Stem cells modified with hepatocyte growth factor, methods of making the same and methods of using the same
Patent Information
- Application Number
- HK62026126533
- Authority / Receiving Office
- HK · HK
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2026-07-23
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2043-11-30
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202380104254.5 (22) Application Date 2023.12.01 (85) PCT International Application Entering National Phase Date 2026.05.25 (86) PCT International Application Application Data PCT / CN2023 / 135752 2023.12.01 (87) PCT International Application Publication Data WO2025 / 112020 EN 2025.06.05 (71) Applicant Anhui Zhong Sheng Suyuan Biotechnology Co., Ltd. Address 230088 Anhui Province, Hefei City, High-tech Zone, Innovation Avenue 2800, Innovation Industrial Park Phase II, Building H3 (72) Inventors request that their names not be disclosed (74) Patent Agency China Patent Agency (Hong Kong) Limited 72001 Patent Attorney Ren Xiaohua Peng Chang (51) Int.Cl. C07K 14 / 475 (2006.01) C12N 5 / 0775 (2006.01) C12N 5 / 074 (2006.01) C12N 5 / 10 (2006.01) C12N 15 / 63 (2006.01) (54) Invention Title Stem Cells Modified by Hepatocyte Growth Factor, Preparation Method Thereof and Use Method Thereof (57) Abstract This paper provides genetically modified cells such as pluripotent stem cells and mesenchymal stem cells and methods for their preparation. The gene editing strategy disclosed herein achieves high expression of transgenes in genetically modified cells. Claims (2 pages), Description (22 pages), Sequence Listing (electronic publication), Figures (14 pages) CN 122270472 A 2026.06.23 CN 1 22 27 04 72 A 1. A genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette comprises an exogenous polynucleotide encoding hepatocyte growth factor (HGF). 2. The genetically modified PSC of claim 1, wherein the target locus is Rosa26. 3. The genetically modified PSC of claim 1 or 2, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC. 4. The genetically modified PSC of claim 3, wherein the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.5. The genetically modified PSC of claim 3, wherein the promoter is the EF1a promoter. 6. The genetically modified PSC of claim 4, wherein the expression cassette comprises a combination of the EF1a promoter and UCOE. 7. The genetically modified PSC of any one of claims 1-6, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. 8. The genetically modified PSC of claim 7, wherein the signal peptide is as shown in SEQ ID NO: 20. 9. A method for producing a genetically modified PSC, the method comprising: introducing a first construct and a second construct into a PSC, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the PSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC. 10. The method of claim 9, wherein the target locus is Rosa26. 11. The method of claim 9 or 10, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC. 12. The method of claim 11, wherein the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F as shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter. 13. The method of claim 11, wherein the promoter is an EF1a promoter. 14. The method of claim 12, wherein the expression cassette comprises a combination of an EF1a promoter and a UCOE. 15. The method of any one of claims 9-14, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. 16. The method of claim 15, wherein the signal peptide is as shown in SEQ ID NO: 20. 17. The method of any one of claims 9-16, further comprising continuously expanding the genetically modified PSC for multiple generations, for example, at least 4 or 9 generations. 18. A genetically modified induced mesenchymal stem cell (iMSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF). 19. The genetically modified iMSC of claim 18, wherein the target locus is Rosa26.20. The genetically modified iMSC of claim 18 or 19, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC. Claims 1 / 2 page 2 CN 122270472 A 21. The genetically modified iMSC of claim 20, wherein the expression cassette further comprises an anti-silencing panchromatin opening element (UCOE), such as 1550F shown in SEQ ID NO:1, and the UCOE is operatively linked to the promoter. 22. The genetically modified iMSC of claim 20, wherein the promoter is an EF1a promoter. 23. The genetically modified iMSC of claim 21, wherein the expression cassette comprises a combination of an EF1a promoter and a UCOE. 24. The genetically modified iMSC of any one of claims 18-23, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. 25. The genetically modified iMSC of claim 24, wherein the signal peptide is as shown in SEQ ID NO:20. 26. The genetically modified iMSC of claim 24 or 25, wherein the genetically modified iMSC secretes HGF at a level at least 16 times higher than that of wild-type iMSCs. 27. A method for producing genetically modified iMSCs, the method comprising: providing a genetically modified PSC according to any one of claims 1-8; and differentiating the genetically modified PSC into iMSCs to produce the genetically modified iMSCs. 28. The method of claim 27, further comprising continuously expanding the genetically modified iMSCs for multiple generations, for example, at least 4 or 7 generations. 29. A method for producing genetically modified iMSCs, the method comprising: introducing a first construct and a second construct into iMSCs, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the iMSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining genetically modified iMSCs. 30. The method of claim 29, wherein the target locus is Rosa26. 31. The method of claim 29 or 30, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.32. The method of claim 31, wherein the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F as shown in SEQ ID NO:1, and the UCOE is operatively linked to the promoter. 33. The method of claim 31, wherein the promoter is an EF1a promoter. 34. The method of claim 32, wherein the expression cassette comprises a combination of an EF1a promoter and a UCOE. 35. The method of any one of claims 29-34, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. 36. The method of claim 35, wherein the signal peptide is as shown in SEQ ID NO:20. 37. The method of any one of claims 29-36, further comprising continuously amplifying the genetically modified iMSC for multiple generations, for example, at least 4 or 7 generations. 38. A pharmaceutical composition comprising the genetically modified iMSC of any one of claims 18-26 and a pharmaceutically acceptable vector. 39. Use of the genetically modified iMSCs according to any one of claims 18-26 in the preparation of a medicament for the treatment or prevention of idiopathic pulmonary fibrosis (IPF). Claims 2 / 2 Page 3 CN 122270472 A Hepatocyte growth factor modified stem cells, methods for their preparation and use Technical Field
[0001] This disclosure belongs to the field of stem cell biology, specifically relating to genetically modified stem cells such as pluripotent stem cells (PSCs) and induced mesenchymal stem cells (iMSCs), methods for their production and applications.
[0002] The sequence listing is contained in this document by reference in the form of an XML file named 42343WO_SequenceList, which is 49,785 bytes in size and was created on November 17, 2023. Background Art
[0003] Mesenchymal stem cells (MSCs) are pluripotent and self-renewing stem cells. MSCs can differentiate into various cell types, including osteoblasts, chondrocytes and adipocytes. In addition, MSCs also have paracrine functions and cell adhesion through their own produced factors. Based on these functions, MSCs exert therapeutic effects on various diseases by repairing and regenerating target tissues and cells, as well as controlling immune responses, such as anti-inflammation.
[0004] Multiple studies have shown that the use of MSCs that secrete a variety of paracrine factors in therapy to treat diseases such as neurological disorders, inflammation, myocardial ischemia, diabetes, and bone and cartilage diseases has great benefits. Of particular note is the great promise of PSC-derived MSCs (iMSCs), as PSCs represent a potentially limitless source of therapeutically active cells.However, further improvements in the efficacy and / or functional stability of iMSCs are needed before iMSC-based therapies become feasible.
[0005] Overview According to this disclosure, engineered PSCs and iMSCs modified with HGF at a target locus are provided. Compared to wild-type stem cells, the engineered stem cells disclosed herein are able to highly express HGF, thereby having enhanced function. This disclosure also provides cell populations, cell lines, and / or clones of the engineered stem cells disclosed herein.
[0006] In a first aspect, this disclosure relates to a genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0007] In some embodiments of this aspect, the target locus is Rosa26.
[0008] In some embodiments of this aspect, the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0009] In some embodiments of this aspect, the expression cassette further comprises an anti-silencing ubiquitous chromatin open element (UCOE), such as 1550F as shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
[0010] In some embodiments of this aspect, the promoter is the EF1a promoter.
[0011] In some embodiments of this aspect, the expression cassette comprises a combination of the EF1a promoter and the UCOE.
[0012] In some embodiments of this aspect, the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0013] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO: 20.
[0014] In a second aspect, this disclosure relates to a method for producing genetically modified PSCs, the method comprising: introducing a first construct and a second construct into a PSC, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the PSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC.
[0015] In some embodiments of this aspect, the target locus is Rosa26.
[0016] In some embodiments of this aspect, the expression cassette includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0017] In some embodiments of this aspect, the expression cassette further includes an anti-silencing ubiquitous chromatin opening element (UCOE), such as 1550F as shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
[0018] In some embodiments of this aspect, the promoter is an EF1a promoter.
[0019] In some embodiments of this aspect, the expression cassette includes a combination of an EF1a promoter and a UCOE.
[0020] In some embodiments of this aspect, the expression cassette further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0021] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO: 20.
[0022] In some embodiments of this aspect, the method further includes continuously amplifying the genetically modified PSC for multiple generations, for example, at least 4 or 9 generations.
[0023] In a third aspect, this disclosure relates to a genetically modified induced mesenchymal stem cell (iMSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0024] In some embodiments of this aspect, the target locus is Rosa26.
[0025] In some embodiments of this aspect, the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0026] In some embodiments of this aspect, the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
[0027] In some embodiments of this aspect, the promoter is the EF1a promoter.
[0028] In some embodiments of this aspect, the expression cassette includes a combination of the EF1a promoter and UCOE.
[0029] In some embodiments of this aspect, the expression cassette further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0030] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO:20.
[0031] In some embodiments of this aspect, the genetically modified iMSC secretes HGF at a level at least 16 times higher than that of wild-type iMSCs.
[0032] In a fourth aspect, this disclosure relates to a method for producing genetically modified iMSCs, the method comprising: providing genetically modified PSCs as described in this disclosure; and differentiating the genetically modified PSCs into iMSCs to produce the genetically modified iMSCs.
[0033] In some embodiments of this aspect, the method further comprises continuously amplifying the genetically modified iMSCs for multiple generations, for example, at least 4 or 7 generations.
[0034] In a fifth aspect, this disclosure relates to a method for producing genetically modified iMSCs, the method comprising: introducing a first construct and a second construct into iMSCs, the first construct comprising a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the iMSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination to obtain genetically modified iMSCs.
[0035] In some embodiments of this aspect, the target locus is Rosa26.
[0036] In some embodiments of this aspect, the expression cassette includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0037] In some embodiments of this aspect, the expression cassette further includes an anti-silencing ubiquitous chromatin opening element (UCOE), such as 1550F as shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
[0038] In some embodiments of this aspect, the promoter is an EF1a promoter.
[0039] In some embodiments of this aspect, the expression cassette includes a combination of an EF1a promoter and a UCOE.
[0040] In some embodiments of this aspect, the expression cassette further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0041] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO: 20.
[0042] In some embodiments of this aspect, the method further includes continuously amplifying the genetically modified iMSCs for multiple generations, for example, at least 4 or 7 generations.
[0043] In a sixth aspect, this disclosure relates to a pharmaceutical composition comprising genetically modified iMSCs as disclosed herein and a pharmaceutically acceptable carrier.
[0044] In a seventh aspect, this disclosure relates to the use of the genetically modified iMSCs disclosed herein in the manufacture of a medicament for the treatment or prevention of idiopathic pulmonary fibrosis (IPF).Figure Descriptions
[0045] Figures 1A-1D A. Schematic diagram of knocking Antares2 into the AAVS1 and Rosa26 loci of iPSCs. The upper line shows the target loci, and the lower line shows the donor vector, where the expression cassette used for insertion contains the EF1a promoter, Antares2, and Neo (neomycin resistance gene, linked by P2A), with 5' and 3' homologous arms on either side. B. Plasmid map of the Cas template vector used to knock Antares2 into iPSCs. C. Plasmid map of the donor vector pKI-Antares2 used to knock Antares2 into iPSCs. D. Flow cytometry analysis of Antares2 expression in iPSCs knocked into the AAVS1 and Rosa26 loci. Wild-type iPSCs (WT-iPSCs) were used as controls.
[0046] Figures 2A-2E A. Plasmid map of the EGFP expression vector pPBml-PNE-EGFP used for random integration of iPSCs and iMSCs, which carries the EF1a promoter, which can be replaced by other promoters in the plasmid used in B. B. Plasmid map of the PBase expression vector used for random integration of iPSCs and iMSCs, which carries EGFP expression vectors driven by different promoters. C. Representative fluorescence microscopy images of EGFP expression in iMSCs and iPSCs at different days after transfection with piggy-bac vectors containing different promoters. D. Flow cytometry analysis of EGFP expression in iMSCs at different days after transfection with piggy-bac vectors containing different promoters. E. Flow cytometry analysis of EGFP expression in iPSCs at different days after transfection with piggy-bac vectors containing different promoters. In the figure, E represents the EF1a promoter; UE represents the UCOE-EF1a promoter; C represents the CMV promoter; and UC represents the UCOE-CMV promoter.
[0047] Figures 3A-3C are schematic diagrams of Antares2 being knocked into the Rosa26 locus of iPSC driven by the E and UC promoters. The upper line shows the target locus, and the lower line shows the donor vector, in which the expression frame for insertion contains the EF1a promoter or the UCOE-CMV promoter, Antares2, and Neo (neomycin resistance gene, linked by P2A), with the 5' and 3' homologous arms on either side.B. Antares2 expression levels in engineered iPSCs with E or UC promoters integrated at the Rosa26 locus (P1, P5, and P10, page 3 / 22 of the specification, CN 122270472 A). Wild-type iPSCs (WT-iPSCs) were used as controls. C. Antares2 expression levels in iMSCs derived from engineered iPSCs at different generations (P0 and P4). WT-iPSCs, UC-iPSCs (iPSC-Rosa26-UC-Antares2) and E-iPSCs (iPSC-Rosa26-E-Antares2) were used as controls.
[0048] Figures 4A-4C A. Comparison of the effects of exogenous TPA signal peptides and endogenous signal peptides on HGF protein secretion by transiently transfected iMSCs. B. Schematic diagram of EF1a promoter-HGF gene knock-in at the Rosa26 locus of iPSCs. C. Flow cytometry analysis of HGF expression in WT-iPSCs and engineered E-HGF-iPSCs.
[0049] Figures 5A-5E A. Representative cell morphology on day 1 (iPSC), day 0 (EB formation), P0, and P2 during the derivatization of iMSCs from engineered E-HGF-iPSCs. B. Flow cytometry analysis of typical MSC surface markers on engineered E-HGF-iMSCs at P2. WT-iPSCs were used as controls. C. Flow cytometry analysis of HGF expression in WT-iPSCs, WT-iMSCs, and engineered E-HGF-iMSCs. D. HGF secretion from iMSCs derived from WT-iPSCs and engineered E-HGF-iPSCs at P1 and P10. E. HGF secretion from WT-iMSCs at P2 and P4, and from engineered E-HGF-iMSCs at P2, P4, and P7.
[0050] Figures 6A-6E A. Timeline of WT-iMSC, E-HGF-iMSC, or saline injection in C57BL / 6N mice after bleomycin administration. B. Lung index analysis of mice in four different groups (n≥6). Error bars represent the standard deviation of different mice undergoing the same process. C. HYP content in the lungs of four different groups (n≥6). Error bars represent the standard deviation of different mice undergoing the same process. D. H&E staining of lung sections from four different groups (n≥6). Scale bar: 200 μm. E. Fibrosis score of mice in four different groups (n≥6) based on Masson staining analysis. Error bars represent the standard deviation of different mice undergoing the same process.
[0051] The various purposes and advantages of the reagents, compositions, and methods provided herein will become apparent only by way of embodiments described herein, in conjunction with the accompanying drawings.
[0052] It should be understood that certain aspects, patterns, embodiments, variations, and features of this disclosure are described below with varying levels of detail in order to provide a substantial understanding of the art.
[0053] The terms “first,” “second,” “third,” “fourth,” “fifth,” “sixth,” “seventh,” “eighth,” or “ninth” used in this specification do not indicate an order or sequence of features, structures (e.g., culture media or compositions) or properties described in connection with that reference, but are used solely for distinguishing purposes.
[0054] The terms “first aspect,” “second aspect,” “third aspect,” “fourth aspect,” “fifth aspect,” “sixth aspect,” “seventh aspect,” “eighth aspect,” or “ninth aspect” used in this specification all indicate that a description of a particular feature, structure, or property associated with that aspect is included in at least one or more aspects of this disclosure. Furthermore, a particular feature, structure, property, or embodiment in one aspect may be combined with a particular feature, structure, property, or embodiment in one or more other aspects in any suitable manner.
[0055] The terms “an embodiment,” “some embodiments,” “preferred embodiments,” or “certain embodiments” used in this specification all indicate that a particular feature, structure, or property described in connection with that embodiment is included in at least one or more embodiments of this disclosure. Furthermore, a particular feature, structure, or property in one embodiment may be combined with features, structures, or properties in one or more other embodiments in any suitable manner.
[0056] It should be understood that this disclosure is not limited to specific uses, methods, reagents, compounds, compositions, or biological systems, which can of course vary. It should also be understood that the terminology used in this disclosure is for describing specific embodiments only and is not intended to be limiting.
[0057] Definitions Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of skill in the art to which this disclosure pertains. The following references provide general definitions for many of the terms used in this disclosure.Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, unless otherwise stated, the following terms have the meanings assigned to them below. The terms used herein are for describing particular embodiments only and are not intended to limit the scope of this disclosure.
[0058] Unless otherwise stated, “an” or “a” means “an / one or more / multiple”.
[0059] As used herein, “about” means ±10%, or ±5%, or ±4%, or ±3%, or ±2%, or ±1%, and specified numbers.
[0060] As used herein, the term “comprising / including” is intended to mean that a composition and method comprises the listed elements, but does not exclude other elements. When “consistently made of” is used to define a composition and method, it should mean excluding other elements that are of any substantial significance to the composition or method. “Constituted of” should mean excluding other components beyond trace amounts in the claimed composition and substantial method steps. Embodiments defined by these transitional terms are all within the scope of this disclosure. Thus, methods and compositions may include additional steps and components (comprising / including), or include insignificant steps and compositions (consistently made of), or include only the method steps or compositions (consistently made of). Furthermore, in each embodiment herein, any one of the terms “comprising / including,” “consistently made of,” and “consistently made of” may be replaced by any of the other two terms.
[0061] As used herein, the term “pluripotent stem cell” (PSC) refers to a cell capable of self-renewing in an undifferentiated state and differentiating into virtually any cell type in the body. Pluripotent stem cells (PSCs) can be pluripotent and differentiate into all derivatives of the three primary germ layers (ectoderm, endoderm, and mesoderm) during development. PSCs can be derived from humans (e.g., human PSCs or hPSCs). PSCs can be induced pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs). PSCs can also include naive PSCs (NPSCs) and extended pluripotent stem cells (EPSCs).In some embodiments, the pluripotent stem cells are human induced pluripotent stem cells (hiPSCs). ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and can be readily obtained using conventional methods, such as those described in the prior art or commercially available products.
[0062] As used herein, the term “embryonic stem cell” or “ESC” refers to a naturally occurring pluripotent stem cell in the inner cell mass of the embryonic blastocyst. Embryonic stem cells are pluripotent and can differentiate into all derivatives of the three primary germ layers (ectoderm, endoderm, and mesoderm) during development. They do not participate in the formation of the extraembryonic membrane or placenta, i.e., they are not totipotent. When used in this disclosure, embryonic stem cells or ESCs are derived from commercially available human embryonic stem cell lines or from human embryonic stem cells isolated or obtained from early embryos that have developed in vitro for no more than 14 days after fertilization.
[0063] As used herein, the term “induced pluripotent stem cell” or “iPSC” refers to stem cells derived from differentiated adult, neonatal, or fetal cells that have been induced or altered, i.e., reprogrammed to differentiate into tissues of all three germ layers or the dermis (mesoderm, endoderm, and ectoderm). The generated iPSC does not refer to cells that exist naturally. Suitable methods for generating iPSCs from somatic cells or pluripotent stem cells are well known to those skilled in the art. For example, iPSCs can be reliably generated from somatic cells using conventional reprogramming techniques. For example, CN108373998B describes in detail a method for reprogramming erythrocyte progenitor cells to generate hiPSCs; this document is the property of the applicant, and its disclosure is incorporated herein by reference in its entirety.
[0064] As used herein, the term “pluripotency” or “pluripotency” refers to the developmental potential of a cell to differentiate into cells of all three germ layers (ectoderm, mesoderm, and endoderm). Pluripotency can be determined at least partially by assessing the pluripotency characteristics of a cell. Pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) unlimited self-renewal potential; (iii) expression of stem cell markers, including but not limited to SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and / or CD50; (iv) ability to differentiate into all three somatic cell lineages (ectoderm, mesoderm and endoderm); (v) teratoma formation composed of the three somatic cell lineages; and (vi) embryomorphic body formation composed of cells from the three somatic cell lineages.
[0065] As used herein, the term “pluripotent stem cell morphology” refers to the typical morphological characteristics of embryonic stem cells. Normal embryonic stem cell morphology can be characterized by: small and round size, high nucleoplasm-to-cytoplasm ratio, prominent nucleoli, and / or typical intercellular spaces.
[0066] As used herein, the term “reprogramming” refers to a method of enhancing cell potential or dedifferentiating cells to a less differentiated state. For example, compared to the same cells in an unreprogrammed state, cells with enhanced cell potential can have improved developmental plasticity (i.e., the ability to differentiate into more cell types). That is, reprogrammed cells are less differentiated than the same cells in an unreprogrammed state. “Reprogramming” can refer to the dedifferentiation of somatic cells or pluripotent stem cells into pluripotent stem cells, also known as induced pluripotent stem cells (iPSCs).
[0067] As used herein, the term “differentiation” refers to the process by which undifferentiated (“undifferentiated”) or poorly differentiated cells acquire the characteristics of specialized cells (e.g., blood cells or immune cells). In some embodiments, differentiated cells or differentiation-inducing cells are cells that occupy a more specialized (“characterized”) position in a cell lineage. For example, after treatment with appropriate differentiation factors in a cell culture medium, human pluripotent stem cells (hPSCs) can differentiate into a variety of more differentiated cell types, such as neural progenitor cells (e.g., midbrain dopaminergic progenitor cells), mesenchymal stem cells (MSCs), hematopoietic progenitor cells, lymphocytes, cardiomyocytes, immune cells, and other cell types. In some embodiments, the term “directed” is applied to the differentiation process to mean that a cell has progressed through the differentiation pathway to the point that, under normal circumstances, the cell would differentiate into a specific cell type or subpopulation of cell type and, under normal circumstances, cannot differentiate into other cell types (other than the specific cell type or subpopulation of cell type) nor revert to a less differentiated cell type. The term “differentiation” as used herein is also referred to as “directed differentiation.”
[0068] As used herein, the term “genetically modified” or “genetically modified” means that a cell has been modified to contain at least one foreign gene in its genome. In the context of this disclosure, “genetically modified” or “genetically modified” may be used interchangeably with “genetically engineered,” “genetically engineered,” “gene-edited,” or “gene-edited.”
[0069] As used herein, the term “genetically modified pluripotent stem cell” or “genetically modified PSC” refers to a pluripotent stem cell that has been modified to include at least one exogenous gene in its genome.
[0070] As used herein, the term “mesenchymal stem cell” or “MSC” refers to a stem cell capable of self-renewal and having the ability to differentiate into adipocytes, osteocytes, and chondrocytes. MSCs include primary MSCs and induced MSCs (also known as iMSCs).Examples of primary MSCs include, for example, bone marrow-derived mesenchymal stem cells (BM-MSCs), placental-derived mesenchymal stem cells (P-MSCs), umbilical cord-derived mesenchymal stem cells (UC-MSCs), adipose-derived mesenchymal stem cells (A-MSCs), peripheral blood-derived mesenchymal stem cells (PB-MSCs), and dental pulp-derived mesenchymal stem cells (DP-MSCs).
[0071] As used herein, the term “induced mesenchymal stem cell” (iMSC) refers to a mesenchymal stem cell derived from a pluripotent stem cell. iMSCs have similar morphological, structural (e.g., biomarker) and functional characteristics to primary MSCs. For example, iMSCs have the potential to develop into adipocytes, osteocytes, and chondrocytes and express typical biomarkers such as CD73, CD90, and CD105. iMSCs can be derived from PSCs of any origin. In some embodiments, iMSCs are ESC-derived MSCs. In some embodiments, iMSCs are iPSC-derived MSCs. In some embodiments, iMSCs are NPSC-derived MSCs. In some embodiments, iMSCs are EPSC-derived MSCs. In some embodiments, iPSCs are human iPSCs (hiPSCs). Various methods for preparing iMSCs from iPSCs are known in the art. For example, iMSCs can be prepared from iPSCs according to the method disclosed in CN110592007B, the entire text of which is incorporated herein by reference. Briefly, the method comprises forming embryoid bodies from human pluripotent stem cells (page 6 / 22 of the specification, CN 122270472 A); differentiating the embryoid bodies into mesodermal cells; and differentiating the mesodermal cells into mesenchymal stem cells.
[0072] As used herein, the terms “genetically modified induced mesenchymal stem cells” or “genetically modified iMSCs” refer to induced mesenchymal stem cells that have been modified to include at least one exogenous gene in their genome.
[0073] As used herein, the terms “wild-type iPSC” or “WT iPSC” refer to unmodified iPSCs.
[0074] As used herein, the terms “wild-type iMSC” or “WT iMSC” refer to unmodified iMSCs.
[0075] As used herein, the term “expression frame” refers to the complete element required to express a gene, including an operable promoter and a gene coding sequence.
[0076] As used herein, the term “coding sequence” refers to the portion of a nucleic acid sequence that directly determines the amino acid sequence of its protein product. The boundaries of a coding sequence are typically determined by a ribosome-binding site (for prokaryotic cells) immediately upstream of the mRNA 5' open reading frame and a transcription termination sequence immediately downstream of the mRNA 3' open reading frame.
[0077] As used herein, the term "target gene" or "target polynucleotide" refers to a DNA sequence that, under the control of appropriate regulatory sequences, is transcribed into RNA in vivo and, in some cases, translated into a polypeptide. Target genes or polynucleotides may include, but are not limited to, prokaryotic sequences, cDNA of eukaryotic mRNA, genomic DNA sequences of eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, a target gene may encode mRNA, shRNA, a natural polypeptide (i.e., a polypeptide found in nature) or a fragment thereof; a variant polypeptide (i.e., a mutant of a natural polypeptide with less than 100% sequence identity to the natural polypeptide) or a fragment thereof; engineered polypeptides or peptide fragments, therapeutic peptides or polypeptides, imaging markers, selection markers, etc.
[0078] As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, which may be deoxyribonucleotides, ribonucleotides, or analogues thereof. Polynucleotides can include genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides also refer to both double-stranded and single-stranded molecules.
[0079] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to a molecule of amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids in a polypeptide. As used herein, the term refers to both short chains (also commonly referred to in the art as peptides, oligopeptides, and oligomers) and longer chains (also commonly referred to in the art as polypeptides or proteins). “Polypeptide” includes, for example, especially biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins. Polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or combinations thereof. In the disclosure herein, when the term is used to refer to a sequence, it includes any sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the referred sequence.
[0080] As used herein, the term “hepatocyte growth factor” or “HGF,” also known as paracrine factor (SF), refers to a paracrine cell growth, motility, and morphogenesis factor. It is secreted by mesenchymal cells and primarily targets and acts on epithelial and endothelial cells, but also on hematopoietic progenitor cells and T cells.
[0081] As used herein, the term “signal peptide” or “signal sequence” refers to a short peptide chain, typically about 5 to 30 amino acids in length, located at the N-terminus of a protein, used to guide the transport of a synthesized protein (e.g., HGF) to the secretory pathway.
[0082] As used herein, the term “exogenous” means the introduction of the molecule or substance or the activity into a host cell. The introduction of the molecule may be, for example, the introduction of a nucleic acid encoding a host genetic material, such as integration into the host chromosome, or as non-chromosomal genetic material (e.g., a plasmid). Therefore, when the term is used to refer to the expression of a nucleic acid encoding a host, it means the introduction of the nucleic acid encoding a host in an expressible form into the cell.
[0083] As used herein, the term “endogenous” means a molecule, substance, or activity present in the host cell. Similarly, when the term is used to refer to the expression of a nucleic acid encoding a host, it means the expression of a non-exogenously introduced nucleic acid contained within the cell.
[0084] As used herein, the terms “operably linked” or “operatively linked” refer to the binding of nucleic acid sequences to a single nucleic acid fragment such that the function of one nucleic acid sequence is influenced by the function of another nucleic acid sequence. For example, when a promoter can influence the expression of a coding sequence or functional DNA (i.e., the coding sequence or functional DNA is under the transcriptional regulation of the promoter), the promoter is operatively linked to the coding sequence or functional DNA. The coding sequence can be operatively linked to the regulatory sequence in a forward or reverse manner.
[0085] “Site-directed integration” or “integration at a target locus” refers to the insertion of a foreign nucleotide of the construct into a predetermined site or integration site of cellular chromosome or mitochondrial DNA. As used herein, the term “integration” also refers to the process of inserting one or more foreign sequences or nucleotides of the construct, with or without deletion of the endogenous sequence or nucleotide at the integration site. If a deletion exists at the insertion site, “integration” may also include replacing the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.
[0086] “Random integration” refers to the insertion of a foreign nucleotide of the construct into any site or integration site of cellular chromosome or mitochondrial DNA.
[0087] “Stable transfection” refers to the introduction of foreign DNA into the genome of transfected cells.
[0088] "Transient transfection" refers to the introduction of exogenous DNA into a cell, but the exogenous DNA fails to integrate into the genome of the transfected cell. The expression time of the unintegrated transgene is shorter than the time it takes for the gene to be integrated into the genome and expressed.
[0089] As used herein, the term "overexpression" means that the expression level of an expression product (e.g., a polypeptide or protein) is higher than the expression level of the same expression product in a comparable host that was not genetically modified before the gene was modified in the host cell or under certain conditions.
[0090] As used herein, the term "co-expression" means that at least two or more polynucleotides (nucleic acid molecules, e.g., genes) are expressed together or simultaneously in a host cell, cell line, or cell culture in approximately the same or different amounts or ratios.
[0091] As used herein, the term “construction” refers to a macromolecule or molecular complex containing a polynucleotide to be delivered to a host cell (in vitro or in vivo). As used herein, “vector” refers to any nucleic acid construct capable of guiding the delivery or transfer of foreign genetic material to a target cell and replicating and / or expressing it in the target cell. The term “vector” as used herein includes the construct to be delivered. Vectors can be linear or circular molecules. Major types of vectors include, but are not limited to, plasmids, augmentative vectors, viral vectors, granules, and artificial chromosomes. Viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, Sendai virus vectors, etc.
[0092] As used herein, the terms “continuous expansion” or “continuously expanding” refer to the long-term expansion of cells, in which cells undergo multiple passages. In the context of this disclosure, “continuous expansion” may be used interchangeably with “persistent expansion.”
[0093] As used herein, the term “embryomorph” (EB) refers to a three-dimensional cluster that has been shown to mimic embryonic development because it generates numerous lineages within its three-dimensional region.
[0094] As used herein, the term "culture medium" refers to a medium capable of supporting cell survival, growth, proliferation, maintenance, and / or differentiation in an in vitro environment. A culture medium may comprise a basal medium and one or more supplements.
[0095] As used herein, the term "differentiation medium" refers to a medium capable of supporting cell differentiation in an in vitro environment.
[0096] As used herein, the term "in vitro" generally refers to an activity performed outside an organism.
[0097] As used herein, the term "in vivo" generally refers to an activity occurring inside an organism.
[0098] As used herein, the term "ex vivo" generally refers to an activity performed outside an organism, such as experiments or measurements on living tissue in an artificial environment outside an organism, preferably with minimal alteration to natural conditions. In specific embodiments, page 8 / 22 of the specification, 11 CN 122270472 A, “in vitro” processes involve removing living cells or tissues from an organism and culturing them in laboratory equipment, typically under sterile conditions, for a period typically of several hours or up to about 24 hours, but depending on the specific circumstances, also including up to 48 hours or 72 hours or longer. In some embodiments, such tissues or cells may be collected and frozen, and then thawed for in vitro processing. Tissue culture experiments or processes using living cells or tissues for more than several days are generally considered “in vitro,” but in some embodiments, the term may be used interchangeably with in vitro.
[0099] As used herein, the term “cell population” or “cell group” refers to a group of at least two cells expressing similar or different phenotypes.In a non-limiting example, the cell population may comprise at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 10,000, at least about 100,000, at least about 1 × 10⁶ cells, at least about 1 × 10⁷ cells, at least about 1 × 10⁸ cells, at least about 1 × 10⁹ cells, at least about 1 × 10¹⁰ cells, at least about 1 × 10¹¹ cells, at least about 1 × 10¹² cells, or more cells expressing similar or different phenotypes.
[0100] As used herein, the term “effective amount” refers to a dose of medicine sufficient to achieve a beneficial or intended effect after administration. The amount of the drug administered to a subject may depend on individual characteristics such as general health status, age, sex, weight, effective concentration of the cells administered (e.g., iMSCs), and tolerance to the drug. Those skilled in the art can determine an appropriate dosage based on these and other factors. An effective dose may be administered in a single or multiple-dose manner.
[0101] As used herein, the term “administration” for giving a drug to a subject includes any route of introducing or delivering the drug to the subject to exert its intended effect. Administration may be performed via any suitable route, including but not limited to intravenous, intramuscular, intraperitoneal, subcutaneous, and other suitable routes described herein. Administration includes self-administration and administration by another person.
[0102] As used herein, the terms “subject,” “individual,” or “patient” are used interchangeably to refer to an individual organism, vertebrate, or mammal, which may include humans, non-human primates, rodents, etc. (e.g., a recipient of a particular medical intervention, or a cell collector). In some embodiments, the individual, patient, or subject is a human.
[0103] As used herein, the term “treatment” refers to a clinical intervention aimed at reversing, alleviating, delaying the onset or progression of a disease, condition, and / or symptom, or one or more symptoms thereof, improving its severity, preventing or delaying its recurrence, and / or improving one or more symptoms of the disease, condition, and / or symptom described herein. Treatment, for example, in the form of iMSCs or iMSCs clusters described herein, may be given to a subject after the onset of one or more symptoms and / or after a diagnosis of the disease. Treatment may be given when symptoms are absent, for example, to prevent or delay the onset of symptoms, or to inhibit the onset or progression of the disease. For example, treatment may be given to a susceptible individual before the onset of symptoms (e.g., taking into account genetic or other susceptibility factors). Treatment may also continue after symptom relief, for example, to prevent or delay recurrence. Treatment may improve and / or alleviate one or more symptoms of a disease, condition, and / or symptom.
[0104] As used herein, the terms “prevention” and “avoidance” refer to reducing the likelihood that a subject who does not have but is at risk of developing or being susceptible to a disease, condition, or symptom will develop a disease, condition, or symptom.
[0105] Genetically Modified Cells In one aspect, this disclosure provides a genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF). Compared to WT stem cells, the resulting engineered stem cells are able to overexpress HGF, thereby having enhanced function. Furthermore, this gene-editing strategy overcomes the current barriers to the engineering of primary MSCs from peripheral blood, umbilical cord blood, or any other donor tissue, as such cells are limited in supply and difficult to engineer, and the engineering of such cells often lacks reproducibility and uniformity.
[0106] In another aspect, a genetically modified induced mesenchymal stem cell (iMSC) is provided, comprising an expression cassette integrated at a target locus in the genome of the genome described on page 9 / 22 of CN 122270472 A, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0107] Genome editing, or genome editing or gene editing, which are used interchangeably, is a genetic engineering technique that inserts, deletes, and / or replaces DNA in the genome of a target cell. Site-directed genome editing (which may be used interchangeably with “site-directed genome editing” or “site-directed gene modification”) enables the insertion, deletion, and / or replacement of DNA at predetermined sites in the genome. During site-directed editing, when an endogenous sequence is inserted, deleted, and / or replaced at a predetermined site, an endogenous gene containing the affected sequence (e.g., Rosa26) can be knocked out or knocked down. Therefore, site-directed editing can also be used to disrupt the expression of endogenous genes.
[0108] The term “site-directed integration” as used herein refers to the process of inserting one or more exogenous sequences at the insertion site with or without the deletion of an endogenous sequence. In contrast, random integration or gene editing (e.g., using transposon systems) is susceptible to positional effects and silencing, leading to unreliable and unpredictable expression. Furthermore, random integration may activate proto-oncogenes, posing safety concerns.
[0109] Loci Non-limiting examples of loci for site-directed integration of HGF in this disclosure include Rosa26, AAVS1, and housekeeping loci such as GAPDH. In some embodiments, the target locus includes Rosa26, AAVS1, and / or the housekeeping locus. In some embodiments, the target locus includes Rosa26, AAVS1, and / or GAPDH. In some embodiments, the target locus is Rosa26 and / or AAVS1. In some embodiments, the target locus is Rosa26.
[0110] ROSA26 is a gene locus in mice for constitutive, ubiquitous gene expression. It was initially isolated in gene trap mutagenesis screening of embryonic stem cells (ESCs) (e.g., see Friedrich, G; Soriano, P (1991). “Promoter traps in embryonic stem cells: a gene screening method for identifying and mutating developmental genes in mice” Genes and Development. 5(9): 1513–23). The ROSA26 locus in humans has been identified (Irion, Stefan; Luche, Hervé; Gadue, Paul; Fehling, Hans Joerg; Kennedy, Marion; Keller, Gordon (2007). “Identification and targeting of the ROSA26 locus in human embryonic stem cells”. Nature Biotechnology. 25(12): 1477–82). ROSA stands for reverse splice acceptor and is named after lentiviral gene capture vectors. More detailed information about ROSA26 can be found in the NCBI database, the full text of which is incorporated herein by reference. Target sequences for the Rosa26 locus can be selected from Chr3:9432781.. 9440914.
[0111] Adeno-associated virus integration site 1 (AAVS1) is a viral integration site encoded in humans by the AAVS1 gene located on chromosome 19 (see, for example, Ward et al., Virology. 25 Nov 2012; 433(2): 356–66. doi: 10.1016 / j.virol. 2012.08.015. Epub 13 Sep 2012; and Kotin et al., EMBO J. 12 Dec 1992; 11(13): 5071–8. doi: 10.1002 / j.1460–2075.1992.tb05614.x.). More detailed information about the AAVS1 locus is available in the NCBI database, which is incorporated herein by reference in its entirety. The target sequence of the AAVS1 locus can be selected from GenBank: AC010327.8 (7774..11429).
[0112] According to this disclosure, gene-edited loci can affect the expression level of transgenes such as HGF.This disclosure uniquely finds that, compared with integration at other loci (e.g., AAVS1), site-specific integration of the HGF gene at the Rosa 26 locus produces engineered PSCs and iMSCs with significantly higher HGF (SEQ ID NO: 21) expression levels. The Rosa 26 locus is believed to be more readily transcribed and less susceptible to epigenetic silencing in stem cells. As described herein, genetic modification of the Rosa 26 locus has no significant effect on HGF expression levels in both PSCs and ultimately differentiated cells (e.g., iMSCs).
[0113] In some embodiments, the expression cassette in the engineered PSCs and iMSCs includes a promoter operatively linked to an exogenous polynucleotide encoding HGF (see specification page 10 / 22, 13 CN 122270472 A). This promoter is part of a gene, typically located upstream of the 5' end of a structural gene, and is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. Any suitable promoter may be used for the genetically modified PSCs and iMSCs described herein. Suitable promoters include, but are not limited to, cytomegalovirus (CMV) promoters. This promoter is a strongly constitutive promoter capable of driving high-level expression of any polynucleotide sequence operatively linked to it. Another suitable example of a promoter is elongation growth factor-1α (EF-1α). However, other promoters may also be used, including but not limited to ubiquitin C (UBC) promoters, phosphoglycerate kinase (PGK) promoters, CMV early enhancer / chicken β-actin (CAG) promoters, and CpG-free promoters (CLP) promoters. Furthermore, the use of any promoter or variants derived from the above promoters is contemplated. This disclosure includes modified nucleotide sequences obtained by substituting, deleting, and / or adding one or more bases compared to the above promoter sequences, and such modifications still preserve the biological function of the promoter for efficient expression in engineered cells. In some embodiments, this disclosure includes sequences having at least 95%, at least 97%, or at least 99% sequence identity with any of the above promoter sequences and having the biological function of expression in engineered cells. In some embodiments, the promoter is selected from EF1a, PGK, CAG, CMV, CLP, and UBC. In some embodiments, the promoter is selected from the EF1a promoter, CMV promoter, or CLP promoter.
[0114] Transgenes in engineered cells are susceptible to epigenetic silencing during persistent cell expansion. Among all factors affecting epigenetic silencing, the specific promoter used is crucial. In some embodiments, the promoter is selected from the EF1a promoter. Of all the promoters tested, the EF1a promoter achieved the highest and most stable HGF expression during persistent expansion of engineered cells.Therefore, engineered stem cells can stably maintain high HGF expression during their persistent expansion (e.g., expansion to at least 2, 4, 6, 8, or 10 generations), thereby enabling the continuous large-scale production of homogeneous engineered stem cells suitable for clinical applications.
[0115] In some embodiments, transgene silencing in engineered stem cells during persistent expansion can be rescued by introducing a panchromatin open element (UCOE) upstream of the promoter. Therefore, in some embodiments, the expression cassette of this disclosure also includes a panchromatin open element (UCOE) operatively linked to the promoter. In some embodiments, the expression cassette includes a combination of the EF1a promoter and a UCOE.
[0116] In some embodiments, examples of UCOE include, but are not limited to, 1550F (SEQ ID NO: 1), 1550R (SEQ ID NO: 14), 1194F (SEQ ID NO: 15), 1194R (SEQ ID NO: 16), and SRF6-3F (SEQ ID NO: 17). In some embodiments, UCOE comprises 1550F, 1550R, and SRF6-3F. In some embodiments, UCOE comprises 1550F.
[0117] In some embodiments, the expression cassette comprises an optional marker gene. In some embodiments, the expression cassette does not comprise an optional marker gene. Available optional marker genes include, for example, antibiotic resistance genes, such as kanamycin (Kan), neomycin (Neo), tetracycline (Ter), chloramphenicol (Cam), etc.
[0118] When the expression cassette comprises an optional marker gene, it can be linked to an exogenous polynucleotide via a linker. Linkers include, but are not limited to, IRES, F2A, E2A, P2A, and T2A.
[0119] The engineered stem cells disclosed herein may also comprise one or more other gene modifications, depending on the application or purpose of the cells. In addition to HGF, the engineered stem cells disclosed herein may also express one or more other exogenous proteins or peptides. In some embodiments, other gene modifications include knocking out or knocking down additional endogenous genes. In some embodiments, other gene modifications include knocking in additional exogenous genes. Examples of knock-in additional exogenous genes include the ACE2, IL21, GLP, IL22, and CTLA4 genes.
[0120] In some embodiments, the engineered stem cells disclosed herein also comprise one or more additional exogenous target polynucleotides integrated into a target locus. These additional exogenous target polynucleotides may be integrated into the same target locus as HGF site-directed integration, or they may be different. In some embodiments, the engineered stem cells disclosed herein also comprise one or more additional exogenous target polynucleotides integrated into the Rosa26 locus.In some embodiments, the engineered stem cells disclosed herein also include one or more additional exogenous target polynucleotides integrated into one or more loci other than Rosa26. Examples of loci other than Rosa26 include AAVS1 and housekeeping gene loci, such as GAPDH.
[0121] One or more exogenous target polynucleotides may be co-expressed. For example, the expression cassette described herein may contain an exogenous polynucleotide encoding HGF and one or more additional exogenous target polynucleotides. These exogenous target polynucleotides may be interconnected via adapters. In some embodiments, the adapters encode self-cleaving peptides. Examples of adapters include, but are not limited to, internal ribosome entry sequences (IRES) or 2A self-cleaving peptides. Examples of 2A self-cleaving peptides include, but are not limited to, F2A, E2A, P2A, and T2A.
[0122] When the expression cassette contains two or more exogenous polynucleotides, all exogenous polynucleotides may be driven by a common promoter or by different promoters. When the expression cassette contains different promoters, different or identical UCOE elements may be operatively linked to these promoters respectively.
[0123] In some embodiments, the expression cassette further includes other regulatory sequences for gene expression. Examples of regulatory sequences include, but are not limited to, enhancers, poly(A) tail signal sequences, etc.
[0124] An enhancer is a DNA sequence that can increase the transcription frequency of a gene linked to it. Enhancers increase the transcription of downstream genes through promoters. Effective enhancers can be located at the 5' end of a gene, or at the 3' end of a gene, or sometimes in an intron of a gene. Enhancers can increase the transcription frequency of a gene. Examples of enhancers include, but are not limited to, CMV enhancers, SV40 enhancers, HPV16 LCR enhancers, immunoglobulin heavy chain enhancers, HACNS1 enhancers, GADD45G enhancers, hormone response elements (HREs), and metal regulatory enhancer elements (MREs).
[0125] In some embodiments, the expression cassette further includes a polynucleotide encoding a signal peptide (SP) for guiding the extracellular secretion of HGF. The signal peptide can be endogenous or exogenous. In some embodiments, the endogenous signal peptide is shown as SEQ ID NO: 20. In some embodiments, the exogenous signal peptide is selected from SIRP, C2, TPA, IFNG, or TNF signal peptides. Engineered stem cells using endogenous signal peptides can exhibit higher HGF secretion levels compared to stem cells using exogenous signal peptides.
[0126] In some embodiments, genetically modified iMSCs secrete HGF at levels up to at least 16 times (e.g., 16, 18, 20, or 22 times) higher than wild-type iMSCs. In some embodiments, genetically modified iMSCs secrete HGF at levels up to at least 24 times (e.g., 24, 26, 28, or 30 times) higher than wild-type iMSCs.
[0127] Methods for producing genetically modified cells This disclosure also relates to methods and compositions for producing the genetically modified PSCs and iMSCs described herein.
[0128] In another aspect, this disclosure provides a method for producing genetically modified PSCs, the method comprising: introducing a first construct and a second construct into a PSC, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the PSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the PSC genome by homologous recombination, thereby obtaining genetically modified PSCs.
[0129] In yet another aspect, this disclosure provides a method for producing genetically modified iMSCs, the method comprising: providing the genetically modified PSCs described herein; and differentiating the genetically modified PSCs into iMSCs, thereby producing genetically modified iMSCs.
[0130] In another aspect, this disclosure provides a method for producing genetically modified iMSCs, the method comprising: introducing a first construct and a second construct into iMSCs, the first construct comprising a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the iMSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining genetically modified iMSCs.
[0131] In some embodiments, the target locus is Rosa26 and / or AAVS1. In some embodiments, the target locus is Rosa26.
[0132] Any PSC can be used in this method. PSCs include embryonic stem cells (ESCs) and / or induced pluripotent stem cells (iPSCs). PSCs are preferred as iPSCs because iPSCs represent an unlimited source of cells for cell therapy. ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and can be readily obtained using conventional methods (e.g., methods described in the prior art or commercially available products). For example, the CytoTune iPS 2.0 Sendai Virus Reprogramming Kit (Thermo Fisher Scientific) can be used to reliably generate induced pluripotent stem cells (iPSCs) from somatic cells, including PBMCs and T cells. In some embodiments, hiPSCs are prepared according to the protocol described in CN108373998B, the entire contents of which are incorporated herein by reference.
[0133] In genetic engineering, vectors are typically used to deliver target genes into cells. In this method, a first construct is introduced using a tool vector containing a site-specific endonuclease capable of introducing double-strand breaks (DSBs), and a second construct is introduced using a donor vector containing an expression cassette encoding a foreign polynucleotide of HGF. In some embodiments, the construct is a vector. Vectors used herein generally include, but are not limited to, plasmids, bacteriophages, animal viruses, and granules. Vectors can be expression vectors, including eukaryotic expression vectors and viral expression vectors. Vectors are preferably eukaryotic expression vectors. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In this disclosure, any suitable vector (including well-known vectors) can be used to deliver the first and second constructs. Techniques for constructing recombinant vectors are common to those skilled in the art of genetic engineering.
[0134] In the donor vector, the expression cassette contains a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from EF1a, PGK, CAG, CMV, CLP, and UBC. In some embodiments, the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter. In some embodiments, the promoter is the EF1a promoter. In some embodiments, the expression cassette comprises a combination of the EF1a promoter and the UCOE. In some embodiments, the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. In some embodiments, the signal peptide is as shown in SEQ ID NO: 20. Other elements in the expression cassette of the donor vector have been described elsewhere, and their description is omitted herein for simplicity.
[0135] As tools for site-directed integration as described herein, available endonucleases capable of introducing DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas nucleases.
[0136] In some embodiments, endonucleases capable of introducing double-strand breaks include zinc finger nucleases (ZFNs). Those skilled in the art know that ZFNs are targeted endonucleases whose nucleases are fused to zinc finger DNA-binding domains. A zinc finger is a domain of approximately 30 amino acids within the zinc finger binding domain, its structure being stabilized by coordination with zinc ions. Examples of zinc fingers include, but are not limited to, C2H2, C3H, and C4 zinc fingers. An example of ZFN is a fusion polypeptide of the FokI nuclease domain and the zinc finger DNA-binding domain.
[0137] In some embodiments, endonucleases capable of introducing double-strand breaks include TALENs.TALENs are targeted endonucleases that have nucleases fused to the DNA-binding domain of TAL effectors. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the plant cell nucleus, bind effector-specific DNA sequences through their DNA-binding domains, and activate gene transcription of these sequences through their transactivation domains. The specificity of the TAL effector DNA-binding domain depends on a variable number of incomplete 34-amino acid repeat sequences, which contain polymorphisms at selected repeat positions, known as variable double residue repeats (RVDs). An example of a TALEN is a fusion polypeptide of the FokI nuclease domain and the TAL effector DNA-binding domain.
[0138] In some embodiments, endonucleases capable of introducing double-strand breaks include CRISPR-Cas nucleases. The CRISPR / Cas system is a powerful gene-editing tool that can selectively modify DNA sequences at any specific location in the cellular genome. CRISPR-Cas systems are divided into two main classes and six main types. An example of a CRISPR / Cas system is the CRISPR / Cas9 system. The CRISPR-Cas9 system is based on the nucleolytic activity of the endonuclease protein Cas9, which reaches the desired site in the genome under the guidance of a specific determinant RNA called guide RNA (gRNA). In addition, the CRISPR / Cas9 system recognizes another sequence located near the target locus, called the protospacer adjacent motif (PAM), which is crucial for Cas9 function. The Cas9 protein binds to the target locus with high precision in the presence of gRNA and performs a double-strand break at the cleavage site. The desired gene knock-in is achieved via homology-directed repair (HDR) using a pre-designed repair template.
[0139] Transfection vectors, such as donor vectors or tool vectors, are common techniques to those skilled in the art. Examples of transfection methods include electroporation, calcium phosphate co-precipitation, liposome transfection, gene gun bombardment, etc.
[0140] In some embodiments, according to this disclosure, the method for producing genetically modified PSCs further includes amplifying the genetically modified PSCs. In some embodiments, the method further includes continuously amplifying the genetically modified PSCs for multiple generations. This allows for the continuous, large-scale production of consistent engineered PSCs with stable high HGF expression.
[0141] In some embodiments, continuously amplifying the genetically modified PSCs includes amplifying the genetically modified PSCs for at least 2, 3, or 4 generations. In some embodiments, continuously amplifying the genetically modified PSCs includes amplifying the genetically modified PSCs for at least 5, 6, or 7 generations.In some embodiments, the continuous amplification of genetically modified PSCs includes amplifying the genetically modified PSC1 for at least 8, 9, or 10 generations. Techniques for amplifying or continuously amplifying PSCs are conventional techniques in the art. For example, engineered PSCs can be cultured and amplified in commonly used amplification media for wild-type PSCs. Any other suitable amplification media may also be used herein. Examples of the aforementioned amplification media include E8 medium and ncEpic medium.
[0142] In some embodiments, according to this disclosure, a method for producing genetically modified iMSCs further includes amplifying the genetically modified iMSCs. In some embodiments, the method further includes continuously amplifying the genetically modified iMSCs for multiple generations. This allows for the continuous, large-scale production of consistent engineered iMSCs with stable high HGF expression.
[0143] In some embodiments, the continuous amplification of genetically modified iMSCs includes amplifying the genetically modified iMSCs for at least 2, 3, or 4 generations. In some embodiments, the continuous amplification of genetically modified iMSCs includes amplifying the genetically modified iMSCs for at least 5, 6, or 7 generations. Techniques for amplifying or continuously amplifying iMSCs are conventional techniques in the art. For example, engineered iMSCs can be cultured and expanded in commonly used expansion media for wild-type iMSCs or primary MSCs. Any other suitable expansion media may also be used herein. Examples of expansion media include Mesencult-XF medium (Stem cell), StemPro MSC SFM Xeno-Free medium (Invirogen), MSCGM-CD medium (Lonza), and M5 medium (Anhui Zhong Sheng Suyuan Biotechnology Co., Ltd.).
[0144] Compositions This disclosure also provides cell populations or compositions comprising the genetically modified PSCs or iMSCs disclosed herein.
[0145] This disclosure also provides a pharmaceutical composition comprising the genetically modified iMSCs described herein and a pharmaceutically acceptable vector. The effective amount of cells in a pharmaceutical composition for treating a particular disease or condition depends on the nature of the disease or condition and can be determined by standard clinical techniques. The pharmaceutical compositions, cell compositions, or cell populations of this disclosure may be administered before, during, and / or after the onset of a disease, disorder, and / or condition. Instructions for Use, Pages 14 / 22, 17 CN 122270472 A
[0146] Pharmaceutically acceptable carriers are well known in the art. Exemplary pharmaceutically acceptable carriers are sterile aqueous solutions that contain no substances other than the active ingredient and water, or buffers containing physiological pH values such as sodium phosphate, physiological saline, or a combination of both such as phosphate-buffered saline. Furthermore, aqueous carriers may contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, glucose, and other solutes.Non-limiting examples of such pharmaceutically acceptable carriers include multi-electrolyte injections and dextran injections.
[0147] Applications This document also provides for the use of the genetically modified PSCs or iMSCs disclosed herein in the preparation of medicaments for the treatment or prevention of diseases such as neurological disorders, ischemic heart disease, bone and cartilage diseases, idiopathic pulmonary fibrosis (IPF), inflammation such as endometrial damage or vascular disease, diabetes, or autoimmune diseases.
[0148] Specifically, the genetically modified iMSCs disclosed herein provide improved efficacy against idiopathic pulmonary fibrosis (IPF). Therefore, this disclosure also provides for the use of the genetically modified iMSCs disclosed herein in the preparation of medicaments for the treatment or prevention of IPF. This disclosure also provides a method of treating or preventing IPF comprising administering any of the genetically modified iMSCs described herein or a cell population or pharmaceutical composition thereof to a subject in need.
[0149] General Approaches In practicing the contents of this disclosure, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA are used. See, for example, Sambrook and Russell (eds.), Molecular Cloning: A Laboratory Manual, 3rd Edition; Ausubel et al. (eds.), New Edition of Experimental Methods in Molecular Biology, 2007; Enzyme Methods Series (Academic Press, Inc., NY); MacPherson et al. (eds.), PCR 1: Practical Methods (Oxford University Press, IRL); MacPherson et al. (eds.), PCR 2: Practical Methods (1995); Harlow and Lane (eds.), Antibodies, Laboratory Manual, 1999; Freshney (2005), Animal Cell Culture: A Basic Technique Manual, 5th Edition; Gait (ed.), Oligonucleotide Synthesis, 1984; US Patent No. 4,683,195; Hames and Higgins (eds.), Nucleic Acid Hybridization, 1984; Anderson (1999), Nucleic Acid Hybridization; Hames and Higgins (eds.), Transcription and Translation; Immobilized Cells and Enzymes (IRL). Press (1986); Perbal (1984) Practical Guide to Molecular Cloning; Miller and Calos (eds.) (1987) Gene Transfer Vectors in Mammalian Cells (Cold Spring Harbor Laboratory); Makrides (ed.) (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker (eds.) (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. (eds.) (1996) Weir Handbook of Experimental Immunology.Example
[0150] Materials All reagents and instruments used in all examples of this disclosure are commercially available.
[0151] Example 1: Optimal selection of loci for iPSC engineering by site-directed integration.
[0152] Experimental procedure: Human iPSCs (hiPSC cells) were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified for 4 days on a glass-coated culture surface in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.). Then, the hiPSCs were engineered to express Antares2 at the AAVS1 locus and the Rosa26 locus, respectively. All procedures were the same except for the target locus. The following steps describe in detail the specific details of knocking in Antares2 (SEQ ID NO: 3) at the Rosa26 locus and the AAVS1 locus (Figure 1A).
[0153] The U6 promoter-gRNA-Rosa26-gRNA chimeric fragment (SEQ ID NO: 4) and the U6 promoter-gRNA-AAVS1-gRNA chimeric fragment (SEQ ID NO: 5) were synthesized by Genscript Biotech Inc. (China). The synthesized U6 promoter-gRNA-Rosa26-gRNA chimeric fragment or U6 promoter-gRNA-AAVS1-gRNA chimeric fragment was inserted into the KpnI / EcoRI site of the Cas-Template vector (Figure 1B, Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.) after double digestion at 37℃ for 1-2 hours. The product was extracted using a DNA gel extraction kit (TIANGEN, DP209) according to the manufacturer's instructions, and the product was ligated using T4 ligase (NEB, MO202) according to the manufacturer's instructions to construct the Cas / gRNA vector. The Cas / gRNA vector and gRNA sequences used are shown in Table 1 below.
[0154] Table 1 Chromosomal exon targeting sequences of Cas / gRNA vector constructs PAM pCas-gRNA-Rosa26 gRNA-Rosa26 3 N / A GGCGATGACGAGATCACGCG (SEQ ID NO: 18) AGG pCas-gRNA-AAVS1 gRNA-AAVS1 19 N / A GTCCCTAGTGGCCCCACTGT (SEQ ID NO: 19) GGG
[0155] The 5'- and 3'- homologous arms were synthesized by Genscript Biotech Inc. (China).The synthesized homologous arms were double-digested at 37℃ for 1–2 hours and then inserted into the NheI / ClaI and EcoRI / BamHI sites of the pKI-Antares2 vector (Figure 1C, Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.). The products were extracted using a DNA gel extraction kit (TIANGEN, DP209) according to the manufacturer's instructions, and then ligated using T4 ligase (NEB, MO202) according to the manufacturer's instructions to construct the donor vector. The homologous arms of each locus and the donor vector are shown in Table 2 below.
[0156] Table 2 Donor vector 5'-homologous arm 3'-homologous arm Target locus pKI-Antares2-Rosa26 SEQ ID NO: 6 SEQ ID NO: 7 Rosa26 pKI-Antares2-AAVS1 SEQ ID NO: 8 SEQ ID NO: 9 AAVS1
[0157] To knock Antares2 into iPSCs, 2 × 10⁶ hiPSCs were transfected with Nucleofector 2b (Lonza Inc.) using 2 μg of donor vector and 2 μg of Cas / gRNA vector. The transfected hiPSCs were seeded in six-well plates at a cell density of 2 × 10⁴ cells / cm² and selected with 100 ng / mL genimycin for 1–2 days. After culturing for 5-7 days, hiPSC single clones were picked and transferred to 48-well plates for further culture, and then further amplified in 6-well plates using ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) to obtain a sufficient number of cells for further screening. HiPSCs from single clones were collected, dissociated into individual cells, and Antares2 expression was analyzed by flow cytometry.
[0158] Positive clones with correct Antares2 sequence insertion at the selected locus were further confirmed by nested PCR using Platinum® Pfx DNA polymerase (Thermo Fisher Scientific) according to the manual instructions, and sequenced by Beijing Qingke Biotechnology Co., Ltd. (China).
[0159] Karyotype analysis was performed on positive clones with correct insertion by KingMed Diagnostics Group (China) to exclude chromosomal abnormalities. Flow cytometry was used to analyze the expression of Antares2 in representative double-knock-in hiPSCs (Figure 1D).
[0160] In the above assays, wild-type iPSCs (hereinafter referred to as WT-iPSCs) were used as controls. As shown in Figure 1D, the expression level of Antares2 in engineered iPSCs integrated into the Rosa26 or AAVS1 locus was significantly higher than that in WT-iPSCs.Furthermore, the expression level of Antares2 integrated into the Rosa26 locus was significantly higher than that of the AAVS1 locus, indicating that the Rosa26 locus is more easily transcribed in iPSC cells. The above examples show that site-specific integration in iPSCs can achieve high-level expression of HGF, and the Rosa26 locus is superior to the AAVS1 locus in both iPSC engineering and subsequent iMSC engineering.
[0161] Example 2: Pre-selected promoters for iPSC and iMSC engineering by random integration.
[0162] Experimental procedure: The pPBml-PNE-EGFP vector (Figure 2A, Anhui Zhong Sheng Suyuan Biotechnology Co., Ltd.) was used as the EGFP expression vector. This vector carries the EF1a promoter (SEQ ID NO: 13). The 1550F UCOE element (SEQ ID NO: 1) and CMV promoter (SEQ ID NO: 2) were synthesized by Genscript Biotech Co., Ltd. (China). According to the instructions, the 1550F UCOE element was inserted into the NotI / ClaI site of the pPBml-PNE-EGFP vector using T4 ligase (NEB MO202) on pages 16 / 22 of the instructions (CN 122270472 A). The CMV promoter was ligated to the ClaI / XbaI site of the pPBml-PNE-EGFP vector.
[0163] hiPSCs were prepared according to the procedures described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified for 4 days on a glass-coated surface in ncEpic medium (Anhui Zhong Sheng Suyuan Biotechnology Co., Ltd.). To transfect hiPSCs, hiPSCs were isolated using TrypLE treatment, and each nuclear transfection (Nucleofector 2b, Lonza Inc.) used 2 × 10⁶ hiPSCs with 2 μg of PBase expression vector (Figure 2B, Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) and 2 μg of EGFP expression vector. On day 1 post-transfection, cells with stable vector integration were screened using genimycin (100 μg / mL).
[0164] iMSCs were differentiated from hiPSCs according to the schemes of Examples 1, 3, and 4 in patent CN110592007B. iMSCs were cultured and amplified in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). iMSC transfection: iMSC cells were isolated using TrypLE treatment, and each nuclear transfection used 1 × 10⁶ iMSCs with 2 μg of PBase expression vector and 2 μg of EGFP expression vector. On day 1 post-transfection, cells that have stably integrated the vector were screened using genimycin (100 μg / mL).EGFP expression in hiPSCs and iMSCs was observed by fluorescence microscopy at different days after transfection (Figure 2C), and EGFP expression in hiPSCs and iMSCs was measured by flow cytometry at different days after transfection (Figures 2D and 2E).
[0165] In order to find the optimal promoter for achieving high-level transgene expression during long-term iMSC culture, the above tests were performed on the EF1α (E) promoter, the CMV (C) promoter, and their combinations with anti-silencing panchromatin open elements (UCOE) (UCOE-EF1a (UE) and UCOE-CMV (UC)). Based on the results of Figures 2C-2E, it was found that during long-term culture, EGFP expression in iMSCs using the E promoter was more uniform and higher than that using the UE promoter, while during long-term culture, EGFP expression in iMSCs using the UC promoter was more uniform and stable than that using the C promoter. Unlike iMSCs, iPSCs showed high EGFP expression during long-term culture with the help of E and UE promoters, and although iPSCs showed good EGFP expression on day 1 with the help of C and UC promoters, EGFP was efficiently silenced during long-term culture. As potential effective drivers of transgene expression in iMSCs during long-term culture, E and UC promoters were selected for further testing in the engineering of iPSCs and iMSCs at the Rosa26 locus.
[0166] Example 3: Comparison of E and UC promoter activity in engineered iPSCs and iMSCs with site-directed integration at the Rosa26 locus during persistent expansion.
[0167] Experimental procedure: hiPSCs were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. hiPSCs were cultured and expanded in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) for 4 days. Similar to the method described in Example 1, Antares2, driven by the EF1a and UCOE-CMV promoters, was knocked into the Rosa26 locus in hiPSCs. The process was identical except for the promoter (Figure 3A). hiPSCs engineered using the EF1a and UCOE-CMV promoters were named iPSC-Rosa26-E-Antares2 and iPSC-Rosa26-UC-Antares2, respectively. The confirmed first-generation engineered iPSCs were designated "P1" (Passage 1). P1 iPSC-Rosa26-E-Antares2 cells were expanded and passaged 9 times in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.), and P1 iPSC-Rosa26-UC-Antares2 cells were expanded and passaged 4 times in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.).The expression of Antares2 in engineered iPSCs was analyzed by flow cytometry (Figure 3B).
[0168] In the above assay, WT iPSCs were used as controls. As shown in Figure 3B, the expression of Antares2 in iPSC-Rosa26-E-Antares2 cells was very high and remained stable even after hiPSCs had been expanded and passaged for 9 generations. In contrast, although iPSC-Rosa26-UC-Antares2 cells showed good Antares2 expression, the expression of Antares2 decreased during sustained expansion. Instructions for Use, pages 17 / 22, 20 CN 122270472 A
[0169] iPSC-Rosa26-E-Antares2 cells and iPSC-Rosa26-UC-Antares2 cells of P1 were differentiated according to the schemes described in Examples 1, 3, and 4 of patent CN110592007B to obtain iMSCs. Then, the iMSCs were cultured and expanded for 4 generations in expansion medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). At P0 and P4, the expression of Antares2 in iMSCs was analyzed by flow cytometry (Figure 3C).
[0170] As shown in Figure 3C, iMSC-Rosa26-E-Antares2 cells exhibited high Antares2 expression at P0, and the expression increased at P4. In contrast, iMSC-Rosa26-UC-Antares2 cells showed lower Antares2 expression at P0 than iMSC-Rosa26-E-Antares2 cells, and even weaker expression at P4.
[0171] The results of this study indicate that transgenes driven by the EF1a promoter integrated into the Rosa26 locus can produce stable and high-level transgene-expressing iPSCs during persistent expansion, and stable and high-level transgene-expressing iMSCs during differentiation and persistent expansion. While the UC promoter can drive high-level transgene expression when directly introduced into iMSCs, it cannot be reactivated to its full activity during the persistent expansion of iPSCs and / or iMSCs, resulting in transgene silencing.
[0172] Examples 4-5: Engineered E-HGF-iPSC cells were generated by targeted integration at Rosa26.
[0173] Example 4 Experimental procedure: hiPSCs were prepared according to the methods of Examples 3 and 4 in CN108373998B, and hiPSCs were induced to differentiate into iMSCs according to the methods of Examples 1, 3 and 4 in CN110592007B.The nucleic acid sequences of HGF (with endogenous SP) (SEQ ID NO: 10) and HGF-TPA (SEQ ID NO: 11) were synthesized by Genscript Biotech Inc. (China). The above HGF and HGF-TPA sequences were inserted into the NotI / BamHI site of the pKPBml-PNUC-EGFP vector (SEQ ID NO: 12) (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) according to the manual instructions using T4 ligase (NEB MO202) to construct the pKPBml-PNUC-HGF and pKPBml-PNUC-HGF-TFA vectors, respectively, and iMSCs cells were transfected with these two constructs. The transfected iMSCs were cultured in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5) for 4 days, and then the culture supernatant was collected to determine the HGF protein concentration by ELISA.
[0174] Enzyme-linked immunosorbent assay (ELISA): In order to analyze the amount of HGF expressed by iMSCs, the culture medium was collected after 4 days of culture and analyzed by ELISA. HGF levels were quantified using a human HGF ELISA kit (Multisciences) according to the manufacturer's instructions. Absorbance was measured at 450 nm after applying STOP solution (Multisciences) for reaction assay.
[0175] As a preliminary experiment, the effect of the TPA signal peptide on HGF secretion in transiently transfected iMSCs was tested, as described above. As shown in Figure 4A, the exogenous TPA signal peptide resulted in reduced HGF protein secretion after introduction into iMSCs compared to the endogenous signal peptide. Therefore, the exogenous TPA signal peptide was not given priority in subsequent site-directed integration genetic engineering.
[0176] Example 5 Experimental Procedure: hiPSCs were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) for 4 days. HGF (SEQ ID NO: 10), driven by the EF1aα promoter, was knocked into the Rosa26 locus in hiPSCs using a method similar to that in Example 1 (Figure 4B). The engineered iPSCs were named E-HGF-iPSC cells. Confirmed E-HGF-iPSCs and WT iPSCs were stained with an anti-HGF antibody (Sino Biological, 10463-T26), and the percentage of HGF+ iPSCs was detected by flow cytometry (Figure 4C). The HGF staining procedure was as follows: The cultured iPSCs were treated with TrypLE. The collected cells were washed with 1 ml of PBS and then centrifuged at 300 × g for 15 seconds.After removing the supernatant, add approximately 200 μl of 4% PFA and mix with the cells, fixing the cells at room temperature for 10 minutes. Then centrifuge at 350×g for 5 minutes (see instructions page 18 / 22, 21 CN 122270472 A). Wash the cells with 1 ml of FACS buffer and centrifuge at 350×g for 5 minutes. After removing the supernatant, add 200 μl / tube of FACS buffer / 0.1% Triton X and mix with the cells, incubating the mixture at room temperature for 10 minutes. Wash the cells again with 1 ml of FACS buffer and centrifuge at 350×g for 5 minutes. After removing the supernatant, add 200 μl / tube of anti-HGF antibody (rabbit polyclonal antibody, Sino Biological, #10463-T6) diluted in FACS buffer and gently mix with the cells, incubating the mixture at room temperature for 30 minutes. Wash the cells again with 1 ml of FACS buffer and centrifuge at 350×g for 5 minutes. After removing the supernatant, 200 μl of goat anti-rabbit IgG H&L (APC) diluted in FACS buffer was added and gently mixed with the cells. The mixture was incubated at room temperature for 30 minutes. The cells were washed with 1 ml of FACS buffer and centrifuged at 350 × g for 5 minutes. After removing the supernatant, 200 μl of FACS buffer was added, and the sample was run on a flow cytometer.
[0177] As shown in Figure 4C, almost all iPSCs expressed HGF. The above results indicate that high-purity engineered iPSCs can be prepared by site-specific integration of HGF at the Rosa26 locus in iPSCs via the EF1a promoter.
[0178] Examples 6-7: Generation of engineered E-HGF-iMSCs by site-specific integration at Rosa26 Example 6 Experimental procedure: The engineered iPSCs (E-HGF-iPSCs) prepared in Example 5 were differentiated for 10 days according to the scheme described in Examples 1, 3 and 4 of patent CN110592007B to obtain engineered iMSCs (hereinafter referred to as E-HGF-iMSCs). Then, the E-HGF-iMSCs were amplified and passaged in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). Figure 5A shows the representative cell morphology during the process of derivatizing iMSCs from engineered HGF-iPSCs. Typical MSC surface markers CD73, CD90 and CD105 in WT-iPSCs and E-HGF-iMSCs (P2) were analyzed by flow cytometry (Figure 5B). HGF expression in WT-iPSCs, WT-iMSCs, and E-HGF-iMSCs (P2) was analyzed by flow cytometry (Figure 5C). Details of CD73 / CD90 / CD105 staining are shown below.Cells were isolated and collected using TrypLE treatment. Cells were washed with 1 ml PBS and centrifuged at 300 × g for 15–20 seconds. The supernatant was removed, and 50 μl / tube of anti-CD73-APC antibody (BD Pharmingen, #559869), anti-CD90-APC antibody (BD Pharmingen, #560847), or anti-CD105-APC antibody (BioLegend, #800508) diluted in FACS buffer was added. The mixture was gently mixed and incubated at 4 °C for 30 min. Cells were washed again with 1 ml FACS buffer and centrifuged at 300 × g for 15–20 seconds. The supernatant was removed, and 200 μl of FACS buffer was added. The samples were then analyzed using flow cytometry.
[0179] As shown in Figures 5A and 5B, the E-HGF-iMSCs of P2 still have the typical phenotype of MSCs, suggesting that E-HGF-iMSCs can stably maintain the stem cell characteristics of MSCs during persistent expansion. As shown in Figure 5C, the expression level of HGF in E-HGF-iMSCs is much higher than that in WT-iMSCs.
[0180] Example 7 Experimental procedure: The WT-iPSCs and E-HGF-iPSCs prepared in Example 5 were cultured and expanded for 9 generations in ncEpic medium (Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.). WT-iPSCs and E-HGF-iPSCs from P1 and P10 were differentiated into iMSCs (hereinafter referred to as WT-iPSC-P1-iMSC-P0 cells, WT-iPSC-P10-iMSC-P0 cells, E-HGF-iPSC-P1-iMSC-P0 cells, and E-HGF-iPSC-P10-iMSC-P0 cells, respectively) according to the schemes described in Examples 1, 3, and 4 of patent CN110592007B. Subsequently, the differentiated iMSCs were cultured and expanded for 4 or 7 passages in expansion medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). HGF expression in WT-iPSC-P1-iMSC-P2 cells, WT-iPSC-P10-iMSC-P2 cells, E-HGF-iPSC-P1-iMSC-P2 cells, and E-HGF-iPSC-P10-iMSC-P2 cells was analyzed by ELISA similar to that in Example 4 (Figure 5D).Furthermore, HGF expression in WT-iPSC-P1-iMSC-P2 cells, WT-iPSC-P1-iMSC-P4 cells, E-HGF-iPSC-P1-iMSC-P2 cells, E-HGF-iPSC-P1-iMSC-P4 cells, and E-HGF-iPSC-P1-iMSC-P7 cells was analyzed by ELISA using a specification similar to Example 4 (pages 19 / 22, CN 122270472 A).
[0181] As determined by ELISA, the level of secreted HGF in E-HGF-iPSC-P1-iMSC-P2 cells was approximately 1627 ng / mL / 10⁶ cells, and in E-HGF-iPSC-P1-iMSC-P4 cells it was approximately 1694 ng / mL / 10⁶ cells. Furthermore, Figure 5D shows that E-HGF-iPSC-P1-iMSC-P2 cells secrete HGF at a level approximately 16.6 times higher than WT-iPSC-P1-iMSC-P2 cells, and E-HGF-iPSC-P10-iMSC-P2 cells secrete HGF at a level approximately 24.4 times higher than WT-iPSC-P10-iMSC-P2 cells. Figure 5E shows that E-HGF-iPSC-P1-iMSC-P2 cells secrete HGF at a level approximately 16.6 times higher than WT-iPSC-P1-iMSC-P2 cells, and E-HGF-iPSC-P1-iMSC-P4 cells secrete HGF at a level approximately 17.5 times higher than WT-iPSC-P1-iMSC-P4 cells. Additionally, E-HGF-iPSC-P1-iMSC-P7 cells secrete HGF at a level approximately 16.6 times higher than WT-iPSC-P1-iMSC-P2 cells. P2 cells secrete HGF at a level approximately 1.54 times higher. These results suggest that E-HGF-iMSCs exhibit high levels of HGF secretion, and that E-HGF-iPSCs used for iMSC differentiation can still stably maintain high levels of HGF secretion even after persistent expansion to P10. Furthermore, E-HGF-iMSCs can stably expand for at least 7 generations and maintain high levels of HGF secretion.
[0182] Examples 8-11: Improvement of the therapeutic effect of engineered E-HGF-iMSCs on IPF mice.
[0183] Example 8 Experimental procedure: To induce idiopathic pulmonary fibrosis (IPF), C57BL / 6N mice (Charles River) were anesthetized with 1% sodium pentobarbital (100 mg / mL). Then, 70 μg of bleomycin dissolved in 50 μL of physiological saline was administered to the mice intratracheally.At 6 h, 5 days, and 10 days after bleomycin administration, 1×10⁶ P⁴ WT-iMSCs and P⁴ E-HGF-iMSCs (Example 7) in 100 μL of physiological saline were injected into the tail vein of mice (Fig. 6A). Mice injected with an equal volume of physiological saline were designated as the model group, and normal C57BL / 6N mice were used as blank controls. All mice were sacrificed on day 21. Mouse body weight and lung weight were measured, and the lung index was calculated as lung weight / body weight ratio (Fig. 6B).
[0184] As shown in Fig. 6B, the lung index of both the E-HGF-iMSC group and the WT-iMSC group was significantly lower than that of the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal control group.
[0185] Example 9 Experimental procedure: Hydroxyproline (HYP) content in lung tissue was determined to assess collagen deposition using a hydroxyproline (HYP) detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. Specifically, lung tissue homogenate was hydrolyzed in 6 M hydrochloric acid at 95°C for 5 hours, then chloramine-T was added and the pH was adjusted. Subsequently, a chromogenic agent (dimethylaminobenzaldehyde) was added, and the sample was incubated at 60°C for 15 minutes, and the absorbance was measured at 550 nm using an ELISA reader (Bio-Rad, USA). The HYP level was determined by plotting a standard curve, and the results were expressed as micrograms / milligrams in lung tissue (Figure 6C).
[0186] As shown in Figure 6C, the HYP content in both the E-HGF-iMSC group and the WT-iMSC group was significantly lower than that in the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal control group.
[0187] Example 10 Experimental procedure: The lungs of each mouse were fixed with 4% paraformaldehyde and embedded in paraffin. The sections were cut into 4 μm thicknesses and stained with hematoxylin and eosin (H&E). The experimental details are as follows. Dewax the slides using two consecutive xylene baths, 10 minutes each. Hydrate the lung slides by passing them through a diluted alcohol bath: change the alcohol twice, 5 minutes each time, followed by 2 minutes with 95% alcohol and 2 minutes with 70% alcohol. Rinse briefly with distilled water. Collect the slides on positively charged microscope slides. Incubate the slides with hematoxylin solution (Sigma) in a staining jar for 10 minutes to stain the cell nuclei. Transfer the slides (see page 20 / 22, CN 122270472 A) to a staining jar filled with tap water until the water runs clear. Then, transfer the slides to a staining jar filled with eosin solution (Sigma) for 3 minutes. Repeat the process of transferring the slides to the staining jar, treating with 70% ethanol for 20 seconds, 90% ethanol for 20 seconds, 100% ethanol for 1 minute, and xylene for 3 minutes.Remove the slides from the xylene and place them in a fume hood until they are dry. Mount the slides with xylene-based mounting media and cover them with coverslips. Press the slides with clips to remove air bubbles. Store the slides at room temperature. Image at least 5 random fields of view for each group using a digital microscope camera.
[0188] The results are shown in Figure 6D. The results show that collagen deposition in both the E-HGF-iMSC group and the WT-iMSC group was significantly reduced compared to the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal group used as a control.
[0189] Example 11 Experimental procedure: The lungs of each mouse were fixed with 4% paraformaldehyde and embedded in paraffin. The sections were cut to a thickness of 4 μm and stained with the Masson staining kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. The experimental details are as follows. The lung sections were dewaxed and rehydrated as described in Example 10. The lung sections were washed with distilled water. Mordanting lung sections in preheated Bouin's solution at 56-60°C for 1 hour or overnight at room temperature. Then, stain the sections in Weigert iron hematoxylin solution for 10 minutes. Next, rinse the sections with running tap water for 10 minutes and then rinse with distilled water. Stain the sections in Biebrich scarlet-acid fuchsin solution for 10-15 minutes, then rinse with distilled water. Then, differentiate the sections in phosphomolybdic acid-phosphotungstic acid solution for 10-15 minutes. Observe the slide sections visually, and proceed to the next step once collagen-rich areas have faded and become transparent. Transfer the slides directly to aniline blue solution and stain for 5-10 minutes. Then, rinse the slides with distilled water and differentiate in 1% acetic acid solution for 2-5 minutes. Then, rinse the slides with distilled water. Quickly dehydrate the tissue by passing the slides through 95% ethanol, then wipe off the Biebrich scarlet-acid fuchsin stain with anhydrous ethanol and clear in xylene. Mount the slides with xylene-based mounting medium and cover with coverslips. Remove all air bubbles and store the slides at room temperature. Image at least five random fields of view in each group using a digital microscope camera. Assess the severity of interstitial fibrosis in each consecutive field of view individually and assign a score between 0 and 8 using a predetermined severity scale (Table 3). The results are shown in Figure 6E.
[0190] Table 3 Grading Criteria for Pulmonary Fibrosis Histological Characteristics of Fibrosis Grading 0 Normal Lung 1 Mild Thickening of Alveolar or Bronchial Walls 2 Moderate Thickening of Walls without Damage to Lung Structure 3 Severe Thickening of Walls with Significant Structural Disorder 4 Severe Thickening of Walls with Significant Damage to Lung Structure 5 Increased Fibrosis with Clear Damage to Lung Structure and Formation of Fibrotic Bands or Small Fibrotic Foci 6 Severe Structural Damage and Large Fibrotic Regions 7 “Honeycomb Lung” is classified into this grade 8 Fibrotic Lesions in the Full Field of View
[0191] As shown in Figure 6E, the fibrosis scores of both the E-HGF-iMSC group and the WT-iMSC group were significantly lower than those of the model group, and the fibrosis score of the E-HGF-iMSC group was lower than that of the WT-iMSC group and closer to the normal group as a control. Based on the results of Figures 6B-6E, compared with WT-iMSCs, E-HGF-iMSCs showed efficacy in improving idiopathic pulmonary fibrosis (IPF).
[0192] Those skilled in the art should understand that the methods, compositions, and products described herein are merely representative of exemplary embodiments described on pages 21 / 22 of CN 122270472 A and are not intended to limit the scope of this disclosure. Those skilled in the art should understand that various substitutions and modifications can be made to the disclosure herein without departing from its scope and spirit.
[0193] All patents and publications mentioned in this specification demonstrate the level of skill of those skilled in the art to which this disclosure pertains. All patents and publications are incorporated herein by reference, and the scope of such reference is identical to that of each publication explicitly and individually indicated as incorporated by reference.
[0194] This disclosure is not limited to the specific embodiments described herein, which are intended as separate illustrations of various aspects of this disclosure. Not all various embodiments of this disclosure will be described herein, and the terminology and expressions used are descriptive rather than limiting, and their use is not intended to exclude any equivalents of the shown and described features or portions thereof, but it should be recognized that various modifications can be made within the scope of the protection claimed in this disclosure. Therefore, it should be understood that although this disclosure has been specifically disclosed through preferred embodiments and optional features, those skilled in the art can modify and change the concepts disclosed herein, and such modifications and changes are considered to be within the scope of this disclosure as defined by the appended claims.Instruction manual, pages 22 / 22; 25 CN 122270472 A; Figure 1A; Figure 1B; Instruction manual drawing, page 1 / 14; 26 CN 122270472 A; Figure 1C; Instruction manual drawing, page 2 / 14; 27 CN 122270472 A; Figure 1D; Instruction manual drawing, page 3 / 14; 28 CN 122270472 A; Figure 2A; Figure 2B; Instruction manual drawing, page 4 / 14; 29 CN 122270472 A; Figure 2C; Instruction manual drawing, page 5 / 14; 30 CN 122270472 A; Figure 2D; Instruction manual drawing, page 6 / 14; 31 CN 122270472 A; Figure 2E; Instruction manual drawing, page 7 / 14; 32 CN 122270472 A; Figure 3A; Figure 3B; Figure 3C; Instruction manual drawing, page 8 / 14; 33 CN 122270472 A; Figure 4A; Figure 4B; Figure 4C Figure 5A, page 9 / 14, CN 122270472 A; Figure 5B, page 10 / 14, CN 122270472 A; Figure 5C, Figure 5D, Figure 5E, page 12 / 14, CN 122270472 A; Figure 6A, Figure 6B, Figure 6C, page 13 / 14, CN 122270472 A; Figure 6D, Figure 6E, page 14 / 14, CN 122270472 A.
Claims
1. A genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
2. The gene-modified PSC according to claim 1, wherein the target locus is Rosa26.
3. The gene-modified PSC according to claim 1 or 2, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP and UBC.
4. The gene-modified PSC of claim 3, wherein the expression cassette further comprises an anti-silencing ubiquitous chromatin open element (UCOE), such as 1550F shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
5. The gene-modified PSC according to claim 3, wherein the promoter is the EF1a promoter.
6. The gene-modified PSC according to claim 4, wherein the expression cassette comprises a combination of the EF1a promoter and UCOE.
7. The genetically modified PSC of any one of claims 1-6, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
8. The genetically modified PSC of claim 7, wherein the signal peptide is as shown in SEQ ID NO:
20.
9. A method for producing genetically modified PSCs, the method comprising: A first construct and a second construct are introduced into a PSC. The first construct contains a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the PSC genome. The second construct contains an expression cassette encoding an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located on either side of the expression cassette. The expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC.
10. The method of claim 9, wherein the target locus is Rosa26.
11. The method of claim 9 or 10, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
12. The method of claim 11, wherein the expression box further comprises an anti-silencing universal chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
13. The method of claim 11, wherein the promoter is the EF1a promoter.
14. The method of claim 12, wherein the expression box comprises a combination of the EF1a promoter and UCOE.
15. The method according to any one of claims 9-14, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
16. The method of claim 15, wherein the signal peptide is as shown in SEQ ID NO:
20.
17. The method according to any one of claims 9-16, further comprising continuously amplifying the genetically modified PSC for multiple generations, for example at least 4 or 9 generations.
18. A genetically modified induced mesenchymal stem cell (iMSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
19. The gene-modified iMSC according to claim 18, wherein the target locus is Rosa26.
20. The genetically modified iMSC according to claim 18 or 19, wherein, The expression cassette includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
21. The gene-modified iMSC of claim 20, wherein the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F shown in SEQ ID NO:1, and the UCOE is operatively linked to the promoter.
22. The gene-modified iMSC of claim 20, wherein the promoter is the EF1a promoter.
23. The gene-modified iMSC of claim 21, wherein the expression cassette comprises a combination of the EF1a promoter and UCOE.
24. The gene-modified iMSC according to any one of claims 18-23, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
25. The genetically modified iMSC according to claim 24, wherein the signal peptide is as shown in SEQ ID NO:
20.
26. The genetically modified iMSC according to claim 24 or 25, wherein the genetically modified iMSC secretes HGF at a level up to at least 16 times that of wild-type iMSC.
27. A method for producing genetically modified iMSCs, the method comprising: Provide a genetically modified PSC according to any one of claims 1-8; as well as The genetically modified PSCs are differentiated into iMSCs, thereby producing the genetically modified iMSCs.
28. The method of claim 27, further comprising continuously amplifying the genetically modified iMSC for multiple generations, for example at least 4 or 7 generations.
29. A method for producing genetically modified iMSCs, the method comprising: A first construct and a second construct are introduced into iMSCs. The first construct contains a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the iMSC genome. The second construct contains an expression cassette encoding a foreign polynucleotide (HGF) and a pair of homologous arms specific to the target locus and located on either side of the expression cassette. The expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining a genetically modified iMSC.
30. The method of claim 29, wherein the target locus is Rosa26.
31. The method of claim 29 or 30, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
32. The method of claim 31, wherein the expression box further comprises an anti-silencing universal chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO:1, and the UCOE is operatively connected to the promoter.
33. The method of claim 31, wherein the promoter is the EF1a promoter.
34. The method of claim 32, wherein the expression box comprises a combination of the EF1a promoter and UCOE.
35. The method according to any one of claims 29-34, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
36. The method of claim 35, wherein the signal peptide is as shown in SEQ ID NO:
20.
37. The method according to any one of claims 29-36, further comprising continuously amplifying the genetically modified iMSC for multiple generations, for example at least 4 or 7 generations.
38. A pharmaceutical composition comprising the genetically modified iMSC of any one of claims 18-26 and a pharmaceutically acceptable vector.
39. Use of the genetically modified iMSC according to any one of claims 18-26 in the preparation of a medicament for the treatment or prevention of idiopathic pulmonary fibrosis (IPF).