step (b) comprises placing the one or more electrodes within the anterior chamber, and step (c) comprises transmitting electrical energy through the electrodes placed within the one or more anterior chambers. 14. The method of claim 12 or 13, wherein the one or more electrodes are located within 5 mm of the corneal endothelium within the anterior chamber. 15. The method of any one of claims 1-14, wherein at least one of the one or more electrodes is a needle electrode. 16. The method of any one of claims 1-5, wherein the ocular cells expressing the anterior segment of the circular DNA vector are corneal cells, trabecular meshwork cells, iris cells, lens cells, ciliary body cells, and / or Schlem tube cells. 17. The method of claim 16, wherein the corneal cells are corneal endothelial cells or corneal stromal cells. 18. The method of any one of claims 1-17, wherein the transgene encodes a protective factor that promotes the survival of corneal endothelial cells. 19. The method of claim 18, wherein the protective factor regulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-β signaling pathway, or the FGF-1 signaling pathway. 20. The method of any one of claims 1-19, wherein the circular DNA vector silences, corrects, or replaces the mutated gene associated with Fuchs malnutrition. 21. The method of claim 19,The gene associated with Fuchs dystrophism is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. 22. A method of expressing a therapeutic protein in anterior segment ocular cells of an individual, the method comprising: (a) applying a nucleic acid vector to the anterior segment of the eye, wherein the nucleic acid vector encodes the therapeutic protein; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to the anterior segment ocular cells, thereby expressing the therapeutic protein in the anterior segment ocular cells. 23. The method of claim 22, wherein the therapeutic protein is a protective factor that promotes corneal endothelial cell survival. 24. The method of claim 23, wherein the protective factor regulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. 25. The method of any one of claims 22-24, wherein the nucleic acid vector silences, corrects, or replaces a mutated gene associated with Fuchs dystrophin. 26. The method of claim 25, wherein the gene associated with Fuchs dystrophin is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. 27. The method of claim 25 or 26, wherein the individual suffers from Fuchs dystrophin. 28. A method of treating Fuchs dystrophin in an individual in need, the method comprising: (a) administering a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector encodes a protective factor that promotes corneal endothelial cell survival; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to ocular cells of the anterior segment, thereby expressing the protective factor in ocular cells of the anterior segment in an amount sufficient to treat Fuchs dystrophin. 29. A method of treating Fuchs dystrophy in an individual in need, the method comprising: (a) administering a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector silences, corrects, or replaces a mutated gene associated with Fuchs dystrophy; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to ocular cells of the anterior segment, thereby silencing, correcting, or replacing the mutated gene in an amount sufficient to treat Fuchs dystrophy. 30. The method of claim 28 or 29.The nucleic acid vector lacks one or more components of the plasmid backbone. 31. The method of any one of claims 28-30, wherein the nucleic acid vector contains an origin of replication. 32. The method of any one of claims 28-31, wherein the DNA vector lacks a selectivity marker. 33. The method of claim 31, wherein the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof. 34. A circular DNA vector comprising: (a) a eukaryotic promoter; (b) a coding sequence, wherein the coding sequence: (i) encodes a protective factor that promotes corneal endothelial cell survival; or (ii) silences, corrects, or replaces a mutant gene associated with Fuchs malnutrition; and (c) a bacterial origin of replication less than 50 bp in length, wherein the circular DNA vector lacks a selectivity marker. 35. The circular DNA vector of claim 34, wherein the protective factor regulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. 36. The circular DNA vector of claim 34, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. 37. The circular DNA vector of any one of claims 34-36, wherein the 3' end of the coding sequence is linked to the 5' end of the promoter via a sequence comprising the bacterial origin of replication, wherein the sequence comprising the bacterial origin of replication is less than 100 bp in length. 38. A pharmaceutical composition comprising: (a) the circular DNA vector of any one of claims 34-37, and (b) a suitable carrier for use in delivering the pharmaceutical composition to an individual. 39. A method of delivering a circular DNA vector as claimed in any one of claims 34-38 to anterior segment eye cells of an individual, the method comprising: (a) applying the circular DNA vector to the anterior segment of the eye; (b) placing one or more electrodes inside and / or around the eye; and (c) delivering the circular DNA vector to the anterior segment eye cells by transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the circular DNA vector to the anterior segment eye cells. Claims 3 / 3 Page 4 CN 121002188 A Gene therapy technology for the anterior segment

[0001] In general,The present invention is characterized by a nucleic acid vector and a method of applying the nucleic acid vector to ocular cells in the anterior segment of the eye.

[0002] Cross-Reference to Related Applications

[0003] This application claims the benefit and priority of U.S. Provisional Application No. 63 / 444,740, filed February 10, 2023, which is hereby incorporated by reference in its entirety.

[0004] Description of Text Files Filed Electronically

[0005] This application contains a sequence list in XML format filed hereby electronically through the Patent Centre. The contents of the XML copy were created on February 8, 2024, and are named “IGT-012PC_135234-5012.xml”, and are 11,089 bytes in size. The sequence list is incorporated herein by reference in its entirety. Background Art

[0006] Many ocular disorders involving dysfunction of anterior segment tissues, such as corneal dysfunction, represent a high level of unmet medical need. For example, Fuchs' dystrophy is a corneal endothelial disease characterized by progressive vision loss due to its progressive degeneration. Symptoms include a decreased corneal endothelial cell count and polymorphic and polymorphic changes, corneal guttata (water-drop-shaped deposits), corneal edema, decreased visual acuity and contrast sensitivity, glare, diurnal visual fluctuations, and pain. Onset can occur early or late in life; it is estimated to affect 4% of the U.S. population aged 40 and older. Fuchs' dystrophy can be caused by an autosomal dominant inheritance of known mutations, which can induce symptoms through mechanisms such as oxidative stress, mitochondrial dysregulation, endoplasmic reticulum-related mechanisms (e.g., protein misfolding), apoptosis, epithelial-mesenchymal transition, RNA toxicity, and non-ATG initiation translation associated with repetitive sequences. Currently, the only available treatment is tissue-based therapy, such as penetrating keratoplasty and Descemet's membrane endothelial keratoplasty / Descemet's membrane endothelial keratoplasty. There is clearly an unmet medical need for treatment options for anterior visual impairment.

[0007] The present invention provides a treatment for anterior segment disorders (e.g., Fuchs dystrophy), a method for delivering a nucleic acid vector to anterior segment tissues and cells, and a therapeutic composition (circular DNA vector) for treating Fuchs dystrophy.

[0008] In one aspect of the invention, a method for expressing a transgene in anterior segment eye cells of an individual is provided. In some embodiments, the method includes: (a) applying a circular DNA vector to an anterior segment of the eye (e.g., the anterior chamber or corneal stroma), wherein the circular DNA vector lacks one or more components of a plasmid backbone and encodes a transgene; (b) placing one or more electrodes (e.g., one, two, three, four or more electrodes) inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the circular DNA vector to anterior segment eye cells.This allows the transgene to be expressed in the anterior segment of the eye cells. In some embodiments, the circular DNA vector is expressed in the anterior segment of the eye cells eight days after administration. In some embodiments, the transgene expressed by the circular DNA vector in the anterior segment of the eye cells is more durable than the transgene encoded by the plasmid DNA vector encoding the transgene. In some embodiments, the immunogenicity of the circular DNA vector in the anterior segment of the eye cells is lower than that of the plasmid DNA vector encoding the transgene. In some embodiments, one or more components of the plasmid backbone missing from the circular DNA vector contain a resistance gene and / or an origin of replication.

[0009] In some embodiments, the circular DNA vector is a non-viral circular DNA vector, such as a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector contains an origin of replication and / or lacks a selectivity marker. In some embodiments, the 3' end of the transgene is linked to the 5' end of the promoter of the transgene by a sequence containing a bacterial origin of replication, wherein the length of the sequence containing the bacterial origin of replication is less than 50 bp or less than 100 bp. In embodiments, the sequence containing the bacterial origin of replication is less than 50 bp in length, and the circular DNA vector lacks a selectivity marker. In various embodiments, the vector further lacks a recombination site. In some embodiments, the vector contains a transposase scar. In some embodiments, the origin of replication is the ColE2-P9 origin of replication or a functional variant thereof.

[0010] In embodiments, the sequence containing the bacterial origin of replication directly links the 3' end of the therapeutic sequence to the 5' end of the therapeutic sequence.

[0011] In embodiments, the circular DNA vector has a bacterial-derived sequence of about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less.

[0012] In embodiments, the origin of replication is derived from a ColE2-associated plasmid, and the origin of replication is optionally ColE2-P9. In such embodiments, the origin of replication is recognized by the ColE2-P9 replication protein. An exemplary ColE2-P9 replication protein comprises the amino acid sequence of SEQ ID NO: 1.

[0013] In embodiments, the length of the origin of replication is 40 bp or less. In some embodiments, the length of the origin of replication is 36 bp or less, 34 bp or less, 32 bp or less, 30 bp or less, or 28 bp or less. For example, the origin of replication may have the nucleotide sequence of SEQ ID NO: 2, or may be a functional variant or a truncated variant thereof.

[0014] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication.The replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or is composed of the nucleotide sequence of SEQ ID NO: 5.

[0015] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or is composed of the nucleotide sequence of SEQ ID NO: 6.

[0016] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or is composed of the nucleotide sequence of SEQ ID NO: 7.

[0017] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or is composed of the nucleotide sequence of SEQ ID NO: 8.

[0018] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin, wherein one strand of the replication origin comprises or is composed of the nucleotide sequence of SEQ ID NO: 9.

[0019] In an embodiment, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication contains or is composed of the nucleotide sequence of SEQ ID NO: 10.

[0020] In an embodiment, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication contains or is composed of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0021] In an embodiment, the origin of replication contains or is composed of the nucleic acid sequence X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7 (SEQ ID NO: 11), wherein each X is selected from A, T, C, or G. In some embodiments: X1 is A, T, or C; X2 is A, T, or C; X3 is A, T, or G; X4 is A, T, or C; X5 is A, T, or G; X6 is C; X7 is A.

[0022] In one aspect, this disclosure provides an engineered bacterial cell for replicating a circular DNA vector. The engineered bacterial cell comprises: (a) the circular DNA vector of this disclosure, and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial origin of replication of said circular DNA vector, wherein said Rep gene replicates said circular DNA vector. Specification 2 / 21 pages 6 CN 121002188 A

[0023] In some embodiments, the therapeutic sequence comprises a transposase overhang sequence, said sequence may be (not limited to) TTAA. In such embodiments, the bacterial cell comprises a transposase protein, wherein said transposase protein hydrolyzes DNA adjacent to the transposase overhang sequence. In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell and may be integrated into the bacterial genome. In some embodiments,The engineered bacterial cells further comprise an insert sequence excision enhancer (IEE), which may be encoded by a gene integrated into the bacterial genome. In some embodiments, the engineered bacterial cells further comprise a closed-terminal linear DNA molecule containing a plasmid backbone. The plasmid backbone may contain a selection marker (which may be an antibiotic resistance gene and / or an anti-selection marker).

[0024] In various embodiments, the origin of replication is a unique bacterial sequence in the circular DNA vector. In embodiments, the engineered bacterial cells (e.g., in a culture) contain an average of at least 10 copies of the circular DNA vector. In various embodiments, the circular DNA vector is monosomic. In some embodiments, the bacterial cells in the culture contain an average of at least 10, at least 15, or at least 20 copies of the circular DNA vector per engineered bacterial cell.

[0025] In another aspect, this disclosure provides an engineered bacterial cell for producing a circular DNA vector, the cell comprising: (a) a plasmid template, wherein the plasmid template comprises: (i) a first segment comprising a therapeutic sequence and a sequence containing a bacterial origin of replication, wherein the first segment is side-mounted with two transposase overhang sequences; and (ii) a second segment comprising a plasmid backbone, wherein the second segment is side-mounted with a left-hand (LE) repeat sequence and a right-hand (RE) repeat sequence, wherein the LE repeat sequence and the RE repeat sequence are bindable to a transposase protein; and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial origin of replication. In various embodiments, the bacterial cell further comprises a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to the transposase overhang sequence. In some embodiments, the engineered bacterial cells further comprise (e.g., generate): (c) a circular DNA vector comprising a therapeutic sequence, a sequence containing a bacterial origin of replication, and one of two transposase overhang sequences; and / or (d) a linearly closed-terminal DNA molecule comprising a plasmid backbone side-joined with LE repeat sequences and RE repeat sequences.

[0026] In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cells, and the transposase gene may be integrated into the bacterial genome. In some embodiments, the engineered bacterial cells further express IEE, wherein the IEE may be encoded by a gene integrated into the bacterial genome.

[0027] In any of the foregoing embodiments for expressing transgenes in ocular cells, step (a) may comprise administering the circular DNA vector into the anterior chamber or administering the circular DNA vector into the corneal stroma. In some embodiments, step (b) comprises placing one or more electrodes (e.g., one or more needle electrodes, such as monopolar needle electrodes) into the anterior chamber, and step (c) comprises transmitting electrical energy through the electrodes placed in the one or more anterior chambers. In some embodiments,One or more electrodes are located 5 mm from the corneal endothelium within the anterior chamber.

[0028] In some embodiments of any of the foregoing embodiments, the eye cells expressing the anterior segment of the circular DNA vector are corneal cells, trabecular meshwork cells, iris cells, lens cells, ciliary body cells, and / or Schlem tube cells. In some embodiments, the anterior segment eye cells are corneal endothelial cells or corneal stromal cells.

[0029] In some embodiments, the transgene encodes a protective factor that promotes the survival of corneal endothelial cells. In some embodiments, the protective factor regulates the nuclear factor erythrocyte-associated factor 2 (Nrf2) signaling pathway (e.g., Nrf2 agonists), the Rho kinase (ROCK) signaling pathway (e.g., ROCK inhibitors), the transforming growth factor β (TGF-B) signaling pathway (e.g., TGF-B inhibitors), or the fibroblast growth factor 1 (FGF-1) signaling pathway. In some embodiments, a circular DNA vector silences, corrects, or replaces mutated genes associated with Fuchs dystrophism, such as members of the solute vector family 4 (SLC4A11), TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0030] In another aspect, the present invention provides a method for expressing a therapeutic protein in anterior segment ocular cells of an individual. In some embodiments, the method includes: (a) applying a nucleic acid vector to the anterior segment of the eye (e.g., the anterior chamber or corneal stroma), wherein the nucleic acid vector encodes a therapeutic protein; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to anterior segment ocular cells, thereby expressing the therapeutic protein in the anterior segment ocular cells.

[0031] In some embodiments, the therapeutic protein is a protective factor that promotes corneal endothelial cell survival. In some embodiments, protective factors regulate the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. In some embodiments, the nucleic acid vector silences, corrects, or replaces mutated genes associated with Fuchs dystrophism, such as SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0032] In some embodiments, the individual suffers from Fuchs dystrophism.

[0033] In another aspect, a method for treating Fuchs dystrophism in an individual in need is provided, the method comprising: (a) applying a nucleic acid vector to the anterior segment of the individual's eye (e.g., the anterior chamber or corneal stroma).The nucleic acid vector encodes a protective factor that promotes corneal endothelial cell survival; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to anterior segment ocular cells, thereby expressing the protective factor in an amount sufficient to treat Fuchs dystrophy.

[0034] In another aspect, a method for treating Fuchs dystrophy in an individual in need is provided, the method comprising: (a) applying a nucleic acid vector to an anterior segment of the eye (e.g., the anterior chamber or corneal stroma) in the individual, wherein the nucleic acid vector silences, corrects, or replaces a mutated gene associated with Fuchs dystrophy; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through one or more electrodes under conditions suitable for electrotransferring the nucleic acid vector to anterior segment ocular cells, thereby silencing, correcting, or replacing the mutated gene in an amount sufficient to treat Fuchs dystrophy.

[0035] In some embodiments, the nucleic acid vector lacks one or more components of a plasmid backbone. In some embodiments, one or more components of a plasmid backbone lacking in a circular DNA vector contain a drug resistance gene and / or an origin of replication.

[0036] In some embodiments, the nucleic acid vector is a circular DNA vector, such as a nonviral circular DNA vector, such as a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector contains an origin of replication and / or lacks a selectivity marker. In some embodiments, the 3' end of the transgene is linked to the 5' end of the transgene's promoter via a sequence containing a bacterial origin of replication, wherein the sequence containing the bacterial origin of replication is less than 100 bp in length. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof.

[0037] In some embodiments, the individual is a mammal, such as a human.

[0038] In another aspect, a circular DNA vector (e.g., an isolated and / or engineered circular DNA vector) is provided, comprising: (a) a eukaryotic promoter; (b) a coding sequence, wherein the coding sequence: (i) encodes a protective factor that promotes corneal endothelial cell survival; or (ii) silences, corrects, or replaces a mutant gene associated with Fuchs dystrophism; and (c) a bacterial origin of replication less than 50 bp in length, wherein the circular DNA vector lacks a selectivity marker (e.g., a drug resistance gene). In some embodiments, the 3' end of the coding sequence is connected to the 5' end of the promoter via a sequence containing the bacterial origin of replication, wherein the length of the sequence containing the bacterial origin of replication is less than 100 bp. In some embodiments, the origin of replication is the ColE2-P9 origin of replication or a functional variant thereof (e.g., a truncated ColE2-P9 origin as described). In some embodiments,Protective factors regulate the Nrf2 signaling pathway, ROCK signaling pathway, TGF-B signaling pathway, or FGF-1 signaling pathway. In some embodiments, genes associated with Fuchs malnutrition are SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0039] In another aspect, the present invention provides a pharmaceutical composition comprising: (a) a circular DNA vector of any of the foregoing embodiments of any of the foregoing aspects; and (b) a suitable carrier for use in delivering the pharmaceutical composition to an individual.

[0040] In another aspect, a method is provided for delivering a circular DNA vector of any prior embodiment of any prior aspect to an anterior segment of an individual's ocular cells (e.g., corneal endothelial cells), the method comprising: (a) administering the circular DNA vector to the anterior segment of the eye (e.g., via intra-anterior chamber injection or intrastromal injection); (b) placing one or more electrodes inside and / or around the eye (e.g., placing one or more electrodes (e.g., needle electrodes) in the anterior chamber); and (c) delivering the circular DNA vector to the anterior segment of the ocular cells (e.g., corneal endothelial cells) by transmitting electrical energy (e.g., electrical pulses) through the one or more electrodes under conditions suitable for electrotransferring the circular DNA vector to the anterior segment of the ocular cells. In some embodiments, the circular DNA vector is expressed in the anterior segment of the ocular cells (e.g., corneal endothelial cells) eight days after administration. In some embodiments, the transgene expressed by the circular DNA vector in the anterior segment of the ocular cells is more persistent than the transgene encoded by a plasmid DNA vector encoding the transgene. In some embodiments, the immunogenicity of the circular DNA vector in the anterior segment of the ocular cells is lower than that of the plasmid DNA vector encoding the transgene. In some embodiments, one or more components of the plasmid backbone missing in the circular DNA vector contain a drug resistance gene and / or an origin of replication. In some embodiments, the individual is a mammal, such as a human.

[0041] This application contains at least one color drawing. Copies of this patent or patent application with color drawings are provided by the Patent Office upon request and payment of the necessary fees.

[0042] Figure 1A is a schematic diagram showing the relative positions of a DNA injection needle and an electrode needle in the anterior segment of the eye, as described in Example 1. DNA is applied to the anterior chamber (within the anterior chamber), and a pulsed electric field is transmitted through a single monopolar electrode in the anterior chamber (within the anterior chamber).

[0043] Figure 1B is a real-time fluorescence image taken using a RetCam with a gonioscope, showing GFP expression in a rabbit eye on postoperative day 7.

[0044] Figure 1C is a fluorescence image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red.And DAPI is blue.

[0045] Figure 2A is a schematic diagram showing the relative positions of the DNA injection needle and electrode needle in the anterior segment of the eye, as described in Example 2. DNA is applied to the corneal stroma, and a pulsed electric field is transmitted through a single monopolar electrode in the anterior chamber (within the anterior chamber).

[0046] Figure 2B is a real-time fluorescence image taken using a RetCam with a gonioscope, showing extensive GFP expression in the rabbit eye on postoperative day 7.

[0047] Figure 2C is a fluorescence image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red, and DAPI is blue. Detailed Description

[0048] I. Definitions

[0049] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art as to be applicable to the invention and as to references to the publications that provide general guidance to those skilled in the art regarding the many terms used in this application. If there is any conflict between the definitions set forth herein and those in the referenced publications, the definitions provided herein shall prevail.

[0050] As used herein, the terms “anterior segment” and “anterior part of the eye” are used interchangeably to refer to the region of the eye containing the cornea, iris, ciliary body, and lens, as well as the anterior and posterior chamber spaces filled with aqueous humor.

[0051] As used herein, “electrotransfer” refers to the movement of molecules (e.g., nucleic acids, such as naked nucleic acids) across the target cell membrane (e.g., from the outside to the inside of a target cell, such as a corneal endothelial cell, as described on page 5 / 21 of the specification, CN 121002188 A), which is caused by an electric field (e.g., a pulsed electric field) transmitted to the microenvironment in which the cell resides (e.g., the anterior segment of the eye). Electrotransfer can occur as a result of electrophoresis, i.e., molecules (e.g., nucleic acids, such as naked nucleic acids) move along an electric field (e.g., in the direction of the current) based on the molecular charge. Electrophoresis can induce electrotransfer, for example by moving molecules (e.g., nucleic acids, such as naked nucleic acids) near the cell membrane to allow biological transport processes (e.g., endocytosis including pinocytosis or phagocytosis) or passive transport (e.g., diffusion or lipid partitioning) to bring the molecules into the cell. Alternatively or concurrently, electrotransfer may occur as a result of electroporation, i.e., the creation of pores in target cells by means of an electric field (e.g., a pulsed electric field), wherein the size, shape, and duration of the pores are adapted to accommodate the movement of molecules (e.g., nucleic acids, such as naked nucleic acids) from the outside to the inside of the target cell. Thus, in some cases, electrotransfer occurs as a result of a combination of electrophoresis and electroporation.

[0052] The terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of polynucleotide or amino acid products or proteins in a biological sample (e.g., the retina). “Expression” generally refers to the process of translating genetically encoded information into structures present and functioning in cells. Therefore, according to the invention,The “expression” of a gene can refer to transcription into a polynucleotide, translation into a protein, or post-translational modification of a protein. Transcribed polynucleotides, translated proteins, or fragments of post-translational modified proteins should also be considered expressed, regardless of whether they originate from transcripts produced by alternative splicing or degraded transcripts, or from post-translational processing of proteins, such as proteolysis. “Expressed genes” include those genes that are transcribed into polynucleotides as mRNA and then translated into proteins, as well as those genes that are transcribed into RNA but not translated into proteins (e.g., transfer RNA and ribosomal RNA).

[0053] As used herein, “delivery,” “to deliver,” and their grammatical variations refer to causing an agent (e.g., a therapeutic agent) to enter target cells. An agent can be delivered by administering it to an individual with target cells (e.g., systemic or local administration), allowing the agent to access the organ or tissue containing the target cells. Alternatively or concurrently, an agent can be delivered by applying a stimulus to a tissue or organ containing the agent, wherein the stimulus causes the agent to enter the target cells. Therefore, in some cases, the drug is delivered to the target cells by transmitting an electric field into the drug-containing tissue under conditions suitable for electrotransferring the drug to the target cells within the tissue.

[0054] As used herein, “administration” means a method of giving an individual a dose of a therapeutic agent disclosed herein (e.g., a nucleic acid carrier described herein) or a composition thereof. The compositions used in the methods described herein can be administered intraocularly, for example, into the anterior chamber (i.e., into the aqueous humor), into the cornea (e.g., into the corneal stroma), into the vitreous body, subretinal, or periocularly. Alternatively or concurrently, the composition may be delivered via intravenous, subcutaneous, intradermal, percutaneous, intramuscular, intra-arterial, intraperitoneal, intralesional, intracranial, intra-articular, intraprostatic, intrapleural, intratracheal, intrathecal, intranasal, intravaginal, intrarectal, local, intraperitoneal, subconjunctival, intracystic, transmucosal, intraperitoneal, intraumbilical, oral, local, transdermal, conjunctival, subfascial, anterior chamber, subretinal, retroocular, microtubule, by inhalation, by injection, by implantation, by infusion, by continuous infusion, by direct local perfusion infiltrating target cells, by catheter, by irrigation, in cremations, or in lipid compositions. The compositions used in the methods described herein may be administered systemically. The method of administration may vary depending on various factors, such as the compound or composition administered and the severity of the condition, disease, or disorder being treated.

[0055] As used herein, the terms "vector" and "nucleic acid vector" are used interchangeably and refer to nucleic acid molecules capable of delivering a linked therapeutic sequence to a target cell, where the therapeutic sequence may subsequently be transcribed, replicated, processed, and / or expressed. After the therapeutic sequence of the vector has been processed by the target cell or host cell, the therapeutic sequence is no longer considered a vector. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop containing a bacterial backbone.Additional DNA segments can be linked to the bacterial backbone. Another type of vector is a bacteriophage vector. Another type of vector is a viral vector (e.g., adeno-associated virus (AAV) vector), in which additional DNA segments can be linked to the viral genome. Some vectors are capable of autonomous replication in the host cells to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and attached mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can be integrated into the host cell genome after introduction into the host cell, thereby replicating together with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. Such vectors are referred to herein as “recombinant expression vectors” (or simply “recombinant vectors” or “expression vectors”). Any nucleic acid vector described herein may be referred to as an “isolated nucleic acid vector.”

[0056] As used herein, the term “circular DNA vector” refers to a DNA vector in a circular form. Such circular forms can typically be amplified into multiples by rolling circle amplification. As used herein, a linear double-stranded nucleic acid having a bound strand at its ends (e.g., a backbone covalently conjoined via a hairpin loop or other structure) is not a circular vector. The term “circular DNA vector” is used interchangeably herein with the terms “covalently closed circular DNA vector” and “C3DNA.” As described herein, those skilled in the art will understand that such circular vectors include vectors covalently closed with supercoil and complex DNA topology. In certain embodiments, the circular DNA vector is supercoiled (e.g., monomerically supercoiled). In other embodiments, the circular DNA vector is loosely open (covalently closed but without supercoil). In some cases, the circular DNA vector lacks a bacterial origin of replication. In some embodiments, the circular DNA vector contains a bacterial origin of replication. In other cases, the circular DNA vector may lack one or more components of the plasmid backbone (e.g., selective markers), but may include an origin of replication (e.g., the ColE2-P9 origin of replication or a truncated version thereof).

[0057] As used herein, the term "recombination site" refers to a nucleic acid sequence that is the product of site-specific recombination, the nucleic acid sequence comprising a first sequence corresponding to a portion of a first recombinase attachment site and a second sequence corresponding to a portion of a second recombinase attachment site. An example of a heterozygous recombination site is attR, which is the product of site-specific recombination and comprises a first sequence corresponding to a portion of attP and a second sequence corresponding to a portion of attB. Alternatively, recombination sites can be generated by Cre / Lox recombination. Thus, vectors generated by Cre / Lox recombination (e.g., vectors comprising a LoxP site) include recombination sites as used herein. Other site-specific recombination events that generate recombination sites include, for example,λ integrase, FLP recombinase, and Kw recombinase. Nucleic acid sequences resulting from non-site-specific recombination events (e.g., ITR-mediated intermolecular recombination) are not recombination sites as defined herein.

[0058] As used herein, the terms “individual” and “subject” are used interchangeably and include any mammal requiring treatment or prevention, for example, via a therapeutic circular DNA vector or pharmaceutical composition thereof as described herein. In some embodiments, the individual or subject is a human. In other embodiments, the individual or subject is a non-human mammal (e.g., a non-human primate, such as a monkey, mouse, pig, rabbit, cat, or dog). The individual or subject may be male or female.

[0059] As used herein, an “effective amount” or “effective dose” of a nucleic acid vector or pharmaceutical composition thereof refers to an amount sufficient to achieve the desired biological, pharmacological, or therapeutic effect, for example, when administered to an individual according to a chosen form, route, and / or schedule of administration. As will be understood by those skilled in the art, the effective absolute amount of a particular composition can vary depending on factors such as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, etc. Those skilled in the art will further understand that an “effective amount” can be applied to a subject through contact with cells or as a single dose or by using multiple doses. An effective amount of the composition for treating a disease can slow or halt disease progression or increase partial or complete response relative to a reference group, such as an untreated group or a placebo group, or a group receiving standard care.

[0060] As used herein, “treatment” (and its grammatical variations, such as “treat” or “treating”) refers to a clinical intervention that attempts to alter the natural course of a disease in an individual being treated, which may be performed for prevention or during a clinicopathological process. The desired effects of treatment include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, slowing the rate of disease progression, improving or alleviating the disease state, and improving prognosis. In some embodiments, the therapeutic circular DNA vector of the present invention is used to delay the development of a disease or slow its progression (e.g., reduced corneal thickness or decreased vision). Instruction manual 7 / 21 pages 11 CN 121002188 A

[0061] As used herein, “target cell” refers to a cell that expresses a therapeutic protein encoded by a therapeutic gene.

[0062] The terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of polynucleotide or amino acid product or protein in a biological sample (e.g., corneal endothelium). “Expression” generally refers to the process of converting gene-encoded information into structures that are present and function in the cell. Therefore, according to the present invention,“Expression” can refer to transcription into a polynucleotide, translation into a protein, or post-translational modification of a protein. Fragments of transcribed polynucleotides, translated proteins, or post-translational modified proteins should also be considered expressed, whether they originate from transcripts produced by alternative splicing or degraded transcripts, or from post-translational processing of proteins, such as by proteolysis. “Expressed genes” include those genes that are transcribed into polynucleotides as mRNA and then translated into proteins, as well as those genes that are transcribed into RNA but not translated into proteins (e.g., transfer RNA and ribosomal RNA). The term “a (species)” (a, an) means “one (species) or more (species)”. For example, “one (species) cell” is understood to mean one (species) or more (species) cells. Therefore, the terms “a (species)” (a, an), “one or more (species)” and “at least one (species)” are used interchangeably herein.

[0063] As used herein, unless otherwise stated, the term “about” means a value within a range of ±10% of a reference value.

[0064] II. Methods

[0065] This document provides methods for applying nucleic acid vectors to the anterior segment of the eye using electrotransfer. Such methods include methods for expressing transgenes encoded by nucleic acid vectors, and methods for treating diseases (e.g., Fuchs dystrophy) by administering nucleic acid vectors encoding protective factors that promote corneal endothelial cell survival, or by administering nucleic acid vectors that silence, correct, or replace mutant genes associated with Fuchs dystrophy.

[0066] Fuchs Dystrophy

[0067] The methods provided herein can be used to treat anterior segment eye diseases, such as Fuchs dystrophy, characterized by progressive vision loss due to progressive degeneration of the corneal endothelium. The methods of the present invention provide treatment for Fuchs dystrophy by administering nucleic acid vectors and transfecting corneal endothelial cells with these vectors by electrotransfer, wherein the nucleic acid vectors (a) encode protective factors that promote corneal endothelial cell survival or (b) silence, correct, or replace mutant genes associated with Fuchs dystrophy.

[0068] In some embodiments, the method of treating Fuchs dystrophy involves administering nucleic acid vectors expressing protective factors known to promote corneal endothelial cell survival. Exemplary protective factors include regulators of Nrf2, ROCK, TGF-β, and FGF-1. In some embodiments, the protective factors regulate the nuclear factor erythrocyte 2-associated factor 2 (Nrf2) signaling pathway (e.g., Nrf2 agonists), the Rho kinase (ROCK) signaling pathway (e.g., ROCK inhibitors), the transforming growth factor β (TGF-β) signaling pathway (e.g., TGF-β inhibitors), or the fibroblast growth factor 1 (FGF-1) signaling pathway. Therefore,Such protective factors can be cell-bound (e.g., intracellular or membrane-bound in transfected cells) or secreted into the extracellular space (e.g., acting on one or more other cell types or extracellular components in the anterior segment of the eye).

[0069] In other embodiments, methods of treating Fuchs dystrophy involve administering a nucleic acid vector of a silencing (e.g., via a repressive nucleic acid (e.g., shRNA)), correction (e.g., via gene editing, e.g., CRISPR) or replacement (e.g., replacing with a functional version of the same or functionally similar or equivalent gene) mutant gene associated with Fuchs dystrophy (i.e., known to cause or contribute to Fuchs dystrophy association). Genes associated with Fuchs dystrophy are known in the art and include, for example, SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. Specific information about these mutations (e.g., nucleotide and amino acid changes) was identified and discussed in Liu et al., Eye Vis. 2021:8(1):24, which is incorporated herein by reference in its entirety.

[0070] In some embodiments, the mutation in the gene is an autosomal dominant mutation. Specification 8 / 21 pages 12 CN 121002188 A

[0071] Administration of the therapeutic agent

[0072] This document provides a method for administering a nucleic acid carrier (such as any nucleic acid carrier described herein) or a pharmaceutical composition thereof to the anterior segment of the eye, thereby delivering a therapeutic agent to target cells in the anterior segment of the eye of an individual (e.g., a human patient). In some cases, the nucleic acid carrier is administered to the eye such that the nucleic acid carrier enters the extracellular space of the anterior segment of the eye (e.g., the anterior chamber or corneal stroma). Once the nucleic acid carrier is located in the anterior extracellular space after administration, it can then be electrotransferred to target retinal cells via electrical energy transfer to the anterior segment of the eye, for example by electrical energy transfer from electrodes placed inside, on, or near the eye (e.g., in the anterior chamber).

[0073] In some embodiments, the nucleic acid carrier is administered prior to the transmission of an electric field. For example, the nucleic acid vector can be administered within 24 hours prior to electric field transmission (e.g., within 20, 18, 16, 14, 12, 10, 8, 6, 4, 3, 2 hours, 90 minutes, 60 minutes, 45 minutes, 30 minutes, 20 minutes, 15 minutes, 10 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, 1 minute, 45 seconds, 30 seconds, 20 seconds, 15 seconds, 10 seconds, or 5 seconds prior to electric field transmission). In some embodiments,Nucleic acid vectors are administered as part of the methods described herein.

[0074] Any suitable anterior ocular administration means known in the art or described herein may be used as part of the methods provided herein. Methods of delivering nucleic acid vectors to target retinal cells include administering the nucleic acid vectors to the eye via intraocular injection (e.g., intra-anterior chamber injection) or intraocular implantation. In some embodiments of any of the methods described herein, the administration of the nucleic acid vectors is achieved via intraocular implantation (e.g., controlled release or reservoir implantation). In other embodiments, the administration of the nucleic acid vectors is not achieved via intraocular implantation.

[0075] In some cases, the administration of the nucleic acid vectors is non-surgical. For example, in some embodiments, the administration of the nucleic acid vectors does not utilize general anesthesia and / or does not involve retrobulbar anesthesia (i.e., retrobulbar block). Additionally or alternatively, the administration of the nucleic acid vectors does not involve injection using a needle larger than 28 gauge.

[0076] Additionally or alternatively, the administration of the nucleic acid vectors does not involve the use of guidance mechanisms that typically require ocular drug delivery via shunts or cannulas.

[0077] In some cases, the application of the nucleic acid carrier is achieved by injection (e.g., microneedle injection) into external tissues of the eye (e.g., sclera, cornea, corneal stroma, conjunctiva, subconjunctival space, or subretinal space). Alternatively, the application of the nucleic acid carrier is achieved by injection (e.g., microneedle injection) into a site close to external tissues (e.g., trabecular meshwork, ciliary body, or aqueous humor).

[0078] In some cases, the application of the nucleic acid carrier is achieved by topical application or eye drops.

[0079] Any nucleic acid vector or pharmaceutical composition thereof described herein may be 1 μg to 10 mg of DNA (e.g., from 5 µg to 5.0 mg, from 10 µg to 2.0 mg, or from 100 µg to 1.0 mg of DNA, e.g., from 10 µg to 20 µg, from 20 µg to 30 µg, from 30 µg to 40 µg, from 40 µg to 50 µg, from 50 µg to 75 µg, from 75 µg to 100 µg, from 100 µg to 200 µg, from 200 µg to 300 µg, from 300 µg to 400 µg, from 400 µg to 500 µg, from 500 µg to 1.0 mg, from 1.0 mg to 5.0 mg; or from 5.0 mg to 10 mg of DNA,For example, doses of DNA of about 10 µg, about 20 µg, about 30 µg, about 40 µg, about 50 µg, about 60 µg, about 70 µg, about 80 µg, about 90 µg, about 100 µg, about 150 µg, about 200 µg, about 250 µg, about 300 µg, about 350 µg, about 400 µg, about 450 µg, about 500 µg, about 600 µg, about 700 µg, about 750 µg, about 1.0 mg, about 2.0 mg, about 2.5 mg, about 5.0 mg, about 7.5 mg, or about 10 mg are administered to the subject.

[0080] Electric Field Transmission

[0081] A method of delivering a nucleic acid carrier (e.g., a circular DNA carrier) to the anterior segment of the eye includes transmitting electrical energy to the tissue containing the target eye cells. Such methods involve electrotransferring a therapeutic agent from the extracellular space of the anterior segment of the eye (e.g., the anterior chamber or corneal stroma) to target eye cells (e.g., the corneal endothelium). For example, in some cases where an individual is receiving treatment for an anterior segment disease of the eye (e.g., Fuchs dystrophy), the method involves transmitting electrical energy to the retina to induce the electrotransfer of nucleic acid carriers from the extracellular space within or near the cornea to corneal endothelial cells.

[0082] In some aspects of the invention, electrodes are placed inside the individual's eye (e.g., within the anterior segment, such as in the anterior chamber or corneal stroma), and an electric field is transmitted through the electrodes to the target eye tissue under conditions suitable for electrotransferring nucleic acid carriers to target cells (e.g., the corneal endothelium). The electric field transmitted to the target eye tissue can promote the transfer of nucleic acid carriers (e.g., circular DNA carriers) to target eye cells. Such electrotransfer can occur through any of several mechanisms (and combinations thereof), including electrophoresis, electrically driven drug uptake, and / or electroporation. The transmission of an electric field involves conditions suitable for such a mechanism. Suitable means of generating an electric field for the electrotransfer of nucleic acids in mammalian tissues are known in the art, and any suitable means known in the art or described herein may be suitable as part of the invention.

[0083] Various means of generating and transmitting an electric field into tissues are contemplated herein as part of the methods of the invention. Devices and systems having electrodes suitable for transmitting electric fields in mammalian tissues are commercially available and can be used in the methods disclosed herein. In some cases, the electric field is transmitted via an electrode comprising a needle (e.g., a needle located within vitreous fluid or in the subretinal space). Suitable needle electrodes include CLINIPORATOR® electrodes sold by IGEA® and needle electrodes sold by AMBU®. Other electrodes adaptable for use in the anterior segment of the eye are described in International Patent Publication No. WO 2022 / 198138.The entire text of the present invention is incorporated herein by reference.

[0084] Electrodes (e.g., needle electrodes) used in the methods of the present invention may be monopolar. In some embodiments involving electrical transfer using monopolar electrodes, a ground electrode is attached to a point on the individual other than the eyes (e.g., attached to the individual's skin). In some embodiments, the ground electrode is a pad that contacts the skin of the individual's buttocks, legs, torso, neck (e.g., back of the neck), or head (e.g., back of the head or temples). In some embodiments, the monopolar electrode transfers electrical energy when positively charged. In some embodiments, the monopolar electrode transfers electrical energy when negatively charged.

[0085] Alternatively, the electrodes may be bipolar. In bipolar embodiments, an auxiliary electrode may be electrically connected to the main electrode. The auxiliary electrode may be located close to the main electrode (i.e., closer to the operator), for example, as part of a sheath housing the main lead electrode or connected to a sheath housing the main lead electrode. In some embodiments involving electrical transfer using bipolar electrodes, electrical energy (e.g., current) is transferred after a positive voltage is applied to the main electrode and a negative voltage is applied to the auxiliary electrode. In some embodiments involving electrical transfer using bipolar electrodes, electrical energy (e.g., current) is transferred after a negative voltage is applied to the main electrode and a positive voltage is applied to the auxiliary electrode.

[0086] It should be understood that a variety of suitable electrical parameters and their algorithms can be used. The power supply can be configured to generate, for example, approximately 10 V / cm to approximately 1,500 V / cm at target cells (e.g., corneal endothelial cells); for example, approximately 10 V / cm to approximately 100 V / cm, such as approximately 10 V / cm, 20 V / cm, 30 V / cm, 40 V / cm, 50 V / cm, 60 V / cm, 70 V / cm, 80 V / cm, 90 V / cm, or 100 V / cm; for example, approximately 100 V / cm to approximately 1,000 V / cm, such as approximately 200 V / cm, 300 V / cm, 400 V / cm, 500 V / cm, 600 V / cm, 700 V / cm, 800 V / cm, 900 V / cm, or 1,000 V / cm; for example, approximately 1,000 V / cm to approximately 1,500 V / cm, such as approximately 1,110 V / cm, 1,200 V / cm, 1,300 V / cm. An electric field strength of 1,400 V / cm, 1,500 V / cm, or 1,400 V / cm is provided. In some embodiments, the power supply is configured to generate an electric field strength of about 10 V / cm to about 1,000 V / cm (e.g., about 10 V / cm to 500 V / cm or about 500 V / cm to about 1,000 V / cm) at the target cell, for example. In some embodiments, the field strength is 50 V / cm to 300 V / cm. In some embodiments, the field strength at the target cell (e.g., target retinal cell) is about 100 V / cm.

[0087] In some embodiments, the total number of electrical pulses is within 1-60 seconds (e.g.,The power pulses are delivered within 1-5 seconds, 5-10 seconds, 10-15 seconds, 15-20 seconds, 20-30 seconds, 30-40 seconds, 40-50 seconds, or 50-60 seconds. In some embodiments, the total number of power pulses is delivered within 1-20 seconds. For example, the total number of power pulses can be delivered within 1-5 seconds, 5-10 seconds, 10-15 seconds, or 15-20 seconds, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 seconds. The power pulses can be, for example, square waveforms. The power pulses can have an amplitude from 5 V to 500 V. For example, the power pulse may have an amplitude of approximately 5 V, 10 V, 15 V, 20 V, 25 V, 30 V, 35 V, 40 V, 45 V, 50 V, 60 V, 70 V, 80 V, 90 V, 100 V, 125 V, 150 V, 175 V, 200 V, 225 V, 250 V, 275 V, 300 V, 325 V, 350 V, 375 V, 400 V, 425 V, 450 V, 475 V, or 500 V. In some embodiments, the power pulse has an amplitude of approximately 5–250 V (e.g., approximately 20 V). Any of the above voltages may be the top of a rectangular waveform, the peak of a sine wave, the peak of a sawtooth waveform, the root mean square (RMS) voltage of a sine wave, or the RMS voltage of a sawtooth waveform.

[0088] In some embodiments, approximately 1-12 power pulses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 pulses) are transmitted during use. In some embodiments, approximately 4-12 power pulses are transmitted during use.

[0089] In some embodiments, each power pulse is approximately 10 ms to approximately 200 ms. For example, each power pulse may be approximately 10 ms, 20 ms, 30 ms, 40 ms, 50 ms, 60 ms, 70 ms, 80 ms, 90 ms, 100 ms, 110 ms, 120 ms, 130 ms, 140 ms, 150 ms, 160 ms, 170 ms, 180 ms, 190 ms, or 200 ms. In some embodiments, each power pulse is approximately 50 ms. In some embodiments, each power pulse is less than 10 ms. For example, each electrical pulse can be approximately 10 µs to approximately 10 ms, such as approximately 10 µs to approximately 100 µs, such as approximately 20 µs, 30 µs, 40 µs, 50 µs, 60 µs, 70 µs, 80 µs, 90 µs, or 100 µs; for example, approximately 100 µs to approximately 1 ms.For example, about 200 µs, 300 µs, 400 µs, 500 µs, 600 µs, 700 µs, 800 µs, 900 µs, or 1 ms; for example, about 1 ms to about 10 ms, for example, about 2 ms, 3 ms, 4 ms, 5 ms, 6 ms, 7 ms, 8 ms, 9 ms, or 10 ms.

[0090] As shown in Examples 1 and 2, the relative positioning of the electrode and the injection can determine, for example, the region of transfection and transgene expression in corneal endothelial cells.

[0091] In one embodiment of the invention, any nucleic acid vector described herein can be injected into the corneal stroma, and an electrode placed in the anterior chamber can transfer energy in the aqueous humor. This configuration can result in widespread expression within the corneal endothelium (e.g., and specific to the corneal endothelium).

[0092] Alternatively, any nucleic acid vector described herein can be injected into the anterior chamber, and an electrode placed in the anterior chamber can transfer energy in the aqueous humor. This configuration can result in localized expression (e.g., and specific to the corneal endothelium) in regions near the electrode. In some cases, the method includes repositioning the electrode once or more and repeating energy transfer to transfect two or more regions of the corneal endothelium.

[0093] III. Compositions

[0094] The present invention provides therapeutic compositions (e.g., nucleic acid vectors and pharmaceutical compositions thereof) that can be used to treat Fuchs dystrophy. In some cases, the present invention provides covalently closed circular DNA (C3DNA) vectors (e.g., C3DNA vectors lacking one or more components of a plasmid backbone) that can be used to treat Fuchs dystrophy.

[0095] Nucleic Acid Vectors

[0096] Nucleic acid vectors comprising any transgenic or coding sequence described herein are provided herein. Nucleic acid vectors can be produced using plasmid DNA vectors, nanoplasmid vectors (as described, for example, in WO 2008 / 153733 and WO 2014 / 035457), microcircular DNA vectors (as described, for example, in U.S. Patent Nos. 8,828,726 and 9,233,174), microintronic plasmids (as described, for example, in Lu et al., Mol. Ther. [Molecular Therapy] 2013, 21:954 and U.S. Patent No. 9,347,073), synthetic circular DNA vectors as described herein and in WO 2019 / 178500, closed-end DNA vectors (as described, for example, in U.S. Patent No. 2020 / 0283794 and U.S. Patent No. 2021 / 0071197), dog bone DNA vectors (as described, for example, in U.S. Patent No. 2015 / 0329902 and U.S. Patent No. 9,347,073), and synthetic circular DNA vectors as described herein and in WO 2019 / 178500. Produced by methods described in, for example, U.S. Patent Nos. 9,290,778 and USRE48908E1, or microstring DNA vectors. In certain embodiments,Any nucleic acid vector described herein contains a therapeutic sequence. Specification 11 / 21 pages 15 CN 121002188 A

[0097] In some cases, the nucleic acid vector is a C3DNA vector that persists in the cell as an episome (e.g., in dividing cells or quiescent cells, such as postmitotic cells), for example in a manner similar to that of AAV vectors. In any of the embodiments described herein, the circular DNA vector may be a non-integrating vector. The C3DNA vectors provided herein may be naked DNA vectors, free from components inherent to viral vectors (e.g., viral proteins) and major components of bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (e.g., CpG islands or CpG motifs)) or additionally or otherwise associated with reduced persistence (e.g., CpG islands or CpG motifs). Circular DNA vectors are characterized by one or more therapeutic sequences and may lack plasmid backbone elements, such as (i) bacterial origin of replication and / or (ii) drug resistance genes and / or (iii) recombination sites. Synthetic circular DNA vectors lacking origins of replication can be synthesized by various methods known in the art and described herein. Synthetic methods may involve the use of phage polymerases, such as Phi29 polymerase, as replication tools using, for example, rolling circle amplification. Specific methods for the cell-free synthesis of synthetic circular DNA vectors are further described, for example, in WO 2019 / 178500, which is hereby incorporated by reference.

[0098] In other embodiments, the therapeutic circular DNA vectors described herein may be non-synthetic vectors (e.g., containing bacterial backbone sequences, such as origins of replication and / or recombination sites).

[0099] Such nucleic acid vectors (e.g., circular DNA vectors lacking plasmid backbone elements) described herein can be generated in vivo (e.g., by bacteria) and may lack selective markers (e.g., antibiotic resistance genes) and optionally lack recombination sites or transposase scars, for example, by generating circular DNA vectors from parent plasmids using engineered bacterial cells. Circular DNA (e.g., C3DNA) vectors produced by bacteria lacking selectivity markers may include any of the features described in International Patent Application No. PCT / US2022 / 082078, which is incorporated herein by reference in its entirety. Bacterial cells (e.g., *E. coli*) may be engineered to contain a Rep gene encoding a bacterial replication protein, said Rep gene optionally being integrated into the bacterial genome. Engineered cells may be transfected with parental plasmids having a vector sequence and a backbone sequence. The vector sequence includes an ori sequence (e.g., ColE2-P9 origin of replication) corresponding to the Rep gene and does not include a selectivity marker. The backbone sequence includes a selectivity marker and does not include the ori sequence included in the vector sequence. The parental plasmid may also have a restriction enzyme recognition sequence, or site-specific recombination, or transposase recognition sequence flanking the vector sequence.This allows the plasmid backbone sequence to be separated from the vector sequence intracellularly via restriction enzyme digestion, site-specific recombination, or transposase activity. In the case of restriction enzyme digestion, a circular DNA vector is subsequently formed through self-ligation of the vector sequence. In the case of site-specific recombination or transposase activity, a circular DNA vector is formed upon completion of the recombination or transposase activity. After separation of the vector sequence and formation of the circular DNA vector, expression of the rep protein can maintain a high copy number of the circular DNA vector, although the circular DNA vector lacks a selectivity marker. In contrast, maintaining the plasmid backbone sequence in engineered bacterial cells after isolation can be avoided by altering culture conditions to remove the selective pressure on the selectivity marker. Culturing bacterial cell populations with high copy numbers of circular DNA vectors under conditions that do not maintain the parental plasmid can efficiently produce high-yield, high-purity C3DNA vectors with a backbone of less than 100 bp (and an origin of less than 50 bp). Such methods are described in WO 2023 / 122625 and U.S. 63 / 509,458 (filed June 21, 2023), which are hereby incorporated by reference in their entirety.

[0100] One advantage of using transposase-based systems is the ability to further reduce the backbone size within C3DNA DNA vectors. For example, the use of site-specific recombinases results in recombination sites (e.g., attachment sites) within the vector, near or adjacent to the origin of replication. In contrast, the use of transposases allows the origin of replication to directly attach the 5' end of the therapeutic sequence to the 3' end of the therapeutic sequence without inserting a sequence. In some cases, the use of transposases can achieve a “scarless” backbone by placing the resulting sequence (transposase overhang) within the therapeutic sequence without altering the function of the therapeutic sequence. As an example, the piggybac transposase produces a four-bp transposase overhang for TTAA. By placing the plasmid backbone at the TTAA site within the target sequence, a system can be designed such that after transposase-mediated excision of the plasmid backbone from the target sequence, the original target sequence is restored, leaving only the original TTAA sequence as a transposase scar. This results in no transposase scar within the backbone of the C3DNA DNA vector. Therefore, the plasmid backbone sequence in the vector can consist entirely of the origin of replication.

[0101] Alternatively or additionally, the transposase scar can be located within the vector backbone (e.g., within the sequence containing the origin of replication). For example, if the parent plasmid contains (left-hand) and (right-hand) inverted repeat sequences flanking the backbone, and / or transposase overhang sequences flanking therapeutic sequences, the transposase scar will be located between the 3' and 5' ends of the target sequence (e.g., next to the origin of replication).

[0102] In some embodiments,Engineered bacterial cells used to generate the C3DNA DNA vector disclosed herein include a Rep gene encoding a bacterial replication protein that directs replication from the ColE2-P9 origin, and said gene may be integrated into the bacterial genome. Alternatively, the Rep gene is included on an extrachromosomal DNA molecule, such as, for example, a plasmid or a bacterial artificial chromosome (“BAC”). The engineered bacterial cells further comprise a parent plasmid containing a vector sequence and a backbone sequence. The vector sequence includes a replication origin (ori) sequence corresponding to the Rep gene and does not include a selection marker. The backbone sequence includes a gene encoding a selection marker and does not include the ori sequence included in the vector sequence. The parent plasmid also has an enzyme recognition sequence (e.g., a restriction enzyme recognition sequence, a site-specific recombination sequence, or a transposase recognition sequence) side-joined to the vector sequence such that the plasmid backbone sequence can be separated from the vector sequence within the cell by restriction enzyme digestion, transposition, or site-specific recombination.

[0103] In some embodiments, a short replication origin is used in the C3DNA DNA vector to minimize the bacterial sequence, such as the ColE2-P9 replication origin or a functional variant thereof. In such embodiments, the Rep gene encodes the ColE2-P9 replication protein. In some exemplary embodiments, the Rep gene encodes the ColE2-P9 replication protein (or a functional variant thereof, such as having at least 80%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity) having the amino acid sequence shown in SEQ ID NO: 1. Other suitable replication proteins include replication proteins encoded by naturally occurring plasmids, including, for example, those associated with ColE2-P9, such as ColE3-CA38.

[0104] In some exemplary embodiments, ori (e.g., one strand) comprises or is composed of the nucleotide sequence shown in SEQ ID NO: 2. In some embodiments, the ori sequence is a functional fragment of the ColE2-P9 ori sequence having the DNA sequence shown in SEQ ID NO: 2 (on one strand). The 40-base-pair functional fragment shown in SEQ ID NO: 2 is capable of supporting vector replication in cells expressing the ColE2-P9 replication protein. In some embodiments, ori is the ColE2-P9 origin and is no more than about 40 nucleotides, or no more than 38 nucleotides, no more than 37 nucleotides, or no more than 36 nucleotides, or no more than 34 nucleotides, or no more than 30 nucleotides in length. In various embodiments, the length of the ColE2-P9 origin is 20 to 40 nucleotides, or 30 to 40 nucleotides, or 34 to 40 nucleotides, thereby minimizing the bacterial-derived sequence in the C3DNA vector. In some embodiments,The ori sequence is a naturally occurring ori sequence.

[0105] In some cases, the ori sequence is a functional variant of the naturally occurring ori, such as an ori sequence that has been modified to be shorter than the corresponding naturally occurring ori sequence, but still retains the ability to support replication initiation. Such functional variants of the ColE2-P9 replication origin include SEQ ID NO: 3-11. Although it is known that the origin will be present in the form of double-stranded DNA in the vector, for convenience, such sequences are shown as single-stranded herein. In some embodiments, the functional variant has 1, 2, 3, 4 or 5 nucleotide substitutions relative to the origin sequence of SEQ ID NO: 3-11.

[0106] In some cases, the C3DNA vector provided herein is a naked DNA vector and does not contain components inherent to viral vectors (e.g., viral proteins) and major components of bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (e.g., CpG motifs)) or additional or otherwise associated with reduced persistence (e.g., CpG islands). For example, in some embodiments, the C3DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks one or more elements of the bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (e.g., CpG motifs)) or additional or otherwise associated components with reduced persistence (e.g., CpG islands). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks CpG methylation. In some embodiments, the C3DNA DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks bacterial methylation signature sequences, such as Dam methylation and Dcm methylation. For example, in some embodiments, the C3DNA DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the GATC sequence is unmethylated (e.g., by Dam methyltransferase). Alternatively or additionally, the C3DNA DNA vector contains DNA.At least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the CCAGG and / or CCTGG sequences are unmethylated (e.g., by Dcm methyltransferase).

[0107] In some embodiments, C3DNA vectors lacking one or more components of the plasmid backbone persist in vivo (e.g., compared to a reference vector, such as a circular DNA vector with a plasmid backbone, C3DNA vectors lacking one or more components of the plasmid backbone exhibit improved expression persistence (e.g., intracellular persistence and / or transgenerational persistence) and / or therapeutic persistence).

[0108] In some embodiments, expression of C3DNA vectors lacking one or more components of the plasmid backbone persists for at least two weeks, at least three weeks, at least four weeks, at least six weeks, at least two months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, at least eleven months, at least one year, or longer after administration.

[0109] In some embodiments, C3DNA vectors lacking one or more components of a plasmid backbone persist in targeted eye cells for at least about six months or at least one year, or at least 18 months, or several years. In some embodiments, the expression level of C3DNA vectors lacking one or more components of a plasmid backbone decreases by no more than 90%, or no more than 50%, or no more than 25%, or no more than 10% for one week or longer after transfection, such as two weeks, three weeks, five weeks, seven weeks, nine weeks or longer, 13 weeks or longer, or 18 weeks or longer, compared to the levels observed in the first 1, 2, or 3 days. In some embodiments, the nucleic acid vectors disclosed herein are administered (e.g., to retinal cells) no more than four times per year, or no more than twice per year, or no more than once per year, or even less frequently (e.g., once every two years).

[0110] In embodiments, the C3DNA vector is monomeric. In some embodiments, the C3DNA vector is supercoiled, for example, after treatment with a topoisomerase (e.g., a gyrase). In some embodiments, the C3DNA vector is a monomeric, supercoiled circular DNA molecule. In some embodiments, the C3DNA vector is nicked. In some embodiments, the C3DNA vector is open-circular (relaxed open-circular). In some embodiments, the C3DNA vector is double-stranded circular.

[0111] The therapeutic C3DNA DNA vectors described herein contain therapeutic sequences, which may include one or more protein-coding domains and / or one or more non-protein-coding domains. The therapeutic sequences may include any expression constructs disclosed herein.

[0112] In embodiments involving C3DNA DNA vectors with non-protein-coding therapeutic sequences,The therapeutic sequence lacks a protein-coding domain (e.g., a therapeutic protein-coding domain). For example, in some embodiments, the therapeutic sequence includes a non-protein-coding therapeutic nucleic acid, such as a short hairpin RNA (shRNA) coding sequence or an immune-activating therapeutic nucleic acid (e.g., a TLR agonist).

[0113] In some embodiments involving C3DNA DNA vectors, the length of the therapeutic sequence is from 0.1 Kb to 100 Kb (e.g., the length of the therapeutic gene sequence is 0.2 Kb to 90 Kb, 0.5 Kb to 80 Kb, 1.0 Kb to 70 Kb, 1.5 Kb to 60 Kb, 2.0 Kb to 50 Kb, 2.5 Kb to 45 Kb, 3.0 Kb to 40 Kb, 3.5 Kb to 35 Kb, 4.0 Kb to 30 Kb, 4.5 Kb to 25 Kb, 4.6 Kb to 24 Kb, 4.7 Kb to 23 Kb, 4.8 Kb to 22 Kb, 4.9 Kb to 21 Kb, 5.0 Kb to 20 Kb, 5.5 Kb to 18 Kb, 6.0 Kb). Kb to 17 Kb, 6.5 Kb to 16 Kb, 7.0 Kb to 15 Kb, 7.5 Kb to 14 Kb, 8.0 Kb to 13 Kb, 8.5 Kb to 12.5 Kb, 9.0 Kb to 12.0 Kb, 9.5 Kb to 11.5 Kb, or 10.0 Kb to 11.0 Kb, for example, lengths of 0.1 Kb to 0.5 Kb, 0.5 Kb to 1.0 Kb, 1.0 Kb to 2.5 Kb, 2.5 Kb to 4.5 Kb, 4.5 Kb to 8 Kb, 8 Kb to 10 Kb, 10 Kb to 15 Kb, 15 Kb to 20 Kb, or greater.For example, lengths of 0.1 Kb to 0.25 Kb, 0.25 Kb to 0.5 Kb, 0.5 Kb to 1.0 Kb, 1.0 Kb to 1.5 Kb, 1.5 Kb to 2.0 Kb, 2.0 Kb to 2.5 Kb, 2.5 Kb to 3.0 Kb, 3.0 Kb to 3.5 Kb, 3.5 Kb to 4.0 Kb, 4.0 Kb to 4.5 Kb, 4.5 Kb to 5.0 Kb, 5.0 Kb to 5.5 Kb, 5.5 Kb to 6.0 Kb, 6.0 Kb to 6.5 Kb, 6.5 Kb to 7.0 Kb, 7.0 Kb to 7.5 Kb, 7.5 Kb to 8.0 Kb, 8.0 Kb to 8.5 Kb, 8.5 Kb to 9.0 Kb, and 9.0 Kb to 9.5 Kb. Kb, 9.5 Kb to 10 Kb, 10 Kb to 10.5 Kb, 10.5 Kb to 11 Kb, 11 Kb to 11.5 Kb, 11.5 Kb to 12 Kb, 12 Kb to 12.5 Kb, 12.5 Kb to 13 Kb, 13 Kb to 13.5 Kb, 13.5 Kb to 14 Kb, 14 Kb to 14.5 Kb, 14.5 Kb to 15 Kb, 15 Kb to 15.5 Kb, 15.5 Kb to 16 Kb, 16 Kb to 16.5 Kb, 16.5 Kb to 17 Kb, 17 Kb to 17.5 Kb, 17.5 Kb to 18 Kb, 18 Kb to 18.5 Kb, 18.5 Kb to 19 Kb, 19 Kb to 19.5 Kb, 19.5 Kb to 20 Kb, 20 Kb to 21 Kb, 21 Kb to 22 Kb, 22 Kb to 23 Kb, 23 Kb to 24 Kb, 24 Kb to 25 Kb or greater, such as lengths of approximately 4.5 Kb, approximately 5.0 Kb, approximately 5.5 Kb, approximately 6.0 Kb, approximately 6.5 Kb, approximately 7.0 Kb, approximately 7.5 Kb, approximately 8.0 Kb, approximately 8.5 Kb, approximately 9.0 Kb, approximately 9.5 Kb, approximately 10 Kb, approximately 11 Kb, approximately 12 Kb, approximately 13 Kb, approximately 14 Kb, approximately 15 Kb, approximately 16 Kb, approximately 17 Kb, approximately 18 Kb, approximately 19 Kb, approximately 20 Kb or greater). In some embodiments, the therapeutic sequence is at least 10 kb (e.g., 10 kb to 15 kb, 15 kb to 20 kb, or 20 kb to 30 kb; e.g., 10 kb to 13 kb, 10 kb to 12 kb, or 10 kb to 11 kb; e.g., 10–11 kb, 11–12 kb, 12–13 kb, 13–14 kb, or 14–15 kb). In some embodiments,The length of the therapeutic sequence is at least 1,100 bp (e.g., 1,100 bp to 10,000 bp, 1,100 bp to 8,000 bp, or 1,100 bp to 5,000 bp). In some embodiments, the length of the therapeutic sequence is at least 2,500 bp (e.g., 2,500 bp to 15,000 bp, 2,500 bp to 10,000 bp, or 2,500 bp to 5,000 bp; e.g., 2,500 bp to 5,000 bp, 5,000 bp to 7,500 bp, 7,500 bp to 10,000 bp, 10,000 bp to 12,500 bp, or 12,500 bp to 15,000 bp). In some embodiments, the therapeutic sequence is at least 8,000 bp, at least 9,000 bp, at least 10,000 bp, at least 11,000 bp, at least 12,000 bp, at least 13,000 bp, at least 14,000 bp, at least 15,000 bp, or at least 16,000 bp (e.g., 11,000 bp to 16,000 bp, 12,000 bp to 16,000 bp, 13,000 bp to 16,000 bp, 14,000 bp to 16,000 bp, or 15,000 bp to 16,000 bp). In certain embodiments, the therapeutic sequence is large enough to encode a protein and is not an oligonucleotide therapy (e.g., not an antisense, siRNA, shRNA therapy, etc.).

[0114] In some embodiments, the nucleic acid vector further includes a reporter sequence in addition to the therapeutic protein-coding domain or the therapeutic non-protein-coding domain. Such reporter genes can be used to verify the expression of therapeutic gene sequences, such as their expression in specific cells and tissues. Reporter sequences that can be provided in transgenes include, but are not limited to, DNA sequences encoding β-lactamases, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other substances well known in the art. When associated with a regulatory element driving its expression, the reporter sequence provides a signal detectable by conventional methods, including enzymatic, radiographic, colorimetric, fluorescence or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunoassays, including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, in the case where the marker sequence is the LacZ gene, the presence of a signal-carrying vector is detected by an assay of β-galactosidase activity. In the case where the transgene is green fluorescent protein or luciferase, the signal-carrying vector can be visually identified by color or luminescence in a photometer. In some embodiments,Therapeutic sequences lack reporter sequences. Specification 15 / 21 pages 19 CN 121002188 A

[0115] In some cases, the nucleic acid vector is a non-viral DNA vector (e.g., a DNA vector not encapsulated within a viral capsid). Alternatively or in some embodiments, before and after administration to an individual, the nucleic acid vector is not encapsulated in a membrane (e.g., a lipid membrane) or matrix (e.g., a polymer matrix) and is not physically associated (e.g., covalently or non-covalently bound) with a solid structure (e.g., a particulate structure). In some embodiments, the nucleic acid vector is not tethered to any adjacent nucleic acid vector, such that in a solution of the nucleic acid vector, each nucleic acid vector diffuses freely independently of adjacent nucleic acid vectors. In some embodiments, the nucleic acid vector is associated with another agent (e.g., a charge-changing molecule or a stabilizing molecule) in a liquid solution.

[0116] The nucleic acid vector may be a naked DNA vector, i.e., not complexed with another agent (e.g., not encapsulated within another agent, not conjugated to, or non-covalently bound to another agent). Naked DNA vectors can be co-formulated (e.g., in solution) with agents that do not co-conjugate with naked DNA vectors (such as buffers and / or agents that are generally considered safe (GRAS) by the U.S. Food and Drug Administration).

[0117] Pharmaceutical Compositions

[0118] The present invention also provides methods relating to administering pharmaceutical compositions having a therapeutic agent (e.g., any nucleic acid vector described herein (e.g., circular DNA vector)) in a pharmaceutically acceptable carrier. In some cases, the pharmaceutical composition contains a non-viral nucleic acid vector (e.g., the pharmaceutical composition is substantially free of viral capsids). Additionally or alternatively, the pharmaceutical composition may contain a nucleic acid vector that is not encapsulated in a membrane (e.g., a lipid membrane) or matrix (e.g., a polymer matrix) before and after administration to an individual and is not physically associated (e.g., covalently or non-covalently bound) with a solid structure (e.g., a particulate structure). In some embodiments of the pharmaceutical composition, the nucleic acid vector is not tethered to any adjacent nucleic acid vector, such that in a solution of the nucleic acid vector, each nucleic acid vector diffuses freely independently of adjacent nucleic acid vectors. In some embodiments of the pharmaceutical composition, the nucleic acid carrier is associated with another agent (such as a charge-changing molecule or a stabilizing molecule) in a liquid solution.

[0119] The pharmaceutical composition may contain a naked nucleic acid carrier, i.e., the nucleic acid carrier is not complexed with another agent (e.g., not encapsulated within another agent, not conjugated to, or non-covalently bound to, another agent). In such pharmaceutical compositions, the naked nucleic acid molecule may be co-formulated (e.g., in solution) with an agent that does not complex with the naked nucleic acid molecule (such as a buffer and / or an agent that is generally considered safe [GRAS] by the U.S. Food and Drug Administration).

[0120] In some aspects of the invention,The pharmaceutical composition comprises a naked circular DNA carrier.

[0121] Pharmaceutically acceptable carriers may include excipients and / or stabilizers that are non-toxic to individuals at the doses and concentrations used. In some embodiments, a pharmaceutically acceptable carrier is a pH-buffered aqueous solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid; low molecular weight (less than about 10 residues) peptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and / or nonionic surfactants, such as Tween, polyethylene glycol (PEG), and pluronics.

[0122] Pharmaceutical compositions having the therapeutic agents of the present invention (e.g., nucleic acid carriers, such as circular DNA carriers) may contain pharmaceutically acceptable carriers. If the composition is provided in liquid form, the carrier may be water (e.g., pyrogen-free water), isotonic saline, or a buffered aqueous solution, such as a phosphate buffer or a citrate buffer. Injection of the pharmaceutical composition may be performed in water or a buffer solution, such as an aqueous buffer containing, for example, a sodium salt (e.g., at least 50 mM sodium salt), a calcium salt (e.g., at least 0.01 mM calcium salt), or a potassium salt (e.g., at least 3 mM potassium salt). According to specific embodiments, the sodium, calcium, or potassium salt may be present as its halide, such as chloride, iodide, or bromide, or as its hydroxide, carbonate, bicarbonate, or sulfate, etc. Examples of sodium salts include, but are not limited to, NaCl, NaI, NaBr, Na2CO2, NaHCO2, and Na2SO4. Examples of potassium salts include, for example, KCl, KI, KBr, K₂CO₂, KHCO₂, and K₂SO₄. Examples of calcium salts include, for example, CaCl₂, CaI₂, CaBr₂, CaCO₂, CaSO₄, and Ca(OH)₂. Additionally, the buffer may contain organic anions of the above-mentioned cations. According to specific embodiments, a buffer suitable for injection purposes, as defined above, may contain a salt selected from sodium chloride (NaCl), calcium chloride (CaCl₂), or potassium chloride (KCl), wherein additional anions may be present. CaCl₂ may also be replaced with another salt (such as KCl). In some embodiments, the salts in the injection buffer are present at a concentration of at least 50 mM sodium chloride (NaCl), at least 3 mM potassium chloride (KCl), and at least 0.01 mM calcium chloride (CaCl₂). The injection buffer may be hypertonic, isotonic, or hypotonic relative to a specific reference medium.The buffer solution can have a higher, the same, or lower salt content relative to a particular reference medium, wherein a concentration of such salt as described above is preferably used without causing cell damage due to osmosis or other concentration effects. The reference medium can be a liquid, such as blood, lymph, cytoplasmic fluid, other body fluids, or common buffer solutions. Such common buffer solutions or liquids are known to those skilled in the art. Lactated Ringer's solution is particularly preferred as a liquid matrix.

[0123] One or more compatible solid or liquid fillers, diluents, or encapsulating compounds may be suitable for administration to humans. The components of the pharmaceutical composition according to the invention can be mixed with the nucleic acid carrier according to the invention as defined herein in a manner that does not interact with the interaction, which would significantly reduce the pharmaceutical efficacy of the (pharmaceutical) composition according to the invention under typical use conditions. Pharmaceutically acceptable carriers, fillers, and diluents may have sufficiently high purity and sufficiently low toxicity to be suitable for administration to the treated individual. Some examples of compounds that can be used as pharmaceutically acceptable carriers, fillers, or components thereof are sugars such as lactose, glucose, trehalose, and sucrose; starches such as corn starch or potato starch; dextrose; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered astragalus gum; malt; gelatin; tallow; solid glidants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as polypropylene glycol, glycerin, sorbitol, mannitol, polyethylene glycol, etc.; or alginic acid.

[0124] The choice of a pharmaceutically acceptable carrier can be determined based on the manner of administration of the pharmaceutical composition.

[0125] Suitable unit dosage forms for injection include sterile aqueous solutions, physiological saline, and mixtures thereof. The pH of such solutions can be adjusted to approximately 7.4. Suitable carriers for injection include hydrogels, devices for controlled or delayed release, polylactic acid, and collagen matrices.

[0126] The pharmaceutical compositions according to the invention can be provided in liquid or dry (e.g., lyophilized) form. In certain embodiments, the nucleic acid carrier of the pharmaceutical composition is provided in lyophilized form. Lyophilized compositions comprising the nucleic acid carrier of the invention can be reconstituted in a suitable buffer (advantageously based on an aqueous carrier, such as lactated Ringer's solution, Ringer's solution, or phosphate buffer) prior to administration.

[0127] In some embodiments of the invention, any nucleic acid carrier of the invention can be complexed with one or more cationic or polycationic compounds (e.g., cationic or polycationic polymers, cationic or polycationic peptides or proteins, such as protamine, cationic or polycationic polysaccharides, and / or cationic or polycationic lipids).

[0128] According to certain embodiments, the nucleic acid carrier of the invention can be complexed with lipids to form one or more liposomes, lipid complexes, or lipid nanoparticles. Thus, in one embodiment, the compositions of the invention comprise liposomes, lipid complexes, and / or lipid nanoparticles.It contains therapeutic agents (e.g., nucleic acid carriers, such as circular DNA carriers).

[0129] Lipid-based formulations can be effective delivery systems for nucleic acid carriers due to their biocompatibility and ease of large-scale production. Cationic lipids have been extensively studied as synthetic materials for nucleic acid delivery. When mixed together, nucleic acids condense through cationic lipids to form lipid / nucleic acid complexes, called lipid complexes. These lipid complexes can protect genetic material from the action of nucleases and deliver it into cells by interacting with negatively charged cell membranes. Lipid complexes can be prepared by directly mixing positively charged lipids with negatively charged nucleic acids at physiological pH.

[0130] Conventional liposomes comprise a lipid bilayer, which may be composed of cationic, anionic, or neutral phospholipids and cholesterol, surrounding an aqueous core. The lipid bilayer and the aqueous interlayer may be incorporated with hydrophobic or hydrophilic compounds, respectively. The in vivo characteristics and behavior of liposomes can be modified by adding a hydrophilic polymer coating (e.g., polyethylene glycol [PEG]) to the surface of the liposomes to impart steric stability. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to the surface of the liposome or to the ends of the attached PEG chains.

[0131] Liposomes are delivery systems based on colloidal lipids and surfactants, consisting of a phospholipid bilayer surrounding an aqueous compartment. They can be spherical vesicles ranging in size from 20 nm to several micrometers. Cationic lipid-based liposomes can complex with negatively charged nucleic acids through electrostatic interactions, forming complexes with the biocompatibility, low toxicity, and large-scale production potential required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed via endocytosis, and then genetic material is released from the endosome / carrier into the cytoplasm.

[0132] Cationic liposomes can be used as RNA delivery systems. Cationic lipids, such as MAP (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-methylammonium sulfate), can form complexes or lipid complexes with negatively charged nucleic acids, forming nanoparticles through electrostatic interactions, providing high in vitro transfection efficiency. Furthermore, neutral lipid-based nanoliposomes (e.g., neutral 1,2-dioleoyl-sn-glycerol-3-phosphatidylcholine (DOPC)-based nanoliposomes) for nucleic acid carrier delivery are available.

[0133] Therefore, in one embodiment of the invention, the nucleic acid carrier of the invention is complexed with cationic lipids and / or neutral lipids to form liposomes, lipid nanoparticles, lipid complexes, or neutral lipid-based nanoliposomes.

[0134] In a particular embodiment,The pharmaceutical compositions according to the invention comprise the nucleic acid carrier of the invention formulated with a cationic or polycationic compound and / or with a polymer carrier. Therefore, in another embodiment of the invention, the nucleic acid carrier, as defined herein, is associated or compounded with a cationic or polycationic compound or polymer carrier, optionally in a weight ratio selected from about 5:1 (w / w) to about 0.25:1 (w / w), for example about 5:1 (w / w) to about 0.5:1 (w / w), for example about 4:1 (w / w) to about 1:1 (w / w) or about 3:1 (w / w) to about 1:1 (w / w), for example about 3:1 (w / w) to about 2:1 (w / w); or optionally in a range of about 0.1-10, for example in a range of about 0.3-4 or 0.3-1, for example in a range of about 0.5-1 or 0.7-1, for example in a range of about 0.3-0.9 or 0.5-0. The nucleic acid carrier has a nitrogen / phosphate (N / P) ratio in the range of 0.9 compared to the cationic or polycationic compound and / or polymer carrier. For example, the N / P ratio of the nucleic acid carrier to one or more polycations is in the range of about 0.1 to 10, including the range of about 0.3 to 4, about 0.5 to 2, about 0.7 to 2, and about 0.7 to 1.5.

[0135] The nucleic acid carriers described herein may also be associated with a transfection agent, transfection agent, or complexing agent to increase the transfection efficiency and / or expression of the regulatory gene according to the invention.

[0136] In some cases, the pharmaceutical composition contains a nucleic acid carrier complexed with one or more polycations (e.g., protamine or oligofectamine). Additional cationic or polycationic compounds that can be used as transfection or complexing agents may include: cationic polysaccharides, such as chitosan, polygluconine; cationic polymers such as polyethyleneimine (PEI); cationic lipids,For example, DOTMA: [1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPE, LEAP, DOPE: dioleoylphosphatidylethanolamine, DOSPA, DODAB, DOIC, DMEPC, DOGS: dioctadecylamidoglicylspermin, DIMRI: dimyristoyl-oxypropyl dimethylhydroxyethylammonium bromide, MAP: dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-ditetradecanoyl-N-(α-trimethylammonium acetyl)diethanolamine chloride, CLIP1: rac-[(2, [3-Dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3-dihexadecyloxypropyloxymethyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyloxypropyloxysuccinyloxy)ethyl]trimethylammonium, oligofectamine; or cationic or polycationic polymers, such as modified polyamino acids like β-amino acid-polymers or reverse polyamides, modified polyethylene like PVP (poly(N-ethyl-4-vinylpyridine bromide)), modified acrylates like pDMAEMA (poly(dimethylaminoethyl methacrylate)), modified amide amines like pAMAM (poly(amide amine)), modified polyβ-amino esters (PBAE) like diamine-terminated 1,4-butanediol diacrylate-co-5- Amino-1-pentanol polymers, dendritic polymers such as polypropylene terpenoids or pAMAM-based dendritic polymers, polyimides (such as PEI: poly(ethyleneimine), poly(propyleneimine), etc., polyallylamine), glycosyl backbone-based polymers (such as cyclodextrin-based polymers, dextran-based polymers, chitosan, etc.), silane backbone-based polymers (such as PMOXA-PDMS copolymers, etc.), block polymers consisting of a combination of one or more cationic blocks (e.g., selected from the cationic polymers described above) and a combination of one or more hydrophilic or hydrophobic blocks (e.g., polyethylene glycol); etc.

[0137] According to a specific embodiment, the pharmaceutical composition of the present invention includes a therapeutic agent, such as a nucleic acid carrier (e.g., a circular DNA carrier) encapsulated within or attached to a polymer carrier. The polymer carrier used according to the present invention may be a polymer carrier formed of disulfide-crosslinked cationic components. The disulfide-crosslinked cationic components may be the same or different from each other. The polymer carrier may also contain additional components. It is also particularly preferred that,The polymer carriers used according to the invention comprise a mixture of cationic peptides, proteins, or polymers as defined herein and optionally additional components, crosslinked via disulfide bonds as described herein. The disclosure of WO 2012 / 013326 is incorporated herein by reference. In this document, the cationic component forming the basis of the polymer carrier via disulfide bond crosslinking is generally selected from any suitable cationic or polycationic peptide, protein, or polymer suitable for this purpose, particularly any cationic or polycationic peptide, protein, or polymer capable of compounding additional nucleic acids contained in a nucleic acid carrier or composition as defined herein, thereby preferably condensing a nucleic acid carrier. The cationic or polycationic peptide, protein, or polymer may be linear molecules; however, branched cationic or polycationic peptides, proteins, or polymers may also be used.

[0138] Each disulfide-linked cationic or polycationic protein, peptide, or polymer that can be used to compound a nucleic acid carrier according to the invention as part of a pharmaceutical composition of the invention may contain at least one SH moiety (e.g., at least one cysteine ​​residue or any other chemical group having an SH moiety), said at least one SH moiety being capable of forming a disulfide bond upon condensation with at least one other cationic or polycationic protein, peptide, or polymer that is a cationic component of the polymer carrier described herein.

[0139] Such a polymer carrier for compounding a nucleic acid carrier of the invention may be formed from a disulfide-linked cationic (or polycationic) component. In particular, such a cationic or polycationic peptide or protein or polymer comprising or otherwise modified to comprise at least one SH moiety may be selected from proteins, peptides, and polymers as complexing agents.

[0140] In other embodiments, the pharmaceutical composition according to the invention may be administered naked without association with any other mediator, transfection agent, or complexing agent.

[0141] IV. Kits and Products

[0142] In another aspect of the invention, products or kits containing materials that can be used for the above-described treatments are provided. The article comprises a container and a label or packaging instructions on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. Containers can be formed from a variety of materials, such as glass or plastic. The container contains a composition, which, alone or in combination with another composition, is effective in treating, preventing, and / or diagnosing a condition, and may have a sterile entry point (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). At least one active agent in the composition is a therapeutic agent of the present invention (e.g., a nucleic acid carrier (e.g., a non-viral DNA carrier, ...).For example, circular DNA vectors lacking bacterial origin of replication, resistance genes, and / or recombination sites, or pharmaceutical combinations containing the therapeutic agents of the present invention (page 19 / 21, CN 121002188 A). The label or package insert indicates that the composition is for the treatment of a selected disease or disorder. The article may further include a package insert indicating that the composition can be used to treat a specific condition (e.g., Fuchs malnutrition). Alternatively or additionally, the article may further include a second container containing a pharmaceutically acceptable carrier, such as antibacterial water for injection (BWFI), phosphate-buffered saline, Ringer's solution, dextran solution, or any of the pharmaceutically acceptable carriers disclosed above. It may further include other materials desired from a commercial and user perspective, including other buffers, diluents, filters, needles, and syringes.

[0143] In a particular example of the invention, a kit is provided comprising (i) any one or more of the above-described materials (e.g., any of the aforementioned therapeutic agents of the invention and / or one or more pharmaceutically acceptable carriers) and (ii) one or more elements of an energy delivery device (e.g., a device including an electrode for delivering an electric field to tissue (e.g., the retina), as any suitable device or system described above). In some embodiments, a kit is provided herein comprising the therapeutic agent of the invention (e.g., a nucleic acid carrier (e.g., a non-viral DNA carrier, e.g., a circular DNA carrier)) and an electrode. In some embodiments, a kit is provided herein comprising a pharmaceutical composition containing the therapeutic agent of the invention (e.g., a nucleic acid carrier (e.g., a non-viral DNA carrier, e.g., a circular DNA carrier)) and an electrode.

[0144] Examples

[0145] Example 1: GFP expression in corneal endothelium via electrotransfer of C3DNA

[0146] Dutch black-banded rabbits were anesthetized and their eyes were prepared aseptically. Approximately 100 μL of C3DNA containing the reporter gene GFP was injected into the anterior chamber of the rabbit eye. Immediately after C3DNA injection, pulsed electric field-mediated electrotransfer was performed. A needle electrode was placed in the anterior chamber near the posterior surface of the cornea. Figure 1A shows the relative positions of the injection needle and the electrode.

[0147] Eight pulses of -50V with a duration of 5 ms were applied. On postoperative day 7, GFP expression in the cornea was observed in live animals using a RetCam with a gonioscope and fluorescence filter (Figure 1B). The rabbits were then euthanized, their eyes were enucleated, and histological analysis was performed. The localization of GFP in the corneal endothelium was confirmed by immunofluorescence microscopy using an anti-GFP antibody (Figure 1C).

[0148] Example 2: GFP expression in the corneal stroma by electrotransfer of C3DNA

[0149] Dutch Black Rabbits were anesthetized,The eyes were prepared aseptically. Approximately 50 μL of C3DNA containing the reporter gene GFP was injected into the corneal stroma of the rabbit eye. Corneal whitening confirmed the delivery of the liquid into the corneal stroma. Pulsed electric field-mediated electrotransfer was performed immediately after C3DNA injection. The COMET electrode was placed in the anterior chamber near the posterior surface of the cornea. Figure 2A shows the relative positions of the injection needle and the electrode.

[0150] Eight pulses of -20V for 20 ms were applied. On postoperative day 7, GFP expression in the cornea was observed in vivo using a RetCam with a gonioscope and fluorescence filter. Surprisingly, extensive GFP expression was observed on most of the corneal surface (Figure 2B). The rabbits were then euthanized, their eyes were enucleated, and histological analysis was performed. The localization of GFP in the corneal stroma was confirmed by immunofluorescence microscopy using an anti-GFP antibody (Figure 2C).

[0151] Sequence Specification 20 / 21 Page 24 CN 121002188 A

[0152]

[0153] Other Embodiments

[0154] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference, as each independent publication or patent application specifically and individually indicates that it is incorporated by reference.

[0155] Although the invention has been described in conjunction with its specific embodiments, it should be understood that it is capable of further modifications, and this application is intended to cover any changes, uses or adaptations of the invention that generally follow the principles of the invention and include deviations from this disclosure that are known or customary practices within the field to which the invention pertains and that may be applied to the basic features set forth above.And fall within the scope of protection of the appended claims.

[0156] Other embodiments are within the scope of the claims. Specification 21 / 21 Page 25 CN 121002188 A Figure 1A Specification Drawing 1 / 4 Page 26 CN 121002188 A Figure 1B Figure 1C Specification Drawing 2 / 4 Page 27 CN 121002188 A Figure 2A Specification Drawing 3 / 4 Page 28 CN 121002188 A Figure 2B Figure 2C Specification Drawing 4 / 4 Page 29 CN 121002188 A GENE THERAPIES FOR THE FRONT OF THE EYE The present invention involves therapies for ocular diseases or disorders in individuals. Provided herein are methods of delivering nucleic acid vectors to ocular cells in the anterior segment of the eye (e.g., corneal endothelium, trabecular meshwork, etc.) involving methods of administering nucleic acid vectors to the individual and methods of electrotransfer of nucleic acid vectors to express therapeutic transgenes. Also provided are nucleic acid vectors for ocular diseases, such as Fuchs' dystrophy. Abstract,

Claims

1. A method for expressing a transgene in ocular cells of the anterior segment of the eye in an individual, the method comprising: (a) Applying a circular DNA vector to the anterior segment of the eye, wherein the circular DNA vector lacks one or more components of the plasmid backbone and encodes the transgene; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the circular DNA vector to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the transgene in the anterior segment of the eye cells.

2. The method of claim 1, wherein the circular DNA vector is expressed in the anterior segment of the eye cells eight days after administration.

3. The method of claim 1 or 2, wherein the transgene expressed by the circular DNA vector in the anterior segment of the eye cell is more persistent than the transgene encoded by the plasmid DNA vector encoding the transgene.

4. The method of any one of claims 1-3, wherein the immunogenicity of the circular DNA vector in the anterior segment of the eye cell is lower than that of the plasmid DNA vector encoding the transgene.

5. The method of any one of claims 1-4, wherein one or more components of the plasmid backbone missing in the circular DNA vector comprise a drug resistance gene and / or an origin of replication.

6. The method according to any one of claims 1-5, wherein the circular DNA vector is a non-viral circular DNA vector.

7. The method of claim 6, wherein the non-viral circular DNA vector is a naked circular DNA vector.

8. The method of claim 6 or 7, wherein the DNA vector is a synthetic circular DNA vector.

9. The method of any one of claims 1-7, wherein the DNA vector comprises a replication origin.

10. The method of any one of claims 1-9, wherein the DNA vector lacks a selective marker.

11. The method of claim 9, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.

12. The method of any one of claims 1-11, wherein step (a) comprises administering the circular DNA vector into the anterior chamber or administering the circular DNA vector into the corneal stroma.

13. The method of any one of claims 1-12, wherein step (b) comprises placing the one or more electrodes in the anterior chamber, and step (c) comprises transmitting electrical energy through the one or more electrodes placed in the anterior chamber.

14. The method of claim 12 or 13, wherein the one or more electrodes are located within 5 mm of the corneal endothelium in the anterior chamber.

15. The method of any one of claims 1-14, wherein at least one of the one or more electrodes is a needle electrode.

16. The method of any one of claims 1-5, wherein the eye cells expressing the anterior segment of the circular DNA vector are corneal cells, trabecular meshwork cells, iris cells, lens cells, ciliary body cells, and / or Schlem tube cells.

17. The method of claim 16, wherein the corneal cells are corneal endothelial cells or corneal stromal cells.

18. The method of any one of claims 1-17, wherein the transgene encodes a protective factor that promotes the survival of corneal endothelial cells.

19. The method of claim 18, wherein the protection factor regulates the Nrf2 signal transduction path, the ROCK signal transduction path, the TGF-B signal transduction path, or the FGF-1 signal transduction path.

20. The method of any one of claims 1-19, wherein the circular DNA vector silences, corrects, or replaces the mutated gene associated with Fuchs malnutrition.

21. The method of claim 19, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

22. A method for expressing a therapeutic protein in anterior segment eye cells of an individual, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye, wherein the nucleic acid vector encodes the therapeutic protein; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the therapeutic protein in the anterior segment of the eye cells.

23. The method of claim 22, wherein the therapeutic protein is a protective factor that promotes the survival of corneal endothelial cells.

24. The method of claim 23, wherein the protection factor regulates the Nrf2 signal transduction path, the ROCK signal transduction path, the TGF-B signal transduction path, or the FGF-1 signal transduction path.

25. The method of any one of claims 22-24, wherein the nucleic acid vector silences, corrects, or replaces the mutated gene associated with Fuchs malnutrition.

26. The method of claim 25, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

27. The method of claim 25 or 26, wherein the individual suffers from Fuchs malnutrition.

28. A method for treating Fuchs malnutrition in individuals in need, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector encodes a protective factor that promotes the survival of corneal endothelial cells; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the protective factor in the anterior segment of the eye cells in an amount sufficient to treat Fuchs dystrophy.

29. A method for treating Fuchs malnutrition in individuals in need, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector silences, corrects, or replaces a mutant gene associated with Fuchs dystrophism; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to silence, correct, or replace the mutated gene in an amount sufficient to treat Fuchs dystrophy.

30. The method of claim 28 or 29, wherein the nucleic acid vector lacks one or more components of the plasmid backbone.

31. The method of any one of claims 28-30, wherein the nucleic acid vector comprises a replication origin.

32. The method of any one of claims 28-31, wherein the DNA vector lacks a selective marker.

33. The method of claim 31, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.

34. A circular DNA vector comprising: (a) Eukaryotic promoters; (b) an encoded sequence, wherein the encoded sequence: (i) Encoding protective factors that promote corneal endothelial cell survival; or (ii) Silencing, correcting, or replacing mutated genes associated with Fuchs malnutrition; and (c) Bacterial replication origins less than 50 bp in length, wherein the circular DNA vector lacks a selectability marker.

35. The circular DNA vector of claim 34, wherein the protective factor regulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway.

36. The circular DNA vector of claim 34, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

37. The circular DNA vector of any one of claims 34-36, wherein the 3' end of the coding sequence is connected to the 5' end of the promoter via a sequence containing the bacterial origin of replication, wherein the length of the sequence containing the bacterial origin of replication is less than 100 bp.

38. A pharmaceutical composition comprising: (a) The circular DNA vector as described in any one of claims 34-37, and (b) A suitable carrier for use in delivering the pharmaceutical composition to an individual.

39. A method of delivering a circular DNA vector as described in any one of claims 34-38 to anterior segment eye cells of an individual, the method comprising: (a) Applying the circular DNA vector to the anterior segment of the eye; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the circular DNA vector to the anterior segment of the eye cells, electrical energy is transferred through the one or more electrodes to deliver the circular DNA vector to the anterior segment of the eye cells.

Images