Pyrrole compounds

Abstract

Provided herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are methods of treating diseases and / or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

Description

(19) *EP004733305A2* (11) EP 4 733 305 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: 29.04.2026 Bulletin 2026 / 18 (21) Application number: 26163262.4 (22) Date of filing: 01.04.2020 (51) International Patent Classification (IPC): C07F 9 / 141 (2006.01) (52) Cooperative Patent Classification (CPC): A61K 31 / 4025; A61K 31 / 40; A61K 31 / 4192; C07D 207 / 34; C07D 401 / 12; C07D 403 / 12; C07D 405 / 12; C07D 405 / 14; C07D 409 / 12; C07D 413 / 12; C07D 417 / 12; C07D 487 / 04; C07F 9 / 094 (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR Designated Extension States: BA ME Designated Validation States: KH MA MD TN (30) Priority: 03.04.2019 US 201962828919 P 08.11.2019 US 201962932686 P (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: 20784496.0 / 3 947 349 (71) Applicants: • Aligos Therapeutics, Inc. South San Francisco, CA 94080 (US) • Emory University Atlanta, GA 30322 (US) (72) Inventors: • VENDEVILLE, Sandrine South San Francisco, 94080 (US) • SMITH, David Bernard South San Francisco, 94080 (US) • BEIGELMAN, Leonid South San Francisco, 94080 (US) • SEREBRYANY, Vladimir South San Francisco, 94080 (US) • SCHINAZI, Raymond F. Atlanta, 30322 (US) • AMBLARD, Franck Atlanta, 30322 (US) • BASSIT, Leda Atlanta, 30322 (US) (74) Representative: Zacco Sweden AB P.O. Box 5581 Löjtnantsgatan 21 114 85 Stockholm (SE) Remarks: This application was filed on 09‑03‑2026 as a divisional application to the application mentioned under INID code 62. (54) PYRROLE COMPOUNDS (57) Provided herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharma- ceutical compositions that include a compound de- scribed herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are meth- ods of treating diseases and / or conditions with a com- pound of Formula (I), or a pharmaceutically acceptable salt thereof. EP 4 73 3 30 5 A 2 Processed by Luminess, 75001 PARIS (FR) Description INCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS

[0001] Any and all applications for which a foreign or domestic priority claim is identified, for example, in the Application DataSheet orRequest as filedwith the present application, are hereby incorporated by reference under 37CFR1.57, and Rules 4.18 and 20.6, including U.S. Provisional Application Nos. 62 / 828919, filed April 3, 2019 and 62 / 932686, filed November 8, 2019. BACKGROUND Field

[0002] The present application relates to the fields of chemistry, biochemistry and medicine. Disclosed herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) andmethods of synthesizing the same. Also disclosed herein are methods of treating diseases and / or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof. Description

[0003] The hepatitis B virus (HBV) is a DNA virus and a member of the Hepadnaviridae family. HBV infects more than 300 million worldwide, and is a causative agent of liver cancer and liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Although there are approved drugs for treating HBV, by either boosting the immune system or slowing down the replication of the HBV virus, HBV continues to be a problem due to the drawbacks associated with each of the approved drugs. SUMMARY

[0004] Some embodiments disclosed herein relate to a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

[0005] Some embodiments disclosed herein relate to a pharmaceutical composition that can contain an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

[0006] Some embodiments described herein relate to amethod of treating a HBVand / or HDV infection that can include administering to a subject identified as suffering from theHBVand / orHDV infection an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for the use of treating a HBV and / or HDV infection.

[0007] Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and / or HDV that can include contacting a cell infectedwith theHBVand / or HDVwith an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate toacompound, or apharmaceutically acceptable salt thereof, asdescribedherein, or apharmaceutical composition that includesaneffectiveamount of a compound, or apharmaceutically acceptable salt thereof, asdescribedherein for the use of inhibiting the replication HBV and / or HDV.

[0008] These are other embodiments are described in greater detail below DETAILED DESCRIPTION

[0009] HBV is a partially double-stranded circular DNA of about 3.2 kilobase (kb) pairs, and is classified into eight genotypes, A to H. The HBV replication pathway has been studied in great detail. T.J. Liang, Hepatology (2009) 49(5 Suppl):S13-S21. On part of replication includes the formation of the covalently closed circular (cccDNA) form. The presence of the cccDNA gives rise to the risk of viral reemergence throughout the life of the host organism. HBV carriers can transmit the disease formany years. An estimated 300million people are livingwith hepatitis B virus infection, and it is estimated that over 750,000 people worldwide die of hepatitis B each year. In addition, immunosuppressed individuals or individuals undergoing chemotherapy are especially at risk for reactivation of a HBV infection. HBV can be acute and / or 2 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 chronic. Acute HBV infection can be either asymptomatic or present with symptomatic acute hepatitis.

[0010] HBVcanbe transmittedbyblood, semen, and / or another body fluid. This canoccur throughdirect blood-to-blood contact, unprotected sex, sharing of needles, and from an infected mother to her baby during the delivery process. The HBV surface antigen (HBsAg) is most frequently used to screen for the presence of this infection. Currently available medications do not cure a HBV and / or HDV infection. Rather, the medications suppress replication of the virus.

[0011] Thehepatitis D virus (HDV) is aDNAvirus, also in theHepadnaviridae family of viruses. HDVcan propagate only in the presence of HBV. The routes of transmission of HDVare similar to those for HBV. Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or in addition to chronic hepatitis B or hepatitis B carrier state (superinfection). Both superinfectionandcoinfectionwithHDVresults inmore severe complications compared to infection withHBValone.Thesecomplications includeagreater likelihoodof experiencing liver failure inacute infectionsanda rapid progression to liver cirrhosis, with an increased risk of developing liver cancer in chronic infections. In combination with hepatitis B, hepatitis D has the highest fatality rate of all the hepatitis infections, at 20%. There is currently no cure or vaccine for hepatitis D. Definitions

[0012] Unless defined otherwise, all technical and scientific terms used herein have the samemeaning as is commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. In the event that there are a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.

[0013] Whenever a group is described as being "optionally substituted" that groupmay be unsubstituted or substituted with one ormore of the indicated substituents. Likewise,whena group is described as being "unsubstituted or substituted" if substituted, the substituent(s) may be selected from one or more of the indicated substituents. If no substituents are indicated, it is meant that the indicated "optionally substituted" or "substituted" groupmay be substituted with one ormore group(s) individually and independently selected from deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), (heterocyclyl)alkyl, hydroxy, alkoxy, acyl, cyano, halogen, thiocar- bonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C- carboxy, O-carboxy, isocyanato, thiocyanato, nitro, azido, silyl, sulfenyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalo- methanesulfonyl, trihalomethanesulfonamido, an amino, a mono-substituted amino group and a di-substituted amino group.

[0014] Asusedherein, "Ca toCb" inwhich "a" and "b" are integers refer to the number of carbonatoms in analkyl, alkenyl or alkynyl group, or the number of carbon atoms in the ring of a cycloalkyl, cycloalkenyl, aryl, heteroaryl or heterocyclyl group. That is, the alkyl, alkenyl, alkynyl, ring of the cycloalkyl, ring of the cycloalkenyl, ring of the aryl, ring of the heteroaryl or ring of the heterocyclyl can contain from "a" to "b", inclusive, carbon atoms. Thus, for example, a "C1 to C4 alkyl" group refers to all alkyl groups having from1 to 4 carbons, that is, CH3‑, CH3CH2‑, CH3CH2CH2‑, (CH3)2CH‑, CH3CH2CH2CH2‑, CH3CH2CH(CH3)‑ and (CH3)3C‑. If no "a" and "b" are designated with regard to an alkyl, alkenyl, alkynyl, cycloalkyl cycloalkenyl, aryl, heteroaryl or heterocyclyl group, the broadest range described in these definitions is to be assumed.

[0015] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that comprises a fully saturated (no double or triple bonds) hydrocarbon group. The alkyl groupmay have 1 to 20 carbon atoms (whenever it appears herein, a numerical rangesuchas "1 to20" refers to each integer in thegiven range;e.g., "1 to 20carbonatoms"means that thealkyl groupmay consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms, although the present definition also covers the occurrence of the term "alkyl" where no numerical range is designated). The alkyl groupmayalsobeamediumsizealkyl having1 to10carbonatoms.Thealkyl groupcouldalsobea loweralkyl having1 to6 carbon atoms. The alkyl group of the compounds may be designated as "C1‑C4 alkyl" or similar designations. By way of example only, "C1‑C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected frommethyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl and t-butyl. Typical alkyl groups include, but are in noway limited to,methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl and hexyl. The alkyl groupmay be substituted or unsubstituted.

[0016] As used herein, "alkenyl" refers to an alkyl group that contains in the straight or branched hydrocarbon chain one ormoredoublebonds.The lengthof analkenyl canvary.Forexample, thealkenyl canbeaC2‑4alkenyl,C2‑6alkenyl orC2‑8 alkenyl. Examples of alkenyl groups include allenyl, vinylmethyl and ethenyl. An alkenyl group may be unsubstituted or substituted.

[0017] As used herein, "alkynyl" refers to an alkyl group that contains in the straight or branched hydrocarbon chain one ormore triple bonds. The length of an alkynyl can vary. For example, the alkynyl can be aC2‑4 alkynyl, C2‑6 alkynyl or C2‑8 alkynyl. Examples of alkynyls include ethynyl and propynyl. An alkynyl group may be unsubstituted or substituted.

[0018] As used herein, "cycloalkyl" refers to a completely saturated (no double or triple bonds) mono‑ or multi‑ cyclic hydrocarbon ring system. When composed of two or more rings, the rings may be joined together in a fused fashion. Cycloalkyl groups can contain 3 to 10 atoms in the ring(s). 3 to 8 atoms in the ring(s) or 3 to 6 atoms in the ring(s). A 3 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 cycloalkyl group may be unsubstituted or substituted. Typical cycloalkyl groups include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.

[0019] As used herein, "cycloalkenyl" refers to a mono‑ or multi‑ cyclic hydrocarbon ring system that contains one or moredoublebonds in at least one ring; although, if there ismore thanone, thedouble bonds cannot forma fully delocalized pi-electronsystem throughoutall the rings (otherwise thegroupwouldbe "aryl," asdefinedherein).Whencomposedof two or more rings, the rings may be connected together in a fused fashion. A cycloalkenyl can contain 3 to 10 atoms in the ring(s) or 3 to 8 atoms in the ring(s). A cycloalkenyl group may be unsubstituted or substituted.

[0020] Asusedherein, "aryl" refers toacarbocyclic (all carbon)monocyclic ormulticyclic aromatic ringsystem(including fused ring systems where two carbocyclic rings share a chemical bond) that has a fully delocalized pi-electron system throughoutall the rings.Thenumberof carbonatoms inanaryl groupcanvary.For example, thearyl groupcanbeaC6‑C14 aryl group, a C6‑C10 aryl group, or a C6 aryl group. Examples of aryl groups include, but are not limited to, benzene, naphthalene and azulene. An aryl group may be substituted or unsubstituted.

[0021] Asused herein, "heteroaryl" refers to amonocyclic, bicyclic and tricyclic aromatic ring system (a ring systemwith fully delocalized pi-electron system) that contain(s) one ormore heteroatoms (for example, 1 to 5 heteroatoms), that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur. The number of atoms in the ring(s) of a heteroaryl group can vary. For example, the heteroaryl group can contain 4 to 14 atoms in the ring(s), 5 to 10 atoms in the ring(s) or 5 to 6 atoms in the ring(s). Furthermore, the term "heteroaryl" includes fused ring systemswhere two rings, such as at least one aryl ring and at least one heteroaryl ring, or at least two heteroaryl rings, share at least one chemical bond. Examples of heteroaryl rings include, but are not limited to, furan, furazan, thiophene, benzothiophene, phthalazine, pyrrole, oxazole, benzoxazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, thiazole, 1,2,3-thiadiazole, 1,2,4-thiadiazole, ben- zothiazole, imidazole, benzimidazole, indole, indazole, pyrazole, benzopyrazole, isoxazole, benzoisoxazole, isothiazole, triazole, benzotriazole, thiadiazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, quinoline, isoquinoline, quinazoline, quinoxaline, cinnoline and triazine. A heteroaryl group may be substituted or unsubstituted.

[0022] As used herein, "heterocyclyl" refers to a monocyclic, bicyclic and tricyclic ring system wherein carbon atoms together with from 1 to 5 heteroatoms constitute said ring system. A heterocycle may optionally contain one or more unsaturated bonds situated in such a way, however, that a fully delocalized pi-electron system does not occur throughout all the rings. The number of atoms in the ring(s) of a heterocyclyl group can vary. For example, the heterocyclyl group can contain4 to14atoms in the ring(s), 5 to10atoms in the ring(s)or 5 to6atoms in the ring(s).Theheteroatom(s) isanelement other than carbon including, but not limited to, oxygen, sulfur and nitrogen. A heterocyclemay further contain one ormore carbonyl or thiocarbonyl functionalities, so as to make the definition include oxo-systems and thio-systems such as lactams, lactones, cyclic imides, cyclic thioimides and cyclic carbamates.When composed of two ormore rings, the rings may be joined together in a fused fashion. Additionally, any nitrogens in a heterocyclyl may be quaternized. Heterocyclyl groups may be unsubstituted or substituted. Examples of such "heterocyclyl groups include but are not limited to, 1,3- dioxin, 1,3-dioxane, 1,4-dioxane, 1,2-dioxolane, 1,3-dioxolane, 1,4-dioxolane, 1,3-oxathiane, 1,4-oxathiin, 1,3-oxathio- lane, 1,3-dithiole, 1,3-dithiolane, 1,4-oxathiane, tetrahydro‑1,4-thiazine, 2H‑1,2-oxazine, maleimide, succinimide, barbi- turic acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro‑1,3,5-triazine, imidazoline, imidazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, oxirane, piperidine N-Oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiamorpholine, thiamorpholine sulfox- ide, thiamorpholine sulfone and their benzo-fused analogs (e.g., benzimidazolidinone, tetrahydroquinoline and 3,4- methylenedioxyphenyl).

[0023] As used herein, "aryl(alkyl)" refer to an aryl group connected, as a substituent, via a lower alkylene group. The lower alkylene and aryl group of an aryl(alkyl) may be substituted or unsubstituted. Examples include but are not limited to benzyl, 2-phenyl(alkyl), 3-phenyl(alkyl), and naphthyl(alkyl).

[0024] As used herein, "heteroaryl(alkyl)" refer to a heteroaryl group connected, as a substituent, via a lower alkylene group.The loweralkyleneandheteroaryl groupof heteroaryl(alkyl)maybesubstitutedor unsubstituted.Examples include but are not limited to 2-thienyl(alkyl), 3-thienyl(alkyl), furyl(alkyl), thienyl(alkyl), pyrrolyl(alkyl), pyridyl(alkyl), isoxazoly- l(alkyl), imidazolyl(alkyl), and their benzo-fused analogs.

[0025] A "(heterocyclyl)alkyl" refer to a heterocyclic group connected, as a substituent, via a lower alkylene group. The lower alkylene and heterocyclyl of a heterocyclyl(alkyl) may be substituted or unsubstituted. Examples include but are not limited tetrahydro‑2H-pyran‑4-yl(methyl), piperidin‑4-yl(ethyl), piperidin‑4-yl(propyl), tetrahydro‑2H-thiopyran‑4- yl(methyl) and 1,3-thiazinan‑4-yl(methyl).

[0026] "Lower alkylene groups" are straight-chained ‑CH2‑ tethering groups, forming bonds to connect molecular fragments via their terminal carbon atoms. Examples include but are not limited to methylene (-CH2‑), ethylene (-CH2CH2‑), propylene (-CH2CH2CH2‑) and butylene (-CH2CH2CH2CH2‑). A lower alkylene group can be substituted by replacing one or more hydrogen of the lower alkylene group with a substituent(s) listed under the definition of "substituted."

[0027] As used herein, "alkoxy" refers to the formula ‑OR wherein R is an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a 4 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) is defined herein. A non- limiting list of alkoxys aremethoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy, tert- butoxy, phenoxy and benzoxy. An alkoxy may be substituted or unsubstituted.

[0028] As used herein, "acyl" refers to a hydrogen an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) connected, as substituents, via a carbonyl group. Examples include formyl, acetyl, propanoyl, benzoyl, and acryl. An acyl may be substituted or unsubstituted.

[0029] As used herein, "hydroxyalkyl" refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a hydroxy group. Exemplary hydroxyalkyl groups include but are not limited to, hydroxymethyl, 1-hydroxyethyl, 2- hydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl and 2,2-dihydroxyethyl. A hydroxyalkyl may be substituted or unsub- stituted.

[0030] As used herein, "haloalkyl" refers to an alkyl group in which one ormore of the hydrogen atoms are replaced by a halogen (e.g., mono-haloalkyl, di-haloalkyl and trihaloalkyl). Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 1-chloro‑2-fluoromethyl and 2-fluoroisobutyl. A haloalkyl may be substituted or unsubstituted.

[0031] Asusedherein, "haloalkoxy" refers toaO-alkyl group inwhichoneormoreof thehydrogenatomsare replacedby a halogen (e.g., mono-haloalkoxy, di-haloalkoxy and tri-haloalkoxy). Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, 1-chloro‑2-fluoromethoxy and 2-fluoroisobutoxy. A haloalkoxy may be substituted or unsubstituted.

[0032] A "sulfenyl" group refers to an "-SR" group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A sulfenyl may be sub- stituted or unsubstituted.

[0033] A "sulfinyl" group refers to an "-S(=O)‑R" group in which R can be the same as definedwith respect to sulfenyl. A sulfinyl may be substituted or unsubstituted.

[0034] A "sulfonyl" group refers to an "SO2R" group in which R can be the same as defined with respect to sulfenyl. A sulfonyl may be substituted or unsubstituted.

[0035] An "O-carboxy" group refers to a "RC(=O)O‑" group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl), as defined herein. An O-carboxy may be substituted or unsubstituted.

[0036] The terms "ester" and "C-carboxy" refer to a "-C(=O)OR" group in which R can be the same as defined with respect to O-carboxy. An ester and C-carboxy may be substituted or unsubstituted.

[0037] A "thiocarbonyl" group refers to a "-C(=S)R" group in which R can be the same as defined with respect to O- carboxy. A thiocarbonyl may be substituted or unsubstituted.

[0038] A "trihalomethanesulfonyl" group refers to an "X3CSO2‑" group wherein each X is a halogen.

[0039] A "trihalomethanesulfonamido" group refers to an "X3CS(O)2N(RA)‑" groupwherein eachX is a halogen, andRA is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl).

[0040] The term "amino" as used herein refers to a ‑NH2 group.

[0041] As used herein, the term "hydroxy" refers to a ‑OH group.

[0042] A "cyano" group refers to a "-CN" group.

[0043] The term "azido" as used herein refers to a ‑N3 group.

[0044] An "isocyanato" group refers to a "-NCO" group.

[0045] A "thiocyanato" group refers to a "-CNS" group.

[0046] An "isothiocyanato" group refers to an " ‑NCS" group.

[0047] A "mercapto" group refers to an "-SH" group.

[0048] A "carbonyl" group refers to a C=O group.

[0049] An "S-sulfonamido" group refers to a "-SO2N(RARB)" group in which RA andRB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocycly- l(alkyl). An S-sulfonamido may be substituted or unsubstituted.

[0050] An "N-sulfonamido" group refers to a "RSO2N(RA)‑" group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocycly- l(alkyl). An N-sulfonamido may be substituted or unsubstituted.

[0051] An "O-carbamyl" group refers to a "-OC(=O)N(RARB)" group inwhichRAandRBcanbe independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocycly- l(alkyl). An O-carbamyl may be substituted or unsubstituted.

[0052] An "N-carbamyl" group refers to an "ROC(=O)N(RA)‑" group in which R andRA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocycly- l(alkyl). An N-carbamyl may be substituted or unsubstituted.

[0053] An "O-thiocarbamyl" group refers to a "-OC(=S)‑N(RARB)" group in which RA and RB can be independently 5 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An O-thiocarbamyl may be substituted or unsubstituted.

[0054] An "N-thiocarbamyl" group refers to an "ROC(=S)N(RA)‑" group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-thiocarbamyl may be substituted or unsubstituted.

[0055] A "C-amido" group refers to a "-C(=O)N(RARB)" group inwhichRA andRB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A C-amido may be substituted or unsubstituted.

[0056] An "N-amido" group refers to a "RC(=O)N(RA)‑" group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-amido may be substituted or unsubstituted.

[0057] The term "halogenatom"or "halogen" asusedherein,meansanyoneof the radio-stableatomsof column7of the Periodic Table of the Elements, such as, fluorine, chlorine, bromine and iodine.

[0058] Asusedherein, the term "α-aminoacids" refers toanyaminoacid (both standardandnon-standardaminoacids). Examples of suitable α-amino acids include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine.

[0059] As used herein, the term "phosphate" is used in its ordinary sense as understood by those skilled in the art, and includes along with its protonated forms (for example,

[0060] Where the numbers of substituents is not specified (e.g. haloalkyl), there may be one or more substituents present. For example "haloalkyl" may include one or more of the same or different halogens. As another example, "C1‑C3 alkoxyphenyl" may include one or more of the same or different alkoxy groups containing one, two or three atoms.

[0061] As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (See, Biochem. 11:942‑944 (1972)).

[0062] The term "pharmaceutically acceptable salt" refers to a salt of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. In someembodiments, the salt is an acid addition salt of the compound. Pharmaceutical salts can be obtained by reacting a compoundwith inorganic acids such as hydrohalic acid (e.g., hydrochloric acid or hydrobromic acid), sulfuric acid, nitric acid and phosphoric acid. Pharmaceutical salts can also be obtained by reacting a compound with an organic acid such as aliphatic or aromatic carboxylic or sulfonic acids, for example formic, acetic, succinic, lactic, malic, tartaric, citric, ascorbic, nicotinic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicylic or naphthalenesulfonic acid. Pharmaceutical salts can also be obtained by reacting a compound with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methy- lamine, C1‑C7 alkylamine, cyclohexylamine, triethanolamine, ethylenediamine, and salts with amino acids such as arginine and lysine.

[0063] Terms and phrases used in this application, and variations thereof, especially in the appended claims, unless otherwise expressly stated, should be construed as open ended as opposed to limiting. As examples of the foregoing, the term ’including’ should be read to mean ’including, without limitation,’ ’including but not limited to,’ or the like; the term ’comprising’ as used herein is synonymous with ’including,’ ’containing,’ or ’characterized by,’ and is inclusive or open- ended and does not exclude additional, unrecited elements or method steps; the term ’having’ should be interpreted as ’having at least;’ the term ’includes’ should be interpreted as ’includes but is not limited to;’ the term ’example’ is used to provide exemplary instances of the item in discussion, not an exhaustive or limiting list thereof. In addition, the term 6 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 "comprising" is to be interpreted synonymously with the phrases "having at least" or "including at least". When used in the context of a compound or composition, the term "comprising" means that the compound or composition includes at least the recited features or components, but may also include additional features or components.

[0064] With respect to the use of substantially any plural and / or singular terms herein, those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application. The various singular / plural permutations may be expressly set forth herein for sake of clarity. The indefinite article "a" or "an" does not exclude a plurality.

[0065] It is understood that, in any compound described herein having one or more chiral centers, if an absolute stereochemistry is not expressly indicated, then each center may independently be of (R)‑configuration or (S)‑config- uration or a mixture thereof. Thus, the compounds provided herein may be enantiomerically pure, enantiomerically enriched, racemicmixture, diastereomerically pure, diastereomerically enriched, or a stereoisomericmixture. Inaddition it is understood that, in any compounddescribed herein havingoneormoredouble bond(s) generatinggeometrical isomers that can be defined as E or Z, each double bondmay independently be E or Z amixture thereof. Likewise, it is understood that, in any compound described, all tautomeric forms are also intended to be included.

[0066] It is tobeunderstood thatwherecompoundsdisclosedhereinhaveunfilledvalencies, then thevalenciesare tobe filled with hydrogens or isotopes thereof, e.g., hydrogen‑1 (protium) and hydrogen‑2 (deuterium).

[0067] It is understood that the compounds described herein can be labeled isotopically. Substitutionwith isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements. Each chemical element as represented in a compound structure may include any isotope of said element. For example, in a compound structure a hydrogen atom may be explicitly disclosed or understood to be present in the compound. At any position of the compound that a hydrogen atom may be present, the hydrogen atom can be any isotope of hydrogen, including but not limited to hydrogen‑1 (protium) and hydrogen‑2 (deuterium). Thus, reference herein to a compound encompasses all potential isotopic forms unless the context clearly dictates otherwise.

[0068] Where a range of values is provided, it is understood that the upper and lower limit, and each intervening value between the upper and lower limit of the range is encompassed within the embodiments. Compounds

[0069] Some embodiments disclosed herein relate to a compound of Formula (I), or a pharmaceutically acceptable salt thereof: wherein: R1 can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkenyl, the C2 alkynyl and themonocyclic heteroaryl are substituted, theC2 alkenyl, theC2 alkynyl and themonocyclic heteroaryl can be independently substituted with one or more substituents selected from halogen, an unsubstituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted C1‑4 hydroxyalkyl, an unsubstituted monocyclic C3‑6 cycloalkyl and a hydroxy-substituted monocyclic C3‑6 cycloalkyl; R2 and R3 can be independently selected from hydrogen, an unsub- stituted or a substituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstituted C1‑5 alkoxyalkyl, wherein when the monocyclic C3‑6 cycloalkyl and the monocyclic 3‑6 heterocyclyl are substituted, themonocyclic C3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl can be independently substitutedwith one ormore substituents selected fromhalogenor hydroxy, andwhereinwhen theC1‑4 alkyl is substituted, theC1‑4 alkyl is substitutedwithoneormore substituents selected from thegroupconsistingof aphosphate, anO-linkedα-aminoacidand an O-carboxy; or R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, whereinwhen theC3‑6 cycloalkyl and 3‑6membered heterocyclyl are substituted, theC3‑6 cycloalkyl and the 7 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 3‑6membered heterocyclyl can be independently substitutedwith 1 or 2 substituents selected fromhalogen and hydroxy; R4 and R5 can be independently hydrogen, halogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; R6 can be hydrogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C3‑4 alkenyl; and provided that at least one of R4, R5 and R6 is not hydrogen; or R5 can be hydrogen, halogen, an unsubstituted C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; and R4 andR6 can be taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring; X1 can be CRA or N (nitrogen); R7a, R7b, R7c and R7d can be independently hydrogen, halogen, an unsubstituted C1‑4 haloalkyl, cyano or an unsubstituted C1‑4 alkoxy; R8 can be hydrogen, ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsubstituted C1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2- phosphate; and RA can be hydrogen, halogen, an unsubstituted C1‑4 haloalkyl or cyano.

[0070] Various groups can be attached to the pyrrole ring of Formula (I). As provided herein, the pyrrole ring can have hydrogen, halogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl and / or or an unsubstituted C2‑4 alkenyl attached, provided that at least one of R4, R5 and R6 is not hydrogen. Examples of C1‑4 alkyls include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl and tert-butyl. In someembodiments, one ofR4 andR5 canbehalogenor anunsubstitutedC1‑4 alkyl and / orR6canbeanunsubstitutedC1‑4 alkyl. In otherembodiments,R4and / orR5canbeeach independently halogen or an unsubstituted C1‑4 alkyl and / or R6 can be an unsubstituted C1‑4 alkyl. In still other embodiments, R4 and R5 can be each independently halogen or an unsubstituted C1‑4 alkyl and R6 can be an unsubstituted C1‑4 alkyl. In yet still other embodiments, one of R4, R5 and R6 can be an unsubstituted C1‑4 alkyl and one of R4, R5 and R6 can be an unsubstituted C3‑4alkenyl.WhenoneofR4,R5andR6 isadeuteratedC1‑4 alkyl, oneormorehydrogensofaC1‑4alkyl canbe replacedby deuteriums. For example, one of R4, R5 andR6 can beCH2D,CHD2,CD3, CH2CD3, CD2CD3, CH2CH2CD3, CH(CD3)2. In some embodiments, one of R4, R5 and R6 can be a deuterated C1‑4 alkyl, and the other two of R4, R5 and R6 can be an unsubstituted C1‑4 alkyl.

[0071] In some embodiments, R4 can be hydrogen; R5 can be hydrogen; and R6 can be an unsubstituted C1‑4 alkyl. In other embodiments, R4 can be halogen; R5 can be hydrogen; and R6 can be an unsubstituted C1‑4 alkyl. In still other embodiments, R4 can be hydrogen; R5 can be halogen; and R6 can be an unsubstituted C1‑4 alkyl. In still other embodiments, R4 can be hydrogen; R5 can be an unsubstituted C1‑4 alkyl; and R6 can be an unsubstituted C3‑4 alkenyl.

[0072] In someembodiments, R4 canbe hydrogen; R5 can behalogen; andR6 canbe hydrogen. In other embodiments, R4canbehydrogen;R5 canbehalogen; andR6canbehydrogen. In still other embodiments,R4 canbehalogen;R5canbe halogen; and R6 can be hydrogen. In yet still other embodiments, R4 can be an unsubstituted C1‑4 alkyl; R5 can be hydrogen; andR6 can be anunsubstitutedC1‑4 alkyl. In some embodiments, R4 can be an unsubstitutedC1‑4 alkyl; R5 can behalogen;andR6canbeanunsubstitutedC1‑4 alkyl. In otherembodiments,R4canbeanunsubstitutedC1‑4 alkyl;R5 can beanunsubstitutedC1‑4 alkyl; andR6canbeanunsubstitutedC1‑4 alkyl. In still other embodiments,whenR4,R5and / orR6 areanunsubstitutedC1‑4 alkyl, theunsubstitutedC1‑4 alkyl canbemethyl. For example,R4,R5andR6canbeeachmethyl. In yet still other embodiments, R4 can be hydrogen; and R5 and R6 can be each an unsubstituted C1‑4 alkyl. In some embodiments,R4canbehalogen;andR5andR6canbeeachanunsubstitutedC1‑4alkyl. Inotherembodiments,R5canbe halogen; and R4 and R6 can be each an unsubstituted C1‑4 alkyl. In still other embodiments, R4 and R5 can be each hydrogen; andR6canbeanunsubstitutedC1‑4 alkyl. In yet still embodiments,R4 canbehydrogen;R5canbehalogen; and R6 can be an unsubstituted C1‑4 alkyl. In some embodiments, R4 and R5 can be each halogen; and R6 can be an unsubstituted C1‑4 alkyl. In other embodiments, R4 and R5 can be each an unsubstituted C1‑4 alkyl; and R6 can be a deuterated C1‑4 alkyl, such as CD3.

[0073] As provided herein, in some embodiments, R5 can be hydrogen, halogen, an unsubstituted C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; and R4 and R6 can be taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring. For example, R4 and R6 can be taken together to form an unsubstituted or substituted or an unsubstituted or substituted wherein N* indicates the nitrogen of the pyrrolyl of Formula (I). In some embodiments, R5 can be hydrogen; andR4 andR6 can be taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring such as those described herein. In other embodiments, R5 can be halogen; and R4 and R6 can be taken together to form an unsubstituted or 8 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 substituted 5‑6 membered heterocyclic ring such as those described herein. In still other embodiments, R5 can be an unsubstituted C1‑4 alkyl; and R4 and R6 can be taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring such as those described herein. In yet still other embodiments, R5 can be an unsubstituted C2‑4 alkenyl; andR4andR6canbe taken together to formanunsubstitutedor substituted5‑6memberedheterocyclic ring suchas those described herein.

[0074] The 6-membered aromatic ring that includes X1 can be an optionally substituted phenyl or an optionally substituted pyridine. When X1 is CRA, the 6-membered ring can be an optionally substituted phenyl. The 6-membered aromatic ring can be an optionally substituted pyridine when X1 is N (nitrogen). As provided herein, the 6-membered aromatic ring that includesX1 can be substituted.When substituted, the phenyl and / or pyridine can be substituted 1, 2 or 3 or more times. The substituted phenyl ring can be substituted at the para-position. Additionally or in the alternative, the phenyl ring can be substituted at themeta-position. In someembodiments, the phenyl ring can be substituted at the ortho- position.

[0075] In some embodiments, X1 can be CH. In other embodiments, X1 can be CRA.When X1 is CRA, RA can be a non- hydrogen group. For example, in some embodiments, RA can be halogen (such as F, Cl or Br). In other embodiments, RA can be an unsubstituted C1‑4 haloalkyl. Suitable C1‑4 haloalkyls include, but are not limited to, ‑CHF2, - CF3, CH2F, CHClF AND CCl3. In still other embodiments, RA can be cyano. In yet still other embodiments, RA can be an unsubstituted C1‑4 alkoxy. Example C1‑4 alkoxys include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy and tert-butoxy.

[0076] As described herein, R7b and / R7c can be hydrogen. AswithRA, R7b and / R7c can be a non-hydrogen group, such as halogen, an unsubstituted C1‑4 haloalkyl, cyano and an unsubstituted C1‑4 alkoxy. In some embodiments, R7b can be hydrogen. In other embodiments, R7b can be halogen (for example, F, Cl or Br). In still other embodiments, R7b can be an unsubstituted C1‑4 haloalkyl, such as those described herein and including ‑CHF2, ‑CF3, and ‑CH2F. In yet still other embodiments,R7b canbecyano. Insomeembodiments,R7b canbeanunsubstitutedC1‑4 alkoxy, suchas thosedescribed herein. In someembodiments, R7c can be hydrogen. In other embodiments, R7c can be halogen, such as F, Cl or Br. In still other embodiments, R7c can bean unsubstitutedC1‑4 haloalkyl, such as ‑CHF2, ‑CF3, ‑CH2F, ‑CHClFand ‑CCl3. In yet still other embodiments, R7c can be cyano. In some embodiments, R7c can be an unsubstituted C1‑4 alkoxy, for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy and tert-butoxy.

[0077] As with other positions on the 6-membered aromatic ring that includes X1, R7a and / or R7d can be hydrogen or a non-hydrogen group. In someembodiments, R7a can be hydrogen. In other embodiments, R7a can be halogen, such as F, Cl or Br. In still other embodiments, R7a can be an unsubstitutedC1‑4 haloalkyl, for example, ‑CHF2, ‑CF3, ‑CH2F, - CHClF and ‑CCl3. In yet still other embodiments, R7a can be cyano. In some embodiments, R7a can be an unsubstituted C1‑4 alkoxy, including, but not limited to, those described herein. In some embodiments, R7d can be hydrogen. In other embodiments, R7d can be halogen (for example, F, Cl or Br). In still other embodiments, R7d can be an unsubstituted C1‑4 haloalkyl, including, but are not limited to, ‑CHF2, ‑CF3, ‑CH2F, ‑CHClF and ‑CCl3. In yet still other embodiments, R7d can be cyano. In someembodiments,R7d canbeanunsubstitutedC1‑4 alkoxy. For example,R7d canbe for example,methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy or tert-butoxy.

[0078] In some embodiments, RA can be a non-hydrogen group as described herein; and R7b or R7c can be a non- hydrogen group as described herein. In other embodiments, RA can be a non-hydrogen group as described herein; R7b or R7c can bea non-hydrogen groupas described herein; andR7a andR7d are each hydrogen. In still other embodiments, RA can be a non-hydrogen group as described herein; one of R7b and R7c can be a non-hydrogen group as described herein, and the other of R7b and R7c can be hydrogen; and R7a and R7d are each hydrogen. The following are examples of 6- membered aromatic ring that includes X1:

[0079] In some embodiments, R2 and R3 can be independently selected from hydrogen, an unsubstituted or a substituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an 9 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 unsubstituted C1‑5 alkoxyalkyl, wherein when the monocyclic C3‑6 cycloalkyl and the monocyclic 3‑6 heterocyclyl are substituted, themonocyclicC3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl can be independently substitutedwith one or more substituents selected from halogen or hydroxy, and wherein when the C1‑4 alkyl is substituted, the C1‑4 alkyl is substitutedwithoneormore substituents selected from thegroupconsistingof aphosphate, anO-linkedα-aminoacidand anO-carboxy. In other embodiments, R2 andR3 are taken together alongwith the carbon towhich R2 andR3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, wherein when the C3‑6 cycloalkyl and 3‑6 membered heterocyclyl are substituted, the C3‑6 cycloalkyl and the 3‑6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy.

[0080] The substituents for R2 and R3 can be the same or different, or R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl. In some embodiments, R2 and R3 can be each hydrogen. In other embodiments, R2 and R3 can be each an unsubstituted C1‑4 alkyl. Examples of suitable an unsubstituted C1‑4 alkyls are described herein. For example, R2 and R3 can be each methyl.

[0081] Asdescribedherein,R2 andR3 canbedifferent. Asanexample, oneofR2 andR3 canbehydrogen; and theother of R2 and R3 can be an unsubstituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstituted C1‑5 alkoxyalkyl. In some embodiments, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be an unsubstituted C1‑4 alkyl, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl and tert-butyl. In other embodiments, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be an unsubstituted C1‑4 haloalkyl. Exemplary C1‑4 haloalkyls are described herein, and include, but are not limited to, ‑CHF2, ‑CF3, ‑CH2F, ‑CHClF and ‑CCl3. In still other embodiments, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be an unsubstitutedor a substitutedmonocyclicC3‑6 cycloalkyl. For example, oneofR2andR3canbehydrogen; and theother of R2 and R3 can be an unsubstituted cycloproyl, an unsubstituted cyclobutyl, an unsubstituted cyclopentyl and an unsubstituted cyclohexyl; or one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be a substituted cycloproyl, a substituted cyclobutyl, a substituted cyclopentyl and a substituted cyclohexyl. When substituted, the substituted monocyclic C3‑6 cycloalkyl can be substituted 1, 2 or 3 or times with a substituent independently selected from halogen (F, Cl or Br) and hydroxy. In some embodiments, substituted monocyclic C3‑6 cycloalkyl can be substituted with 1 or 2 halogens. For example, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be In yet still other embodiments, one of R2 andR3 can be hydrogen; and the other of R2 andR3 can be an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl. Various monocyclic 3‑6 membered heterocyclyls are suitable for R2 / R3. In some embodiments, one of R2 andR3 can be hydrogen; and the other of R2 andR3 can be an unsubstitutedC1‑4 hydroxyalkyl. As an example, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be ‑CH2OH. In other embodiments, one of R2 and R3 can be hydrogen; and the other of R2 and R3 can be an unsubstituted C1‑5 alkoxyalkyl. Examples of an unsubstituted C1‑5 alkoxyalkyls include ‑CH2OCH3, ‑CH2CH2OCH3, - CH2OCH2CH3, ‑CH2CH2OCH2CH3, ‑CH2OCH(CH3)2, ‑CH2OCH2CH(CH3)2 and - CH2CH2OCH(CH3)2.

[0082] A prodrug moiety can be present at one of R2 and R3. In some embodiments, one of R2 and R3 can be an unsubstituted C1‑4 alkyl (for example, methyl); and the other of R2 andR3 can be a substituted C1‑4 alkyl, wherein the C1‑4 alkyl is substituted with one ormore substituents selected from a phosphate, anO-linkedα-amino acid and anO-carboxy. Suitable α-amino acids are described herein and include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine. As used herein, an "-O-linked α-amino acid" refers to an α-amino acid that is attached to the indicatedmoiety via thehydroxy from itsmain-chain carboxylic acid group.When theα-aminoacid is attached in an ‑O-linkedα-amino acid, the hydrogen that is part of the hydroxy from itsmain-chain carboxylic acid group is notpresent and theα-aminoacid isattachedvia theoxygen. Insomeembodiments, the ‑O-linkedα-aminoacidsubstituted on the C1‑4 alkyl of R2 or R3 can be an ‑O-linked-L-α-amino acid. In other embodiments, the ‑O-linked α-amino acid substituted on the C1‑4 alkyl of R2 or R3 can be an ‑O-linked-D-α-amino acid. Examples of ‑O-linked-α-amino acids are shown herewith respect toR8. As another example of a prodrugmoiety that can be present on the substitutedC1‑4 alkyl of R2orR3 isanO-carboxy. In someembodiments, oneofR2andR3canbeanunsubstitutedC1‑4 alkyl (suchas,methyl); and the other of R2 and R3 can be an O-carboxy substituted C1‑4 alkyl. For example, the O-carboxy substituted C1‑4 alkyl can have the structure ‑(CH2)4‑OC(=O)(an unsubstituted C1‑4 alkyl). As described herein, the C1‑4 alkyl of R2 or R3 can be substituted with a phosphate. For example, when R2 or R3 are a substituted C1‑4 alkyl with a phosphate, R2 or R3 can be 10 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 ‑CH2‑O-P(=O)(O-)2 or ‑CH2‑OP(=O)(OH)2.

[0083] As provided herein, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl are substituted, the C3‑6 cycloalkyl and the 3‑6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy. In some embodiments, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted monocyclic C3‑6 cycloalkyl. In other embodiments, R2 andR3 can be taken together alongwith the carbon towhichR2 and R3 are attached to form a substituted monocyclic C3‑6 cycloalkyl. The C3‑6 cycloalkyl can be an unsubstituted or a substituted cyclopropyl, an unsubstituted or a substituted cyclobutyl, an unsubstituted or a substituted cyclopentyl or an unsubstituted or a substituted cyclohexyl.When theC3‑6 cycloalkyl is substituted, theC3‑6 cycloalkyl can be substituted 1, 2 or 3 or more times. When 2 or more substituents are present, the substituents can be all the same or at least different substituents can be present. For example, in some embodiments, the C3‑6 cycloalkyl can be substituted with 1 or 2 halogens (such as 1 or 2 fluoro substituents). In other embodiments, the C3‑6 cycloalkyl can be substitutedwith a hydroxy. Exemplary C3‑6 cycloalkyls include unsubstituted cyclopropyl, unsubstituted cyclobutyl, unsubstituted cyclopentyl, unsubstituted cyclohexyl, fluoro-substituted cyclopropyl, fluoro-substituted cyclobutyl, fluoro-substituted cyclopentyl, fluoro-substituted cyclohexyl, hydroxy-substituted cyclopropyl, hydroxy-substituted cyclobutyl, hydroxy-substituted cy- clopentyl, hydroxy-substituted cyclohexyl,

[0084] In someembodiments, R2 andR3 canbe taken together alongwith the carbon towhichR2 andR3 are attached to form an unsubstituted monocyclic 3‑6 membered heterocyclyl. In some embodiments, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form a substituted monocyclic 3‑6 membered heterocyclyl. For example, R2 andR3 can be taken together alongwith the carbon towhichR2 andR3 are attached to forman unsubstituted or substituted monocyclic 3-membered heterocyclyl, an unsubstituted or substituted monocyclic 4-membered hetero- cyclyl, anunsubstitutedor substitutedmonocyclic 5-memberedheterocyclyl or anunsubstitutedor substitutedmonocyclic 6-membered heterocyclyl. In some embodiments, R2 andR3 can be taken together alongwith the carbon to which R2 and R3 are attached to form an unsubstituted monocyclic, oxygen-containing 3‑6 membered heterocyclyl. In other embodi- ments, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted monocyclic, nitrogen-containing 3‑6 membered heterocyclyl. Suitable monocyclic 3‑6 membered heterocyclyls include, but arenot limited to, anunsubstitutedor substitutedoxetane, anunsubstitutedor substituted thietane, anunsubstitutedor substituted an unsubstituted or substituted an unsubstituted or substituted 11 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 an unsubstituted or substituted an unsubstituted or substituted and an unsubstituted or substituted In some embodiments, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form

[0085] Various unsaturated substituents can be present at R1. As described herein, R1 can be substituted or unsubstituted. In some embodiments, R1 can be an unsubstituted C2 alkenyl. In other embodiments, R1 can be a substituted C2 alkenyl that can be substituted with one or more substituents independently selected from halogen, an unsubstituted C1‑4 haloalkyl an unsubstituted C1‑4 hydroxyalkyl, an unsubstituted monocyclic C3‑6 cycloalkyl and a hydroxy-substituted monocyclic C3‑6 cycloalkyl. In some embodiments, R1 can be an unsubstituted C2 alkynyl. In other embodiments, R1 can be a substituted C2 alkynyl. The C2 alkynyl can be substituted one or more times with a substituent independently selected from halogen, an unsubstituted C1‑4 haloalkyl an unsubstituted C1‑4 hydroxyalkyl, an unsub- stitutedmonocyclic C3‑6 cycloalkyl and a hydroxy-substitutedmonocyclic C3‑6 cycloalkyl. For example, theC2 alkynyl can be substituted one timewith an unsubstitutedmonocyclic C3‑6 cycloalkyl or theC2 alkynyl can be substituted one timewith an unsubstituted C1‑4 haloalkyl. In some embodiments, R1 can be an unsubstituted C1‑4 haloalkyl, for example, CF3.

[0086] As described herein, several cyclic moieties can be present at R1. In some embodiments, R1 can be an unsubstituted monocyclic heteroaryl. In other embodiments, R1 can be a substituted monocyclic heteroaryl. Several suitablemonocyclic heteroaryls are described herein. In some embodiments, R1 can be an unsubstituted or a substituted nitrogen-containing monocyclic heteroaryl, for example, R1 can be an unsubstituted or a substituted 1,2,3-triazole (such as ), an unsubstituted or a substituted thiazole (for example, 12 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 ), an unsubstituted or a substituted pyridinyl (such as ), an unsubstituted or a substituted pyrimindine (for example, ) an unsubstituted or a substituted pyrazole (e.g., ) an unsubstituted or a substituted imidazole (such as ) or an unsubstituted or a substituted oxadiazole (for example, ), wherein eachof the structures showncanbeunsubstituted or substituted (includingwhere ahydrogenonanitrogen can be replaced with a non-hydrogen substitutent). In some embodiments, R1 can be an unsubstituted bicyclic heteroaryl. In other embodiments, R1 can be a substituted bicyclic heteroaryl. Exemplary bicyclic heteroaryls are provided herein, and include benzimidazole. In some embodiments, R1 can be an unsubstituted monocyclic heterocyclyl. In other embodi- ments, R1 can be a substituted monocyclic heterocyclyl. Several examples of suitable monocyclic heterocyclyls are described herein. In some embodiments, R1 can be an unsubstituted or substituted 2-oxo‑1H-pyridinyl. When cyclic moieities of R1 is substituted, various substituents can be present. Examples of substituents that can be present on the monocyclic heteroaryl of R1 include the following: an unsubstituted C1‑4 alkyl, an unsubstituted cyclopropyl and an unsubstituted cyclobutyl.

[0087] Several substituents canbepresentatR8. In someembodiments,R8canbehydrogen. Inotherembodiments,R8 can be ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl). For example, R8 can be pivaloyloxymethyl (POM). In still other embodiments, R8 canbe -CH2OC(=O)‑O(an unsubstitutedC1‑4 alkyl), such as isopropyloxycarbonyloxymethyl (POC). In yet still other embodiments, R8 canbe ‑CH2‑(α-aminoacid). Suitableα-amino acids include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine. When R8 includes an α-amino acid, the carboxylic acidmoiety is theportion connected to the ‑CH2of ‑CH2‑(α-aminoacid), and thehydrogenof the carboxylic acid 13 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 is not present. As some examples, R8 can be In some embodiments, the -α-amino acid of ‑CH2‑(α-amino acid) of R8 can be an L-α-amino acid. In other embodiments, the -α-amino acid of ‑CH2‑(α-amino acid) of R8 can be an D-α-amino acid. In some embodiments, R8 can be ‑CH2- phosphate

[0088] Compounds of Formula (I), along with pharmaceutically acceptable salts thereof, can have a variety of structures. In someembodiments,R1canbeanunsubstitutedor asubstitutedC2alkenyl, anunsubstitutedor asubstituted C2alkynyl, an unsubstitutedor a substitutedmonocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkenyl, the C2 alkynyl, an unsubstituted C1‑4 haloalkyl and themonocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and themonocyclic heteroaryl are independently substituted with one or more substituents selected from halogen, an unsubstituted C1‑4 alkyl, an 14 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 unsubstituted C1‑4 haloalkyl, an unsubstituted C1‑4 hydroxyalkyl, an unsubstituted monocyclic C3‑6 cycloalkyl and a hydroxy-substituted monocyclic C3‑6 cycloalkyl; R2 and R3 can be independently selected from hydrogen, an unsub- stituted or a substituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstituted C1‑5 alkoxyalkyl, wherein when the monocyclic C3‑6 cycloalkyl and the monocyclic 3‑6 heterocyclyl are substituted, themonocyclicC3‑6 cycloalkyl and themonocyclic 3‑6heterocyclyl are independently substitutedwithone or more substituents selected from halogen or hydroxy, and wherein when the C1‑4 alkyl is substituted, the C1‑4 alkyl is substituted with one or more substituents selected from a phosphate, an O-linked α-amino acid and an O-carboxy, and provided that at least one of R2 and R3 is not hydrogen; R4 and R5 can be independently hydrogen, halogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; R6 can be hydrogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C3‑4 alkenyl; and provided that at least one of R4, R5 and R6 is not hydrogen; X1 can be CRA or N; R7a, R7b, R7c and R7d can be independently hydrogen, halogen, an unsubstituted C1‑4 haloalkyl, cyano or an unsubstituted C1‑4 alkoxy; R8 can be hydrogen, ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsubstitutedC1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2-phosphate; andRA can be hydrogen, halogen, an unsubstitutedC1‑4 haloalkyl or cyano. For this paragraph, when at least one of R2 andR3 is not hydrogen, the following for R2 and R3 are provided: (1) R2 and R3 can be each an unsubstituted C1‑4 alkyl, such as methyl, (2) a C1‑4 alkyl substitutedbyaphosphate, anO-linkedα-aminoacidoranO-carboxy (for example, ‑O(C=O)(anunsubstitutedC1‑4 alkyl), (3) an unsubstituted C1‑4 haloalkyl (for example, CF3), (4) an unsubstituted cyclopropyl and (5) an unsubstituted C1‑4 hydroxyalkyl (such as ‑CH2OH).

[0089] In other embodiments, R1 can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2alkynyl, an unsubstitutedor a substitutedmonocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkenyl, the C2 alkynyl, an unsubstituted C1‑4 haloalkyl and themonocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and themonocyclic heteroaryl are independently substituted with one or more substituents selected from halogen, an unsubstituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted C1‑4 hydroxyalkyl, an unsubstituted monocyclic C3‑6 cycloalkyl and a hydroxy-substitutedmonocyclicC3‑6 cycloalkyl; R2 andR3 canbe taken together alongwith the carbon towhichR2andR3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6memberedheterocyclyl,whereinwhen theC3‑6 cycloalkyl and3‑6memberedheterocyclyl are substituted, theC3‑6 cycloalkyl and the3‑6memberedheterocyclyl are independently substitutedwith1or 2 substituents selected from halogen and hydroxy; R4 and R5 can be independently hydrogen, halogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; R6 can be hydrogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C3‑4 alkenyl; and provided that at least one of R4, R5 and R6 is not hydrogen; X1 can be CRA or N; R7a, R7b, R7c and R7d can be independently hydrogen, halogen, an unsubstituted C1‑4 haloalkyl, cyano or an unsubstituted C1‑4 alkoxy; R8 can be hydrogen, ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsubstituted C1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2-phosphate; and RA can be hydrogen, halogen, an unsubstituted C1‑4 haloalkyl or cyano. As provided herein, R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached form an unsubstituted cyclobutyl, a fluoro-substituted cyclobutyl, a hydroxy-substituted cyclobutyl or an unsubstituted oxetane.

[0090] In still other embodiments, R1 can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl can be independently substituted with one or more substituents selected from halogen, an unsubstitutedC1‑4 alkyl, an unsubstitutedC1‑4 haloalkyl, an unsubstitutedC1‑4 hydroxyalkyl, an unsubstitutedmonocyclic C3‑6 cycloalkyl and a hydroxy-substituted monocyclic C3‑6 cycloalkyl; R2 and R3 can be independently selected from hydrogen, an unsubstituted or a substituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstitutedC1‑5 alkoxyalkyl, whereinwhen themonocyclic C3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl are substituted, themonocyclic C3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl can be independently substitutedwithoneormoresubstituents selected fromhalogenorhydroxy, andwhereinwhen theC1‑4 alkyl is substituted, theC1‑4 alkyl is substitutedwithoneormore substituents selected from thegroupconsistingofaphosphate, anO-linkedα- aminoacid andanO-carboxy; orR2 andR3 canbe taken together alongwith the carbon towhichR2andR3are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, wherein when the C3‑6 cycloalkyl and 3‑6 membered heterocyclyl are substituted, the C3‑6 cycloalkyl and the 3‑6 membered heterocyclyl can be independently substituted with 1 or 2 substituents selected from halogen and hydroxy; R5 can be hydrogen, halogen, an unsubstituted C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; and R4 andR6 can be taken together to form an unsubstituted or substituted 5‑6membered heterocyclic ring; X1 can beCRA or N (nitrogen); R7a, R7b, R7c and R7d can be independently hydrogen, halogen, an unsubstituted C1‑4 haloalkyl, cyano or an unsubstituted C1‑4 alkoxy; R8 can be hydrogen, ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsub- 15 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 stituted C1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2-phosphate; and RA can be hydrogen, halogen, an unsubstituted C1‑4 haloalkyl or cyano.

[0091] Examples of compound of Formula (I), or a pharmaceutically acceptable salt thereof, include the following: 16 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 17 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 18 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 19 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 20 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 21 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 22 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 23 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 24 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 25 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 26 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 27 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 or a pharmaceutically acceptable salt of any of the foregoing.

[0092] Further examples of compound of Formula (I), or a pharmaceutically acceptable salt thereof, include the following: 28 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 29 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 30 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 31 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and or a pharmaceutically acceptable salt of any of the foregoing.

[0093] In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt, cannot be one ormore of the following compounds: 32 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and 33 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 or a pharmaceutically acceptable salt of any of the foregoing. In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt, cannot bea compoundprovided inWO2017 / 156255. In someembodiments,R1cannot be a difluoro-substituted phenyl. In some embodiments, R1 cannot be an unsubstituted or substituted tetrazole, an unsubstituted or substituted 1,2,3-triazole and / or an unsubstituted or substituted imidazole. In some embodiments, X1 cannot beCRA,whereinRA is halogen (such as F); andR7B cannot be halogen (such as For Cl). In someembodiments, at least of RA, R7a, R7b, R7c andR7d is an unsubstitutedC1‑4 haloalkyl, for example, CF3. In some embodiments, at least one of R4 and R5 is halogen. In some embodiments, at least one of R4, R5 and R6 is hydrogen. Synthesis

[0094] CompoundsofFormula (I) alongwith thosedescribedhereinmaybeprepared invariousways.General synthetic routes for preparing compounds of Formula (I) are shown and described herein along with some examples of starting materials used to synthesize compounds described herein. The routes shown and described herein are illustrative only andare not intended, nor are they to be construed, to limit the scope of the claims in anymannerwhatsoever. Those skilled in the art will be able to recognize modifications of the disclosed syntheses and to devise alternate routes based on the disclosures herein; all such modifications and alternate routes are within the scope of the claims.

[0095] The synthesis of compounds of Formula (I) can be performed as outlined in Scheme 1. An ester of general Formula (Ia) can be coupled with an amine of general Formula (Ib), in presence of a base, for example LiHMDS, in a suitable solvent (such as THF), to give an amide of general Formula (Ic). Reaction of general Formula (Ic) with ethyl 2- chloro‑2-oxoacetate in presence of aluminium chloride in a suitable solvent (for example, DCM) can give ketoester of general Formula (Id). General Formula (Id) can subsequently be saponified in basic conditions, using for example lithium hydroxide in a mixture of methanol and water, to give the ketoacid derivative of general Formula (Ie). Coupling of general Formula (Ie) with a substituted amine of general Formula (If) can be performed in the presence of a peptide coupling reagent, for example, HATU or EDCI / HOAT, in the presence of an organic amine base (such as Et3N or DIPEA), in a suitable solvent (for example DCM), to afford compound of Formula (I), and pharmaceutically acceptable salts thereof. Pharmaceutical Compositions

[0096] Some embodiments described herein relate to a pharmaceutical composition, that can include an effective 34 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 amount of a compound described herein (e.g., a compound, or a pharmaceutically acceptable salt thereof, as described herein) and a pharmaceutically acceptable carrier, excipient or combination thereof. A pharmaceutical composition described herein is suitable for human and / or veterinary applications.

[0097] As used herein, a "carrier" refers to a compound that facilitates the incorporation of a compound into cells or tissues.Forexample,without limitation, dimethyl sulfoxide (DMSO) isacommonlyutilizedcarrier that facilitates theuptake of many organic compounds into cells or tissues of a subject.

[0098] As used herein, a "diluent" refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and / or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.

[0099] As used herein, an "excipient" refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, binding ability, lubrication, disintegrating ability etc., to the composition. A "diluent" is a type of excipient.

[0100] Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of admin- istering a compound exist in the art including, but not limited to, oral, rectal, topical, aerosol, injection and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and intraocular injections. Pharmaceutical compositionswill generally be tailored to the specific intended route of administration.

[0101] Onemay also administer the compound in a local rather than systemic manner, for example, via injection of the compound directly into the infected area, often in a depot or sustained release formulation. Furthermore, one may administer the compound in a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody. The liposomes may be targeted to and taken up selectively by the organ.

[0102] The pharmaceutical compositions disclosed herein may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, en- trapping or tableting processes. As described herein, compounds used in a pharmaceutical compositionmay be provided as salts with pharmaceutically compatible counterions. Methods of Use

[0103] Some embodiments described herein relate to amethod of treating a HBVand / or HDV infection that can include administering to a subject identified as suffering from theHBVand / orHDV infection an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of amedicament for treating a HBVand / or HDV infection. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein or a pharmaceutical composition that includes a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating a HBV and / or HDV infection.

[0104] Some embodiments disclosed herein relate to amethod of treating a HBVand / or HDV infection that can include contacting a cell infected with the HBV and / or HDV with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating a HBV and / or HDV infection. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating a HBV and / or HDV infection.

[0105] Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and / or HDV that can include contacting a cell infectedwith theHBVand / or HDVwith an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for inhibiting replication of HBVand / or HDV. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, for inhibiting replication of HBV and / or HDV. 35 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0106] In some embodiments, the HBV infection can be an acute HBV infection. In some embodiments, the HBV infection can be a chronic HBV infection.

[0107] Some embodiments disclosed herein relate to amethod of treating liver cirrhosis that is developed because of a HBVand / or HDV infection that can include administering to a subject suffering from liver cirrhosis and / or contacting a cell infected with the HBVand / or HDV in a subject suffering from liver cirrhosis with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or apharmaceutically acceptable salt thereof, asdescribedherein.Other embodimentsdescribed herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in themanufacture of amedicament for treating liver cirrhosiswithaneffectiveamount of thecompound, orapharmaceutically acceptable salt thereof. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver cirrhosis.

[0108] Some embodiments disclosed herein relate to a method of treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBVand / or HDV infection that can include administering to a subject suffering from the liver cancer and / or contacting a cell infected with the HBVand / or HDV in a subject suffering from the liver cancer with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating liver cancer (such as hepatocellular carcinoma). Still other embodiments described herein relate to the use of a compound, or a pharmaceu- tically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver cancer (such as hepatocellular carcinoma).

[0109] Some embodiments disclosed herein relate to a method of treating liver failure that is developed because of a HBVand / or HDV infection that can include administering to a subject suffering from liver failure and / or contacting a cell infected with the HBV and / or HDV in a subject suffering from liver failure with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or apharmaceutically acceptable salt thereof, asdescribedherein.Other embodimentsdescribed herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in themanufacture of a medicament for treating liver failure. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver failure.

[0110] Various indicators for determining theeffectivenessof amethod for treatinganHBVand / orHDV infectionarealso known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a reduction in viral load indicated by reduction inHBVDNA (or load) (e.g., reduction <105 copies / mL in serum), HBV surface antigen (HBsAg) and HBV e-antigen (HBeAg), a reduction in plasma viral load, a reduction in viral replication, a reduction in time to seroconversion (virus undetectable in patient serum), an increase in the rate of sustained viral response to therapy, an improvement in hepatic function, and / or a reduction of morbidity or mortality in clinical outcomes.

[0111] As used herein, the terms "treat," "treating," "treatment," "therapeutic," and "therapy" do not necessarily mean total cure or abolition of the disease or condition. Any alleviation of any undesired signs or symptoms of a disease or condition, to any extent can be considered treatment and / or therapy. Furthermore, treatment may include acts that may worsen the subject’s overall feeling of well-being or appearance.

[0112] Asusedherein, a "subject" refers to ananimal that is the object of treatment, observation or experiment. "Animal" includes cold‑ and warm-blooded vertebrates and invertebrates such as fish, shellfish, reptiles and, in particular, mammals. "Mammal" includes, without limitation,mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and, in particular, humans. In some embodiments, the subject is human.

[0113] The term "effective amount" is used to indicate an amount of an active compound, or pharmaceutical agent, that elicits the biological or medicinal response indicated. For example, an effective amount of compound can be the amount needed to alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. This response may occur in a tissue, system, animal or human and includes alleviation of the signs or symptoms of the disease being treated. Determination of an effective amount is well within the capability of those skilled in the art, in view of the disclosure provided herein. The effective amount of the compounds disclosed herein required as a dose will depend on the route of administration, the type of animal, including human, being treated, and the physical characteristics of the specific animal under consideration. The dose can be tailored to achieve a desired effect, but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the medical arts will recognize.

[0114] In some embodiments, an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein is an amount that is effective to achieve a sustained virologic response, for example, a sustained viral 36 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 response 12 month after completion of treatment.

[0115] SubjectswhoareclinicallydiagnosedwithaHBVand / orHDVinfection include "naïve"subjects (e.g., subjectsnot previously treated for HBV and / or HDV) and subjects who have failed prior treatment for HBV and / or HDV ("treatment failure" subjects). Treatment failuresubjects include "non-responders" (subjectswhodidnotachievesufficient reduction in ALT (alanine aminotransferase) levels, for example, subject who failed to achievemore than 1 log10 decrease frombase- line within 6 months of starting an anti-HBV and / or anti-HDV therapy) and "relapsers" (subjects who were previously treated for HBV and / or HDV whose ALT levels have increased, for example, ALT > twice the upper normal limit and detectable serum HBV DNA by hybridization assays). Further examples of subjects include subjects with a HBVand / or HDV infection who are asymptomatic.

[0116] In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a treatment failure subject suffering from HBV and / or HDV. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a non-responder subject suffering from HBVand / or HDV. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a relapser subject suffering fromHBVand / or HDV. In some embodiments, the subject can have HBeAg positive chronic hepatitis B. In some embodiments, the subject can have HBeAg negative chronic hepatitis B. In some embodiments, the subject can have liver cirrhosis. In some embodiments, the subject can be asymptomatic, for example, thesubject canbe infectedwithHBVand / orHDVbutdoesnot exhibit anysymptomsof theviral infection. In some embodiments, the subject can be immunocompromised. In some embodiments, the subject can be undergoing che- motherapy.

[0117] Examples of agents that have been used to treat HBV and / or HDV include immunomodulating agents, and nucleosides / nucleotides. Examples of immunomodulating agents include interferons (such as IFN-α and pegylated interferons that include PEG-IFN-α‑2a); and examples of nucleosides / nucleotides include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. However, some of the drawbacks associatedwith interferon treatment are the adverse side effects, the need for subcutaneousadministration andhigh cost. Potential advantages of a compound of Formula (I), or a pharmaceutically acceptable salt of any of the foregoing, can be less adverse side effects, delay in the onset of an adverse side effect and / or reduction in the severity of an adverse side effect. A drawback with nucleoside / nucleotide treatment can be the development of resistance, including cross-resis- tance.

[0118] Resistance can be a cause for treatment failure. The term "resistance" as used herein refers to a viral strain displaying a delayed, lessened and / or null response to an anti-viral agent. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a subject infected with an HBVand / or HDV strain that is resistant to one or more anti-HBV and / or anti-HDV agents. Examples of anti-viral agents wherein resistance candevelop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamideand tenofovir disoproxil. In someembodiments, development of resistantHBVand / orHDVstrains is delayedwhena subject is treatedwithacompound,orapharmaceutically acceptablesalt thereof, asdescribedhereincompared to thedevelopment of HBV and / or HDV strains resistant to other HBV and / or HDV anti-viral agents, such as those described.

[0119] Previously known compounds, such as those provided in WO 2017 / 156255, were shown to form adducts with glutathione in in vitroassays. Formation of glutathioneadducts canbeasignal that a compoundhas thepotential to induce liver injury. Thus, the formation of glutathione adducts can be used as a signal to predict safety. Unexpectedly, compounds described herein, such as many compounds of Formula (I), and pharmaceutically acceptable salts thereof, have been shown not to form adducts with glutathione in in vitro assays. Further, known compounds (for example, those described in WO 2017 / 156255), have demonstrated potency in a HepG2.2.15 cell based assay with an EC50 of >1000 pM. Many compounds described herein, such as compounds of Formula (I), and pharmaceutically acceptable salts thereof, unexpectedly show improvedpotency in aHepG2.2.15 cell basedassaywith anEC50<1000pM range. Thus, compounds described herein, including compounds of Formula (I), and pharmaceutically acceptable salts thereof, can be at least 16 timesmorepotent thanpreviously knowncompounds. In someembodiments, improvedpotency can lead toa significantly lower dose requirement and therefore improve daily dose burden as well as lead to improved safety margins. Combination Therapies

[0120] In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be used in combination with one or more additional agent(s) for treating and / or inhibiting replication HBV and / or HDV. Additional agents include, but are not limited to, an interferon, nucleoside / nucleotide analogs, a sequence specific oligonucleotide (such as anti-sense oligonucleotide and siRNA), nucleic acid polymers (NAPs, such as nucleic acid polymers that reduce HBsAg levels) an entry inhibitor and / or a small molecule immunomodulator. Examples of additional agents include recombinant interferon alpha 2b, IFN-α, PEG-IFN-α‑2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. Examples of NAPs include, but are not limited to, REP 2139, REP 2165 and those described in U.S. Application No. 62 / 757632, filed November 8, 2018, which is hereby 37 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 incorporated by reference for the purpose of the NAPs described therein.

[0121] In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be administeredwithoneormoreadditional agent(s) together inasinglepharmaceutical composition. Insomeembodiments, a compound, or a pharmaceutically acceptable salt thereof, can be administered with one or more additional agent(s) as two or more separate pharmaceutical compositions. Further, the order of administration of a compound, or a pharma- ceutically acceptable salt thereof, as described herein with one or more additional agent(s) can vary. EXAMPLES

[0122] Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the claims. EXAMPLE 1

[0123]

[0124] A250-mL 3-necked round-bottom flask purged andmaintainedwith an inert atmosphere of N2was chargedwith 3-tert-butyl 4-methyl 2,2-dimethyl‑1,3-oxazolidine‑3,4-dicarboxylate (5.00 g, 19.3 mmol, 1.00 eq.), toluene (50 mL). Diisobutylaluminiumhydride (38.6mL,38.6mmol, 2.00eq., 1M in toluene)was slowlyaddedat ‑78 °C.The rateof addition was adjusted so as to keep the internal temperature below ‑65 °C. The resulting solution was stirred for 2 h at ‑78 °C, and the reaction quenched by slowly adding cold CH3OH (10 mL). The mixture was slowly poured into ice-cold 1M HCl (100 mL), and the mixture was extracted with ethyl acetate (3 x 100 mL). The combined organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated under vacuum to afford tert-butyl 4-formyl‑2,2-dimethyl‑1,3- oxazolidine‑3-carboxylate (4.20 g, crude) of as a colorless oil.

[0125] A 40-mL vial was charged with tert-butyl 4-formyl‑2,2-dimethyl‑1,3-oxazolidine‑3-carboxylate (4.20 g, 18.3 mmol, 1.00 eq.), dimethyl (1-diazo‑2-oxopropyl)phosphonate (4.22 g, 22.0 mmol, 1.20 eq.), K2CO3 (5.06 g, 36.6 mmol, 2.00 eq.) andmethanol (20mL). The resulting solutionwas stirred for overnight at room temperature (rt). The reactionwas quenched by water (20 mL) and diluted with ethyl acetate (3 x 20 mL). The mixture was washed with brine (20 mL) and water (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographedonasilicagel columnwithethyl acetate (EA):petroleumether (PE) (1:10) toprovide3.20g (70%yield) of tert-butyl 4-ethynyl‑2,2-dimethyl‑1,3-oxazolidine‑3-carboxylate as a yellow oil.

[0126] A solution of tert-butyl 4-ethynyl‑2,2-dimethyl‑1,3-oxazolidine‑3-carboxylate (1.00 g, 4.44 mmol), 4M hydro- chloric acid in 1,4-dioxane (5mL) andethanol (10mL)was stirred overnight at 60 °C. Themixturewas concentrated under reduced pressure to provide 2-aminobut‑3-yn‑1-ol hydrochloride (538 mg, crude) as a yellow solid. 1H NMR (300 MHz, Methanol‑d4) δ4.14 (br, 1H), 3.89 (dd, J=11.6, 4.2Hz, 1H), 3.75‑3.68 (m,1H), 3.25 (d, J=2.4Hz, 1H). LCMS(ES)m / z=86 (M+H-HCl)+. EXAMPLE 2

[0127] 38 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0128] Themixture of 3‑(benzyloxy)cyclobutan‑1-one (5.00 g, 28.4mmol, 1.00 eq.), titanium isopropylate (8.80 g, 30.9 mmol, 1.09 eq.), tert-butanesulfinamide (3.70 g, 30.5mmol, 1.08 eq.) and dichloromethane (50mL) was stirred overnight at 45 °C. Themixturewas cooled to rt. Sat. sodiumbicarbonate solution (5mL)wasadded. Themixturewasstirred30min, and thesolidswerefilteredoff.Thefiltratewasconcentratedunder reducedpressure.The residuewaspurifiedbysilicagel column chromatography, eluted with EA:PE (1:10) to afford N‑[3‑(benzyloxy)cyclobutylidene]‑2-methylpropane‑2-sulfi- namide (4.50 g, 57% yield) as a light yellow oil.

[0129] Toa stirredmixture of trimethylsilylacetylene (4.70 g, 47.8mmol, 2.97 eq.) in diethyl ether (100mL)was added n- BuLi (13.0mL, 32.5mmol, 2.02eq., 2.5M inhexane) dropwise ‑78 °CunderN2atmosphere.Themixturewasstirred for 1h at ‑78 °C.N‑[3‑(benzyloxy)cyclobutylidene]‑2-methylpropane‑2-sulfinamide (4.50g,16.1mmol, 1.00eq.) inEt2O (10mL) wasaddeddropwiseat ‑78 °C.Themixturewasstirred for 2hat ‑78 °C.The reactionwasquenchedbywater (100mL).The mixturewas extractedwithEA (3 x 100mL). Theorganic layerswere combined, dried overwith anhydrous sodiumsulfate, filtered and concentrated under reduced pressure. The residue was purified by Prep-TLC (EA:PE=1:3) to afford N‑[3‑(benzyloxy)‑1‑[2‑(trimethylsilyl)ethynyl]cyclobutyl]‑2-methylpropane‑2-sulfinamide (950 mg, 16% yield) as a color- less oil.

[0130] To a stirred mixture of N‑[3‑(benzyloxy)‑1‑[2‑(trimethylsilyl)ethynyl]cyclobutyl]‑2-methylpropane‑2-sulfinamide (300mg, 0.800mmol, 1.00 eq.) in chloromethane (5mL)was addedBBr3 (3.00mL, 3.00mmol, 3.70 eq., 1M inDCM) at rt. Themixturewas stirred for 2hat rt.Water (0.1ml)wasadded to themixtureandstirred for 0.5h. Thesolidswere filteredoff. The filtrate was concentrated under reduced pressure to afford 3-amino‑3‑((trimethylsilyl)ethynyl)cyclobutan‑1-ol hydro- bromide salt (130mg, 62%yield) asa light yellowsolid. 1HNMR(400MHz,Methanol‑d4) δ4.42‑4.31 (m, 1H), 2.83 (ddt, J= 9.1, 7.0, 2.5 Hz, 2H), 2.37 (ddt, J = 11.6, 7.6, 2.2 Hz, 2H), 0.22 (s, 9H). LCMS (ESI, m / z): 184 [M+H-HBr]+. EXAMPLE 3

[0131] 39 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0132] Themixture of 3-oxetanone (5.00 g, 69.4 mmol, 1.00 eq.), tert-butanesulfinamide (9.20 g, 75.9 mmol, 1.10 eq.), titanium isopropylate (21.6 g, 76.0 mmol, 1.10 eq.) and dichloromethane (50.00 mL) was stirred overnight at 45 °C. The reactionwascooled to rt andquenchedwith sat. sodiumbicarbonate solution (5.0mL). Themixturewasstirred30min, and the solids were filtered off. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel columnchromatography, elutedwithEA:PE (1:10) to afford2-methyl-N‑(oxetan‑3-ylidene)propane‑2-sulfinamide (5.00g, 39% yield) as a light yellow oil. LCMS (ESI, m / z): 176 [M+H]+.

[0133] To a stirredmixture of trimethylsilylacetylene (8.40 g, 85.5 mmol, 3.00 eq.) in THF (50.00mL) was added n-BuLi (30.0mL,2.5M inhexane, 75.0mmol, 2.63eq.) dropwiseat ‑78 °Cunderatmosphere.Themixturewasstirred for1hat ‑78 °C.Themixtureof 2-methyl-N‑(oxetan‑3-ylidene)propane‑2-sulfinamide (5.00g, 28.5mmol, 1.00eq.) inTHF (10mL )was addeddropwiseat ‑78°C.The reactionwasstirred for2hat ‑78°C,and thenquenchedbywater (100mL).Themixturewas extracted with EA (3 x 100 mL). The organic phase was washed with water, dried with anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE (1:10) to afford 2-methyl-N‑[3‑[2‑(trimethylsilyl)ethynyl]oxetan‑3-yl]propane‑2-sulfinamide (7.00 g, 88%yield) as a yellow solid. LCMS (ESI, m / z): 274 [M+H]+.

[0134] Hydrochloric acid (7.5 mL, 30.0 mmol, 2.05 eq., 4 M in 1,4-dioxane) was added to the mixture of 2-methyl- N‑[3‑[2‑(trimethylsilyl)ethynyl]oxetan‑3-yl]propane‑2-sulfinamide (4.00 g, 14.6 mmol, 1.00 eq.) and 1,4-dioxane (50 mL). The mixture was stirred for 2 h at rt. The solid was collected by filtration, washed with PE and dried to afford 3‑[2‑(trimethylsilyl)ethynyl]oxetan‑3-amine hydrochloride (2.70 g, 89% yield) as a light yellow solid. LCMS (ESI, m / z): 170 [M+H-HCl]+. EXAMPLE 4

[0135] 40 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0136] A 250mL round bottom flask was charged with ethyl 3,5-dimethyl‑1H-pyrrole‑2-carboxylate (10.0 g, 59.8mmol, 1.00 eq.) and dimethylsulfoxide (100 mL). KOH (5.03 g, 89.7 mmol, 1.50 eq.) was added in portions at 0 °C. The mixture was stirred 30 min at rt. Methyl iodide (10.2 g, 71.8 mmol, 1.20 eq.) was added dropwise at rt. The resulting solution was stirred for 4 h at rt. The reaction was quenched by water (100mL) and diluted with EA (500mL). Themixture was washed with brine (200mL) andwater (5 x 100mL ), dried over anhydrous sodiumsulfate, filteredand concentratedunder reduced pressure to provide ethyl 1,3,5-trimethyl‑1H-pyrrole‑2-carboxylate (10.1 g, 92% yield) as a white solid. LCMS (ESI,m / z): 182 [M+H]+.

[0137] A 100-mL three-necked round-bottom flask was placed ethyl 1,3,5-trimethylpyrrole‑2-carboxylate (2.00 g, 11.0 mmol, 1.00eq.), 5-amino‑2-fluorobenzonitrile (3.00g, 22.1mmol, 2.00 eq.) and tetrahydrofuran (20mL) underN2. Lithium hexamethyldisilazide (33.0 mL, 33.0 mmol, 3.00 eq., 1M in THF) was added dropwise to above mixture at 0 °C. The resulting solution was stirred overnight at rt, and the reaction quenched with a sat. ammonium chloride solution (50 mL). The mixture was extracted with EA (3 x 50 mL). The organic layers were combined, dried over anhydrous sodium sulfate and concentrated under vacuum. The residuewas purified by triturationwith EA:hexane (1:1), and the solid was collected by filtration and dried to afford N‑(3-cyano‑4-fluorophenyl)‑1,3,5-trimethylpyrrole‑2-carboxamide (2.50 g, 75% yield) as a white solid. LCMS (ESI, m / z): 272 [M+H]+.

[0138] Into a 50-mL 3-necked round-bottom flask was placed ethyl 1,3,5-trimethyl‑1H-pyrrole‑2-carboxylate (2.50 g, 13.8 mmol, 1.00 eq.) and dichloromethane (100 mL). Ethyl oxalochloridate (2.82 g, 20.0 mmol, 1.50 eq.) in dichlor- omethane (20mL)wasaddeddropwise to themixture at 0 °C.Aluminiumchloride (4.23g, 31.7mmol, 2.50 eq.)wasadded in portions at 0 °C. The solutionwas stirred overnight at rt, and the reactionwasquenchedwithwater / ice. The solutionwas extracted dichloromethane (3 x 100 mL). The organic layers were combined, washed with sat. sodium bicarbonate solution (100 mL) and water (100 mL). The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was purified by trituration with EA:hexane (1:1), and the solid was collected by filtration and dried to afford ethyl 4‑(2-ethoxy‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxylate (2.00 g, 56%yield) as awhite solid. LCMS (ESI, m / z): 372 [M+H]+.

[0139] A 50 mL round bottom flask was charged with ethyl 4‑(2-ethoxy‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2- carboxylate (2.00 g, 5.39 mmol, 1.00 eq.), lithium hydroxide (21.6 mg, 10.8 mmol, 2.00 eq.), methanol (50 mL) and water (10 mL). The resulting solution was stirred overnight at rt. The methanol was removed under reduced pressure. The residuewas dissolvedwithwater (50mL) and extracted byEA (3 x 20mL). The pHvalue of thewater layerwas adjusted to 3withhydrochloric acid (1mol / L). ThemixturewasextractedEA (3x50mL).Theorganic layerswere combined, driedover anhydrous sulfate, filtered and concentrated under reduced pressure to provided desired product 2‑(5‑((3-cyano‑4- fluorophenyl)carbamoyl)‑1,2,4-trimethyl‑1H-pyrrol‑3-yl)‑2-oxoacetic acid (1.50 g, 81% yield ) as white solid. LCMS (ESI, m / z): 344 [M+H]+. EXAMPLE 5

[0140]

[0141] A 250mL round bottom flask was charged with ethyl 3,5-dimethyl‑1H-pyrrole‑2-carboxylate (10.0 g, 59.8mmol, 41 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 1.00 eq.) and dimethylsulfoxide (100 mL). KOH (5.03 g, 89.7 mmol, 1.50 eq.) was added in portions at 0 °C. The mixture wasstirred30minat rt.Methyl iodide (10.2g,71.8mmol, 1.20eq.)wasaddeddropwise toabovemixtureat rt. The resulting solution was stirred for 4 h at rt. The reaction was quenched by water (100 mL) and diluted with EA500 mL). The mixture was washed with brine (200 mL) and water (5 x 100mL ), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to provide ethyl 1,3,5-trimethyl‑1H-pyrrole‑2-carboxylate (10.1 g, 92% yield) as a white solid. LCMS (ESI, m / z): 182 [M+H]+.

[0142] Into a 250-mL round-bottomflask purged andmaintainedwith an inert atmosphere of N2, was placed ethyl 1,3,5- trimethylpyrrole‑2-carboxylate (5.00 g, 27.6 mmol, 1.00 eq.), 4-fluoro‑3‑(trifluoromethyl)aniline (7.40 g, 41.3 mmol, 1.50 eq.) and tetrahydrofuran (50.00 mL). LiHMDS (80.0 mL, 80.0 mmol, 2.90 eq., 1 mol / L in THF) was added dropwise to the mixture at 0 °C. The resulting solution was stirred overnight at rt, and the reaction was quenched with a sat. ammonium chloride solution (100mL). The solutionwasextractedwithEA (3 x 100mL). Theorganic layerswere combined, dried over anhydroussodiumsulfate, filteredandconcentratedundervacuum.The residuewaspurifiedby triturationwithEA:hexane (1:1). The solids were collected by filtration and dried to provide N‑[4-fluoro‑3‑(trifluoromethyl)phenyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide (9.00 g, 93% yield) as a white solid. LCMS (ESI, m / z): 315 [M+H]+.

[0143] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of N2, was placed N‑[4-fluoro‑3‑(trifluoromethyl)phenyl]‑1,3,5-trimethylpyrrole‑2-carboxamide (3.00 g, 9.55 mmol, 1.00 eq.) and dichlor- omethane (100 mL). A solution of ethyl chloroglyoxylate (1.56 g, 11.5 mmol, 1.20 eq.) in dichloromethane (20 mL) was added dropwise to the mixture at 0 °C. Aluminium chloride (1.90 g, 14.3 mmol, 1.50 eq.) was added to above mixture in portions at 0 °C. The resulting solution was stirred overnight at rt, and the reaction quenched by ice / water (100 mL). The mixture was extracted with dichloromethane (3 x 100 mL). The organic layers were combined, washed with sat. sodium bicarbonate solution (100mL) andwater (100mL), dried over anhydrous sodium, filteredand concentratedunder reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE (1:2) to afford ethyl 2‑(5‑[[4- fluoro‑3‑(trifluoromethyl)phenyl]carbamoyl]‑1,2,4-trimethylpyrrol‑3-yl)‑2-oxoacetate (2.00 g, 48% yield) as a white solid. LCMS (ESI, m / z): 415 [M+H]+.

[0144] A 100mL round bottom flask was charged with ethyl 2‑(5‑[[4-fluoro‑3‑(trifluoromethyl)phenyl]carbamoyl]‑1,2,4- trimethylpyrrol‑3-yl)‑2-oxoacetate (2.00g, 4.83mmol, 1.00eq.), LiOH (0.231g, 9.65mmol, 2.00eq.),methanol (50.00mL) andwater (10.00mL). The resulting solutionwas stirredovernight at rt anddilutedwithwater (100mL). ThepHvalue of the mixture was adjusted to 3 with hydrochloric acid (1 mol / L). The mixture was extracted with EA (3 x 100 mL). The organic layers was combined, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to provide (5‑[[4-fluoro‑3‑(trifluoromethyl)phenyl]carbamoyl]‑1,2,4-trimethylpyrrol‑3-yl)(oxo)acetic acid (1.85 g, 94% yield) as a white solid. LCMS (ESI, m / z): 387 [M+H]+. EXAMPLE 6

[0145]

[0146] Amixture compound D (1.00 g, 2.91 mmol, 1.00 eq.), HATU (3.30 g, 8.68mmol, 2.98 eq.), 1,2-dichloromethane (50 mL), N,N-diisopropylethylamine (1.50 mL, 8.61 mmol, 2.96 eq.) and compound C (0.900 g, 4.37 mmol, 1.50 eq.) was stirredovernight at rt. The reactionwasquenchedbywater (200mL). Themixturewasextractedwith dichloromethane (3 x 200 mL). The combined organic layers were washed with water (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by trituration with EA (50 mL), and the solid was 42 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 collected by filtration and dried to afford N‑(3-cyano‑4-fluorophenyl)‑1,3,5-trimethyl‑4‑[([3‑[2‑(trimethylsilyl)ethynyl]ox- etan‑3-yl]carbamoyl)carbonyl]pyrrole‑2-carboxamide (1.30 g, 90% yield) as a white solid. LCMS (ESI,m / z): 495 [M+H]+.

[0147] The mixture of N‑(3-cyano‑4-fluorophenyl)‑1,3,5-trimethyl‑4‑[([3‑[2‑(trimethylsilyl)ethynyl]oxetan‑3-yl]carba- moyl)carbonyl]pyrrole‑2-carboxamide (1.30 g, 2.63 mmol, 1.00 eq.), potassium carbonate (1.10 g, 7.89 mmol, 3.00 eq.), methanol (5mL) andN,N-dimethylformamide (20mL) was stirred for 2 h at rt. The solidswere filtrated off. The filtrate was concentrated under reduced pressure. The residue was trituration by water (100mL), and the solid was collected by filtration and dried to afford N‑(3-cyano‑4-fluorophenyl)‑4‑[[(3-ethynyloxetan‑3-yl)carbamoyl]carbonyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide (compound 26) (784.8mg, 68%yield) as an off-white solid. 1HNMR (400MHz,DMSO-d6) δ 10.53 (s, 1H), 9.75 (s, 1H), 8.20 (dd, J=5.8, 2.7Hz, 1H), 7.95 (ddd, J=8.0, 4.7, 2.6Hz, 1H), 7.53 (t, J =9.1Hz, 1H), 4.72 (d, J =6.6 Hz, 4H), 3.65 (s, 1H), 3.59 (s, 3H), 2.41 (s, 3H), 2.25 (s, 3H). LCMS (ESI, m / z): 423 [M+H]+. EXAMPLE 7

[0148]

[0149] A 40 mL vial was charged with Compound A (240 mg, 1.97 mmol, 1.00 eq.), 1,2-dichloroethane (10 mL), Compound D (678 mg, 1.97 mmol, 1.00 eq.), 1‑[Bis(dimethylamino)methylene]‑1H‑1,2,3-triazolo[4,5-b]pyridinium 3- oxide hexafluorophosphate (751mg, 1.97mmol, 1.00 eq.) andN,N-diisopropylethylamine (766mg, 5.92mmol, 3.00 eq.). The resulting solution was stirred overnight at rt, and the reaction was quenched by water (10 mL). The mixture was extracted with EA (3 x 10 mL). The organic layers were combined, washed with brine (3 x 10 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The product mixture (360 mg) was separated by pre- Chiral-HPLC (Column: CHIRALPAK IG, 20*250mm,5 um; Mobile Phase A:Hex(8mmol / L NH3.MeOH)--HPLC, Mobile PhaseB:EtOH--HPLC;Flow rate:18mL / min;Gradient:50B to 50B in 22min; 254 / 220nm;RT1:12.491;RT2:17.162). The appropriate fractions were identified by UV absorbance (254 nm) to obtain pure the first eluting isomer N‑(3-cyano‑4- fluorophenyl)‑4‑([[(2S)‑1-hydroxybut‑3-yn‑2-yl]carbamoyl]carbonyl)‑1,3,5-trimethylpyrrole‑2-carboxamide (125.6 mg, 0.306 mmol) as a white solid. LCMS (ES) m / z = 411 (M+H)+. 1H NMR (300 MHz, DMSO‑d6) δ 10.52 (s, 1H), 9.05 (d, J = 8.2 Hz, 1H), 8.19 (dd, J = 5.8, 2.7 Hz, 1H), 7.92‑7.98 (m, 1H), 7.53 (t, J = 9.2 Hz, 1H), 5.13 (t, J = 5.9 Hz, 1H), 4.58‑4.65 (m, 1H), 3.66‑3.46 (m, 5H), 3.22 (d, J = 2.3 Hz, 1H), 2.39 (s, 3H), 2.24 (s, 3H).

[0150] The second eluting isomer N‑(3-cyano‑4-fluorophenyl)‑4‑([[(2R)‑1-hydroxybut‑3-yn‑2-yl]carbamoyl]carbo- nyl)‑1,3,5-trimethylpyrrole‑2-carboxamide (133.5 mg, 0.326 mmol) as a white solid. LCMS (ES) m / z = 411 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 10.52 (d, J = 3.5 Hz, 1H), 9.07 (d, J = 8.2 Hz, 1H), 8.28‑8.11 (m, 1H), 7.92‑7.98 (m, 1H), 7.60‑7.45 (m,1H), 5.14 (s, 1H), 4.61 (s, 1H), 3.57 (s, 5H), 3.21‑3.23 (m,1H), 2.39 (d,J=4.0Hz,3H), 2.24 (d,J=4.1Hz,3H). EXAMPLE 8

[0151] 43 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0152] The mixture of Compound B (200 mg, 1.10 mmol, 1.00 eq.), Compound D (250 mg, 0.700 mmol, 0.67 eq.), ethyl‑3‑(3-dimethylaminopropyl)carbodiimide hydrochloride (320 mg, 1.70 mmol, 1.50 eq.), 1-hydroxy‑7-azabenzotria- zole (220mg, 1.60mmol, 1.50 eq.), N,N-diisopropylethylamine (220mg, 1.70mmol, 1.56 eq.) and 1,2-dichloroethane (10 mL) was stirred overnight at rt and concentrated in reduced pressure. The residue was dissolved in EA (50 mL) and washed with water (3 x 20 mL). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by Prep-TLC (EA:PE=2:1) to afford N‑(3-cyano‑4-fluorophenyl)‑4‑[([3- hydroxy‑1‑[2‑(trimethylsilyl)ethynyl]cyclobutyl]carbamoyl)carbonyl]‑1,3,5-trimethylpyrrole‑2-carboxamide (170 mg, 46% yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.29 (s, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J=9.3, 4.9, 2.7Hz, 1H), 7.56 (t, J=9.1Hz, 1H), 5.33 (d,J=6.7Hz, 1H), 4.14 (q, J=7.2Hz, 1H), 3.60 (s, 3H), 2.77 (ddd, J=9.5, 6.9, 3.0Hz, 2H), 2.43 (s, 3H), 2.28 (s, 3H), 2.22‑2.10 (m, 2H), 0.14 (s, 9H). LCMS (ESI,m / z):509 [M+H]+.

[0153] The mixture of N‑(3-cyano‑4-fluorophenyl)‑4‑[([3-hydroxy‑1‑[2‑(trimethylsilyl)ethynyl]cyclobutyl]carbamoyl) carbonyl]‑1,3,5-trimethylpyrrole‑2-carboxamide (170 mg, 0.30 mmol, 1.00 eq.), methanol (5 mL) and potassium carbo- nate (150mg, 1.10mmol, 3.22 eq.) was stirred for 2 h at rt. The solidswere filtered off. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC using the following gradient conditions: Column: XBridge C18 OBD Prep Column, 19 mm x 250 mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: THF--HPLC; Flow rate:25 mL / min; Gradient: 25% to 55% in 7 min; 220 nm. Purification resulted in N‑(3-cyano‑4-fluorophenyl)‑4‑[[(1- ethynyl‑3-hydroxycyclobutyl)carbamoyl]carbonyl]‑1,3,5-trimethylpyrrole‑2-carboxamide (26.1mg,18%yield) asayellow solid. 1HNMR(300MHz,DMSO-d6) δ10.50 (s, 1H), 9.26 (s, 1H), 8.20 (dd, J=5.8, 2.7Hz, 1H), 8.03‑7.91 (m, 1H), 7.53 (t, J =9.2Hz,1H), 5.30 (d,J=6.7Hz,1H), 4.15 (q,J=7.3Hz, 1H), 3.60(s, 3H), 3.22 (s, 1H), 2.83‑2.71 (m,2H), 2.42 (s, 3H), 2.27 (s, 3H), 2.17 (t, J = 10.1 Hz, 2H). LCMS (ESI, m / z): 437 [M+H]+. EXAMPLE 9

[0154] 44 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0155] Cesiumcarbonate (9.78 g, 30mmol, 3 eq.) was added to a stirred solution ofCompound26 (4.22 g, 10mmol), di- tert-butyl chloromethyl phosphate (3.89 g, 15mmol, 1.5 eq.) and tetrabutylammonium iodide (738mg, 2mmol, 0.2 eq.) in anhydrous DMSO (40 mL). The mixture stirred overnight at rt and then partitioned between water and ethyl acetate. The organic phase was separated and washed with diluted brine (2x). The aqueous phases were back-extracted with ethyl acetate. The combinedorganic solutionwasdried over sodiumsulfate and concentratedunder reduced pressure to a give a yellow-beige foam (9 g). The residuewaspurifiedby columnchromatography in 40 to 100%ethyl acetate-hexane to give the bis-tert-butyl phosphate intermediate (1.72 g, 27%).

[0156] To solution of the bis-tert-butyl phosphate intermediate from previous step (1.7 g, 2.6 mmol) in IPA (10mL) were added 0.2M aq. sodium acetate solution (6 mL, 1.2 mmol, 0.46 eq.) and 0.2M aqueous acetic acid (2 mL, 0.4mmol, 0.15 eq.). Themixturewas heated at 55‑60 °C for 3 h. After cooling to rt, themixturewasmade basic (pH8.5) with 2Naq.NaOH (3.1 mL, 6.2 mmol). The resulting solution was concentrated under reduced pressure to ~8 mL. Some precipitate was filtered-off anddiscarded. The filtratewas dilutedwith acetone (40mL), and resultingmixturewas kept overnight at 4 °C. A fine crystalline solid formed andwas collected by filtration, rinsedwith acetone and dried under vacuum to provide sodium (2‑(5‑((3-cyano‑4-fluorophenyl)carbamoyl)‑1,2,4-trimethyl‑1H-pyrrol‑3-yl)‑N‑(3-ethynyloxetan‑3-yl)‑2-oxoacetamido) methyl phosphate (1.15 g, 76%). LC-MS: (ES,m / z): 531 [M-H]-. 1H NMR (400 MHz, D2O ), δ 7.94 (m, 1H), 7.74 (m, 1H), 7.31 (dd, 1H), 5.16 (d, 2H), 5.0 (d, 2H), 4.82 (d, 2H), 3.56 (s, 3H), 2.45 (s, 3H), 2.28 (s, 3H). EXAMPLE 10

[0157]

[0158] To a stirred at 0 °C solution of Compound 26 (844mg, 2mmol) and chloromethyl isobutyrate (0.379mL, 3mmol, 1.5 eq.) in DMF (15 ml) was added sodium hydride (176 mg as 60% dispersion in mineral oil, 4.4 mmol, 2.2 eq.). The mixture was stirred at rt for 2 h, and then partitioned between half-saturated aqueous solution of ammonium chloride and ethyl acetate. The organic phase was separated, dried over sodium sulfate and concentrated under reduced pressure. [[2‑[5‑[(3-cyano‑4-fluorophenyl)carbamoyl]‑1,2,4-trimethyl-pyrrol‑3-yl]‑2-oxo-acetyl]‑(3-ethynyloxetan‑3-yl)amino] methyl 2-methylpropanoate (Compound 73, 530 mg, 50.8%) was isolated by column chromatography (5 to 25% ethyl acetate in dichloromethane) followed by crystallization from isopropyl acetate. LC-MS: (ES,m / z): 523 [M+H)]+. 1H NMR (400 MHz, DMSO-d6), δ 10.6 (bs, 1H), 8.22 (dd, 1H), 7.98 (m, 1H), 7.55 (dd, 1H), 5.47 (s, 2H), 4.93 (d, 2H), 4.65 (d, 2H), 3.71 (s, 1H), 3.62 (s, 3H), 2.48 (m, 1H), 2.45 (s, 3H), 2.28 (s, 3H), 1.05 (d, 6H). 45 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 EXAMPLE 11

[0159]

[0160] [[2‑[5‑[(3-cyano‑4-fluoro-phenyl)carbamoyl]‑1,2,4-trimethyl-pyrrol‑3-yl]‑2-oxo-acetyl]‑(3-ethynyloxetan‑3-yl) amino]methyl 2,2-dimethylpropanoate was synthesized as described in Example 10 using pivaloyl chloride in place of chloromethyl isobutyrate.Compound77 (800mg,74.6%)was isolatedbycolumnchromatography (5‑25%ethyl acetate in dichloromethane) followed by crystallization from ethyl acetate:hexane. LC-MS: (ES, m / z): 537 [M+H)]+. 1H NMR (400 MHz,DMSO-d6), δ 10.6 (bs, 1H), 8.21 (dd, 1H), 7.97 (m, 1H), 7.55 (dd, 1H), 5.46 (s, 2H), 4.93 (d, 2H), 4.66 (d, 2H), 3.73 (s, 1H), 3.62 (s, 3H), 2.45 (s, 3H), 2.28 (s, 3H), 1.07 (s, 9H). EXAMPLE 12

[0161]

[0162] [[2‑[5‑[(3-cyano‑4-fluoro-phenyl)carbamoyl]‑1,2,4-trimethyl-pyrrol‑3-yl]‑2-oxo-acetyl]‑(3-ethynyloxetan‑3-yl) amino]methyl isopropyl carbonatewassynthesizedasdescribed inExample10usingchloromethyl isopropyl carbonate in place of chloromethyl isobutyrate. Compound 78 (770mg, 71.6%) was isolated by column chromatography (5‑30% ethyl acetate in dichloromethane) followed by crystallization from ethyl acetate:hexane. LC-MS: (ES, m / z): 539 [M+H)]+. 1H NMR (400MHz, DMSO-d6), δ 10.6 (bs, 1H), 8.22 (dd, 1H), 7.98 (m, 1H), 7.56 (dd, 1H), 5.49 (s, 2H), 4.92 (d, 2H), 4.71 (m, 1H), 4.65 (d, 2H), 3.71 (s, 1H), 3.62 (s, 3H), 2.44 (s, 3H), 2.27 (s, 3H), 1.20 (d, 6H). EXAMPLE 13

[0163] 46 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0164] 90% hydroxyacetone (16.59 g) and 4-dimethylaminopyridine (1.37 g, 0.05 eq.) were combined in a reactor and dilutedwith dichloromethane (100mL). tert-butyldiphenylsilyl chloride (63.40 g, 1.03 eq.) was added, and then rinsedwith dichloromethane (230 mL). The solution was cooled with a rt water bath and stirred while triethylamine (36 mL, 1.15 eq.) was added over 1 min. After 3 mins, the solids began to precipitate. After 18 h, the mixture was concentrated and hexane (350 mL) and water (200mL) were added. The aqueous phase removed via a separatory funnel. The organic phase was washed water (2 x 150 mL), dried with sodium sulfate and concentrated to provide 1‑((tert-butyldiphenylsilyl)oxy) propan‑2-one (72.62 g). 1H NMR (CDCl3, 400 MHz): δ 7.70 (4H, d), 7.47 (6H, m), 4.20 (2H, s), 2.22 (3H, s), 1.13 (9H, s).

[0165] (R)‑(+)‑2-Methyl‑2-propanesulfinamide (18.47g, 1.0eq.), 1‑((tert-butyldiphenylsilyl)oxy)propan‑2-one (47.62g, 1.0 eq.), and toluene (500 mL) were combined in a reactor under Ar. Titanium tetraisopropanoate (75.8 g, 1.75 eq.) was added, and then themixture was rinsedwith toluene (400mL). The solution was heated at 100 °C for 23 h. After cooling to rt, sat. aq. sodium bicarbonate (50 mL) was added, and the mixture stirred for 2 mins. The resulting slurry was filtered through Celite, and the organic phase was dried with sodium sulfate. The solution was concentrated to a brown liquid that was purified by normal phase silica gel chromatography using an ethyl acetate-hexanes gradient to afford the product sulfinimineasa redoil (13.8g). Theproductwasdissolved in toluene (90mL)and then loaded intoanaddition funnel above a reaction flask. The reaction flask was loaded with trimethylsilylacetylene (9.78 g, 3.0 eq.) and toluene (230 mL). An Ar atmospherewasestablished,and themixturestirredandcooledwithadry ice-acetonebath. 2.5Mn-butyllithium inhexane (33.1 mL, 2.5 eq.) was added below an internal temperature of ‑61 °C. After stirring for 1 h and 10 mins, the sulfinimine solutionwas added over 1 h, and the internal temperature remained below ‑67 °C during this time. Themixturewas stirred for 1.5 h before the cooling bath was removed. Themixture was warmed slowly by the agency of the surrounding air until ‑20 °C, when the reaction waswarmed to 0 °C by immersion in a rt-water bath.Water (20mL) was added, and themixture was stirred for 2 mins. Themixture was then filtered through Celite. The organic phase was dried with sodium sulfate and concentrated to give a brown oil (16.8 g) that was purified by normal phase silica gel chromatography using a dichloromethane-ethyl acetate gradient to give (R)‑N‑((S)‑1‑((tert-butyldiphenylsilyl)oxy)‑2-methyl‑4‑(trimethylsilyl) but‑3-yn‑2-yl)‑2-methylpropane‑2-sulfinamide (6.00 g) as an orange oil. 1H NMR(CDCl3, 400 MHz): δ 7.75 (4H, m), 7.45 (6H, m), 3.90 (1H, s), 3.80 (1H, d), 3.60 (1H, d), 1.50 (3H, s), 1.25 (9H, s), 1.10 (9H, s), 0.20 (9H, s).

[0166] (R)‑N‑((S)‑1‑((tert-butyldiphenylsilyl)oxy)‑2-methyl‑4‑(trimethylsilyl)but‑3-yn‑2-yl)‑2-methylpropane‑2-sulfina- mide (6.00 g, 1.0 eq.) was dissolved with 1,4-dioxane (70 mL) then 4MHCl (12 mL) in 1,4-dioxane (4.1 eq.). The solution was stirred for 1 h, and then concentrated. Toluene (75 mL) was added, and the solution was concentrated. To the concentrate was added 2‑(5‑((4-fluoro‑3‑(trifluoromethyl)phenyl)carbamoyl)‑1,2,4-trimethyl‑1H-pyrrol‑3-yl)‑2-oxoacetic acid (4.50 g, 1.0 eq.), HATU (6.47 g, 1.46 eq.), N,N-dimethylformamide (250 mL), and N,N-diisopropylethylamine (17.8 mL, 9.0 eq.). The solution was stirred for 21 h, and then concentrated. Ethyl acetate (250 mL) was added. The resulting solution was washed with water (100 mL) and brine (50 mL), dried with sodium sulfate, concentrated and mixed with dichloromethane (60 mL). The slurry was filtered. The filtrate was concentrated and purified by normal phase silica gel chromatographyusing anethyl acetate-hexanegradient to provide theproduct (7.58g) as a yellow foam. 1HNMR (CDCl3, 400MHz): δ7.90 (1H,m), 7.77 (5H,m), 7.63 (1H, s), 7.43 (6H,m), 7.25 (2H,m), 3.91 (1H, d), 3.85 (1H, d), 3.71 (3H, s), 2.41 (6H, s), 1.71 (3H, s), 1.12 (9H, s), 0.20 (9H, s). LC-MS: (ES, m / z): 778 [M+1].

[0167] The startingmaterial (7.58 g) was dissolved in THF (75mL), and 1.0M tetrabutylammonium fluoride (24mL, 2.5 eq.) in THFwas added. The solution was stirred for 2 h, and then concentrated. The concentrate was dissolved with ethyl acetate (100 mL). The resulting solution was washed water (3 x 50 mL) and brine (30 mL), dried with sodium sulfate and concentrated to give a yellow oil (7.3 g). The oil was purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to give a yellow foam (4.11 g) thatwasdissolvedwithDMF (30mL). Themixturewas stirredwhile slowly adding water (30 mL). Crystallization of white solids began after 3 minutes. Stirring of the developing slurry was continued for 1 hand then itwas cooled in an ice bath for 0.5h.Theslurrywasfiltered,washedwith2:1water:DMF (10mL), and then with water (20 mL). The filter cake was dried under vacuum at 65 °C to give (S)‑N-(4-fluoro‑3‑(trifluoromethyl) phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide (3.46 g) as a white powder. 1H NMR (CDCl3, 400 MHz): δ 10.50 (1H, s), 8.47 (1H, s), 8.22 (1H, m), 7.99 (1H, m), 7.51 (1H, t), 5.20 (1H, t), 3.70 (1H,m), 3.60 (3H, s), 3.58 (1H,m), 3.21 (1H, s), 2.42 (3H, s), 2.30 (3H, s), 1.51 (3H, s). LC-MS: (ES,m / z): 468 [M+1]. αD20 20.6 °C (c = 1.03, MeOH). EXAMPLE 14

[0168] 47 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0169] (S)‑(+)‑2-Methyl‑2-propanesulfinamide (4.82 g, 1.0 eq.), 1‑((tert-butyldiphenylsilyl)oxy)propan‑2-one (12.43 g, 1.0 eq.), and toluene (310mL) were combined in a reactor under Ar. Titanium tetraisopropanoate (13.57 g, 1.20 eq.) was added, and then the residue was rinsed with toluene (400mL). The resulting solution was heated at 100 °C for 18 h. After cooling to rt, sat. aq. sodium bicarbonate (13 mL) was added, and the mixture stirred for 5 mins. The resulting slurry was filtered throughCelite, and theorganicphasewasdriedwith sodiumsulfate.Thesolutionwasconcentrated togiveabrown liquid (16.5 g) that was purified by normal phase silica gel chromatography using an ethyl acetate-hexanes gradient to afford theproduct sulfinimine (6.07g) as anorangeoil. Theoil wasdissolved in toluene (50mL) and loaded intoanaddition funnel above a reaction flask. The reaction flaskwas loadedwith trimethylsilylacetylene (4.30 g, 3.0 eq.) and toluene (195 mL), and an argon atmosphere established. The mixture was stirred and cooled with a dry ice-acetone bath. 2.5 M n- butyllithium in hexane (14.6 mL, 2.5 eq.) was added below internal temperature of ‑63 °C. After stirring for 1 h and 10 minutes, the solution waswarmed to ‑20 °C for 2mins. Themixture was cooled below ‑67 °Cwhile the sulfinimine solution was added over 14 mins. The mixture was stirred for 1 h from ‑73‑(‑67) °C, and then the cooling bath was removed. The contentswarmedslowly by theagencyof the surrounding air until - 40 °C, andwhen the reactionwaswarmed to 0 °Cusing immersion in a room temperature-water bath. Water (10 mL) was added. The mixture was stirred for 5 mins, and then filtered throughCelite. Theorganicphasewasdriedwith sodiumsulfateandconcentrated togiveanorangeoil (7.55g) that was partially purified using normal phase silica gel chromatography and an ethyl acetate-hexane gradient to give an orange oil (4.10 g). The oil was further purified using normal phase silica gel chromatography and an ethyl acetate- dichloromethane gradient to give‑ (S)‑N‑((R)‑1‑((tert-butyldiphenylsilyl)oxy)‑2-methyl‑4‑(trimethylsilyl)but‑3-yn‑2-yl)‑2- methylpropane‑2-sulfinamide (1.93g) asa yellowoil. 1HNMR(CDCl3, 400MHz): δ7.75 (4H,m), 7.45 (6H,m), 3.90 (1H, s), 3.80 (1H, d), 3.60 (1H, d), 1.50 (3H, s), 1.25 (9H, s), 1.10 (9H, s), 0.20 (9H, s).

[0170] (S)‑N‑((R)‑1‑((tert-butyldiphenylsilyl)oxy)‑2-methyl‑4‑(trimethylsilyl)but‑3-yn‑2-yl)‑2-methylpropane‑2-sulfina- mide (1.93g, 1.0eq.)wasdissolvedwith 1,4-dioxane (40mL) then4Mhydrogenchloride in 1,4-dioxane (4mL4.3eq.)was added. The solution was stirred for 3 h, and then concentrated. To the concentrate was added 2‑(5‑((4-fluoro‑3‑(trifluor- omethyl)phenyl)carbamoyl)‑1,2,4-trimethyl‑1H-pyrrol‑3-yl)‑2-oxoacetic acid (1.21 g, 0.83 eq.), HATU (1.79 g, 1.25 eq.), N,N-dimethylformamide (75mL) and N,N-diisopropylethylamine (4.2 mL, 6.42 eq.). The solution was stirred for 16 h, and then concentrated.Ethyl acetate (75mL)wasadded. Thesolutionwaswashedwithwater (30mL) andbrine (25mL), dried with sodium sulfate and concentrated to a red solid (5.6 g) that was purified by normal phase silica gel chromatography usinganethyl acetate-hexanegradient toprovide theproduct amideasayellow foam (2.57g). 1HNMR(CDCl3, 400MHz): δ 7.90 (1H, m), 7.77 (5H, m), 7.63 (1H, s), 7.43 (6H, m), 7.25 (2H, m), 3.91 (1H, d), 3.85 (1H, d), 3.71 (3H, s), 2.41 (6H, s), 1.71 (3H, s), 1.12 (9H, s), 0.20 (9H, s). LC-MS: (ES, m / z): 778 [M+1].

[0171] The starting material (2.57 g) was dissolved in THF (25 mL) and 1.0 M tetrabutylammonium fluoride in THF (8.2 mL, 2.5 eq.) was added. The solution was stirred for 1.5 h, and then concentrated. The concentrate was dissolved with ethyl acetate (30mL). The solution waswashedwithwater (3 x 20mL) and then brine (15mL). The solutionwas driedwith sodium sulfate and concentrated to a yellow oil (2.6 g) that was purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to give a yellow wax (1.4 g). The wax was dissolved with dichloromethane (80 mL), and thenwarmed to dissolve all solids. Themixturewas removed fromheat and then stirredwhile the solution slowly cooled. A slurry developedover 1.5 h. Themixturewascooled for 1 h in an ice bath, and thenfiltered. The filter cakewaswashedwith ice-cold dichloromethane, and then dried under vacuum at 60 °C to provide (R)‑N-(4-fluoro‑3‑(trifluoromethyl)phe- nyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide (0.90 g) as awhite powder. 1HNMR (CDCl3, 400MHz): δ 10.50 (1H, s), 8.47 (1H, s), 8.22 (1H,m), 7.99 (1H,m), 7.51 (1H, t), 5.20 (1H, t), 3.70 (1H,m), 3.60 (3H, s), 3.58 (1H,m), 3.21 (1H, s), 2.42 (3H, s), 2.30 (3H, s), 1.51 (3H, s). LC-MS: (ES,m / z): 468 [M+1]. αD20 ‑22.4 °C (c = 0.98, MeOH). EXAMPLE 15

[0172] 48 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0173] To a stirred solution of (R)‑N‑(4-fluoro‑3‑(trifluoromethyl)phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)ami- no)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide (233.5 mg, 0.5 mmol) in DCM (3 mL) and pyridine (0.2 mL) was added isobutyryl chloride (0.126mL, 1.2mmol). Themixture was warmed up to 40 °C and stirred overnight. After the reactionwas quenchedwithmethanol, themixturewas partitioned between isopropyl acetate and 1M sodiumdihydrogen phosphate. The organic layer was separated, and the solvent was removed under reduced pressure. The residue was purified by column chromatography (20 to 50% ethyl acetate-hexane) to furnish 165a (192 mg, 71%) as a light-yellow foam. LC-MS: (ES,m / z): 538.4 [M+H]. 1H NMR(CDCl3, 400MHz): δ 7.91 (m, 1H), 7.77 (m, 1H), 7.65 (br. s, 1H), 7.22 (dd, 1H), 7.17 (br. s, 1H), 4.46 (dd, 2H), 3.73 (s, 3H), 2.65 (m, 1H), 2.46 (s, 1H), 2.42 (s., 3H), 2.41 (s, 3H), 1.75 (s, 3H), 1.22 (d, 6H).

[0174] The (S)‑enantiomer was synthesized as described for the (R)‑enantiomer using (S)‑N‑(4-fluoro‑3‑(trifluoro- methyl)phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide. LC-MS: (ES, m / z): 538.4 [M+H]. EXAMPLE 16

[0175]

[0176] Compounds 166a and 166b were synthesized from the parent alcohol (233 mg, 0.5 mmol) following the procedure described in Example 15 using pivaloyl chloride in place of isobutyryl chloride. 166a (237 mg, 86%). LC- MS: (ES,m / z): 552.5 [M+H]. 1H NMR (CDCl3, 400MHz): δ 7.91 (m, 1H), 7.77 (m, 1H), 7.65 (br. s, 1H), 7.23 (dd, 1H), 7.16 (br. s, 1H), 7.44 (dd, 2H), 3.72 (s, 3H), 2.45 (s, 1H), 2.42 (s, 3H), 2.40 (s, 3H), 1.75 (s, 3H), 1.26 (s, 9H). 166b LC-MS: (ES, m / z): 552.5 [M+H]. EXAMPLE 17

[0177] 49 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55

[0178] To a stirred solution of Boc-L-valine (214 mg, 0.99 mmol) in acetonitrile (3 mL) was added carbonyldiimidazole (160 mg, 0.99 mmol). After 1 h, a solution of the imidazolide was added to a solution of (S)‑N‑(4-fluoro‑3‑(trifluoromethyl) phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide (307 mg, 0.66 mmol), DIPEA (0.343 mL, 1.97 mmol) and DMAP (16 mg, 0.13 mmol) in acetonitrile (2 mL). The reaction was allowed to proceed for 1 h at rt, and then the reaction was quenchedwith water. The solution was taken into isopropyl acetate and 1M sodium dihydrogen phosphate. The organic phase was separated, washed with sodium bicarbonate and concentrated under reduced pressure. The residue was purified by column chromatography (20 to 50% ethyl acetate- hexane) to afford the Boc-protected intermediate as a slight yellow foam that was then dissolved in ethyl acetate (4 mL). The solution was treated with 4M hydrogen chloride solution in dioxane (1.9 mL, 7.6 mmol). After 3.5 h the mixture was concentrated under reduced pressure, and the residue was triturated with MTBE (5 mL). The resulting solid was isolated by filtration. The filter cake was rinsed with MTBE and the product (370 mg, 93%) was dried under vacuum. LC-MS: (ES, m / z): 567.7 [M-HCl+H]. 1HNMR (400MHz,DMSO-d6) δ: 10.58 (s, 1H), 9.00 (s, 1H), 8.45 (br. s, 3H), 8.23 (m, 1H), 7.98 (m, 1H), 7.53 (dd, 1H), 4.53 (dd, 2H), 3.53 (s, 3H), 3.48 (s, 1H), 2.43 (s, 3H), 2.26 (s, 3H), 1.60 (s, 3H), 1.03‑0.93 (m, 7H).

[0179] The (R)‑enantiomer was obtained as described for the (S)‑enantiomer using (R)‑N‑(4-fluoro‑3‑(trifluoromethyl) phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide. LC- MS: (ES, m / z): 567.7 [M-HCl+H]. EXAMPLE 18

[0180]

[0181] To a stirred at 0°C solution of (S)‑N‑(4-fluoro‑3‑(trifluoromethyl)phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl) amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide (4.82 g, 10.4 mmol) in THF (100 mL) and pyridine (2.44 50 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 mL, 31mmol)was added phosphorus oxychloride (2.88mL, 31mmol). Themixturewas stirred for 1 h at 0 °C, and then the reaction was quenched with water (30mL). Themixture was warmed to rt and stirred for 1 h. Themixture was diluted with ethyl acetate, and the solution was washed with water (3x). The organic phase was concentrated to dryness, and the residue was dissolved in isopropanol (100 mL). An aqueous solution (2M) of NaOH was added slowly until pH ~8.5 (9.7 mL). A precipitate formed upon addition of NaOHandwas isolated by filtration. The filter cakewas rinsedwith isopropanol and dried under vacuum to afford the product(5.19 g, 83%). LC-MS: (ES, m / z): 548.1 [M‑2Na+3H]. 1H NMR (400 MHz, D2O) δ: 7.83 (m,H), 7.66 (m, 1H), 7.31 (dd, 1H), 3.91 (split dd, 2H), 3.54 (s, 3H), 2.80 (s, 1H), 2.40 (s, 3H), 2.29 (s, 3H), 1.61 (s, 3H). 31P NMR (162 MHz, D2O) δ: 4.08 (s).

[0182] The (R)‑enantiomer was obtained as described for the (S)‑enantiomer using (R)‑N‑(4-fluoro‑3‑(trifluoromethyl) phenyl)‑4‑(2‑((1-hydroxy‑2-methylbut‑3-yn‑2-yl)amino)‑2-oxoacetyl)‑1,3,5-trimethyl‑1H-pyrrole‑2-carboxamide. LC- MS: (ES, m / z): 548.1 [M‑2Na+3H]. EXAMPLE 19

[0183] The following compounds were made following similar procedures and starting materials as described in the Examples above. Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phenyl)‑3- fluoro‑1-methyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 6 1H NMR (400 MHz, DMSO-d6) δ 10.36 (s, 1H), 9.22 (s, 1H), 8.21‑8.15 (m, 1H), 8.12 (d, J = 4.2 Hz, 1H), 7.96 (s, 1H), 7.53 (t, J = 9.1 Hz, 1H), 4.00‑3.93 (s, 2H), 3.85 (s, 3H), 3.14 (s, 1H) 4‑[2‑(allylamino)‑2-oxo-acet- yl]‑N‑(3-cyano‑4-fluoro-phe- nyl)‑3-fluoro‑1-methyl-pyr- role‑2-carboxamide 7 1H NMR (400 MHz, DMSO-d6) δ 10.35 (s, 1H), 8.96 (t, J = 6.0 Hz, 1H), 8.18 (dd, J = 5.9, 2.7 Hz, 1H), 8.11 (d, J = 4.3 Hz, 1H), 7.96 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 5.85 (m, 1H), 5.20‑5.06 (m, 2H), 3.85 (s, 3H), 3.83 (d, J = 5.6 Hz, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3-dimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 8 1H NMR (300 MHz, DMSO-d6) δ 10.56‑10.50 (m, 1H), 9.09 (d, J = 5.6 Hz, 1H), 8.20 (m, J = 5.8, 2.7 Hz, 1H), 8.14 (s, 1H), 8.03‑7.91 (m, 1H), 7.55 (t, J = 9.2 Hz, 1H), 3.96 (m, J = 5.9, 2.5 Hz, 2H), 3.77 (s, 3H), 3.14 (t, J = 2.5 Hz, 1H), 2.40 (s, 3H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1,3-dimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 9 1H NMR (300 MHz, DMSO-d6) δ 10.67 (s, 1H), 9.21 (t, J = 5.7 Hz, 1H), 8.20 (m, 1H), 8.02‑7.91 (m, 1H), 7.56 (t, J = 9.1 Hz, 1H), 4.01 (m,, 2H), 3.68 (s, 3H), 3.19 (t, J = 2.5 Hz, 1H), 2.29 (s, 3H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1-methyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 10 1H NMR (300 MHz, DMSO-d6) δ 10.76 (s, 1H), 9.24 (t, J = 5.8 Hz, 1H), 8.27 (s, 1H), 8.22 (m, 1H), 7.99 (m, 1H), 7.57 (t, J = 9.1 Hz, 1H), 3.98 (m, 2H), 3.87 (s, 3H), 3.17 (t, J = 2.5 Hz, 1H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑(1,1-dimethylprop‑2- ynylamino)‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 11 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.76 (s, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 3.61 (s, 3H), 3.20 (s, 1H), 2.44 (s, 3H), 2.29 (s, 3H), 1.57 (s, 6H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑3-fluoro‑1-methyl‑4‑[2- oxo‑2‑(prop‑2-ynylamino)acet- yl]pyrrole‑2-carboxamide 12 1H NMR (400 MHz, DMSO-d6) δ 10.57 (s, 1H), 9.30 (t, J = 5.6 Hz, 1H), 8.17 (m, 1H), 7.96 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.02 (m, 2H), 3.81 (s, 3H), 3.21 (t, J = 2.5 Hz, 1H) N‑(3-cyano‑4-fluoro-phenyl)‑3- fluoro‑1,5-dimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 13 1H NMR (300 MHz, Methanol-d4) δ 8.12 (dd, J = 5.7, 2.7 Hz, 1H), 7.88 (m, 1H), 7.34 (t, J = 9.0 Hz, 1H), 4.09 (d, J = 2.6 Hz, 2H), 3.81 (s, 3H), 2.65 (t, J = 2.6 Hz, 1H), 2.53 (s, 3H) 51 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(1-ethynylcyclopro- pyl)amino]‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 14 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.27 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (m, 1H), 7.54 (t, J = 9.2 Hz, 1H), 3.59 (s, 3H), 3.06 (s, 1H), 2.40 (s, 3H), 2.23 (s, 3H), 1.21‑1.10 (m, 2H), 1.10‑1.00 (m, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(1-ethynylcyclobutyl) amino]‑2-oxo-acetyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 15 1H NMR (400 MHz, DMSO-d6) δ 10.53 (s, 1H), 9.20 (s, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 3.61 (s, 3H), 3.23 (s, 1H), 2.46‑2.37 (m, 7H), 2.28 (s, 3H), 1.97 (m, 2H) 5-bromo‑3-chloro-N‑(3-cya- no‑4-fluoro-phenyl)‑1- methyl‑4‑[2-oxo‑2‑(prop‑2-yny- lamino)acetyl]pyrrole‑2-carbox- amide 16 1H NMR (400 MHz, DMSO-d6) δ 10.93 (s, 1H), 9.31 (t, J = 4.8 Hz, 1H), 8.27 (s, 1H), 7.97 (s, 1H), 7.57 (t, J = 9.1 Hz, 1H), 4.02 (d, J = 2.4 Hz, 2H), 3.75 (s, 3H), 3.20 (s, 1H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-methylprop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 17a 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.18 (d, J = 7.9 Hz, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.76‑4.64 (m, 1H), 3.60 (s, 3H), 3.25 (d, J = 2.3 Hz, 1H), 2.42 (s, 3H), 2.25 (s, 3H), 1.38 (d, J = 7.0 Hz, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-methylprop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 17b 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.18 (d, J = 7.9 Hz, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.70 (m, 1H), 3.60 (s, 3H), 3.25 (d, J = 2.3 Hz, 1H), 2.42 (s, 3H), 2.25 (s, 3H), 1.38 (d, J = 7.0 Hz, 3H) 4‑[2‑(allylamino)‑2-oxo-acet- yl]‑N‑(3-cyano‑4-fluoro-phe- nyl)‑3-fluoro‑1,5-dimethyl-pyr- role‑2-carboxamide 18 1H NMR (300 MHz, DMSO-d6) δ 10.36 (s, 1H), 8.88 (t, J = 5.9 Hz, 1H), 8.18 (dd, J = 5.8, 2.8 Hz, 1H), 8.00‑7.87 (m, 1H), 7.54 (t, J = 9.2 Hz, 1H), 5.97‑5.81 (m, 1H), 5.31‑5.09 (m, 2H), 3.82 (t, J = 5.6 Hz, 2H), 3.72 (s, 3H), 2.55 (s, 3H) 5-bromo-N‑(3-cyano‑4-fluoro- phenyl)‑3-fluoro‑1-methyl‑4‑[2- oxo‑2‑(prop‑2-ynylamino)acet- yl]pyrrole‑2-carboxamide 20 1H NMR (400 MHz, DMSO-d6) δ 9.27 (s, 1H), 8.16 (m, 1H), 7.99‑7.90 (m, 1H), 7.54 (t, J = 9.2 Hz, 1H), 4.01 (dd, J = 5.6, 2.6 Hz, 2H), 3.81 (s, 3H), 3.19 (t, J = 2.6 Hz, 1H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1,5-dimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 21 1H NMR (300 MHz, DMSO-d6) δ 10.76 (s, 1H), 9.20 (t, J = 5.6 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.99 (m,1H), 7.56 (t, J = 9.1 Hz, 1H), 4.01 (dd, J = 5.6, 2.5 Hz, 2H), 3.66 (s, 3H), 3.18 (t, J = 2.5 Hz, 1H), 2.51 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑(3-cyclopropylprop‑2- ynylamino)‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 22 1H NMR (300 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.05 (t, J = 5.6 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 3.94 (dd, J = 5.6, 2.0 Hz, 2H), 3.61 (s, 3H), 2.40 (s, 3H), 2.24 (s, 3H), 1.36‑1.20 (m, 1H), 0.83‑0.65 (m, 2H), 0.64‑0.49 (m, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-cyclopropyl- prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 23a 1H NMR (400 MHz, DMSO-d6) δ 10.53 (s, 1H), 9.30 (d, J = 8.2 Hz, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.54 (t, J = 9.1 Hz, 1H), 4.35 (td, J = 7.9, 2.4 Hz, 1H), 3.24 (d, J = 2.3 Hz, 1H), 2.42 (s, 3H), 2.26 (s, 3H), 1.25‑1.15 (m, 1H), 0.69‑0.14 (m, 4H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1-methyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 25 1H NMR (300 MHz, DMSO-d6) δ 10.58 (s, 1H), 9.28 (t, J = 5.7 Hz, 1H), 8.22 (m, 1H), 8.09‑7.97 (m, 1H), 7.89 (s, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.02 (m, 2H), 3.93 (s, 3H), 3.18 (t, J = 2.5 Hz, 1H) 52 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[(1S)‑1‑(methoxyme- thyl)prop‑2-ynyl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 28a 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.21 (d, J = 8.3 Hz, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (m, 1H), 4.91‑4.78 (m, 1H), 3.61‑3.54 (m, 5H), 3.36 (m, 3H), 2.52 (s, 1H), 2.42 (s, 3H), 2.26 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[(1R)‑1‑(methoxyme- thyl)prop‑2-ynyl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 28b 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.21 (d, J = 8.3 Hz, 1H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (m, 1H), 4.91‑4.78 (m, 1H), 3.61 (m, 3H), 3.54 (m, 2H), 3.36 (m, 3H), 2.52 (s, 1H), 2.42 (s, 3H), 2.26 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑(1H-triazol‑4-yl)oxe- tan‑3-yl]amino]acetyl]pyrrole‑2- carboxamide 29 1H NMR (400 MHz, DMSO-d6) δ 15.01 (s, 1H), 10.52 (s, 1H), 9.90 (s, 1H), 8.21 (t, J = 8.4 Hz, 1H), 7.97 (s, 1H), 7.83 (s, 1H), 7.55 (t, J = 9.0 Hz, 1H), 4.92 (s, 4H), 3.59 (s, 3H), 2.35 (s, 3H), 2.20 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-tert-butylprop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 30b 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.03 (d, J = 9.3 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.95‑8.01 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.53 (dd, J = 9.2, 2.5 Hz, 1H), 3.61 (s, 3H), 3.26 (d, J = 2.4 Hz, 1H), 2.43 (s, 3H), 2.27 (s, 3H), 1.00 (s, 9H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[(3-vinyloxetan‑3-yl)ami- no]acetyl]pyrrole‑2-carboxa- mide 33 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.42 (s, 1H), 8.20 (dd, J = 5.8, 2.7 Hz, 1H), 7.96 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.53 (t, J = 9.1 Hz, 1H), 6.28 (dd, J = 17.2, 10.5 Hz, 1H), 5.31 (dd, J = 17.3, 1.1 Hz, 1H), 5.20 (dd, J = 10.5, 1.0 Hz, 1H), 4.71 (d, J = 6.6 Hz, 2H), 4.57 (d, J = 6.6 Hz, 2H), 3.59 (s, 3H), 2.42 (s, 3H), 2.27 (s, 3H) 4‑[2‑[(3-ethynyloxetan‑3-yl) amino]‑2-oxo-acetyl]‑N‑[4-fluor- o‑3‑(trifluoromethyl)phe- nyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 34 1H NMR (400 MHz, DMSO-d6) δ 10.51 (s, 1H), 9.74 (s, 1H), 8.20 (dd, J = 6.6, 2.6 Hz, 1H), 7.99‑7.90 (m, 1H), 7.50 (t, J = 9.8 Hz, 1H), 4.72 (d, J = 6.6 Hz, 4H), 3.65 (s, 1H), 3.59 (s, 3H), 2.41 (s, 3H), 2.25 (s, 3H) 4‑[2‑(1,1-dimethylprop‑2-ynyla- mino)‑2-oxo-acetyl]‑N‑[4-fluor- o‑3‑(trifluoromethyl)phe- nyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 35 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.77 (s, 1H), 8.22 (dd, J = 6.7, 2.6 Hz, 1H), 7.98 (dd, J = 9.0, 4.3 Hz, 1H), 7.53 (t, J = 9.8 Hz, 1H), 3.60 (s, 3H), 3.22 (s, 1H), 2.44 (s, 3H), 2.28 (s, 3H), 1.57 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(trifluoromethyl)al- lyl]amino]acetyl]pyrrole‑2-car- boxamide 36b 1H NMR (300 MHz, DMSO-d6) δ 10.57 (s, 1H), 9.66 (d, J = 9.1 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.95‑8.01 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.86‑5.98 (m, 1H), 5.65 (d, J = 17.1 Hz, 1H), 5.51 (d, J = 10.4 Hz, 1H), 5.30 (q, J = 8.0 Hz, 1H), 2.41 (s, 3H), 2.23 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(trifluoromethyl)al- lyl]amino acetyl]pyrrole‑2-car- boxamide 36a 1H NMR (300 MHz, DMSO-d6) δ 10.57 (s, 1H), 9.66 (d, J = 9.1 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.95‑8.01 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.86‑5.98 (m, 1H), 5.65 (d, J = 17.1 Hz, 1H), 5.51 (d, J = 10.4 Hz, 1H), 5.30 (q, J = 8.0 Hz, 1H), 2.41 (s, 3H), 2.23 (s, 3H) 53 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR 4‑[2‑[(1-ethynyl‑3,3-difluoro-cy- clobutyl)amino]‑2-oxo-acet- yl]‑N‑[4-fluoro‑3‑(trifluoro- methyl)phenyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide 37 1H NMR (300 MHz, DMSO-d6) δ 10.53 (s, 1H), 9.62 (s, 1H), 8.22 (dd, J = 6.7, 2.6 Hz, 1H), 7.97 (dt, J = 8.1, 3.8 Hz, 1H), 7.54 (d, J = 9.9 Hz, 1H), 3.61 (s, 3H), 3.53 (s, 1H), 3.13 (t, J = 12.1 Hz, 4H), 2.43 (s, 3H), 2.27 (s, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-cyclopropyl- prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 38a 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.30 (d, J = 8.2 Hz, 1H), 8.20 (dd, J = 6.7, 2.7 Hz, 1H), 7.98‑7.90 (m, 1H), 7.50 (t, J = 9.8 Hz, 1H), 4.33 (td, J = 7.9, 2.4 Hz, 1H), 3.58 (s, 3H), 3.24 (d, J = 2.4 Hz, 1H), 2.41 (s, 3H), 2.25 (s, 3H), 1.18 (dt, J = 8.0, 6.5 Hz, 1H), 0.51 (dddd, J = 12.7, 7.0, 4.8, 3.2 Hz, 2H), 0.45‑0.38 (m, 1H), 0.37‑0.30 (m, 1H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-cyclopropyl- prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 38b 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.30 (d, J = 8.2 Hz, 1H), 8.20 (dd, J = 6.6, 2.7 Hz, 1H), 7.94 (dt, J = 7.6, 3.5 Hz, 1H), 7.50 (t, J = 9.8 Hz, 1H), 4.33 (td, J = 7.9, 2.4 Hz, 1H), 3.58 (s, 3H), 3.24 (d, J = 2.3 Hz, 1H), 2.41 (s, 3H), 2.25 (s, 3H), 1.18 (dtd, J = 12.7, 7.9, 4.6 Hz, 1H), 0.56‑0.46 (m, 2H), 0.42 (ddd, J = 10.8, 5.6, 3.1 Hz, 1H), 0.34 (ddd, J = 10.7, 4.9, 2.3 Hz, 1H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3-dimethyl-pyrrole‑2- carboxamide 39 1H NMR (400 MHz, DMSO-d6) δ 10.67 (s, 1H), 9.67 (s, 1H), 8.19 (dd, J = 5.8, 2.7 Hz, 1H), 7.95 (ddd, J = 9.3, 4.8, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 3.68 (s, 3H), 3.52 (s, 1H), 3.12 (t, J = 12.0 Hz, 4H), 2.29 (s, 3H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(3-ethynyloxe- tan‑3-yl)amino]‑2-oxo-acet- yl]‑1,3-dimethyl-pyrrole‑2-car- boxamide 40 1H NMR (300 MHz, DMSO-d6) δ 10.70 (s, 1H), 9.84 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.57 (t, J = 9.1 Hz, 1H), 4.75 (d, J = 1.4 Hz, 4H), 3.70 (s, 3H), 3.68 (s, 1H), 2.32 (s, 3H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1,3-dimethyl‑4‑[2- oxo‑2‑[(3-vinyloxetan‑3-yl)ami- no]acetyl]pyrrole‑2-carboxa- mide 41 1H NMR (300 MHz, DMSO-d6) δ 10.69 (s, 1H), 9.52 (s, 1H), 8.22 (dd, J = 5.8, 2.6 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.57 (t, J = 9.1 Hz, 1H), 6.31 (dd, J = 17.2, 10.5 Hz, 1H), 5.38‑5.17 (m, 2H), 4.77 (d, J = 6.6 Hz, 2H), 4.60 (d, J = 6.6 Hz, 2H), 3.71 (s, 3H), 2.33 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(trifluoromethyl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 42a 1H NMR (300 MHz, DMSO-d6) δ 10.58 (s, 1H), 10.08 (d, J = 8.8 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 8.01‑7.95 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.99‑5.58 (m, 1H), 3.81 (d, J = 2.5 Hz, 1H), 3.61 (s, 3H), 2.42 (s, 3H), 2.24 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(trifluoromethyl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 42b 1H NMR (300 MHz, DMSO-d6) δ 10.58 (s, 1H), 10.08 (d, J = 8.8 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 8.01‑7.95 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.99‑5.58 (m, 1H), 3.81 (d, J = 2.5 Hz, 1H), 3.61 (s, 3H), 2.42 (s, 3H), 2.24 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3‑(2-cyclopropylethy- nyl)oxetan‑3-yl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 43 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s,1H), 9.65 (s,1H), 8.24‑8.21 (m,1H), 8.00‑7.95 (m,1H), 7.55 (t, J=9,1H), 4.69 (s,4H), 3.60 (s,3H), 2.27 (s,3H), 2.08 (s,3H), 1.42‑1.33 (m,1H), 0.84‑0.80 (m 2H), 0.62‑0.59 (m,2H) 54 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(3,3-difluoro‑1-vi- nyl-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3-dimethyl-pyrrole‑2- carboxamide 44 1H NMR (300 MHz, DMSO-d6) δ 10.68 (s, 1H), 9.37 (s, 1H), 8.21 (dd, J = 5.8, 2.6 Hz, 1H), 8.04‑7.90 (m, 1H), 7.57 (t, J = 9.2 Hz, 1H), 6.12 (dd, J = 17.2, 10.4 Hz, 1H), 5.34‑5.01 (m, 2H), 3.70 (s, 3H), 3.00 (dt, J = 18.0, 13.1 Hz, 4H), 2.31 (s, 3H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(3-ethynyloxe- tan‑3-yl)amino]‑2-oxo-acet- yl]‑1,5-dimethyl-pyrrole‑2-car- boxamide 45 1H NMR (300 MHz, DMSO-d6) δ 10.77 (s, 1H), 9.80 (s, 1H), 8.22 (dd, J = 5.7, 2.7 Hz, 1H), 8.05‑7.91 (m, 1H), 7.56 (t, J = 9.2 Hz, 1H), 4.74 (s, 4H), 3.67 (s, 3H), 3.66 (s, 1H), 2.48 (s, 3H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1,5-dimethyl‑4‑[2- oxo‑2‑[(3-vinyloxetan‑3-yl)ami- no]acetyl]pyrrole‑2-carboxa- mide 46 1H NMR (400 MHz, DMSO-d6) δ 10.75 (s, 1H), 9.47 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, 1H), 7.54 (t, J = 9.1 Hz, 1H), 6.29 (dd, J = 17.3, 10.5 Hz, 1H), 3.65 (s, 3H), 2.47 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑(3,3,3-trifluoroprop‑1- ynyl)oxetan‑3-yl]amino]acetyl] pyrrole‑2-carboxamide 47 1H NMR (400 MHz, DMSO-d6) δ 10.59 (s, 1H), 8.22(dd, J = 5.6, 2.8 Hz, 1H), 8.00‑7.96 (m, 1H), 7.56 (t, J =8.8Hz, 1H), 6.37‑6.31 (m, 1H), 4.80‑4.76 (m, 4H), 3.63 (s, 3H), 2.39 (s, 3H), 2.20 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[3‑(3- methylbut‑1-ynyl)oxetan‑3-yl] amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 48 1H NMR (300 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.67 (s, 1H), 8.22 (dd, J=5.8, 2.7 Hz, 1H), 8.00‑7.94 (m, 1H), 7.55 (t, J = 9.2Hz, 1H), 4.70 (s, 4H), 3.61 (s, 3H), 2.69‑2.59 (m, 1H), 2.28 (s, 3H), 2.08 (s, 3H), 1.13 (d, J=6.9Hz, 6H) 4‑[2‑[(1-ethynyl‑3-hydroxy-cy- clobutyl)amino]‑2-oxo-acet- yl]‑N‑[4-fluoro‑3‑(trifluoro- methyl)phenyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide 49 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.31 (s, 1H), 8.22 (dd, J = 6.5, 2.6 Hz, 1H), 7.97 (dt, J = 7.9, 3.8 Hz, 1H), 7.52 (t, J = 9.8 Hz, 1H), 5.34 (s, 1H), 4.15 (s, 1H), 3.60 (s, 3H), 3.26 (s, 1H), 2.78 (ddd, J = 9.5, 6.9, 2.8 Hz, 2H), 2.42 (s, 3H), 2.28 (s, 3H), 2.17 (t, J = 10.0 Hz, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[(3-prop‑1-ynyloxetan‑3- yl)amino] acetyl]pyrrole‑2-car- boxamide 50 1H NMR (400 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.68 (s, 1H), 8.21(dd, J = 5.6, 2.4 Hz, 1H), 7.99‑7.95 (m, 1H), 7.55 (t, J = 9.2 Hz, 1H), 4.70 (s, 4H), 3.60(s, 3H), 2.41 (s, 3H), 2.27 (s, 3H), 1.86 (s, 3H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(3,3-difluoro‑1-vi- nyl-cyclobutyl)amino]‑2-oxo- acetyl]‑1,5-dimethyl-pyrrole‑2- carboxamide 51 1H NMR (400 MHz, DMSO-d6) δ 10.75 (s, 1H), 9.32 (s, 1H), 8.20 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.54 (t, J = 9.1 Hz, 1H), 6.09 (dd, J = 17.2, 10.4 Hz, 1H), 5.23 (dd, J = 17.1, 0.9 Hz, 1H), 5.13 (dd, J = 10.5, 0.9 Hz, 1H), 3.64 (s, 3H), 2.97 (dq, J = 46.6, 13.5 Hz, 4H), 2.46 (s, 3H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(1 -ethynyl‑3,3 -difluoro-cyclobutyl)amino]‑2- oxo-acetyl]‑1,5-dimethyl-pyr- role‑2-carboxamide 52 1H NMR (300 MHz, DMSO-d6) δ 10.74 (s, 1H), 9.63 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 3.66 (s, 3H), 3.50 (s, 1H), 3.14 (t, J = 12.1 Hz, 4H), 2.47 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(3,3-difluoro‑1-vinyl- cyclobutyl)amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 53 1H NMR (400 MHz, DMSO-d6) δ 10.52 (s, 1H), 9.27 (s, 1H), 8.20 (dd, J = 5.8, 2.7 Hz, 1H), 7.96 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.53 (t, J = 9.1 Hz, 1H), 6.09 (dd, J = 17.2, 10.5 Hz, 1H), 5.25 (dd, J = 17.2, 0.9 Hz, 1H), 5.13 (dd, J = 10.4, 0.9 Hz, 1H), 3.59 (s, 3H), 3.10‑2.80 (m, 4H), 2.41 (s, 3H), 2.25 (s, 3H) 55 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(3-ethynyloxetan‑3- yl)amino]‑2-oxo-acetyl]‑3- fluoro‑1,5-dimethyl-pyrrole‑2- carboxamide 55 1H NMR (400 MHz, DMSO-d6) δ 10.44 (s, 1H), 9.82 (s, 1H), 8.17 (dd, J = 5.8, 2.7 Hz, 1H), 7.97 (ddd, J = 9.3, 4.9, 2.7 Hz, 1H), 7.54 (t, J = 9.1 Hz, 1H), 4.78 C 4.68 (m, 4H), 3.73 (s, 3H), 3.66 (s, 1H), 2.52 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑3-fluoro‑1,5-dimethyl- pyrrole‑2-carboxamide 56 1H NMR (400 MHz, DMSO-d6) δ 10.45 (s, 1H), 9.67 (s, 1H), 8.17 (dd, J = 5.8, 2.7 Hz, 1H), 7.96 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.54 (t, J = 9.1 Hz, 1H), 3.72 (s, 3H), 3.52 (s, 1H), 3.18 C 3.04 (m, 4H), 2.50 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[1R)‑1‑(oxetan‑3-yl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 57 1H NMR (300 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.27 (d, J = 8.1 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.96 (td, J = 8.0, 2.4 Hz, 1H), 4.63 (ddd, J = 9.5, 7.8, 6.3 Hz, 2H), 4.47 (t, J = 6.2 Hz, 1H), 4.36 (t, J = 6.2 Hz, 1H), 3.61 (s, 3 H), 3.37 (d, J = 2.3 Hz, 1H), 3.30‑3.21 (m, 1H), 2.41 (s, 3H), 2.25 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(oxetan‑3-yl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 58 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.27 (d, J = 8.1 Hz, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 8.05‑7.87 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.03‑4.88 (m, 1H), 4.71‑4.55 (m, 2H), 4.47 (t, J = 6.3 Hz, 1H), 4.36 (t, J = 6.2 Hz, 1H), 3.61 (s, 3H), 3.37 (d, J = 2.3 Hz, 1H), 3.30‑3.22 (m, 1H), 2.41 (s, 3H), 2.25 (s, 3H) 5-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(1-ethynyl‑3-hy- droxy-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3-dimethyl-pyrrole‑2- carboxamide 59 1H NMR (300 MHz, DMSO-d6) δ 10.68 (s, 1H), 9.37 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.8 Hz, 1H), 7.57 (t, J = 9.1 Hz, 1H), 5.34 (d, J = 6.8 Hz, 1H), 4.15 (q, J = 7.3 Hz, 1H), 3.70 (s, 3H), 3.26 (s, 1H),2.84 C 2.72 (m, 2H), 2.31 (s, 3H), 2.21 (s, 2H) 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(1-ethynyl‑3-hy- droxy-cyclobutyl)amino]‑2-oxo- acetyl]‑1,5-dimethyl-pyrrole‑2- carboxamide 60 1H NMR (300 MHz, DMSO-d6) δ 10.75 (s, 1H), 9.34 (s, 1H), 8.23 (dd, J = 5.8, 2.7 Hz, 1H), 8.00 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.56 (t, J = 9.1 Hz, 1H), 5.32 (d, J = 6.8 Hz, 1H), 4.14 (q, J = 7.2 Hz, 1H), 3.66 (s, 3H), 3.25(s, 1H), 2.83 C 2.73 (m, 2H), 2.47 (s, 3H), 2.21 (s, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1‑(2-hydroxyethyl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 61a 1H NMR (300 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.12 (d, J = 8.2 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 8.03‑7.92 (m, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.77 (d, J = 6.1 Hz, 1H), 4.63 (t, J = 4.9 Hz, 1H), 3.60 (s, 3H), 3.53 (q, J = 5.9 Hz, 2H), 3.25 (d, J = 2.3 Hz, 1H), 2.42 (s, 3H), 2.26 (s, 3H), 1.82 (q, J = 6.6 Hz, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1‑(2-hydroxyethyl) prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 61b 1H NMR (300 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.12 (d, J = 8.2 Hz, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.3, 4.9, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 4.77 (d, J = 7.1 Hz, 1H), 4.63 (t, J = 4.9 Hz, 1H), 3.60 (s, 3H), 3.53 (q, J = 5.8 Hz, 2H), 3.25 (d, J = 2.3 Hz, 1H), 2.42 (s, 3H), 2.26 (s, 3H), 1.86‑1.78 (m, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3-hydroxy‑1‑(3,3,3- trifluoroprop‑1-ynyl)cyclobutyl] amino]‑2-oxo-acetyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 62 1H NMR (300 MHz, Methanol-d4) δ 8.16 (dd, J = 5.7, 2.7 Hz, 1H), 7.93 (ddd, J = 9.2, 4.7, 2.8 Hz, 1H), 7.39 (t, J = 9.0 Hz, 1H), 4.37 (t, J = 7.5 Hz, 1H), 3.69 (s, 3H), 3.05 (td, J = 6.9, 3.5 Hz, 2H), 2.49 (s, 3H), 2.37 (s, 5H) 56 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-cyclopro- pyl‑1‑(hydroxymethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 63a 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.53 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 8.03 C 7.91 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 5.17 (t, J = 6.0 Hz, 1H), 3.94 (dd, J = 10.5, 6.4 Hz, 1H), 3.68 C 3.58 (m, 1H), 3.59 (s, 3H), 3.20 (s, 1H), 2.43 (s, 3H), 2.28 (s, 3H), 1.41 C 1.31 (m, 1H), 0.70‑0.60 (m, 1H), 0.50 C 0.41 (m, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-cyclopro- pyl‑1‑(hydroxymethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 63b 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.53 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 8.03 C 7.91 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 5.17 (t, J = 6.0 Hz, 1H), 3.94 (dd, J = 10.5, 6.4 Hz, 1H), 3.68 C 3.58 (m, 1H), 3.59 (s, 3H), 3.20 (s, 1H), 2.43 (s, 3H), 2.28 (s, 3H), 1.41 C 1.31 (m, 1H), 0.70‑0.60 (m, 1H), 0.50 C 0.41 (m, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxymethyl)‑1- methyl-prop‑2-ynyl]amino]acet- yl]pyrrole‑2-carboxamide 64a 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.48 (s, 1H), 8.21 (dd, J = 5.8, 2.6 Hz, 1H), 8.02‑7.91 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 5.18 (t, J = 6.1 Hz, 1H), 3.69 (dd, J = 10.7, 6.3 Hz, 1H), 3.59 (s, 3H), 3.57‑3.50 (m, 1H), 3.21 (s, 1H), 2.42 (s, 3H), 2.27 (s, 3H), 1.50 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxymethyl)‑1- methyl-prop‑2-ynyl]amino]acet- yl]pyrrole‑2-carboxamide 64b 1H NMR (300 MHz, DMSO-d6) δ 10.52 (s, 1H), 8.48 (s, 1H), 8.21 (dd, J = 5.8, 2.7 Hz, 1H), 8.05‑7.90 (m, 1H), 7.54 (t, J = 9.1 Hz, 1H), 5.18 (t, J = 6.1 Hz, 1H), 3.69 (dd, J = 10.6, 6.3 Hz, 1H), 3.59 (s, 3H), 3.57‑3.52 (m, 1H), 3.21 (s, 1H), 2.42 (s, 3H), 2.27 (s, 3H), 1.50 (s, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-cyclopro- pyl‑1‑(hydroxymethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 65a 1H NMR (400 MHz, DMSO-d6) δ 10.51 (s, 1H), 8.53 (s, 1H), 8.23 (dd, J = 6.6, 2.7 Hz, 1H), 8.01‑7.93 (m, 1H), 7.53 (t, J = 9.8 Hz, 1H), 5.18 (t, J = 6.1 Hz, 1H), 3.95 (dd, J = 10.6, 6.4 Hz, 1H), 3.65‑3.55 (m, 4H), 3.21 (s, 1H), 2.44 (s, 3H), 2.30 (s, 3H), 1.37 (ddd, J = 13.6, 8.0, 5.4 Hz, 1H), 0.64 (q, J = 4.8 Hz, 1H), 0.46 (ddd, J = 9.0, 6.4, 3.2 Hz, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-cyclopro- pyl‑1‑(hydroxymethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 65b 1H NMR (400 MHz, DMSO-d6) δ 10.51 (s, 1H), 8.53 (s, 1H), 8.23 (dd, J = 6.6, 2.7 Hz, 1H), 8.01‑7.93 (m, 1H), 7.53 (t, J = 9.8 Hz, 1H), 5.18 (t, J = 6.1 Hz, 1H), 3.95 (dd, J = 10.6, 6.4 Hz, 1H), 3.65‑3.55 (m, 4H), 3.21 (s, 1H), 2.44 (s, 3H), 2.30 (s, 3H), 1.37 (ddd, J = 13.6, 8.0, 5.4 Hz, 1H), 0.64 (q, J = 4.8 Hz, 1H), 0.46 (ddd, J = 9.0, 6.4, 3.2 Hz, 3H) N‑(3-bromo‑2-fluoro‑4-pyri- dyl)‑4‑[2‑[(3-ethynyloxetan‑3- yl)amino]‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 67 1H NMR (400 MHz, DMSO-d6) δ 9.97 (s, 1H), 9.79 (s, 1H), 8.19 (d, J = 5.5 Hz, 1H), 7.96 (d, J = 5.5 Hz, 1H), 4.79‑4.69 (m, 4H), 3.67 (d, J = 2.7 Hz, 4H), 2.43 (d, J = 5.9 Hz, 6H) N‑(3-bromo‑2-fluoro‑4-pyri- dyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 68 1H NMR (400 MHz, DMSO-d6) δ 9.97 (s, 1H), 9.64 (s, 1H), 8.19 (dd, J = 5.6, 2.3 Hz, 1H), 7.95 (dd, J = 5.5, 2.3 Hz, 1H), 3.67 (d, J = 2.3 Hz, 3H), 3.54 (d, J = 2.3 Hz, 1H), 3.14 (t, J = 12.3 Hz, 4H), 2.42 (dd, J = 7.3, 2.4 Hz, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxymethyl)‑1- methyl-allyl]amino]acetyl]pyr- role‑2-carboxamide 69a 1H NMR (300 MHz, DMSO-d6) δ 10.49 (s, 1H), 8.21 (dd, J = 6.6, 2.6 Hz, 1H), 8.15 (s, 1H), 8.01‑7.91 (m, 1H), 7.52 (t, J = 9.8 Hz, 1H), 6.01 (dd, J = 17.5, 10.8 Hz, 1H), 5.22‑5.04 (m, 2H), 4.95 (t, J = 5.9 Hz, 1H), 3.59 (s, 3H), 3.56‑3.51 (m, 1H), 3.46 (dd, J = 10.8, 5.9 Hz, 1H), 2.41 (s, 3H), 2.26 (s, 3H), 1.39 (s, 3H) 57 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxymethyl)‑1- methyl-allyl]amino]acetyl]pyr- role‑2-carboxamide 69b 1H NMR (300 MHz, DMSO-d6) δ 10.49 (s, 1H), 8.21 (dd, J = 6.6, 2.7 Hz, 1H), 8.15 (s, 1H), 8.00‑7.91 (m, 1H), 7.52 (t, J = 9.8 Hz, 1H), 6.01 (dd, J = 17.6, 10.8 Hz, 1H), 5.22‑5.03 (m, 2H), 4.95 (t, J = 5.9 Hz, 1H), 3.59 (s, 3H), 3.55‑3.42 (m, 2H), 2.41 (s, 3H), 2.26 (s, 3H), 1.39 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1-methylpyrazol‑4-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 70 1H NMR (400MHz, CDCl3) δ 8.02 (dd, J=2.7, 5.4 Hz, 1H), 7.76‑7.61 (m, 2H), 7.49 (s, 1H), 7.41 (s, 1H), 7.20 (t, J=8.6 Hz, 1H), 7.00‑6.92 (m, 1H), 3.87 (s, 3H), 3.69 (s, 3H), 2.34 (d, J=8.3 Hz, 6H), 1.78 (s, 6H), 1.25 (s, 1H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 71a 1H NMR (400 MHz, CDCl3) δ 8.02 (dd, J = 5.2, 2.8 Hz, 1H), 7.75‑7.71(m,, 1H), 7.58 (s, 1H), 7.51 (s, 1H), 7.24‑7.20 (m, 1H), 4.39‑4.34(m, 1H), 4.15‑4.12 (m, 1H), 3.72 (s, 3H), 3.71‑3.68 (m,1H), 2.72 (s, 1H), 2.40 (d, J = 7.2 Hz, 6H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 71b 1H NMR (400 MHz, CDCl3) δ 8.02 (dd, J = 5.2, 2.4 Hz, 1H), 7.75‑7.71 (m, 1H), 7.60 (s, 1H), 7.51 (s, 1H), 7.24‑7.20 (m, 1H), 4.36 (d, J = 12.4 Hz, 1H), 4.16 (d, J = 12.8 Hz, 1H), 3.72 (s, 3H), 3.37‑3.68(m,1H),2.74 (s, 1H), 2.40 (d, J = 7.2 Hz, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxymethyl)‑1- methyl-allyl]amino]acetyl]pyr- role‑2-carboxamide 72a 1H NMR (300 MHz, DMSO-d6) δ 10.51 (s, 1H), 8.25‑8.19 (m, 1H), 8.15 (s, 1H), 7.98 (dddd, J = 9.2, 4.8, 2.7, 1.5 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 6.02 (dd, J = 17.6, 10.8 Hz, 1H), 5.22‑5.06 (m, 2H), 4.95 (t, J = 5.8 Hz, 1H), 3.60 (s, 3H), 3.57‑3.43 (m, 2H), 2.42 (s, 3H), 2.27 (s, 3H), 1.39 (s, 3H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxymethyl)‑1- methyl-allyl]amino]acetyl]pyr- role‑2-carboxamide 72b 1H NMR (300 MHz, DMSO-d6) δ 10.51 (s, 1H), 8.25‑8.11 (m, 2H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 6.02 (dd, J = 17.6, 10.8 Hz, 1H), 5.23‑5.05 (m, 2H), 4.95 (t, J = 5.9 Hz, 1H), 3.65‑3.41 (m, 5H), 2.42 (s, 3H), 2.27 (s, 3H), 1.39 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)allyl] amino acetyl]pyrrole‑2-carbox- amide 74a 1H NMR (300 MHz, CDCl3) δ 8.04 (dd, J = 5.4, 2.7 Hz, 1H), 7.79‑7.73 (m, 1H), 7.67 (s, 1H), 7.35 (s, 1H), 7.25 (dd, J = 12.0, 3.6 Hz, 1H), 6.03 (dd, J = 17.4, 10.8 Hz, 1H), 5.62 C 5.55 (m, 2H), 4.47 (s, 1H), 4.23 (d, J = 12.6 Hz, 1H), 3.96 (d, J = 13.2 Hz, 1H), 3.75 (s, 3H), 2.43 (d, J = 6.6 Hz, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)allyl] amino acetyl]pyrrole‑2-carbox- amide 74b 1H NMR (400 MHz, CDCl3) δ 8.02 (dd, J = 5.2, 2.8 Hz, 1H), 7.76‑7.72 (m, 1H), 7.65 (s, 1H), 7.33 (s, 1H), 7.23 (dd, J = 15.6, 7.2 Hz, 1H), 6.00 (dd, J = 17.6, 10.8 Hz, 1H), 5.59 C 5.53 (m, 2H), 4.46 (t, J = 7.6 Hz, 1H), 4.21 (dd, J = 12.8, 8.4 Hz, 1H), 3.94 (dd, J = 12.8, 6.4 Hz, 1H), 3.73 (s, 3H), 2.41 (d, J = 8.8 Hz, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 75a 1H NMR (400 MHz, CDCl3) δ 7.88 (dd, J = 6.0, 2.4 Hz, 1H), 7.76‑7.72 (m, 1H), 7.51 (d, J = 6.4 Hz, 2H), 7.24 (t, J = 9.2 Hz, 1H), 4.38 (d, J = 12.4 Hz, 1H), 4.15 (d, J = 11.6Hz, 1H), 3.73 (s, 3H), 2.71 (s, 1H), 2.41 (d, J = 3.6 Hz, 6H) 58 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)prop‑2- ynyl]amino]acetyl]pyrrole‑2- carboxamide 75b 1H NMR (400 MHz, CDCl3) δ 7.88 (dd, J = 6.4, 2.8 Hz, 1H), 7.76‑7.72 (m, 1H), 7.50 (d, J = 5.2 Hz, 2H), 7.21 (t, J = 9.6 Hz, 1H), 4.37 (d, J = 12.4 Hz, 1H), 4.15 (d, J = 12.4 Hz, 1H), 3.73 (s, 3H), 2.71 (s, 1H), 2.40 (d, J = 4.8 Hz, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3‑(3-hydroxyprop‑1- ynyl)oxetan‑3-yl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 76 1H NMR (400 MHz, DMSO-d6) δ 10.55 (s, 1H), 9.74 (s, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 5.26 (t, J = 5.9 Hz, 1H), 4.74 (s, 4H), 4.14 (d, J = 5.9 Hz, 2H), 3.61 (s, 3H), 2.43 (s, 3H), 2.28 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-methyl‑1‑(tri- fluoromethyl)prop‑2-ynyl]ami- no]acetyl]pyrrole‑2-carboxa- mide 79a 1H NMR (300 MHz, Methanol-d4) δ 8.16 (dd, J = 5.6, 2.7 Hz, 1H), 7.94 (ddd, J = 9.2, 4.8, 2.8 Hz, 1H), 7.39 (t, J = 9.0 Hz, 1H), 3.69 (s, 3H), 3.24 (s, 1H), 2.51 (s, 3H), 2.39 (s, 3H), 1.90 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-methyl‑1‑(tri- fluoromethyl)prop‑2-ynyl]ami- no]acetyl]pyrrole‑2-carboxa- mide 79b 1H NMR (300 MHz, Methanol-d4) δ 8.16 (dd, J = 5.7, 2.7 Hz, 1H), 7.94 (ddd, J = 9.2, 4.7, 2.7 Hz, 1H), 7.39 (t, J = 9.0 Hz, 1H), 3.69 (s, 3H), 3.24 (s, 1H), 2.51 (s, 3H), 2.39 (s, 3H), 1.90 (s, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1R)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)allyl] aminoacetyl]pyrrole‑2-carboxa- mide 80a 1H NMR (400 MHz, CDCl3) δ 7.88 (dd, J = 6.0, 2.4 Hz, 1H), 7.76‑7.72 (m, 1H), 7.34 (s, 1H), 7.22 (t, J = 9.2 Hz, 1H), 6.01 (dd, J = 17.6, 10.8 Hz, 1H), 5.60 C 5.54 (m, 2H), 4.23 (d, J = 12.8 Hz, 1H), 3.96 (d, J = 12.8 Hz, 1H), 3.74 (s, 3H), 2.43 (d, J = 3.6 Hz, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑[[(1S)‑1‑(hydroxyme- thyl)‑1‑(trifluoromethyl)allyl] amino]acetyl]pyrrole‑2-carbox- amide 80b 1H NMR (400 MHz, CDCl3) δ 7.98 (dd, J = 6.0, 2.8 Hz, 1H), 7.76‑7.73 (m, 1H), 7.51 (s, 1H), 7.34 (s, 1H), 7.22 (t, J = 9.2 Hz, 1H), 6.01 (dd, J = 17.2, 10.8 Hz, 1H), 5.60 C 5.54 (m, 2H), 4.23 (d, J = 12.8 Hz, 1H), 3.95 (d, J = 13.2 Hz, 1H), 3.73 (s, 3H), 2.42 (d, J = 4.8 Hz, 6H) 5-chloro-N‑[3‑(difluoro- methyl)‑4-fluoro-phe- nyl]‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3-dimethyl-pyrrole‑2- carboxamide 81 1H NMR (400 MHz, DMSO-d6) δ 10.59 (s, 1H), 9.69 (s, 1H), 8.20‑8.01 (m, 1H), 7.83 (s, 1H), 7.48‑7.07 (m, 2H), 3.70 (s, 3H), 3.54 (s, 1H), 3.15 (t, J = 11.9 Hz, 4H), 2.31 (s, 3H) N‑[3‑(difluoromethyl)‑4-fluoro- phenyl]‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 82 1H NMR (400 MHz, DMSO-d6) δ 10.45 (s, 1H), 9.62 (s, 1H), 8.08 (dd, J = 6.4, 2.6 Hz, 1H), 7.88‑7.79 (m, 1H), 7.41‑7.09 (m, 2H), 3.61 (s, 3H), 3.53 (s, 1H), 3.20‑3.05 (m, 4H), 2.43 (s, 3H), 2.26 (s, 3H). N‑(2-bromo‑3-fluoro‑4-pyri- dyl)‑4‑[2‑[(3-ethynyloxetan‑3- yl)amino]‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 83 1H NMR (300 MHz, DMSO-d6) δ 10.56 (s, 1H), 9.77 (s, 1H), 8.19 (d, J = 5.3 Hz, 1H), 8.05 (t, J = 5.4 Hz, 1H), 4.73 (q, J = 6.6 Hz, 4H), 3.66 (s, 1H) , 3.63 (s, 3H), 2.42 (s, 3H), 2.30 (s, 3H) 59 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(2-bromo‑3-fluoro‑4-pyri- dyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 84 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.62 (s, 1H), 8.19 (d, J = 5.3 Hz, 1H), 8.05 (t, J = 5.4 Hz, 1H), 3.63 (s, 3H), 3.52 (s, 1H), 3.12 (t, J = 12.2 Hz, 4H), 2.42 (s, 3H), 2.30 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-thiazol‑2-yl-ethyl)ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 85 1H NMR (400 MHz, DMSO-d6) δ 10.53 (s, 1H), 9.21 (s, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, 1H), 7.69 (d, J = 3.3 Hz, 1H), 7.62 (d, J = 3.3 Hz, 1H), 7.55 (t, J = 9.2 Hz, 1H), 3.59 (s, 3H), 2.40 (s, 3H), 2.24 (s, 3H), 1.74 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 91 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 8.98 (s, 1H), 8.51 (d, J=4.0 Hz, 1H), 8.20 (dd, J=2.7, 5.8 Hz, 1H), 7.97 (ddd, J=2.6, 4.9, 9.2 Hz, 1H), 7.78 (dt, J=1.8, 7.8 Hz, 1H), 7.57‑7.48 (m, 2H), 7.25 (dd, J=5.3, 7.0 Hz, 1H), 3.58 (s, 3H), 2.39 (s, 3H), 2.25 (s, 3H), 1.71‑1.59 (m, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(3-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 92 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 9.00 (s, 1H), 8.66 (d, J=2.3 Hz, 1H), 8.42 (dd, J=1.4, 4.7 Hz, 1H), 8.19 (dd, J=2.6, 5.8 Hz, 1H), 7.96 (ddd, J=2.8, 4.8, 9.2 Hz, 1H), 7.86‑7.71 (m, 1H), 7.53 (t, J=9.1 Hz, 1H), 7.35 (dd, J=4.8, 8.0 Hz, 1H), 3.58 (s, 3H), 2.37 (s, 3H), 2.22 (s, 3H), 1.67 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(4-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 93 1H NMR (400MHz, DMSO-d6) δ 10.50 (s, 1H), 9.03 (s, 1H), 8.58‑8.42 (m, 2H), 8.20 (dd, J=2.6, 5.8 Hz, 1H), 8.02‑7.89 (m, 1H), 7.53 (t, J=9.1 Hz, 1H), 7.44‑7.30 (m, 2H), 3.58 (s, 3H), 2.39 (s, 2H), 2.24 (s, 3H), 1.63 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑[(3R)‑3-hydroxybut‑1- ynyl]oxetan‑3-yl]amino]acetyl] pyrrole‑2-carboxamide 94a 1H NMR (400 MHz, Methanol-d4) δ 8.14 (t, J = 2.8 Hz, 1H), 7.93‑7.89 (m, 1H), 7.36 (t, J=8.8 Hz, 1H),4.85‑4.84 (m, 4H), 4.54 (q, J= 6.8 Hz, 1H),3.88 (s, 3H),2.48 (s, 3H), 2.37(s, 3H), 1.40 (d, J=6.8 Hz, 3H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑[(3S)‑3-hydroxybut‑1- ynyl]oxetan‑3-yl]amino]acetyl] pyrrole‑2-carboxamide 94b 1H NMR (400 MHz, Methanol-d4) δ 8.14 (t, J = 2.8 Hz, 1H), 7.93‑7.89 (m, 1H), 7.36 (t, J=8.8 Hz, 1H),4.85‑4.84 (m, 4H), 4.54 (q, J= 6.8 Hz, 1H),3.88 (s, 3H),2.48 (s, 3H), 2.37(s, 3H), 1.40 (d, J=6.8 Hz, 3H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-methyl‑1‑(tri- fluoromethyl)allyl]amino acetyl] pyrrole‑2-carboxamide 95a 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.03 (s, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 6.32 (dd, J = 17.5, 10.9 Hz, 1H), 5.80 C 5.28 (m, 2H), 3.61 (s, 3H), 2.43 (s, 3H), 2.26 (s, 3H), 1.70 (s, 3H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-methyl‑1‑(tri- fluoromethyl)allyl]amino acetyl] pyrrole‑2-carboxamide 95b 1H NMR (300 MHz, DMSO-d6) δ 10.54 (s, 1H), 9.03 (s, 1H), 8.22 (dd, J = 5.8, 2.7 Hz, 1H), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H), 7.55 (t, J = 9.1 Hz, 1H), 6.32 (dd, J = 17.5, 10.9 Hz, 1H), 5.80 C 5.28 (m, 2H), 3.61 (s, 3H), 2.43 (s, 3H), 2.26 (s, 3H), 1.70 (s, 3H). N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1H-pyrazol‑4-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 96 1H NMR (400MHz, DMSO-d6) δ 12.57 (br s, 1H), 10.48 (s, 1H), 8.49 (s, 1H), 8.20 (dd, J=2.6, 5.8 Hz, 1H), 7.96 (ddd, J=2.8, 4.9, 9.1 Hz, 1H), 7.53 (br t, J=9.1 Hz, 3H), 3.57 (s, 3H), 2.35‑2.32 (m, 2H), 2.32‑2.32 (m, 1H), 2.20 (s, 3H), 1.65 (s, 6H) 60 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1H-pyrazol‑4-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 97 1H NMR (400MHz, DMSO-d6) δ 12.57 (br s, 1H), 10.46 (s, 1H), 8.49 (s, 1H), 8.20 (dd, J=2.4, 6.4 Hz, 1H), 8.01‑7.90 (m, 1H), 7.63‑7.41 (m, 3H), 3.57 (s, 3H), 2.34 (s, 3H), 2.21 (s, 3H), 1.66 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1-methylpyrazol‑4-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 98 1H NMR (400MHz, DMSO-d6) δ 10.47 (s, 1H), 8.51 (s, 1H), 8.20 (dd, J=2.6, 6.6 Hz, 1H), 7.98‑7.92 (m, 1H), 7.60 (s, 1H), 7.51 (t, J=9.8 Hz, 1H), 7.38 (d, J=0.6 Hz, 1H), 3.78 (s, 3H), 3.57 (s, 3H), 2.36‑2.33 (m, 3H), 2.21 (s, 3H), 1.63 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 99 1H NMR (400MHz, DMSO-d6) δ 10.48 (s, 1H), 8.98 (s, 1H), 8.51 (d, J=3.9 Hz, 1H), 8.21 (br d, J=3.9 Hz, 1H), 7.99‑7.92 (m, 1H), 7.79 (br d, J=1.6 Hz, 1H), 7.52 (d, J=8.4 Hz, 2H), 7.25 (br d, J=1.9 Hz, 1H), 3.59 (s, 3H), 2.39 (s, 3H), 2.25 (s, 3H), 1.67 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(3-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 100 1H NMR (400MHz, DMSO-d6) δ 10.48 (s, 1H), 9.01 (s, 1H), 8.66 (d, J=2.4 Hz, 1H), 8.43 (dd, J=1.4, 4.7 Hz, 1H), 8.20 (dd, J=2.6, 6.6 Hz, 1H), 7.95 (br dd, J=4.1, 7.6 Hz, 1H), 7.80 (td, J=1.9, 8.0 Hz, 1H), 7.51 (t, J=9.8 Hz, 1H), 7.35 (dd, J=4.8, 8.0 Hz, 1H), 3.58 (s, 3H), 2.38 (s, 3H), 2.23 (s, 3H), 1.68 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(4-pyridyl)ethyl]ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 101 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 9.04 (s, 1H), 8.57‑8.45 (m, 2H), 8.21 (dd, J=2.5, 6.6 Hz, 1H), 7.96 (td, J=3.7, 8.5 Hz, 1H), 7.52 (t, J=9.8 Hz, 1H), 7.45‑7.34 (m, 2H), 3.59 (s, 3H), 2.40 (s, 3H), 2.25 (s, 3H), 1.64 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3‑[2‑(1-hydroxycy- clopropyl)ethynyl]oxetan‑3-yl] amino]‑2-oxo-acetyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 102 1H NMR (300 MHz, Methanol-d4) δ 8.16 (dd, J = 5.6, 2.7 Hz, 1H), 7.94 (ddd, J = 9.2, 4.7, 2.7 Hz, 1H), 7.39 (t, J = 9.0 Hz, 1H), 4.86 (s, 4H), 3.69 (s, 3H), 2.51 (s, 3H), 2.39 (s, 3H), 1.01 (t, J = 2.8 Hz, 2H), 0.97 (t, J = 2.8 Hz, 2H). N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-thiazol‑2-yl-ethyl)ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 103 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 9.17 (s, 1H), 8.21 (dd, J=2.2, 6.4 Hz, 1H), 8.02‑7.89 (m, 1H), 7.68 (d, J=3.3 Hz, 1H), 7.61 (d, J=3.3 Hz, 1H), 7.51 (t, J=9.8 Hz, 1H), 3.59 (s, 3H), 2.39 (s, 3H), 2.24 (s, 3H), 1.74 (s, 6H) [[2‑[5‑[(3-cyano‑4-fluoro-phe- nyl)carbamoyl]‑1,2,4-trimethyl- pyrrol‑3-yl]‑2-oxo-acetyl]‑(3- ethynyloxetan‑3-yl)amino] methyl‑(2S)‑2-amino‑3-methyl- butanoate 105 1H NMR (400 MHz, DMSO-d6) δ 10.60 (s, 1H), 8.19 (dd, J = 5.7, 2.6 Hz, 1H), 7.99 C 7.91 (m, 1H), 7.54 (t, J = 9.2 Hz, 1H), 5.51 C 5.38 (m, 2H), 4.91 (dd, J = 6.9, 5.2 Hz, 2H), 4.64 (dd, J = 6.3, 2.7 Hz, 2H), 3.65 (d, J = 50.3 Hz, 4H), 3.09 (s, 1H), 2.42 (s, 3H), 2.25 (s, 3H), 1.80 (dd, J = 12.4, 6.1 Hz, 1H), 0.83 (d, J = 6.8 Hz, 3H), 0.74 (d, J = 6.8 Hz, 2H). N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(4-ethynyltetrahydro- pyran‑4-yl)amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 107 1H NMR (400MHz, DMSO-d6) δ 10.54 (s, 1H), 8.89 (s, 1H), 8.22 (dd, J=2.7, 5.8 Hz, 1H), 7.98 (ddd, J=2.8, 4.9, 9.1 Hz, 1H), 7.55 (t, J=9.1 Hz, 1H), 3.81‑3.71 (m, 2H), 3.64 (br s, 1H), 3.60 (s, 4H), 3.43 (s, 1H), 2.45 (s, 3H), 2.29 (s, 3H), 2.10 (br d, J=14.4 Hz, 2H), 1.96‑1.83 (m, 2H) 61 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[(1-ethynylcyclopen- tyl)amino]‑2-oxo-acetyl]‑1,3,5- trimethyl-pyrrole‑2-carboxa- mide 109 1H NMR (400MHz, DMSO-d6) δ 10.54 (s, 1H), 8.83 (s, 1H), 8.21 (dd, J=2.7, 5.8 Hz, 1H), 7.97 (ddd, J=2.8, 4.8, 9.2 Hz, 1H), 7.54 (t, J=9.2 Hz, 1H), 3.59 (s, 3H), 3.20 (s, 1H), 2.43 (s, 3H), 2.27 (s, 3H), 2.22‑2.12 (m, 2H), 2.06‑1.94 (m, 2H), 1.77‑1.63 (m, 4H) 4‑[2‑[[3,3-difluoro‑1‑(1-methyl- triazol‑4-yl)cyclobutyl]amino]‑2- oxo-acetyl]‑N‑[4-fluoro‑3‑(tri- fluoromethyl)phenyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 110 1H NMR (400MHz, DMSO-d6) δ 10.52 (s, 1H), 9.74 (s, 1H), 8.21 (dd, J=2.5, 6.5 Hz, 1H), 8.04‑7.86 (m, 2H), 7.53 (t, J=9.8 Hz, 1H), 4.04 (s, 3H), 3.59 (s, 3H), 3.30‑3.19 (m, 4H), 2.34 (s, 3H), 2.20 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[1‑(1H-imidazol‑2- yl)‑1-methyl-ethyl]amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 131 1H NMR (400MHz, DMSO-d6) δ 10.45 (s, 1H), 9.61 (s, 1H), 8.22 (d, J=2.4 Hz, 1H), 7.72‑7.65 (m, 1H), 7.63‑7.57 (m, 1H), 3.60 (s, 3H), 3.52 (s, 1H), 3.13 (br t, J=11.9 Hz, 4H), 2.42 (s, 3H), 2.28 - 2.22 (m, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑4‑[2‑[[1‑(1H-imidazol‑2- yl)‑1-methyl-ethyl]amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 132 1H NMR (400 MHz, CDCl3) δ 10.64 - 10.35 (m, 1H), 7.88 (dd, J=2.7, 6.1 Hz, 1H), 7.76 (td, J=3.5, 8.7 Hz, 1H), 7.61 (s, 1H), 7.22 (t, J=9.3 Hz, 1H), 6.98 (s, 2H), 3.72 (s, 3H), 2.36 (d, J=8.1 Hz, 6H), 1.89 (s, 6H) N‑(3-bromo‑4-chloro-phe- nyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 133 1H NMR (400MHz, DMSO-d6) δ 10.45 (s, 1H), 9.61 (s, 1H), 8.22 (d, J=2.4 Hz, 1H), 7.72‑7.65 (m, 1H), 7.63‑7.57 (m, 1H), 3.60 (s, 3H), 3.52 (s, 1H), 3.13 (br t, J=11.9 Hz, 4H), 2.42 (s, 3H), 2.28 - 2.22 (m, 3H) N‑(4-bromo‑3-chloro-phe- nyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 134 1H NMR (400 MHz, CDCl3) δ 7.87 (d, J=2.5 Hz, 1H), 7.58 (d, J=8.6 Hz, 1H), 7.43 (s, 1H), 7.35 - 7.29 (m, 2H), 3.72 (s, 3H), 3.22 (br t, J=11.4 Hz, 4H), 2.53 (s, 1H), 2.40 (d, J=11.9 Hz, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[1‑(1-cyclopropylpyr- azol‑4-yl)‑1-methyl-ethyl]ami- no]‑2-oxo-acetyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 135 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 8.50 (s, 1H), 8.20 (dd, J=2.8, 5.8 Hz, 1H), 7.97 (ddd, J=2.7, 4.9, 9.2 Hz, 1H), 7.69 (s, 1H), 7.54 (t, J=9.1 Hz, 1H), 7.38 (s, 1H), 3.69‑3.62 (m, 1H), 3.57 (s, 3H), 2.33 (s, 3H), 2.19 (s, 3H), 1.63 (s, 6H), 1.01‑0.95 (m, 2H), 0.95‑0.88 (m, 2H) 4‑[2‑[[1‑(1-cyclopropylpyra- zol‑4-yl)‑1-methyl-ethyl]ami- no]‑2-oxo-acetyl]‑N‑[4-fluor- o‑3‑(trifluoromethyl)phe- nyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 136 1H NMR (400MHz, DMSO-d6) δ 10.47 (s, 1H), 8.49 (s, 1H), 8.20 (dd, J=2.5, 6.5 Hz, 1H), 7.99‑7.93 (m, 1H), 7.69 (s, 1H), 7.51 (t, J=9.8 Hz, 1H), 7.38 (s, 1H), 3.68‑3.61 (m, 1H), 3.57 (s, 3H), 3.44‑3.20 (m, 58H), 2.34 (s, 3H), 2.19 (s, 3H), 1.63 (s, 6H), 1.00‑0.95 (m, 2H), 0.94‑0.88 (m, 2H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-methylpyrazol‑3-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 137 1H NMR (400 MHz, CDCl3) δ 8.04 (dd, J=2.6, 5.4 Hz, 1H), 7.85 (s, 1H), 7.71 (ddd, J=2.9, 4.3, 9.0 Hz, 1H), 7.38 (d, J=1.6 Hz, 1H), 7.20 (t, J=8.7 Hz, 1H), 7.14‑7.14 (m, 1H), 7.12 (s, 1H), 6.22 (d, J=1.8 Hz, 1H), 3.91 (s, 3H), 3.69 (s, 3H), 2.39 (s, 3H), 2.30 (s, 3H), 1.82 (s, 6H), 1.59 (s, 10H) 62 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-methylpyrazol‑3-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 138 1H NMR (400 MHz, CDCl3) δ 7.88 (dd, J=2.6, 6.0 Hz, 1H), 7.78 - 7.67 (m, 1H), 7.62 (s, 1H), 7.38 (d, J=1.9 Hz, 1H), 7.20 (t, J=9.4 Hz, 1H), 7.12 (s, 1H), 6.23 (d, J=1.9 Hz, 1H), 3.94 (s, 3H), 3.70 (s, 3H), 2.40‑2.29 (m, 6H), 1.83 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1,3,4-oxadiazol‑2-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 139 1H NMR (400 MHz, CDCl3) δ 8.37 (s, 1H), 8.05 (dd, J=2.8, 5.5 Hz, 1H), 7.76‑7.70 (m, 2H), 7.40 (s, 1H), 7.21 (t, J=8.7 Hz, 1H), 3.70 (s, 3H), 2.38 (s, 3H), 2.33 (s, 3H), 1.88 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-thiazol‑4-yl-ethyl)ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 140 1H NMR (400 MHz, CDCl3) δ 10.50 (s, 1H), 9.01 (d, J=1.9 Hz, 1H), 8.79 (s, 1H), 8.20 (dd, J=2.7, 5.8 Hz, 1H), 7.96 (ddd, J=2.8, 4.9, 9.2 Hz, 1H), 7.54 (t, J=9.1 Hz, 1H), 7.47 (d, J=1.9 Hz, 1H), 3.57 (s, 3H), 2.34 (s, 3H), 2.20 (s, 3H), 2.07 (s, 1H), 1.71 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-thiazol‑4-yl-ethyl)ami- no]‑2-oxo-acetyl]pyrrole‑2-car- boxamide 141 1H NMR (400MHz, DMSO-d6) δ 10.48 (s, 1H), 9.01 (d, J=1.9 Hz, 1H), 8.79 (s, 1H), 8.21 (dd, J=2.5, 6.5 Hz, 1H), 7.95 (td, J=3.6, 8.8 Hz, 1H), 7.57‑7.42 (m, 2H), 3.57 (s, 3H), 2.36‑2.33 (m, 3H), 2.21 (s, 3H), 1.71 (s, 6H) 4‑[2‑[[1‑(2-cyclopropyltriazol‑4- yl)‑3,3-difluoro-cyclobutyl]ami- no]‑2-oxo-acetyl]‑N‑[4-fluor- o‑3‑(trifluoromethyl)phe- nyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 142 1H NMR (400 MHz, CDCl3) δ 7.88 (dd, J=2.6, 6.0 Hz, 1H), 7.77‑7.69 (m, 1H), 7.63‑7.54 (m, 2H), 7.49 (s, 1H), 7.22 (t, J=9.3 Hz, 1H), 3.97 (tt, J=3.8, 7.5 Hz, 1H), 3.72 (s, 3H), 3.44‑3.23 (m, 4H), 2.38 (d, J=8.9 Hz, 6H), 1.38‑1.29 (m, 2H), 1.16‑1.06 (m, 2H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1,3,4-oxadiazol‑2-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 143 1H NMR (400 MHz, CDCl3) δ 8.29 (s, 1H), 7.82 (dd, J=2.6, 6.1 Hz, 1H), 7.66 (td, J=3.5, 8.9 Hz, 1H), 7.50 (s, 1H), 7.32 (s, 1H), 7.13 (t, J=9.3 Hz, 1H), 3.63 (s, 3H), 2.29 (d, J=13.4 Hz, 6H), 1.81 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-pyrimidin‑5-yl-ethyl) amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 144 1H NMR (400MHz, DMSO-d6) δ 10.53 (s, 1H), 9.17 (s, 1H), 9.08 (s, 1H), 8.85 (s, 2H), 8.21 (dd, J=2.8, 5.7 Hz, 1H), 7.97 (br dd, J=3.4, 8.8 Hz, 1H), 7.55 (t, J=9.1 Hz, 1H), 3.59 (s, 3H), 2.38 (s, 3H), 2.22 (s, 3H), 1.71 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[1‑(5-fluoro‑2-pyri- dyl)‑1-methyl-ethyl]amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 145 1H NMR (400MHz, DMSO-d6) δ 10.51 (br s, 1H), 9.01 (s, 1H), 8.49 (d, J=2.9 Hz, 1H), 8.21 (dd, J=2.6, 5.8 Hz, 1H), 7.97 (ddd, J=2.7, 4.9, 9.1 Hz, 1H), 7.72 (dt, J=3.0, 8.8 Hz, 1H), 7.61‑7.48 (m, 2H), 3.59 (s, 3H), 2.38 (s, 3H), 2.24 (s, 3H), 1.66 (s, 6H) 4‑[2‑[[1‑(1-cyclopropyltriazol‑4- yl)‑3,3-difluoro-cyclobutyl]ami- no]‑2-oxo-acetyl]‑N‑[4-fluor- o‑3‑(trifluoromethyl)phe- nyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 146 1H NMR (400 MHz, CDCl3) δ 7.90 (dd, J=2.5, 5.9 Hz, 1H), 7.80 (br dd, J=3.6, 9.0 Hz, 1H), 7.73‑7.62 (m, 3H), 7.22 (t, J=9.4 Hz, 1H), 3.80 - 3.67 (m, 4H), 3.44‑3.21 (m, 4H), 2.36 (d, J=15.4 Hz, 6H), 1.31‑1.12 (m, 4H) 63 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR 4‑[2‑[[1‑(5-fluoro‑2-pyridyl)‑1- methyl-ethyl]amino]‑2-oxo- acetyl]‑N‑[4-fluoro‑3‑(trifluoro- methyl)phenyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide 147 1H NMR (400MHz, DMSO-d6) δ 10.49 (s, 1H), 9.01 (s, 1H), 8.49 (d, J=2.9 Hz, 1H), 8.21 (dd, J=2.3, 6.4 Hz, 1H), 8.02‑7.88 (m, 1H), 7.72 (dt, J=3.0, 8.8 Hz, 1H), 7.61‑7.45 (m, 2H), 3.58 (s, 3H), 2.38 (s, 3H), 2.24 (s, 3H), 2.07 (s, 1H), 1.65 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-pyrimidin‑5-yl-ethyl) amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 148 1H NMR (400MHz, DMSO-d6) δ 10.50 (s, 1H), 9.16 (s, 1H), 9.07 (s, 1H), 8.85 (s, 2H), 8.21 (dd, J=2.4, 6.5 Hz, 1H), 8.02‑7.89 (m, 1H), 7.52 (t, J=9.8 Hz, 1H), 3.58 (s, 3H), 2.38 (s, 3H), 2.21 (s, 3H), 1.70 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1-methylimidazol‑4- yl)ethyl]amino]‑2-oxo-acetyl] pyrrole‑2-carboxamide 149 1H NMR (400MHz, DMSO-d6) δ 10.64‑10.26 (m, 1H), 8.74 (s, 1H), 8.21 (br d, J=3.8 Hz, 1H), 7.95 (br d, J=3.4 Hz, 1H), 7.50 (br t, J=9.6 Hz, 1H), 7.30‑6.82 (m, 1H), 3.88 (br s, 2H), 3.57‑3.46 (m, 3H), 2.35‑2.27 (m, 3H), 1.82‑1.71 (m, 2H), 1.29‑1.13 (m, 5H) 4‑[2‑[[3,3-difluoro‑1‑(4-pyridyl) cyclobutyl]amino]‑2-oxo-acet- yl]‑N‑[4-fluoro‑3‑(trifluoro- methyl)phenyl]‑1,3,5-trimethyl- pyrrole‑2-carboxamide 150 1H NMR (400 MHz, CDCl3) δ 8.69‑8.62 (m, 2H), 7.87 (dd, J=2.6, 6.1 Hz, 1H), 7.75‑7.68 (m, 1H), 7.53 (s, 1H), 7.42 (s, 1H), 7.40‑7.36 (m, 2H), 7.22 (t, J=9.4 Hz, 1H), 3.71 (s, 3H), 3.28 (dd, J=10.3, 12.8 Hz, 4H), 2.34 (d, J=12.6 Hz, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑(1H-pyrazol‑4-yl)oxe- tan‑3-yl]amino]acetyl]pyrrole‑2- carboxamide 151 1H NMR (400MHz, DMSO-d6) δ 12.79 (br s, 1H), 10.54 (s, 1H), 9.67 (s, 1H), 8.21 (dd, J=2.6, 5.8 Hz, 1H), 7.96 (dt, J=2.7, 4.5 Hz, 1H), 7.67 (br s, 2H), 7.54 (t, J=9.1 Hz, 1H), 4.90 (d, J=6.5 Hz, 2H), 4.75 (d, J=6.5 Hz, 2H), 3.59 (s, 3H), 2.37 (s, 3H), 2.22 (s, 3H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-pyrimidin‑4-yl-ethyl) amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 152 1H NMR (400MHz, DMSO-d6) δ 10.53 (s, 1H), 9.23‑9.08 (m, 2H), 8.77 (d, J=5.4 Hz, 1H), 8.21 (dd, J=2.6, 5.8 Hz, 1H), 7.96 (ddd, J=2.7, 4.9, 9.1 Hz, 1H), 7.63‑7.48 (m, 2H), 3.59 (s, 3H), 2.40 (s, 3H), 2.24 (s, 3H), 1.63 (s, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[(1- methyl‑1-pyrimidin‑4-yl-ethyl) amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 153 1H NMR (400 MHz, CDCl3) δ 9.19 (d, J=0.9 Hz, 1H), 8.74 (d, J=5.5 Hz, 1H), 8.22 (s, 1H), 7.87 (dd, J=2.6, 6.1 Hz, 1H), 7.72 (td, J=3.5, 8.6 Hz, 1H), 7.50 (s, 1H), 7.44 (dd, J=1.2, 5.4 Hz, 1H), 7.20 (t, J=9.3 Hz, 1H), 3.70 (s, 3H), 2.38 (d, J=5.9 Hz, 6H), 1.81 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3‑(1H-imidazol‑2-yl) oxetan‑3-yl]amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 154 1H NMR (400 MHz, CDCl3) δ 8.09‑7.96 (m, 2H), 7.81‑7.68 (m, 1H), 7.54 (d, J=12.4 Hz, 1H), 7.23 (d, J=8.9 Hz, 1H), 7.06 (s, 2H), 5.28 (d, J=6.8 Hz, 2H), 5.06 (d, J=6.9 Hz, 2H), 3.74 (s, 3H), 2.40 (d, J=9.6 Hz, 6H), 1.26 (s, 1H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑4‑[2‑[[3‑(1H-imidazol‑2- yl)oxetan‑3-yl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 155 1H NMR (400 MHz, CDCl3) δ 7.99 (s, 1H), 7.88 (dd, J=2.3, 6.1 Hz, 1H), 7.76 (br d, J=8.5 Hz, 1H), 7.55‑7.41 (m, 1H), 7.25‑7.17 (m, 2H), 7.06 (s, 2H), 5.29 (d, J=6.8 Hz, 2H), 5.05 (d, J=6.6 Hz, 2H), 3.74 (s, 3H), 2.40 (d, J=5.1 Hz, 6H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑4‑[2‑[[3‑(1H-imidazol‑4- yl)oxetan‑3-yl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 156 1H NMR (400MHz, Methanol-d4) δ 8.09 (dd, J=2.6, 6.3 Hz, 1H), 7.93‑7.84 (m, 1H), 7.73 (s, 1H), 7.33 (t, J=9.6 Hz, 1H), 7.17 (s, 1H), 5.11 - 5.00 (m, 4H), 3.65 (s, 3H), 2.41 (s, 3H), 2.34‑2.21 (m, 3H) 64 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Compound Name Compound No. 1H NMR N‑(3-cyano‑4-fluoro-phe- nyl)‑4‑[2‑[[3‑(1H-imidazol‑4-yl) oxetan‑3-yl]amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 157 1H NMR (300 MHz, Methanol-d4) δ 8.09 (dd, J=2.6, 6.3 Hz, 1H), 7.93‑7.84 (m, 1H), 7.73 (s, 1H), 7.33 (t, J=9.6 Hz, 1H), 7.17 (s, 1H), 5.11‑5.00 (m, 4H), 3.65 (s, 3H), 2.41 (s, 3H), 2.34‑2.21 (m, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[3‑(1H-pyrazol‑4-yl)oxe- tan‑3-yl]amino]acetyl]pyrrole‑2- carboxamide 158 1H NMR (300 MHz, Methanol-d4) δ 8.40 (s, 1H), 8.13 (dd, J=2.8, 5.6 Hz, 1H), 7.92 (ddd, J=2.8, 4.7, 9.2 Hz, 1H), 7.46 (d, J=0.9 Hz, 1H), 7.37 (t, J=8.9 Hz, 1H), 5.11‑4.96 (m, 4H), 3.66 (s, 3H), 2.44 (s, 3H), 2.32 (s, 3H) N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-oxo‑1H-pyridin‑3- yl)ethyl]amino]‑2-oxo-acetyl] pyrrole‑2-carboxamide 159 1H NMR (400MHz, DMSO-d6) δ 12.79 (br s, 1H), 10.50 (s, 1H), 9.65 (s, 1H), 8.21 (dd, J=2.5, 6.5 Hz, 1H), 8.02‑7.89 (m, 1H), 7.78 (s, 1H), 7.63‑7.43 (m, 2H), 4.91 (d, J=6.5 Hz, 2H), 4.75 (d, J=6.5 Hz, 2H), 3.59 (s, 3H), 3.37‑3.28 (m, 47H), 2.37 (s, 3H), 2.23 (s, 3H) 4‑[2‑[[1‑(1H-benzimidazol‑5- yl)‑1-methyl-ethyl]amino]‑2- oxo-acetyl]‑N‑(3-cyano‑4- fluoro-phenyl)‑1,3,5-trimethyl- pyrrole‑2-carboxamide 160 1H NMR (400MHz, DMSO-d6) δ 11.55 (br d, J=1.6 Hz, 1H), 10.49 (s, 1H), 8.69 (s, 1H), 8.21 (dd, J=2.4, 6.5 Hz, 1H), 7.99‑7.91 (m, 1H), 7.52 (t, J=9.8 Hz, 1H), 7.42 (dd, J=2.0, 7.0 Hz, 1H), 7.30 (br d, J=5.0 Hz, 1H), 6.19 (t, J=6.8 Hz, 1H), 3.58 (s, 3H), 2.40 (s, 3H), 2.25 (s, 3H), 1.71 (s, 6H) N‑(3-cyano‑4-fluoro-phe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(2-oxo‑1H-pyridin‑3- yl)ethyl]amino]‑2-oxo-acetyl] pyrrole‑2-carboxamide 161 1H NMR (400MHz, DMSO-d6) δ 12.57‑12.27 (m, 1H), 10.52 (br s, 1H), 8.89 (s, 1H), 8.21 (dd, J=2.4, 5.6 Hz, 1H), 8.18 (s, 1H), 8.03‑7.90 (m, 1H), 7.67‑7.46 (m, 3H), 7.30 (br d, J=8.8 Hz, 1H), 3.61‑3.53 (m, 3H), 2.38 (s, 3H), 2.29‑2.23 (m, 3H), 1.71 (s, 6H) 4‑[2‑[[1‑(1H-benzimidazol‑5- yl)‑1-methyl-ethyl]amino]‑2- oxo-acetyl]‑N‑(4-fluoro‑3- methyl-phenyl)‑1,3,5-trimethyl- pyrrole‑2-carboxamide 162 1H NMR (400MHz, DMSO-d6) δ 11.68‑11.42 (m, 1H), 10.51 (br s, 1H), 8.70 (s, 1H), 8.21 (dd, J=2.7, 5.8 Hz, 1H), 7.97 (ddd, J=2.8, 4.8, 9.2 Hz, 1H), 7.54 (t, J=9.1 Hz, 1H), 7.42 (dd, J=2.0, 7.0 Hz, 1H), 7.30 (dd, J=1.8, 6.3 Hz, 1H), 6.19 (t, J=6.7 Hz, 1H), 3.58 (s, 3H), 2.40 (s, 3H), 2.25 (s, 3H), 1.71 (s, 6H) EXAMPLE 20 Additional Compounds

[0184] The foregoing syntheses are exemplary and can be used as a starting point to prepare a large number of additional compounds. Examples of compounds of Formula (I) that can be prepared in various ways, including those synthetic schemes shown and described herein, are provided below. Those skilled in the art will be able to recognize modifications of the disclosed syntheses and to devise routes based on the disclosures herein; all suchmodifications and alternate routes are within the scope of the claims. Structure Name Compound No. N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 1 65 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. 4‑[2‑(allylamino)‑2-oxo-acet- yl]‑N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 2 N‑(3-cyano‑4-fluorophenyl)‑1- methyl‑4‑[2-oxo‑2‑(prop‑2-yny- lamino)acetyl]pyrrole‑2-carbox- amide 3 N‑(2-bromo‑3-fluoro‑4-pyri- dyl)‑1,3,5-trimethyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 4 4‑[2‑(allylamino)‑2-oxo-acet- yl]‑N‑(2-bromo‑3-fluoro‑4-pyri- dyl)‑1,3,5-trimethyl-pyrrole‑2- carboxamide 5 N‑(3-cyano‑4-fluorophe- nyl)‑4‑[2‑[[3,3-difluoro‑1‑(1H- triazol‑4-yl)cyclobutyl]amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 19 N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1S)‑1-cyclopropyl- prop‑2-ynyl]amino]acetyl]pyr- role‑2-carboxamide 23b N‑(3-cyano‑4-fluorophe- nyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 24 66 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. N‑(3-cyano‑4-fluorophenyl)‑1,5- dimethyl‑4‑[2-oxo‑2‑(prop‑2- ynylamino)acetyl]pyrrole‑2-car- boxamide 27 N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(1R)‑1-tert-butylprop‑2- ynyl]amino]acetyl]pyrrole‑2-car- boxamide 30a 4‑[2‑[(1-ethynyl‑3-hydroxy-cy- clobutyl)amino]‑2-oxo-acet- yl]‑N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 49 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(3,3-difluoro‑1-vi- nyl-cyclobutyl)amino]‑2-oxo- acetyl]‑1,5-dimethyl-pyrrole‑2- carboxamide 51 3-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑4‑[2‑[(1-ethynyl‑3,3-di- fluoro-cyclobutyl)amino]‑2-oxo- acetyl]‑1,5-dimethyl-pyrrole‑2- carboxamide 52 N‑(3-cyano‑4-fluorophe- nyl)‑4‑[2‑[(3,3-difluoro‑1-vinyl- cyclobutyl)amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2-car- boxamide 53 N‑(3,4-difluorophenyl)‑4‑[2‑[(3- ethynyloxetan‑3-yl)amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 86 67 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. N‑(3,4-difluorophenyl)‑4‑[2‑[(1- ethynylcyclohexyl)amino]‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 87 N‑(3,4-difluorophenyl)‑4‑[2‑[(1- ethyl‑1-methyl-prop‑2-ynyl)ami- no]‑2-oxo-acetyl]‑1,3,5-tri- methyl-pyrrole‑2-carboxamide 88 4‑[2‑(1,1-diethylprop‑2-ynylami- no)‑2-oxo-acetyl]‑N‑(3,4-difluor- ophenyl)‑1,3,5-trimethyl-pyr- role‑2-carboxamide 89 N‑(3,4-difluorophenyl)‑4‑[2‑(1,1- dimethylprop‑2-ynylamino)‑2- oxo-acetyl]‑1,3,5-trimethyl-pyr- role‑2-carboxamide 90 N‑(3-cyano‑4-fluorophe- nyl)‑4‑[2‑[[1‑(1H-imidazol‑4- yl)‑1-methylethyl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 104 N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑4‑[2‑[[1‑(1H-imidazol‑4- yl)‑1-methyl-ethyl]amino]‑2-oxo- acetyl]‑1,3,5-trimethyl-pyrrole‑2- carboxamide 106 68 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. N‑(3-cyano‑4-fluorophe- nyl)‑4‑[2‑[(4-ethynyl‑1,1-dioxo- thian‑4-yl)amino]‑2-oxo-acet- yl]‑1,3,5-trimethyl-pyrrole‑2-car- boxamide 108 N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(3R)‑3-ethynyltetrahy- drofuran‑3-yl]amino]acetyl]pyr- role‑2-carboxamide 111 N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(3S)‑3-ethynyltetrahy- drofuran‑3-yl]amino]acetyl]pyr- role‑2-carboxamide 112 N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(3S)‑3-ethynyl‑1,1-di- oxo-thiolan‑3-yl]amino]acetyl] pyrrole‑2-carboxamide 113a N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2- oxo‑2‑[[(3R)‑3-ethynyl‑1,1-di- oxo-thiolan‑3-yl]amino]acetyl] pyrrole‑2-carboxamide 113b N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1H-pyrazol‑3-yl)ethyl] amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 114 N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1H-pyrazol‑3-yl)ethyl] amino]‑2-oxo-acetyl]pyrrole‑2- carboxamide 115 69 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. N‑(3-cyano‑4-fluorophe- nyl)‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1-methylpyrazol‑3-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 116 N‑[4-fluoro‑3‑(trifluoromethyl) phenyl]‑1,3,5-trimethyl‑4‑[2‑[[1- methyl‑1‑(1-methylpyrazol‑3-yl) ethyl]amino]‑2-oxo-acetyl]pyr- role‑2-carboxamide 117 1-allyl-N‑(3-cyano‑4-fluoro-phe- nyl)‑3-methyl‑4‑[2-ox- o‑2‑(prop‑2-ynylamino)acetyl] pyrrole‑2-carboxamide 118 2-chloro-N‑(3-cyano‑4-fluoro- phenyl)‑1‑[2-oxo‑2‑(prop‑2-yny- lamino)acetyl]‑6,7-dihydro‑5H- pyrrolizine‑3-carboxamide 119 N‑(3-cyano‑4-fluorophenyl)‑2- methyl‑1‑[2-oxo‑2‑(prop‑2-yny- lamino)acetyl]‑6,7-dihydro‑5H- pyrrolizine‑3-carboxamide 120 1‑[2‑(allylamino)‑2-oxo-acet- yl]‑N‑(3-cyano‑4-fluoro-phe- nyl)‑2-methyl‑6,7-dihydro‑5H- pyrrolizine‑3-carboxamide 121 70 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Structure Name Compound No. N‑(3-cyano‑4-fluorophenyl)‑2- methyl‑1‑[2-oxo‑2‑[[(1S)‑2,2,2- trifluoro‑1-methyl-ethyl]aminoa- cetyl]‑6,7-dihydro‑5H-pyrroli- zine‑3-carboxamide 122 (including pharmaceutically acceptable salts of any of the foregoing). EXAMPLE A HBV-DNA Antiviral Assay using HepG2.2.15 cells

[0185] The followingassayproceduredescribes theHBVantiviral assay. This assayusesHepG2.2.15cells,which have been transfected with HBV genome, and extracellular HBV DNA quantification as endpoint. Cell viability is assessed in parallel by measuring the intracellular ATP content using the CellTiter-Glo® reagent from Promega.

[0186] On day 0, HepG2.2.15 cells were seeded in 96-well plates at a density of 6.0 x 104 cells / well (0.1 mL / well). The cells were incubated at 37°C and 5% CO2.

[0187] On day 1, the test articles were diluted and added to cell culture wells (8 concentrations, 4-fold dilution, in duplicate). GLS4, Tenofovir and Sorafenib were used as reference compounds. 100 µL of culture medium containing the compoundswas added to the plate, and the final total volume perwell was 200µL. The final concentration of DMSO in the culturemediumwas0.5%. Theplatemapof compound treatment is shownbelow. The cellswere cultured at 37 °Cand5% CO2 for 3 days.

[0188] On day 4, the plates were refreshed with culture media with compounds.

[0189] Onday7, cell viabilitywasassessedusing theCellTiter-Glo®, and the cell culture supernatantswere collected for determination of HBV DNA by qPCR. HBV DNA quantification by qPCR

[0190] Extracellular DNA was isolated with QIAamp 96 DNA Blood Kit per the manufacturer’s manual. HBV DNA was then quantified by qPCR with HBV specific primers and probes as specified in Table 1 using the FastStart Universal MasterMix fromRoche on an ABI‑7900HT. The PCR cycle program consisted of 95°C for 10min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Table 1: HBV DNA Primers and Probe Items Name Sequence (5’→3’) HBV Primer HBV-forward GTGTCTGCGGCGTTTTATCA HBV-reverse GACAAACGGGCAACATACCTT 71 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Items Name Sequence (5’→3’) HBV Probe HBV probe FAM-CCTCTKCATCCTGCTGCTATGCCTCATC‑ TAMRA

[0191] ADNAstandardwas prepared by dilution of the pAAV2HBV1.3 plasmidwith concentrations ranging from10 to 1 x 107 copies / uL and used to generate a standard curve by plotting Ct value vs. the concentration of the HBVplasmid DNA standard. The quantity of HBV DNA in each sample was determined by interpolating from the standard curve. Cell viability

[0192] Afterharvestof thesupernatants, thecell viabilitywasdetectedbyCellTiter-Glo®according to themanufacturer’s manual. In brief, 50µL of fresh cell culturemediumwas added to the culture plates, followed by addition of 50µLCellTiter- Glo into eachwell. The plateswere incubated at room temperature for 10mins. The luminescence signal was collected on a BioTek Synergy 2 plate reader. Data analysis

[0193] Cell viability was calculated as follows: % Cell viability = (luminescence value of test sample - average luminescence value of blank) / (average luminescence value of 0.5% DMSO control - average luminescence of blank) × 100%. HBV DNA inhibition was calculated as follows: 100‑(HBV DNA copy number of test sample - HBV DNA copy number of ETV) / HBV DNA copy number of 0.5% DMSO control - HBV DNA copy number of ETV) × 100%. The CC50, EC50 and EC90 values were determined by dose-response curves fitted by GraphPad Prism using "log (agonist) vs. response -‑ Variable slope ".

[0194] Compounds of Formula (I) are active against HBVas shown in Table 2, where ’A’ indicates an EC50 < 1 nM, ’B’ indicates anEC50 of≥1 nMand<10nM, ’C’ indicates anEC50 ≥ 10nMand<100 nM, ’D’ indicates anEC50 ≥ 100nMand< 1000 nM, and ’E’ indicates an EC50 > 1000 nM. Table 2 - Activity of compounds No. EC50 1 B 2 B 3 E 4 B 5 C 6 D 7 D 8 C 9 B 10 C 11 A 12 D 13 B 14 A 15 A 16 C 17a B 17b B 18 B 72 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) No. EC50 19 A 20 C 21 B 22 B 23a A 23b A 24 A 25 D 26 A 27 C 28a B 28b B 29 B 30a A 30b A 31a B 31b B 32 B 33 B 34 A 35 A 36a A 36b A 37 A 38a A 38b A 39 A 40 A 41 B 49 A 50 A 51 A 52 A 53 B 55 A 56 A 57 A 58 B 61a B 73 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) No. EC50 61b B 62 D 63a B 63b B 64a B 64b B 65a A 65b B 66a A 66b B 67 C 68 A 69a B 69b B 70 B 71a B 71b B 72a B 72b B 74a B 75b C 76a B 76b B 76 C 79a B 79b B 80a B 80b B 81 B 82 B 83 B 84 B 85 B 86 B 87 B 88 B 89 B 90 B 91 B 74 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) No. EC50 92 B 93 B 94a C 94b B 95a B 95b B 96 B 97 A 98 A 99 B 100 A 101 B 102 B 103 B 104 B 105 B 106 B 107 B 108 B 109 B 131 B 132 B 133 B 134 B 135 B 136 B 137 B 138 B 139 B 140 B 141 B 142 B 143 B 144 B 145 B 146 B 147 B 148 B 149 D 75 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) No. EC50 150 A 151 B 152 B 153 A 155 B 156 A 157 B 158 A 159 B 160 B 161 B 162 B

[0195] Although the foregoing has been described in some detail by way of illustrations and examples for purposes of clarity and understanding, it will be understood by those of skill in the art that numerous and various modifications can be made without departing from the spirit of the present disclosure. Therefore, it should be clearly understood that the forms disclosed herein are illustrative only and are not intended to limit the scope of the present disclosure, but rather to also cover all modification and alternatives coming with the true scope and spirit of the invention. ITEMS

[0196] The following items are included as embodiments of the present invention: 1. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 isanunsubstitutedor asubstitutedC2alkenyl, anunsubstitutedora substitutedC2alkynyl, anunsubstitutedor a substitutedmonocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substitutedmonocyclic heterocyclyl, whereinwhen theC2 alkenyl, theC2 alkynyl, an unsubstitutedC1‑4 haloalkyl and the monocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl are independently substituted with one or more substituents selected from the group consisting of halogen, an unsubstituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted C1‑4 hydroxyalkyl, an unsubstituted monocyclic C3‑6 cycloalkyl and a hydroxy-substituted monocyclic C3‑6 cycloalkyl; R2 and R3 are independently selected from the group consisting of hydrogen, an unsubstituted or a substituted C1‑4 alkyl, an unsubstituted C1‑4 haloalkyl, an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl, an unsubstitutedor a substitutedmonocyclic 3‑6memberedheterocyclyl, anunsubstitutedC1‑4 hydroxyalkyl andan unsubstitutedC1‑5 alkoxyalkyl, whereinwhen themonocyclic C3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl are substituted, themonocyclicC3‑6 cycloalkyl and themonocyclic 3‑6heterocyclyl are independently substituted with one or more substituents selected from the group consisting of halogen or hydroxy, and wherein when the 76 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 C1‑4 alkyl is substituted, the C1‑4 alkyl is substituted with one or more substituents selected from the group consistingofaphosphate, anO-linkedα-aminoacidandanO-carboxy,andprovided that at least oneofR2andR3 is not hydrogen; or R2 andR3 are taken together alongwith the carbon towhich R2 andR3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered hetero- cyclyl, wherein when the C3‑6 cycloalkyl and 3‑6 membered heterocyclyl are substituted, the C3‑6 cycloalkyl and the 3‑6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy; R4 and R5 are independently hydrogen, halogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; R6 is hydrogen, an unsubstituted C1‑4 alkyl, a deuterated C1‑4 alkyl or an unsubstituted C3‑4 alkenyl; and provided that at least one of R4, R5 and R6 is not hydrogen; or R5 is hydrogen, halogen, an unsubstituted C1‑4 alkyl or an unsubstituted C2‑4 alkenyl; and R4 and R6 are taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring; X1 is CRA or N; R7a, R7b, R7c and R7d are independently hydrogen, halogen, an unsubstituted C1‑4 haloalkyl, cyano or an unsubstituted C1‑4 alkoxy; R8 is hydrogen, ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsubstituted C1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2-phosphate; and RA is hydrogen, halogen, an unsubstituted C1‑4 haloalkyl or cyano. 2. The compound of Item 1, wherein R2 andR3 are independently selected from the group consisting of hydrogen, an unsubstitutedC1‑4 alkyl, an unsubstitutedC1‑4 haloalkyl, an unsubstitutedor a substitutedmonocyclicC3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstituted C1‑5 alkoxyalkyl, wherein when themonocyclic C3‑6 cycloalkyl and themonocyclic 3‑6 heterocyclyl are substituted, the monocyclic C3‑6 cycloalkyl and the monocyclic 3‑6 heterocyclyl are independently substituted with one or more substituents selected from the group consisting of halogen or hydroxy. 3. The compound of Item 2, wherein R2 and R3 are each an unsubstituted C1‑4 alkyl. 4. The compound of Item 1, wherein R2 and R3 are independently selected from the group consisting of hydrogen, a substitutedC1‑4 alkyl, anunsubstitutedC1‑4 haloalkyl, anunsubstitutedora substitutedmonocyclicC3‑6 cycloalkyl, an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, an unsubstituted C1‑4 hydroxyalkyl and an unsubstituted C1‑5 alkoxyalkyl, wherein the C1‑4 alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy. 5. The compound of any one of Items 1‑4, wherein one of R2 and R3 is hydrogen. 6. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted C1‑4 alkyl. 7. The compound of Item 5, wherein the other of R2 and R3 is a substituted C1‑4 alkyl, wherein when the C1‑4 alkyl is substituted, the C1‑4 alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy. 8. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted C1‑4 haloalkyl. 9. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted monocyclic C3‑6 cycloalkyl. 10. The compound of Item 5, wherein the other of R2 and R3 is a substituted monocyclic C3‑6 cycloalkyl. 11. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted monocyclic 3‑6 membered heterocyclyl. 12. The compound of Item 5, wherein the other of R2 and R3 is a substituted monocyclic 3‑6membered heterocyclyl. 13. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted C1‑4 hydroxyalkyl. 14. The compound of Item 5, wherein the other of R2 and R3 is an unsubstituted C1‑5 alkoxyalkyl. 15. The compound of Item 1, wherein R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3‑6 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑6 membered heterocyclyl, wherein when the C3‑6 cycloalkyl and 3‑6 membered heterocyclyl are substituted, the C3‑6 cycloalkyl and the 3‑6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy. 16. The compound of Item 15, wherein R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted monocyclic C3‑6 cycloalkyl. 17. The compound of Item 15, wherein R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form a substituted monocyclic C3‑6 cycloalkyl 18. The compound of Item 55, wherein R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted monocyclic 3‑6 membered heterocyclyl. 19. The compound of Item 15, wherein R2 and R3 are taken together along with the carbon to which R2 and R3 are 77 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 attached to form a substituted monocyclic 3‑6 membered heterocyclyl. 20. The compound of Item 18 or 19, wherein the monocyclic 3‑6 membered heterocyclyl is selected from the group consisting of an unsubstituted or substituted oxetane, an unsubstituted or substituted thietane, an unsubstituted or substituted an unsubstituted or substituted an unsubstituted or substituted an unsubstituted or substituted an unsubstituted or substituted and an unsubstituted or substituted 21. The compound of any one of Items 1‑20, wherein R4 is hydrogen. 22. The compound of any one of Items 1‑20, wherein R4 is halogen. 23. The compound of any one of Items 1‑20, wherein R4 is an unsubstituted C1‑4 alkyl. 24. The compound of any one of Items 1‑20, wherein R4 is a deuterated C1‑4 alkyl. 25. The compound of any one of Items 1‑24. wherein R5 is hydrogen. 26. The compound of any one of Items 1‑24. wherein R5 is halogen. 27. The compound of any one of Items 1‑24. wherein R5 is an unsubstituted C1‑4 alkyl. 28. The compound of any one of Items 1‑27. wherein R6 is an unsubstituted C1‑4 alkyl. 29. The compound of any one of Items 1‑27, wherein R6 is an unsubstituted C3‑4 alkenyl. 30. The compound of any one of Items 1‑20, wherein R5 is hydrogen; and R4 and R6 are taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring. 78 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 31. The compound of any one of Items 1‑20, wherein R5 is halogen; and R4 and R6 are taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring. 32. The compound of any one of Items 1‑20, wherein R5 is an unsubstituted C1‑4 alkyl; and R4 and R6 are taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring. 33. The compound of any one of Items 1‑20, wherein R5 is an unsubstituted C2‑4 alkenyl; and R4 and R6 are taken together to form an unsubstituted or substituted 5‑6 membered heterocyclic ring. 34. The compound of any one of Items 1‑33, wherein X1 is N. 35. The compound of any one of Items 1‑33, wherein X1 is CRA. 36. The compound of Item 35, wherein RA is hydrogen. 37. The compound of Item 35, wherein RA is halogen. 38. The compound of Item 35, wherein RA is an unsubstituted C1‑4 haloalkyl. 39. The compound of Item 35, wherein RA is cyano. 40. The compound of Item 35, wherein RA is an unsubstituted C1‑4 alkoxy. 41. The compound of any one of Items 1‑40, wherein R7a is hydrogen. 42. The compound of any one of Items 1‑40, wherein R7a is halogen. 43. The compound of any one of Items 1‑40, wherein R7a is an unsubstituted C1‑4 haloalkyl. 44. The compound of any one of Items 1‑40, wherein R7a is cyano. 45. The compound of any one of Items 1‑40, wherein R7a is an unsubstituted C1‑4 alkoxy. 46. The compound of any one of Items 1‑45, wherein R7b is hydrogen. 47. The compound of any one of Items 1‑45, wherein R7b is halogen. 48. The compound of any one of Items 1‑45, wherein R7b is an unsubstituted C1‑4 haloalkyl. 49. The compound of any one of Items 1‑45, wherein R7b is cyano. 50. The compound of any one of Items 1‑45, wherein R7b is an unsubstituted C1‑4 alkoxy. 51. The compound of any one of Items 1‑50, wherein R7c is hydrogen. 52. The compound of any one of Items 1‑50, wherein R7c is halogen. 53. The compound of any one of Items 1‑50, wherein R7c is an unsubstituted C1‑4 haloalkyl. 54. The compound of any one of Items 1‑50, wherein R7c is cyano. 55. The compound of any one of Items 1‑50, wherein R7c is an unsubstituted C1‑4 alkoxy. 56. The compound of any one of Items 1‑55, wherein R7d is hydrogen. 57. The compound of any one of Items 1‑55, wherein R7d is halogen. 58. The compound of any one of Items 1‑55, wherein R7d is an unsubstituted C1‑4 haloalkyl. 59. The compound of any one of Items 1‑55, wherein R7d is cyano. 60. The compound of any one of Items 1‑55, wherein R7d is an unsubstituted C1‑4 alkoxy. 61. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted C2 alkenyl. 62. The compound of any one of Items 1‑60, wherein R1 is a substituted C2 alkenyl. 63. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted C2 alkynyl. 64. The compound of any one of Items 1‑60, wherein R1 is a substituted C2 alkynyl. 65. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted C1‑4 haloalkyl. 66. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted monocyclic heteroaryl. 67. The compound of any one of Items 1‑60, wherein R1 is a substituted monocyclic heteroaryl. 68. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted bicyclic heteroaryl. 69. The compound of any one of Items 1‑60, wherein R1 is a substituted bicyclic heteroaryl. 70. The compound of any one of Items 1‑60, wherein R1 is an unsubstituted monocyclic heterocyclyl. 71. The compound of any one of Items 1‑60, wherein R1 is a substituted monocyclic heterocyclyl. 72. The compound of any one of Items 1‑71, wherein R8 is hydrogen. 73. The compound of any one of Items 1‑71, wherein R8 is ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl). 74. The compound of any one of Items 1‑71, wherein R8 is ‑CH2OC(=O)‑O(an unsubstituted C1‑4 alkyl). 75. The compound of any one of Items 1‑71, wherein R8 is ‑CH2‑(α-amino acid). 76. The compound of any one of Items 1‑71, wherein R8 is ‑CH2-phosphate. 77. The compound of Item 1, wherein the compound is selected from the group consisting of : 79 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 80 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 81 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 82 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 83 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and 84 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 or a pharmaceutically acceptable salt of any of the foregoing. 78. The compound of Item 1, wherein the compound is selected from the group consisting of : 85 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 86 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 87 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 88 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and 89 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 or a pharmaceutically acceptable salt of any of the foregoing. 79. The compound of Item 78 or 79, wherein the compound is selected from the group consisting of : 90 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 91 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 92 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 93 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and or a pharmaceutically acceptable salt of any of the foregoing. 80. A compound is selected from the group consisting of : 94 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 and 95 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 or a pharmaceutically acceptable salt of any of the foregoing. 81. A pharmaceutical composition comprising an effective amount of a compound of any one of Items 1‑80, or a pharmaceutically acceptable salt thereof, and excipient. 82. Use of the compound of any one of Items 1‑80 in the preparation of amedicament for the treatment of hepatitis B. 83. Use of the compound of any one of Items 1‑80 in the preparation of amedicament for the treatment of hepatitis D. 84. The use of any one of Items 82‑83, wherein the use further comprises the use of one or more additional agents selected from the group consisting of an interferon, a nucleoside analog, a nucleotide analog, a sequence specific oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molecule immunomodulator. 85. The use of Item 84, wherein the one or more additional agents are selected from the group consisting of recombinant interferon alpha 2b, IFN-α, PEG-IFN-α‑2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. 86. A compound of any one of Items 1‑80 for use in treating hepatitis B. 87. A compound of any one of Items 1‑80 for use in treating hepatitis D. 88. The compound of any one of Items 86‑87, wherein the compound is used in combination with one or more additional agents selected from the group consisting of an interferon, a nucleoside analog, a nucleotide analog, a sequence specific oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molecule immunomodulator. 89. The compound of Item 88, wherein the one or more additional agents are selected from the group consisting of recombinant interferon alpha 2b, IFN-α, PEG-IFN-α‑2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. 90. A method for treating hepatitis B in a subject comprising administering to the subject in need thereof an effective amount of a compound of any one of Items 1‑80 suffering from hepatitis B. 91. A method for treating hepatitis D in a subject comprising administering to the subject in need thereof an effective amount of a compound of any one of Items 1‑80 suffering from hepatitis D. 92. The method of any one of Items 90‑91, further comprising administering an additional agent selected from the group consisting of an interferon, a nucleoside analog, a nucleotide analog, a sequence specific oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molecule immunomodulator. 93. Themethod of Item 92, wherein the additional agent selected from the group consisting of recombinant interferon alpha 2b, IFN-α, PEG-IFN-α‑2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafena- mide and tenofovir disoproxil. Claims 1. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 andR3 are taken together alongwith the carbon towhich R2 andR3 are attached to form an unsubstituted or a substituted monocyclic C3‑4 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑4 membered hetero- 96 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 cyclyl, wherein when the C3‑4 cycloalkyl and 3‑4 membered heterocyclyl are substituted, the C3‑4 cycloalkyl and the 3‑4 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy; and wherein the monocyclic 3‑4 membered heterocyclyl contains 1 heteroatom selected from nitrogen, oxygen and sulfur; R4 and R5 are each an unsubstituted C1‑4 alkyl; R6 is an unsubstituted C1‑4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1‑4 haloalkyl or cyano; and R8 is ‑CH2OC(=O)‑(an unsubstituted C1‑4 alkyl), ‑CH2OC(=O)‑O(an unsubstituted C1‑4 alkyl), ‑CH2‑(α-amino acid) or ‑CH2-phosphate. 2. The compound of Claim 2, wherein R8 is ‑CH2-phosphate; or R8 is 3. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 andR3 are taken together alongwith the carbon towhich R2 andR3 are attached to form an unsubstituted or a substituted monocyclic C3‑4 cycloalkyl or an unsubstituted or a substituted monocyclic 3‑4 membered hetero- cyclyl, wherein when the C3‑4 cycloalkyl and 3‑4 membered heterocyclyl are substituted, the C3‑4 cycloalkyl and the 3‑4 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy; and wherein the monocyclic 3‑4 membered heterocyclyl contains 1 heteroatom selected from nitrogen, oxygen and sulfur; R4 and R5 are each an unsubstituted C1‑4 alkyl; R6 is an unsubstituted C1‑4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1‑4 haloalkyl or cyano; and R8 is H. 4. Thecompoundof any oneofClaims1‑3,whereinR2andR3alongwith the carbon towhichR2 andR3are attachedare taken together to form an unsubstitutedmonocyclic 3‑4membered heterocyclyl; or wherein R2 and R3 along with the carbon to which R2 and R3 are attached are taken together to form an unsubstituted monocyclic 4 membered heterocyclyl; orwhereinR2andR3alongwith the carbon towhichR2andR3areattachedare taken together to forman unsubstituted oxetane; or wherein R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form 97 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 5. The compound of any one of Claims 1‑4, wherein R4, R5 and R6 are each methyl. 6. The compound of any one of Claims 1‑5, wherein R7b is cyano; and RA is F. 7. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 is an unsubstituted C1‑4 alkyl; R3 is selected from the group consisting of a substituted C1‑4 alkyl and an unsubstituted C1‑4 hydroxyalkyl, wherein the substituted C1‑4 alkyl is substituted with one ormore substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy; R4 and R5 are each an unsubstituted C1‑4 alkyl; R6 is an unsubstituted C1‑4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1‑4 haloalkyl or cyano; and R8 is H. 8. The compound of Claim 7, wherein R2 is an unsubstituted C1‑4 alkyl; and R3 is an unsubstituted C1‑4 hydroxyalkyl; or wherein R2 is methyl; and R3 is ‑CH2OH. 9. The compound of Claim 7, wherein R2 is an unsubstitutedC1‑4 alkyl; andR3 is a substitutedC1‑4 alkyl substitutedwith one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O- carboxy; or wherein R2 ismethyl; andR3 is a substituted C1‑4 alkyl substituted with one ormore substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy. 10. The compound of any one of Claims 7‑9, wherein R4, R5 and R6 are each methyl. 11. The compound of any one of Claims 7‑10, wherein R7b is ‑CF3; and RA is F. 12. A compound having the structure 98 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 13. A compound having the structure 14. A method of preparing a compound having the structure comprising reacting with di-tert-butyl chloromethyl phosphate to provide 15. A method of preparing a compound having the structure 99 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 comprising removing the t-Bu groups of to provide 16. A method of preparing a compound having the structure comprising reacting with sodium hydroxide, sodium acetate or a combination thereof. 100 EP 4 733 305 A2 5 10 15 20 25 30 35 40 45 50 55 101 EP 4 733 305 A2 REFERENCES CITED IN THE DESCRIPTION This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard. Patent documents cited in the description • US 62828919

[0001] • US 62932686 B

[0001] • WO 2017156255 A

[0093]

[0119] • US 62757632

[0120] Non-patent literature cited in the description • T.J. LIANG. Hepatology, 2009, vol. 49 (5), S13-S21

[0009] • Biochem., 1972, vol. 11, 942-944

[0061] 说明书摘要 发明名称：吡咯化合物 本文提供了式(I)的化合物或其药学上可接受的盐、包含本文所述的 化合物（包括本文所述的化合物的药学上可接受的盐）的药物组合 物及其合成方法。本文还提供了用式(I)的化合物或其药学上可接受 的盐治疗疾病和 / 或病症的方法。 Abstract Title: PYRROLE COMPOUNDS Provided herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are methods of treating diseases and / or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof. 摘要

Claims

1. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3-4 cycloalkyl or an unsubstituted or a substituted monocyclic 3-4 membered heterocyclyl, wherein when the C3-4 cycloalkyl and 3-4 membered heterocyclyl are substituted, the C3-4 cycloalkyl and the 3-4 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy; and wherein the monocyclic 3-4 membered heterocyclyl contains 1 heteroatom selected from nitrogen, oxygen and sulfur; R4 and R5 are each an unsubstituted C1-4 alkyl; R6 is an unsubstituted C1-4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1-4 haloalkyl or cyano; and R8 is -CH2OC(=O)-(an unsubstituted C1-4 alkyl), -CH2OC(=O)-O(an unsubstituted C1-4 alkyl), -CH2-(α-amino acid) or -CH2-phosphate.

2. The compound of Claim 2, wherein R8 is -CH2-phosphate; or R8 is 3. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 and R3 are taken together along with the carbon to which R2 and R3 are attached to form an unsubstituted or a substituted monocyclic C3-4 cycloalkyl or an unsubstituted or a substituted monocyclic 3-4 membered heterocyclyl, wherein when the C3-4 cycloalkyl and 3-4 membered heterocyclyl are substituted, the C3-4 cycloalkyl and the 3-4 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consisting of halogen and hydroxy; and wherein the monocyclic 3-4 membered heterocyclyl contains 1 heteroatom selected from nitrogen, oxygen and sulfur; R4 and R5 are each an unsubstituted C1-4 alkyl; R6 is an unsubstituted C1-4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1-4 haloalkyl or cyano; and R8 is H.

4. The compound of any one of Claims 1-3, wherein R2 and R3 along with the carbon to which R2 and R3 are attached are taken together to form an unsubstituted monocyclic 3-4 membered heterocyclyl; or wherein R2 and R3 along with the carbon to which R2 and R3 are attached are taken together to form an unsubstituted monocyclic 4 membered heterocyclyl; or wherein R2 and R3 along with the carbon to which R2 and R3 are attached are taken together to form an unsubstituted oxetane; or wherein R2 and R3 can be taken together along with the carbon to which R2 and R3 are attached to form 5. The compound of any one of Claims 1-4, wherein R4, R5 and R6 are each methyl.

6. The compound of any one of Claims 1-5, wherein R7b is cyano; and RA is F.

7. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure: wherein: R1 is an unsubstituted C2 alkynyl; R2 is an unsubstituted C1-4 alkyl; R3 is selected from the group consisting of a substituted C1-4 alkyl and an unsubstituted C1-4 hydroxyalkyl, wherein the substituted C1-4 alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy; R4 and R5 are each an unsubstituted C1-4 alkyl; R6 is an unsubstituted C1-4 alkyl; X1 is CRA; RA is halogen; R7a, R7c and R7d are each hydrogen; R7b is an unsubstituted C1-4 haloalkyl or cyano; and R8 is H.

8. The compound of Claim 7, wherein R2 is an unsubstituted C1-4 alkyl; and R3 is an unsubstituted C1-4 hydroxyalkyl; or wherein R2 is methyl; and R3 is -CH2OH.

9. The compound of Claim 7, wherein R2 is an unsubstituted C1-4 alkyl; and R3 is a substituted C1-4 alkyl substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy; or wherein R2 is methyl; and R3 is a substituted C1-4 alkyl substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy.

10. The compound of any one of Claims 7-9, wherein R4, R5 and R6 are each methyl.

11. The compound of any one of Claims 7-10, wherein R7b is -CF3; and RA is F.

12. A compound having the structure 13. A compound having the structure 14. A method of preparing a compound having the structure comprising reacting with di-tert-butyl chloromethyl phosphate to provide 15. A method of preparing a compound having the structure comprising removing the t-Bu groups of to provide 16. A method of preparing a compound having the structure comprising reacting with sodium hydroxide, sodium acetate or a combination thereof.