Methods for reducing hepatitis b virus surface antigen (HBSAG) and drugs used in the methods thereof

Abstract

There is provided a method of curing chronic hepatitis B infection in a human, the method comprising administering to a subject in need thereof an effective amount of one or both of an exogenous anti-HBs antibody or an anti-HBs antibody producing carrier, the present invention relates to a method for reducing cellular and blood hepatitis B surface antigen (HBsAg) by providing continuously increased levels of anti-HBs antibodies in the subject.

Description

!!!!!!!! --iiiiiiii iiiiiiii !!!!!!!! -- -iiiiiiii !!!!!!!! - iiiiiiii - !!!!!!!! - !!!!!!!! iiiiiiii iiiiiiii ~ < °" ""' ~ '° 0 (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (l 9 ) Worl~~;:::~~:! Property ~ 1111111111111111 IIIIII IIIII 111111111111111 II Ill 11111111111111111111 IIIII IIII IIIIIII IIII IIII IIII International Bureau ~ (tow) lntoern2atoio2na5I / POubOh6" calti4on9NAum2ber (43) International Publication Date ;;;,;..,,,-"" 02 January 2025 (02.01.2025) WI PO I PCT (51) International Patent Classification: Not classified (21) International Application Number: (22) International Filing Date: (25) Filing Language: (26) Publication Language: (30) Priority Data: PCT / US2024 / 032725 06 June 2024 (06.06.2024) English English 63 / 506,582 27 June 2023 (27.06.2023) us (71) Applicant: HBVTECH LLC [US / US]; 4539 Metropolitan Ct., LAB 237, Frederick, Maryland 21701 (US).(72) Inventor: ZHANG, Yong-Yuan; 13901 Lullaby Road, Germantown, Maryland 20874 (US). (74) Agent: MASON, J. Derek; Tucker Ellis LLP, 950 Main Avenue, Suite ll00, Cleveland, OH 44ll3 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, EH, EN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CV, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IQ, IR, IS, IT, JM, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, MG, MK, MN, MU, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, WS, ZA,ZM,ZW.(84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, CV, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SC, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, ME, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Published: without international search report and to be republished upon receipt of that report (Rule 48. 2(g)) with sequence listing part of description (Rule 5.2(a)) (54) Title: METHODS FOR REDUCING HEPATITIS B VIRUS SURF ACE ANTIGEN (HBSAG) AND THE HEPATITIS B DRUGS USED IN THE METHODS THEREOF ::::- E -::::, ::::. Cl) c6 ~ ~<( <(~ Cl)_J mw :I: >­ E .c :::, ... Q) Cl) u .. Q) C S2 -tr- 831 500000-----........ -------- -<>- 838 50000+-------::::b__......,,~-+----+--====----1 5000-+-~~~=-G..::---+----1--------1 500--+-+---+---+----+------+-------+--------I 50-Y---+------,a;,----+----F-t-V----+---+---+--------1 ro 5 -+--+------+-------+----+--+--------I ..... N 1 --t---t-~~-----t-----j--------t----t--------1 co 0 --0-0.--------...... -----------,0i--------1 14 64 114 164 214 Days post infection FIG.10A ~ In (57) Abstract: A method of curing chronic hepatitis B infection in humans is provided, the method including administering to a subject ~ in need thereof, an effective amount of one or both of an exogenous anti-HBs antibody or an anti-HBs antibody producing vector to 0 reduce cellular and blood hepatitis B surface antigen (HBsAg), by providing a sustained elevated level of anti-HBs antibody in the ~ subject.0 ~ WO 2025 / 006149 PCT / US2024 / 032725 TITLE OF THE INVENTION TITLE METHODS FOR REDUCING HEPATITIS B VIRUS SURFACE ANTIGEN (HBsAg) AND THE HEPATITIS B DRUGS USED IN THE METHODS THEREOF CROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application is related to, and claims priority to, U.S. Provisional Application No. 63 / 506,582, filed June 6, 2023, the contents of which are hereby incorporated by reference in their entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under contract no. 75N930220C00042 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

[0003] The present invention relates to methods for reducing cellular and serum hepatitis B virus surface antigen (HBsAg) levels in chronic hepatitis B virus (HBV) infections by maintaining high anti-HBs antibody levels and blocking de novo infection mediated cccDNA replenishment. DESCRIPTION OF THE RELATED ART

[0004] Hepatitis B virus (HBV) has chronically infected 316 million people worldwide and nearly one million die ofHBV related diseases each year. Current HBV drugs rarely deliver durable suppression of HBV replication after years of medication, let alone HBV functional cure.

[0005] Currently, both serum HBsAg and HBV DNA markers are required to become undetectable in establishing HBV functional cure, that is, HBV functional cure is defined as undetectable serum HBsAg and HBV DNA after a finite period of HBV treatment (Alter et WO 2025 / 006149 PCT / US2024 / 032725 al., Hepatology 67, 1127-1131 (2018)).Serum HBV DNA can be inhibited and reduced to undetectable level after long-term treatment with the approved HBV drug of nucleos / tide analogues (NA) but the most difficult challenge is how to effectively reduce serum HBsAg to undetectable level.

[0006] The current strategy to reduce serum HBsAg level is to directly inhibit intracellular HBsAg synthesis with siRNA or antisense oligos (ASO) drugs. However, the efficacy of this strategy and siRNA / ASO based therapies is limited. showing average <2 log reduction in serum HBsAg demonstrated by both preclinical and clinical evaluations and serum HBsAg level bounces back after stopping the therapy.

[0007] A method that demonstrates more efficient reduction ofHBsAg level is needed for establishing an effective HBV functional cure. SUMMARY OF THE INVENTION

[0008] This invention discloses how to effectively reduce cellular and serum HBsAg level and it comprises following elements:

[0009] 1.In contrast to the current strategy to reduce serum HBsAg through direct inhibition of intracellular HBsAg synthesis, the present invention method does not require a direct inhibition of intracellular HBsAg synthesis.

[0010] 2. cccDNA is the major HBsAg transcription template but is frequently spontaneously lost in infected cells. HBV infected cells keep secreting HBsAg into blood, leading to emptying HBsAg in the infected cells if the lost cccDNA pool does not get replenished. Thus, the present invention method ofreducing cellular and serum HBsAg aims to block de novo infection mediated cccDNA replenishment using sustained high level of anti-HBs antibody in the presence or absence of other anti-HBV drugs.

[0011] 3. The present invention provides the method for using AAV-anti-HBs vectors to express sustained high levels of anti-HBs antibody after a single injection and can be used to block de novo infection mediated cccDNA replenishment.

[0012] The advantages of the present invention, either alone or in combinations thereof, may be satisfied by method of curing chronic hepatitis B infection in humans. comprising: administering to a subject in need thereof, an effective amount of one or both of an exogenous anti-HBs antibody or an anti-HBs antibody producing vector to reduce cellular and blood hepatitis B surface antigen (HBsAg), by providing a sustained elevated level of anti-HBs antibody in the subject, wherein the reduction of cellular and blood HBsAg occurs 2 WO 2025 / 006149 PCT / US2024 / 032725 (i) with blocking of de novo infection mediated cccDNA replenishment or (ii) without direct inhibition of HBsAg synthesis, or both (i) and (ii).BRIEF DESCRIPTION OF THE DRAWINGS

[0013] A more complete appreciation of the im-ention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:

[0014] FIGS. lA-lD show kinetic HBsAg levels in blood ofHBV infected uP A / SCID chimeric mice with humanized livers (from day 14 to day 162 post infection), wherein Figure IA shows Group 1 (Gl) without treatment; Figure lB-lD represent where Groups 2 and 3 (G2-G4) were treated with HBVZl0 and 12-weeks of entecavir but started at different timepoints to allow HBsAg to reach different levels. HBVZlO was given at day 11 (dl 1) at a dose of 2.5El 1 copies and day 58 at a dose of 4El 1 copies, respectively in G2 (Figure lB), given at day 22 at dose of 1.8El2 copies in G3 (Figure IC), and given at day 44 at dose of 7.2El2 copies in G4 (Figure lD).Timepoints were truncated among mice who deceased prior to day 162. Lower limit of qualification for HBsAg is 0. 05IU / ml (HBsAg EIA kit, Bio-rad).

[0015] FIG. 2 shows copies ofHBsAg per cell and numbers of input cells for assaying HBsAg in liver lysates from HBV infected uP A / SCID chimeric mice with humanized livers. Cellular HBsAg levels were titrated by serial dilutions from 1 / 1000, 1 / 100. 1 / 10, 1 / 2, 1 / 3.3, and 1 / 2.5. The inhibitory effect was detected at 1 / 2.5 dilution and the allowable dilution was 1 / 3.3. A total of 4 lysates from each of animals 825, 838, and 831 were analyzed and numbered as .1, .2, .3, and .4, respectively.

[0016] FIG. 3 shows numeral relation of cellular HBsAg and rcDNA per cell among mice in Figure 2. Figure 3A provides a graphical representation showing the copies ofHBsAg and rcDNA per cells in 2 mice "ith undetectable serum HBsAg and one untreated mouse control. Figure 3B provides the ratios of cellular HBsAg and rcDNA in the mice of Figure 3A.

[0017] FIGS.4A-4C provide graphical representations showing the serum HBsAg levels, serum HBV DNA levels, and intracellular HBsAg, rcDNA and cccDNA levels during HBV infection phases.

[0018] FIGS. 5A-5C provide graphical representations shO\ving cccDNA levels in analyzed mouse liver samples.

[0019] FIG. 6 provides a graphical representation showing the correlation between average cccDNA and HBV RNA levels in HBV infection. 3 WO 2025 / 006149 PCT / US2024 / 032725

[0020] FIGS. 7 A-7C provide graphical representations showing the effect on average cccDNA and rcDNA levels in mice after treatment with AAV-anti-HBs vector HBVZl0 of one embodiment of the present im-ention.

[0021] FIGS. 8A-8H provide graphical representations showing the effects on average cccDNA level, kinetic serum HBsAg level, kinetic serum HBeAg, evidencing progressive clearance of cccDNA after treatment with embodiments of the present invention.

[0022] FIGS.9A-9B provide graphical representations showing that subjects treated using embodiments of the present invention have no significant differences in average Ki67 RNA levels, while having significant differences in average cccDNA levels compared to untreated subjects.

[0023] FIGS. l0A-l0J provide graphical representations showing kinetic serum HBsAg levels and intracellular HBsAg levels, which were confirmed by the Western Blot analyses also shown in these figures.

[0024] FIGS. l lA-1 lB provide schematic representations for replication-driven cccDNA loss via either spontaneous clearance or cell destruction pathways. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Embodiments identified herein as exemplary are intended to be illustrative and not limiting. Table 1 outlines some main features of the present invention compared to current conventional therapies to reduce HBsAg, and they are further elaborated in the description below.

[0026] Table 1.Present invention Current therapies to reduce HBsAg Method Blocking de novo infection Direct inhibition of cellular mediated cccDNA HBsAg synthesis replenishment without direct inhibition of cellular HBsAg synthesis Drug modality AAV vector-based gene siRNA or anti-sense oligos therapy 4 WO 2025 / 006149 PCT / US2024 / 032725 Regimens A single injection Multi-injection Average efficacy 1-5 log reduction <2log Achieving undetectable Yes frequently No or rarely HBsAg Durability Durable Non-durable

[0027] Hepatitis B virus (HBV) is a hepatotropic DNA virus that may cause persistent and largely noncytopathic infection if caught in infancy [See, e.g., Summers J., Hepatology, 1981: 1(2): 179-83; and Seeger C, et al., The Liver: Biology and Pathobiology, 2020:793-820]. Establishing and maintaining HBV infection in hepatocytes requires the formation of episomal covalently closed circular DNA (cccDNA) molecules, which function as templates for viral transcription in the nucleus [See, e.g., Summers J, et al., Cell, 1982;29(2):403-15; and Tuttleman JS, et al., Cell, 1986;47(3):451-60]. Therefore, a single copy of cccDNA in an infected cell is minimally required. The cccDNA molecules are assumed to be long-lived [ Alter H, et al. Hepatology. 2018;67(3): 1127-31] because a chronic HBV infection usually lasts for years or decades [Seto W-K, et al., The Lancet, 2018;392(10161):2313-24]. Chronic HBV infection is thought to result from the failure of the host's immune system to clear the established infection [Guidotti LG, et al., Annual Review a / Pathology. 2006: 1 :23-61 l: therefore, it is comentionally viewed as a continuation of the established initial infection. Conventional HBV cure strategies aim to directly eliminate or permanently silence cccDNA [Alter H, et al. Hepatology. 2018;67(3): 1127-31], or clear infected cells from the Ii vers [Fanning GC, et al., Nature Reviews Drug discovery, 2019: 18( 11 ): 82 7-44].

[0028] HBV replicates robustly in infected human hepatocytes, as evidenced by high serum hepatitis surface B antigen (HBsAg), HBV DNA levels [See, e.g., Keating SM, et al., The Journal of Infectious Diseases, 2014;209(6):845-54; Jaroszewicz J, et al., Journal of Hepatology, 2010;52(4):514-22; and Nguyen T, et al., Journal ofHepatology, 2010:52(4):508-13], and accumulated HBsAg and hepatitis B core antigen (HBcAg) proteins in infected cells during chronic HBV infection [See, e.g., Naoumov NV, et al., Gastroenterology, 1990;99(4):1248-5312; and Chu CM, et al., Journal of Clinical Pathology, 1995:48(5):470-3] or in vitro infection [See. e.g., Ko C, et al., Journal of Hepatology, 2018:69(6): 1231-41: and Konig A, et al., Journal of Hepatology, 2019:71(2):289-300].The 5 WO 2025 / 006149 PCT / US2024 / 032725 intracellular accumulation of viral products may indicate that the secretion of viral particles by infected cells lags behind HBV replication capacity, which may cause cytopathic changes if not stopped. The retention of L protein in hepatocytes ofHBV transgenic mice causes a spectrum of pathologies, including necrosis and persistently elevated ALT levels, and the severity of pathology is related to the concentration of intracellular envelope proteins [Chisari FV, et al., Proceedings of the National Academy of Sciences of the United States of America, 1987:84(19):6909-13]. The intracellular HBsAg accumulation within smooth endoplasmic reticulum (ER) causes ER hyperplasia and displaces other organelles to the cell periphery, giving an appearance of "ground-glass" in some hepatocytes in chronic infection [Hadziyannis S, et al., Arch Pathol, 1973;96(5):327-30], [Gerber MA, et al., The American Journal of Pathology. 1974:75(3):489].However, most HBsAg-positive cells in liver sections do not show a ground-glass appearance [Deodhar K, et al., Journal of Clinical Pathology, 1975;28(1):66-70]. In the early 1990s, Summers et al. discussed the following principles on the replication and persistent infection of Hepadnaviruses: i. a persistent infection of Hepadnaviruses is contingent upon the inhibition of replication at late phase of infection; ii. control of cccDNA copy numbers is required to maintain persistent noncytopathic infection because high levels of cccDNA were ahrnys associated with cytopathic effects in infected hepatocytes; and iii. intracellularly accumulated L protein acts as an overall suppressor of replication and permits persistent infection [See, e.g., Summers J, et al., Journal o / Tirology, 1991:65(3): 1310-7; and Lenhoff RJ, et al., Journal o / Tirology, l 994:68(9):5706-13].

[0029] Clinical evidence has shown the dynamic evolution of the cccDNA population.The wild-type viral population in serum or cccDNA in the liver can be cleared and replaced with mutant populations during chronic hepatitis B infection [See, e.g., Brunetto MR, et al., Proceedings of the National Academy of Sciences of the United States of America, 1991:88(10):4186-90; Carman WF, et al., Lancet, 1989:2(8663):588-91; Jiang B, et al., Alimentary Pharmacology & Therapeutics, 2019;50(8):940-54; Chen Q-Y, et al., Infection, Genetics and Evolution, 2021: 105184: and Huang Q, et al., Hepatology (Baltimore, Md), 2020]. Complete cccDNA turnover in patients with chronic hepatitis B receiving nucleotide analog (NA) treatment occurs in a duration as short as 24 weeks [Huang Q, et al., Hepatology (Baltimore, Md), 2020].

[0030] The loss of pre-existing cccDNA is supported by the quantitative detection of cccDNA levels in serial liver tissues, which showed that cccDNA levels were progressively reduced by 20- to 100-fold during NA treatment of woodchucks chronically infected with 6 WO 2025 / 006149 PCT / US2024 / 032725 woodchuck hepatitis virus [Zhu Y, et al., Journal of Virology, 2001;75(1):311-22], an animal model closely resembling chronic HBV infection in humans. A 1-2.9 log reduction in cccDNA levels has also been reported in human patients treated with NA [See, e.g., Werle­ Lapostolle B, et al., Gastroenterology, 2004;126(7):1750-8; Wong DK, et al., Antiviral Therapy, 2006;11(7):909-16; Wursthom K, et al., Hepatology, 2006;44(3):675-84; Lutgehetmann M, et al., Antiviral Therapy, 2008; 13(1):57-66; Boyd A, et al., Journal of Hepatology, 2016:65(4):683-91: and Lai C-L. et al.. Journal ofHepatology, 2017;66(2):275- 81].The detected cccDNA reduction raises the possibility that cccDNA molecules can be spontaneously cleared from infected cells.

[0031] Taken together, the present imentor hypothesized that in vivo HBV-infected cells spontaneously clear cccDNA. Testing this hypothesis in uP A / SCIO chimeric mice with humanized livers that support a robust persistent HBV infection in the absence of functional T- and B-cell immunity [Tateno C, et al., PloS ONE, 2015; 10(1 l):e0142145], the present invention provides evidence supporting the concept of spontaneous cccDNA loss in HBV­ infected cells and an cccDNA elimination strategy that transforms spontaneous cccDNA clearance into progressive cccDNA elimination by blocking cccDNA replenishment. The present invention thus relates to the treatment of persistent HBV infection by blocking cccDNA replenishment and providing an efficient cccDNA elimination therapy.

[0032] The Anti-hepatitis B Drugs Used in This Invention

[0033] Any existing or newly developed anti-hepatitis B drugs which can block the replenishment and / or synthesis of cccDNA and / or rcDNA can be used in the methods of treatment described above. Such drugs include, but are not limited to, antibody drugs that are exogenous or endogenously expressed, small molecules drugs against any of HBV infection and replication steps, peptide drugs and vector drugs. The following AAV-anti-HBs vectors­ based HBV drugs that endogenously express anti-HBs antibodies after a single injection, were designed and tested in the present invention, and were found to be effective against chronic hepatitis infections by blocking cccDNA replenishment in cells, when used in the treatment methods described above. A total of nine AAV-anti-HBs vectors comprise the following sequences:

[0034] Nucleic acid sequence ID NO: 1 encodes the amino acid sequence of sequence ID NO: 2.Sequence ID NO:2 is the variable region of heavy chain of HBVZlO human anti-HBs monoclonal IgGl antibody against 4 serotypes of HBsAg. 7 WO 2025 / 006149 PCT / US2024 / 032725

[0035] Nucleic acid sequence ID NO: 3 encodes the amino acid sequence of sequence ID NO: 4. Sequence ID NO:4 is the variable region oflight chain ofHBVZl0 human anti-HBs monoclonal IgGl antibody against 4 serotypes of HBsAg.

[0036] Nucleic acid sequence ID NO: 5 encodes the amino acid sequence of sequence ID NO: 6. Sequence ID NO:6 is the variable region of heavy chain of HBVZ20 human anti-HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0037] Nucleic acid sequence ID NO: 7 encodes the amino acid sequence of sequence ID NO: 8. Sequence ID NO:8 is the variable region of light chain ofHBVZ20 human anti-HBs monoclonal IgGl antibody against 4 serotypes of HBsAg.

[0038] Nucleic acid sequence ID NO: 9 encodes the amino acid sequence of sequence ID NO: 10.Sequence ID NO: 10 is the variable region of heavy chain ofHBVZ30 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0039] Nucleic acid sequence ID NO: 11 encodes the amino acid sequence of sequence ID NO: 12. Sequence ID NO: 12 is the variable region of light chain ofHBVZ30 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0040] Nucleic acid sequence ID NO: 13 encodes the amino acid sequence of sequence ID NO: 14. Sequence ID NO: 14 is the variable region of hea,y chain ofHBVZ40 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0041] Nucleic acid sequence ID NO: 15 encodes the amino acid sequence of sequence ID NO: 16. Sequence ID NO: 16 is the variable region of light chain ofHBVZ40 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0042] Nucleic acid sequence ID NO: 17 encodes the amino acid sequence of sequence ID NO: 18.Sequence ID NO: 18 is the variable region of heavy chain ofHBVZ50 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0043] Nucleic acid sequence ID NO: 19 encodes the amino acid sequence of sequence ID NO: 20. Sequence ID NO:20 is the variable region oflight chain of HBVZ50 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0044] Nucleic acid sequence ID NO: 21 encodes the amino acid sequence of sequence ID NO: 22. Sequence ID NO:22 is the variable region of heavy chain of HBVZ60 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0045] Nucleic acid sequence ID NO:23 encodes the amino acid sequence of sequence ID NO: 24. Sequence ID NO:24 is the variable region of light chain of HBVZ60 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg. 8 WO 2025 / 006149 PCT / US2024 / 032725

[0046] Nucleic acid sequence ID NO: 25 encodes the amino acid sequence of sequence ID NO: 26.Sequence ID NO:26 is the variable region of heavy chain of HBVZ70 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0047] Nucleic acid sequence ID NO: 27 encodes the amino acid sequence of sequence ID NO: 28. Sequence ID NO:28 is the variable region oflight chain of HBVZ70 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0048] Nucleic acid sequence ID NO: 29 encodes the amino acid sequence of sequence ID NO: 30. Sequence ID NO:30 is the variable region of heavy chain of HBVZ80 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0049] Nucleic acid sequence ID NO:31 encodes the amino acid sequence of sequence ID NO: 32. Sequence ID NO: 32 is the variable region of light chain ofHBVZ80 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0050] Nucleic acid sequence ID NO: 33 encodes the amino acid sequence of sequence ID NO: 34.Sequence ID NO:34 is the variable region of heavy chain ofHBVZ90 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0051] Nucleic acid sequence ID NO:35 encodes the amino acid sequence of sequence ID NO: 36. Sequence ID NO: 36 is the variable region of light chain ofHBVZ90 human anti­ HBs monoclonal IgGl antibody against 4 serotypes ofHBsAg.

[0052] Nucleic acid sequence ID NO: 37 is nucleic acid sequence of AA V vector which consists of 3758bp including two ITRs (inverted Terminal Repeat from AAV), chicken Beta­ actin promoter, constant regions of human IgGl heavy and light chains, WPRE (woodchuck hepatitis virus posttranscriptional regulatory element), and SV 40 polyadenylation signal. This AAV vector (sequence ID NO: 37) allows cloning two variable regions of both heavy and light chains to express a full human IgGl monoclonal anti-HBs antibodies.

[0053] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof \\hich specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 2 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 4. or a variant thereof with at least 95% sequence homology. In one embodiment, the present imention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0054] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg 9 WO 2025 / 006149 PCT / US2024 / 032725 subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 6 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 8, or a variant thereof with at least 95% sequence homology. In one embodiment, the present imention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0055] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 10 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 12, or a variant thereof with at least 95% sequence homology. In one embodiment, the present imention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0056] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 14 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 16, or a variant thereof with at least 95% sequence homology. In one embodiment, the present invention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0057] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 18 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 20, or a variant thereof with at least 95% sequence homology. In one embodiment, the present invention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0058] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 22 and an antibody VL, wherein the VL comprises the amino acid 10 WO 2025 / 006149 PCT / US2024 / 032725 sequences of SEQ ID NO: 24, or a variant thereof with at least 95% sequence homology. In one embodiment, the present invention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0059] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH.wherein the VH comprises the amino acid sequences of SEQ ID NO: 26 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 28, or a variant thereof with at least 95% sequence homology. In one embodiment, the present invention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0060] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH, wherein the VH comprises the amino acid sequences of SEQ ID NO: 30 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 32, or a variant thereof with at least 95% sequence homology.In one embodiment, the present invention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0061] In one embodiment, the present invention is directed to an isolated binding molecule or antigen-binding fragment thereof which specifically binds to HBV virions and / or HBsAg subviral particles comprising an antibody VH. wherein the VH comprises the amino acid sequences of SEQ ID NO: 34 and an antibody VL, wherein the VL comprises the amino acid sequences of SEQ ID NO: 36, or a variant thereof with at least 95% sequence homology. In one embodiment, the present imention is directed to a nucleic acid molecule encoding the above isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention is directed to a vector comprising the above nucleic acid molecule.

[0062] In one embodiment.the present invention is directed to a method of curing chronic hepatitis B infection in humans, comprising administering to a subject in need thereof, an effective amount of an anti-HBs antibody producing vector to reduce cellular and blood hepatitis B surface antigen (HBsAg), by providing a sustained elevated level of anti-HBs antibody in the subject. In certain embodiments, the sustained elevated level of anti-HBs antibody l00rnIU / ml, l000rnIU / ml, 10,000mIU / ml, 100,000mIU / ml or higher for a period of 11 WO 2025 / 006149 PCT / US2024 / 032725 3-months or longer. In preferred embodiments, these levels of anti-HBs antibody are produced for the stated time period by a single administration of the anti-HBs antibody producing vector.

[0063] In preferred embodiments, the single dose administration of the anti-HBs antibody producing vector is an amount of lEl 1 copies or more, more preferably 2El 1 copies or more, still more preferably 1El2 copies or more, most preferably 3El2 copies or more.

[0064] If the concept of spontaneous cccDNA clearance from infected cells is valid. then continuous cccDNA replenishment is required to maintain cccDNA levels. The present invention method provides therapeutic interventions aimed at blocking cccDNA replenishment.

[0065] Two known pathways contribute to cccDNA replenishment: intracellular recycling and de novo infection. The intracellular recycling pathway involves the delivery of newly synthesized rcDNA molecules into the nucleus for cccDNA conversion [See, e.g., Tuttleman JS, et al., Cell, 1986;47(3):451-60; and Nassal M., Gut, 2015;64(12):1972-84] However, this pathway primarily operates during the early phase of replication and is impeded by the accumulation of envelope proteins during the late phase of replication [Lenhoff RJ, et al., Journal of Virology, l 994;68(9):5706-13]. Previous studies have suggested that de novo infection is the primary pathway of cccDNA replenishment [See, e.g., Konig A, et al., Journal of Hepatology, 2019;71(2):289-300; Allweiss L, et al., Gut, 2018;67(3):542-52; and Volz T, et al., Journal of Hepatology, 2013:58(5):861-71.

[0066] The present invention rethinks the cccDNA elimination strategy. Directly targeting cccDNA or killing infected cells is conventionally recommended for cccDNA elimination and complete cure of chronic HBV infection. Such a strategy may not be required based on the present invention. Instead, the present invention provides an unconventional cccDNA elimination strategy that does not require direct targeting of cccDNA molecules but aims to transform spontaneous cccDNA loss into progressive cccDNA elimination by blocking cccDNA replenishment.

[0067] In certain embodiments of the method of the present invention, the reduction of cellular and blood HBsAg occurs (i) with blocking of de novo infection mediated cccDNA replenishment or (ii) \\ithout direct inhibition of HBsAg synthesis, or both (i) and (ii).

[0068] In certain embodiments, the anti-HBs antibody provides blocking of de novo infection mediated cccDNA replenishment. In certain embodiments, the anti-HBs antibody blocks de novo infection through blocking HBV particles (virions and subviral particles) from attaching to human hepatocytes. In certain embodiments, the anti-HBs antibody has 12 WO 2025 / 006149 PCT / US2024 / 032725 specificity against the "a" determinant of HBsAg, and preferably has specificity against human hepatocyte attachment site in the '"a" determinant of HBsAg.

[0069] In certain embodiments, the anti-HBs antibody is provided by one or more administrations, wherein the administration is performed by a procedure selected from injection, infusion, oral administration, or transdermal administration. In embodiments of the invention, the sustained high level of anti-HBs antibody is provided either endogenously or exogenously.In certain embodiments, the anti-HBs antibody can be expressed through administering viral, non-viral vectors or nano particles that deliver human anti-HBs antibody genes or mRNA to express anti-HBs antibody or vaccines that express or directly deliver HBsAg proteins or peptides to elicit anti-HBs antibody response in receipts.

[0070] In certain embodiments, anti-HBs antibody is expressed through administering viral vectors, including, but not limited to, AAV vector-based therapy to express a sustained high level of anti-HBs antibody. In preferred embodiments, the AAV vector-based therapy comprises administration of one or more members selected from the group consisting of HBVZl0, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90. In certain embodiments, the exogenous anti-HBs antibody is infused or injected with human anti-HBs antibody, nanoantibody or antibody fragments.

[0071] In the method of the present invention, the reduction ofHBsAg in the blood can be progressive or precipitous, both having blood HBsAg reduced by 1-5 log, preferably 3-5 log, or to an undetectable level or <0.05IU / ml.

[0072] In one embodiment, the treating of chronic HBV infection comprises treating newborns / children who have been infected by HBV.

[0073] In one embodiment, the treating of chronic HBV infection comprises treating adults who have been infected by HBV.

[0074] In one embodiment, the HBV infected human patient is a chronic HBV infected individual who has been HBsAg positive for more than 6 months and have normal or elevated alanine aminotransferase (ALT) level.

[0075] In one embodiment, the HBV infected human patient is an HBV positive pregnant woman, or an organ transplant recipient who is HBsAg positive or HBsAg negative / anti hepatitis B core antibody (anti-HBc) positive, and is prone to recurrent HBV infection after transplant.

[0076] In one embodiment, the HBV neutralizing antibodies or antibody fragments are produced by HBV therapeutic vectors. 13 WO 2025 / 006149 PCT / US2024 / 032725

[0077] In one embodiment, the HBV therapeutic vectors comprise a mixed population of vectors each of which encodes one specific anti-HBs antibody or antibody fragment binding to one or more epitopes ofHBV envelope proteins, or a single vector which encodes one HBV neutralizing antibody or antibody fragment binding to one or more epitopes ofHBV envelope proteins.

[0078] In certain embodiments, the method is a monotherapy. In other embodiments, the method is a combinational therapy with one or more additional HBV drugs that inhibit intracellular HBV DNA, HBV RNA or / and viral proteins synthesis.In such combinational therapy embodiments, the one or more additional HBV drugs are preferably one or more members selected from the group consisting of reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inihibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunoregulatory drugs

[0079] In an important embodiment, this invention utilizes the finding that cccDNA molecules, the main transcriptional template directing cellular HBsAg synthesis, is frequently spontaneously lost from infected cells. HBsAg is being continuously secreted into blood from infected cells. cccDNA loss and ongoing HBsAg secretion will lead to emptying HBsAg in infected cells. Thus, HBsAg can be cleared from infected cells through secretion alone if the replenishment of depleted cccDNA pool is prevented. This understanding forms the foundation of this invention.

[0080] In a preferred embodiment, this invention recognizes that HBsAg can't be cleared if cccDNA pool in infected cells keeps replenished despite HBsAg secretion or the inhibition of HBsAg synthesis because the inhibition ofHBsAg synthesis alone does not address the root cause for maintaining HBsAg production in infected cells, as demonstrated by preclinical evaluations and clinical trials.

[0081] In a further embodiment, this invention utilizes the function ofHBsAg secretion, a natural process ofHBV infected cells and a property ofHBsAg proteins for clearing HBsAg from infected cells.

[0082] There are two pathways to replenish cccDNA pool. one is recycling pathway that transports the de novo synthesized rcDNA molecules to nuclei for cccDNA conversion, and the other is do novo infection in ,vhich virions circulated in blood attach and enter hepatocytes to initiate new rounds of infection through establishing cccDNA pool in the nuclei of infected hepatocytes.However, these two cccDNA replenishment pathways are not utilized equally. This imentor found that the recycling pathway is generally restricted, and de 14 WO 2025 / 006149 PCT / US2024 / 032725 novo infection is the main pathway to replenish cccDNA pool. Thus, an expanding embodiment of this imention aims to block de novo infection to effectively prevent cccDNA replenishment.

[0083] To further demonstrate this invention, a durable blocking of de novo infection can be realized through using AAV-anti-HBs vectors that express sustained high level of anti-HBs antibody after a single intramuscular injection, which not only deliver durable efficacy without HBsAg relapse, but also simplifies the therapies for HBsAg reduction.

[0084] In a combined embodiment, in contrast to the current method of reducing serum HBsAg level through direct inhibition of intracellular HBsAg synthesis, the present invention reduces cellular and serum HBsAg through blocking cccDNA replenishment that eliminate the root cause for HBsAg production. In addition, this method does not require the direct inhibition of cellular HBsAg synthesis. EXAMPLES

[0085] Example 1. Experimental procedures using uP A / SCID chimeric mice for HBV infection and treatment.

[0086] A total of 49 HBV infected uP A / SCID chimeric mice were divided into 7 groups as illustrated in table 2 belm,v.

[0087] Table 2. Animal experiment design Group Starting Doses Duration Treatment 1. AAV malaria antibody Dav 15 2.5E11 qenome copies IM 30W infection 2. HBVZ10 monotherapy Dav 15 2.5E11 qenome copies IM 27W HBVZ10 treatment 3. HBVZ10+ETV Day 15 2.5E11 AAV vector+ ETV 12W ETV + 27W 0.3mg / kg 3 times a week for 16 HBVZ10 treatment weeks 4. H BVZ10 monotherapy Dav 29 1.8E12 qenome copies IM 25 W HBVZ10 treatment 5. HBVZ10+ETV Day 29 1.8E12 AAV vector+ ETV 12W ETV + 25W 0.3mg / kg 3 times a week for 16 HBVZ10 treatment weeks 6. HBVZ10 monotherapy Dav 50 5.7E12 qenome copies IM 22W HBVZ10 treatment 7. HBZZ10+ETV Day 50 5.7E12 AAV vector+ ETV 12W ETV + 22W 0.3mg / kg 3 times a week for 16 HBVZ10 treatment weeks

[0088] Serial blood samples were drawn biweekly or triweekly until termination upon which liver tissues were collected and snap-frozen.

[0089] Example 2. Analyzing HBV infection in blood and liver samples

[0090] HBsAg, HBeAg, HBV DNA, anti-HBs antibody, and human albumin levels in serial blood samples ,vere quantitatively analyzed. 15 WO 2025 / 006149 PCT / US2024 / 032725

[0091] Average intracellular HBsAg, rcDNA, and cccDNA were determined by quantitative assays of 20 samplings of each liver.

[0092] Western blot of HBsAg in liver lysates and immunohistochemical staining of HBsAg and HBcAg in liver sections were also performed.

[0093] Figures lA-1D provide graphical representations of kinetic HBsAg levels in blood of HBV infected uP A / SCID chimeric mice with humanized livers (from day 14 to day 162 post infection), wherein Figure IA shows Group 1 (GI) without treatment; and Figures lB-1D represent where Groups 2 and 4 (G2-G4) were treated with HBVZIO and 12-weeks of entecavir but started at different timepoints to allow HBsAg to reach different levels. HBVZl0 was given at day 11 (dl 1) at a dose of 2.5El l copies and day 58 at a dose of 4El l copies, respectively in G2 (Figure lB), given at day 22 at dose of l .8El2 copies in G3 (Figure IC), and given at day 44 at dose of 7.2El2 copies in G4 (Figure 1D). Timepoints were truncated among mice who deceased prior to day 162. Lower limit of qualification for HBsAg is 0.05IU / ml (HBsAg EIA kit Bio-rad).

[0094] Figure 2 provides a graphical representation of copies of HBsAg per cell and numbers of input cells for assaying HBsAg in liver lysates from HBV infected uP A / SCID chimeric mice with humanized livers. Cellular HBsAg levels were titrated by serial dilutions from 1 / 1000, 1 / 100. 1 / 10, 1 / 2, 1 / 3.3, and 1 / 2.5. The inhibitory effect was detected at 1 / 2.5 dilution and the allowable dilution was 1 / 3.3. A total of 4 lysates from each of animals 825. 838, and 831 were analyzed and numbered as .1, .2, .3, and .4, respectively.

[0095] Figures 3A-3B shows numeral relation of cellular HBsAg and rcDNA per cell among mice in Figure 2. Figure 3A prm·ides a graphical representation showing the copies of HBsAg and rcDNA per cells in 2 mice with undetectable serum HBsAg and one untreated mouse control. Figure 3B provides the ratios of cellular HBsAg and rcDNA in the mice of Figure 3A.

[0096] Example 3.The present invention method showed more effective serum HBsAg reduction than the reported efficacy with siRNA or ASO drugs that directly inhibit intracellular HBsAg synthesis, specifically.

[0097] 1. All treated mice with this invented method responded with serum HBsAg reduction. Furthermore, 3-5 log progressive reduction of serum HBsAg was observed and serum HBsAg became undetectable in 8 of 11 mice as of day 162 post inoculation. Note: the 16 WO 2025 / 006149 PCT / US2024 / 032725 direct inhibition of intracellular HBsAg synthesis showed average <2log reduction in both preclinical evaluations and clinical trials.

[0098] 2. Progressive serum HBsAg reduction was closely paralleled with progressive reduction of serum HBeAg levels, implying that the observed progressive serum HBsAg reduction reflects progressive HBV clearance in the livers.

[0099] 3. Intrahepatic HBsAg, rcDNA, and cccDNA levels were lowered by 3-4 logs in mice with undetectable serum HBsAg compared to untreated control mice.Materials and Methods Animals and HBV infection

[00100] All animal experiments were performed at Noble Life Sciences Inc (Sykesville, MD), a preclinical research contract service provider. The selection of Noble Life Sciences Inc as the subcontractor to perform animal experiments was approved by the NIAID contract office at NIH (NIH approved Animal Welfare Assurance number, A4633-0l). All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Noble Life Sciences protocol NLS-614. All animals received humane care.

[00101] Immunocompetent female mice (CDl) were purchased from Charles River Laboratories (Boston, MA, USA), and immunodeficient male mice (uPA / SCID chimeric mice) were supplied by PhoenixBio USA (New York. NY, USA). All mice were kept in housing cages (TP107, One Corporation, Osaka, Japan) in an BSL-2 room with controlled temperature at 23°C and 12 hour-light / dark cycle.All animals fed with y-radiated CRFl food and autoclaved water ad libitum. An HBV inoculum (HBsAg ADR subtype / genotype C). prepared from mouse serum (project no H0l-108 animal 4) by diluting viremia of 5£9 HBV DNA copies / mL to 2£7 HBV DNA copies with PBS in 100 µl volume, was administered intravenously (tail vein) to each chimeric mouse. AAV-anti-HBs vector (HBVZJO)

[00102] The present invention provides new HBV therapy candidates called AAV-anti-HBs vectors, which utilize an optimized adeno-associated virus (AA V) vector [See, e.g., Balazs A, et al., Nature Medicine, 2014;20(3):296-300; Balazs A, et aL Nature Biotechnology, 2013:31(7):647-52; de Jong YP. et al.. Science Translational Medicine. 2014:6(254):254ral29: and Deal C, et al., Proceedings of the National Academy of Sciences of the United States of America, 2014; 111(34): 12528-32] to deliver human anti-hepatitis B surface antigen ( anti-HBs) antibody genes.The AA V-anti-HBs vectors of preferred 17 WO 2025 / 006149 PCT / US2024 / 032725 embodiments of the present invention express sustained high levels of anti-HBs antibody after a single injection. By using these AAV-anti-HBs vectors as a new HBV therapy candidate, the method of the present invention remedies the deficiency in anti-HBs antibody production in chronic HBV infection. A most preferred AAV-anti-HBs vector is HBVZl0. Administration ofHBVZlO intramuscularly in chimeric mice expresses human anti-HBs antibody endogenously and blocks de novo infection in the absence or presence of entecavir. Production of AA V-anti-HBs or anti-malaria antibody vectors

[00103] Briefly, 293 cells were co-transfected with an AAV vector encoding anti-HBs or anti-malaria antibody and the plasmid pDP8.ape (PlasmidFactory, Bielefeld, Germany), which provides pHELP plasmid function and encodes AA V2 rep and AA V8 cap proteins in trans for packaging AA V vectors.The resultant AA V vector does not contain any viral open reading frame (ORF). AA V was purified via PEG precipitation and cesium chloride ultracentrifugation. The infectivity of AA V aliquots was confirmed in vitro by transducing 293 cells and quantifying the antibody concentration in the medium using ELISA A total of 1El4 genome copies were obtained for each vector after production, purification, and concentration. HBVZJO administration doses

[00104] A small dose of HBVZl Oat lEl 1 genomic copies was intramuscularly administered in animal experiments 1 and 2, and the higher doses ofHBVZlO at 2.5El L 1.8El2 or 7El2 genomic copies were administered for animal experiment 3.Monitoring HBV infection and human albumin level in blood

[00105] Blood was collected tri-weekly for quantification of serum HBV DNA (qPCR see below), HBeAg (CSB-El3557h, CUSABIO), HBsAg (GS HBsAg EIA 32591, Bio-Rad), anti-HBs antibody (MONOLISA Anti-HBs EIA 25200, Bio-Rad) with calibrators (MONO LISA Anti-HBs 20-Calibrator kit 25219, Bio-Rad) and human albumin (Human albumin ELISA kit E-80AL Immunology Consultants Laboratory) levels by ELISA per instructions. In addition, serum HBsAg in the selected samples was analyzed by western blot. Alanine transaminase (ALT) activity in serum

[00106] Serum ALT activity was assessed using the alanine transaminase colorimetric assay kit (Cayman Chemical item no 700260) according to the detection manual. Absorbance 18 WO 2025 / 006149 PCT / US2024 / 032725 values were measured at 340 nm once per minute for 10 min, and the resulting 10 absorbance values were plotted against time.Due to limited serum volumes, a modification was made: the 20 µl serum sample was adjusted to 10 µl and compensated with 10 µl of H2O. Consequently, in the calculation formula, the 0.02 ml of serum sample was adjusted to 0.01 ml accordingly. Analysis ofintrahepatic HBV DNA

[00107] Each liver was randomly sampled 20-40 times by cutting 20-40 mg liver tissue (weighed and recorded) and placed in a disposable micro-homogenizer (BioMasher, Takara cat no: 9790B) in 500 µl of an isotonic buffer (154 mM Tris-HCl, pH 7.5, 1 mM EDTA and 0.05% TritonX-100) with 10 strokes. The homogenized tissue suspension was spun for 2 min at 14,000 rpm and 100 µl oflysate were saved for western blot or ELISA of intracellular HBsAg and the remaining 400 µl transferred to a new microtube for isolation of replicative intermediates (RI) while nucleic pellet remained in the tube for cccDNA isolation.

[00108] Two negative controls were included for each round of extraction, one placed in the 1st sample position and the other in the last position to monitor any contamination during extraction. Extraction of rcDNA from the 400 µl supernatant is peiformed by the following procedure: [Zhang YY, et al., Journal of Virology, 2004;78(3):1195-201}

[00109] 1. Add 110 µl of proteinase K (final 0. 5 mg / mL) with 1 % SDS and incubate at 50°C for an hour. 2. Add 500 µl phenol, vortexed and chilled on ice for 3 min and centrifuge at 14,000 rpm for 2 min. 3. Transfer the supernatant to a new tube and add 1000 µl of 100% ethanol for precipitation and centrifuge samples at 14,000 rpm for 15 min. 4. Wash pellets with 1000 µl of 100% ethanol at 14,000r pm for 10 min. 5. Remove residual ethanol and air dry for 5 min. 6. Dissolve the pellet in 200 µl of 10: 1 TE buffer, pH 7.4, and then the rcDNA is ready for qPCR 19 WO 2025 / 006149 PCT / US2024 / 032725 Extraction of cccDNA.from nucleic pellets is performed by tlte following procedure: [Zhang YY, et al., Proceedings of the National Academy of Sciences of the United States ofAmerica, 2003: 100(21): 12372-7]

[00110] 1. Suspend pellet with 200 µl of 10: 1 TE with 0.05% Triton-XlO0 pH7.4. 2. Add 200 µl of 6% SDS-0.1 M NaOH solution and incubated at 37°C for 15 min. 3. Add 100 µI of 3 M KAc pH 5.07 and mix thoroughly. Chill on ice for 5 min and then microfuge to remove KSDS-protein-ssDNA complexes (pellet) at 14,000 rpm for 2 mm. 4. Transfer supernatant to a new tube, add 500 µI of phenol, and centrifuge at 14,000 rpm for 2 min. 5. Recover supernatant and add 5 µI of glycogen (4µg / µl for total 20µg). 6. Add 1000 µI ethanol and centrifuge at 14,000 rpm for 15 min. 7. Wash with 1000 µI ethanol and centrifuge at 14,000 rpm for 10 min. 8. Dissolve in 50 µI EcoR I buffer at 37°C for 15 min and inactivate at 80°C for 20 min. The cccDNA samples are ready for qPCR.RT-qPCR detection of total HBV RNA in cccDNA and rcDNA samples

[00111] Total HBV RNA levels were determined in each of 120 cccDNA and 120 rcDNA samples prepared from untreated mice 842 and 836 (representing the amplification phase), 831 and 987 (representing the maintenance phase), and 38 and 813 (treated who achieved progressive reduction of serum HBsAg to undetectable levels accompanied by> 100-fold reduction in cccDNA). Specifically, 20 cccDNA and 20 rcDNA samples from each liver were tested. Average RNA concentrations in cccDNA samples were approximately l.5µg / µl and 0.5µg / µl in rcDNA samples. A260 / 280 ratios varied narrowly between 1.98 and 2.08. All RNA samples were 10-fold diluted and then 2µ1 were used for RT-qPCR with TaqMan™ Fast Virus I-Step Master Mix (Thermo Fisher 4444432) and primers / probe located in S gene (rcDNA for qPCR in Table 3).rcDNA was also detected in the same cccDNA and rcDNA samples ,,iithout RT in the same plates with the same primers / probe for RNA detection, in addition to cccDNA detection in the same cccDNA samples. The detected HBV RNA levels were approximately 10 times higher than those of rcDNA in the same samples. The net RNA copies are plotted after subtracting rcDNA copies in the same samples. The ratios of RNA copies / cell to cccDNA copies / cell were calculated using the total net RNA copies (nuclear RNA copies+ cytoplasmic RNA copies). 20 WO 2025 / 006149 PCT / US2024 / 032725 RT-qPCR detection of human Ki67 RNA levels in 840 cccDNA samples

[00112] One set of pre-stocked human Ki67 RNA primers / probe system (F AM-MGB, Hs01032435 _gl) was purchased from ThermoFisher Scientific. This detection system generates a 179 bp-long amplicon that was isolated for the preparation of qPCR standards.Two microliters of cccDNA containing total nuclear RN As were used for RT-qPCR detection of human Ki67 RNA with the same TaqMan™ Fast Virus I-Step Master Mix (Thermo Fisher 4444432). To first establish a broad picture of Ki67 RNA expression in humanized livers of chimeric mice, a total of 840 cccDNA samples from 42 livers were analyzed, including 15 untreated, 11 treated vvith either anti-HBs antibody or a combination ofHBVZl0 with entecavir but with detectable serum HBsAg (HBsAg+), and 16 treated with progressive reduction of serum HBsAg to undetectable levels (HBsAg-). Subsequently, correlation analysis between Ki67 RNA and cccDNA in the same samples was conducted using scatter plots, generating correlation trendlines and R2 values. The cccDNA samples were consistently stored at -20°C, and all handling procedures were conducted in a biosafety cabinet with an air blower on. All tips, plates, tubes, and solutions used were nuclease-free.Analysis of differences in Ki67 RNA levels between the existing cccDNA and newly isolated cccDNA samples from 5 foers (mice 907,471,987,831, and 805) revealed unremarkable results ( data not shown), indicating no noticeable degradation of RNA samples in the existing cccDNA samples. qPCR t~f serum HBV DNA and intraltepatic rcDNA and cccDNA

[00113] Primers and probe sequences for detection of serum HBV DNA and intracellular rcDNA by qPCR are listed in Table 3 while primers sequences for detection of cccDNA flank the gap region and the probe is placed immediately after ORI sequence (Table 3).

[00114] Table 3. Positions and sequences of cccDNA and rcDNA primers and probes Target Primer ID Nucleotide Sequence position rcDNA in Panl22F 520-537 ccagcacgggaccatgc (SEQ ID No. 38) qPCR Pan160R 655-637 tgaggcccactcccatagg (SEQ ID No. 39) S probe 563-583 FAM'tgttgctgtacaaaaccttcg (SEQ ID No. 40) rcDNA in rcDNA 1345-1370 gtcctctctcggaaatacacctcctt (SEQ ID No.41) dPCR forward rcDNA reverse 1454-1438 tccgcgggattcagcgc (SEQ ID No. 42) rcDNAprobe 1372-1405 Cy5' ccatggctgctcgggtgtgctgccaactggatcc (SEQ ID No. 43) 21 WO 2025 / 006149 PCT / US2024 / 032725 cccDNA in HBVcccF 1550-1570 cgtctgtgccttctcatctgc (SEQ ID No. 44) qPCR and dPCR HBVcccR 1885-1868 aaggcacagcttggaggc (SEQ ID No. 45) cccDNA probe 1835-1862 FAM' ctaatcatctcttgtacatgtcccactg (SEQ ID No. 46)

[00115] The specificity of the listed cccDNA primers and probe can discriminate against rcDNA amplification by 300-6000-fold. qPCR was performed using Taqman fast advanced master mix (ThermoFisher cat no:4444558) in a QuantStudio 3 instrument (ThermoFisher cat no: A28136) that accommodates 0.1 ml 96-well hard-shell plate.

[00116] All standards used for qPCR were calibrated with the Absolute Q digital PCR. Absolute Q (ABQ) Digital PCR of cccDNA

[00117] cccDNA copies / cell were computed initially based on qPCR, then retested with the Absolute Q digital PCR (ThermoFisher cat no: A52864).Briefly, the procedures included the following steps: 1. Prepare 9.1 µl reaction mix consisting of 1.8 µl of 5x DNA dPCR mix (ThermoFisher cat no: A52490), 0.5 µl of 20x primers / probe mix (final concentration 900nM each primer and 250 nM probe). 1 µl cccDNA sample, and 5.8 µl of DNase and RNase free H2O 2. Load 9 µl reaction mix into one well of microfluidic array plate (MAP, ThermoFisher cat no: A53301) 3. Run dPCR consisting of 10 min preheat at 96°C and 40 cycles of 5 sat 96°C and 15 s at 60°C 4. Generate data reports using QuantStudio Absolute Q Digital PCR software.

[00118] The sensitivity of dPCR is a single copy per microchamber and the result deemed valid if Rox fluorescent signal was read in> 19,000 of 20,480 microchambers for each sample.Procedures and principles of simultaneous detection of cccDNA and rcDNA by ABQ duplexing Digital PCR in the same nuclei

[00119] The main procedures for the detection of both cccDNA and rcDNA in the same nuclei are as follows: 22 WO 2025 / 006149 PCT / US2024 / 032725 1. Homogenizing 20-30mg liver tissues in 500µ1 of homogenization buffer (10 mM Tris_HCl (pH 7.5). 3 mM MgC12. 0.25 M sucrose. and 0.05% Triton X-100). The nuclei were pelleted by centrifugation and resuspended in homogenization buffer containing 2µg / ml ethidium bromide. 2. Individual nuclei were singly sorted and deposited in wells of 96-well plates. 3. The deposited nuclei were digested by proteinase Kat concentration of 0.5mg / ml for 60 min, then inactivated for 15 min at 80 C. 4. The released HBV DNA was linearized ,vith NcoI digestion. 5. The linearized HBV DNA was subjected to ABQ dPCR detection of both cccDNA and rcDNA.Principles of simultaneous detection of cccDNA and rcDNA by ABQ duplexing Digital PCR in the same nuclei

[00120] The ABQ digital PCR instrument can simultaneously detect 4 fluorescent signals of FAM, VIC, ABY, and JUN / Cy 5, which allows to detect 4 different targets in the same reaction (Multiplexing). The emission wavelengths of FAM and Cy5 are 517 and 670 nm, respectively, and there is no overlapping in their wavelength spectrum. Thus, FAM was selected for labeling cccDNA probe and Cy5 for labeling rcDNA probe to detect both molecules in the same reaction, called duplexing dPCR.

[00121] The specificity of cccDNA detection is provided through cccDNA specific primers that flank the gap region in HBV genome and the cccDNA-specific probe that is placed immediately after DR I sequence (Table 3). Linearized cccDNA template cannot generate.fluorescent signal with rcDNA primers / probe detection system

[00122] HBV DNA released from each of the deposited nuclei will be subjected to NcoI digestion to exclude cccDNA from detection with rcDNA primers / probe. Plus strand in rcDNA is only partially synthesized, containing a single-stranded gap of 600-2100 nucleotides at 3' end f Summers J, et al., Proceedings of the National Academy of Sciences of the United States of America, l 975;72(11):4597-601]. Since NcoI is located between ntl372 and 1376, close to the 3'end of plus strand. Therefore it is most likely present in a single­ strand sequence in rcDNA molecules [Summers J, et al., Proceedings of the National Academy of Sciences of the United States ofAmerica, 1975:72(11):4597-601]. Thus, NcoI will linearize cccDNA but cannot cut rcDNA. 23 WO 2025 / 006149 PCT / US2024 / 032725

[00123] The Ncol linearized cccDNA sequence starts ,vith Cat ntl373 (5') and ends with C at ntl372 (3').rcDNA forward primer \\ill bind the 3' end of the linearized cccDNA, but the rcDNA probe binds its 5' end. The Taq DNA polymerase that binds the forward primer at 3' end cannot reach the probe that is located at the 5' end, thus cannot cut off the 1st base C with Cy5 dye through its 5' -3' exonuclease activity, and the Cy5 fluorescent signal cannot be generated. Cy5 fluorescent signal will be generated if both rcDNA forward primer and probe bind a continuous template comprising ntl345 to ntl454 sequentially, that is, F primer binds upstream of the probe binding position, which only occurs in rcDNA after Ncol cut. Thus, rcDNA, but not cccDNA, will be specifically detected with rcDNA primers / probe following Ncol cut.

[00124] An HBV DNA plasmid (an ADW subtype monomer cloned into the Psp65 vector) was used that was linearized by Ncol as a surrogate cccDNA molecule to validate that cccDNA was not detected by the rcDNA probe / primers.The Ncol-digested plasmid was serially diluted and tested using ABQ-duplexing dPCR containing both cccDNA and rcDNA probe / primers. Serially diluted cccDNA molecules were detected using the FAM labeled cccDNA probe; however, no positive signal was detected using the Cy5 labeled rcDNA probe, which detects the extracted rcDNA. Verification of simultaneous detection of both cccDNA and rcDNA.

[00125] The cccDNA samples extracted with the modified Hirt method [Zhang YY, et al., Journal of Virology, 2005;79(15):9896-9031 contain rcDNA molecules. Deproteinized rcDNA molecules were detected in the extracted cccDNA samples using Southern blot [See, e.g., Tuttleman JS, et al., Cell, 1986;47(3):451-60; Gao W, et al.,Journal of Virology, 2007;81(12):6164-74; and Blondot M-L, et al., Journal of Hepatology, 2016;64(1):S49-S59]. Therefore, the extracted cccDNA samples were used to evaluate the ability of duplexing dPCR to detect cccDNA and rcDNA.The rcDNA was detected by a regular qPCR in the extracted cccDNA samples using a FAM labelled rcDNA probe. Both cccDNA and rcDNA were detected in the extracted cccDNA samples by ABQ-duplexing dPCR. These results not only demonstrated the ability of duplex dPCR to detect both cccDNA and rcDNA molecules, but also support the idea that nuclear rcDNA molecules can be used as HBV infection markers.

[00126] The sorted nucleus in each well is subjected to Ncol digestion. The DNA sample from a single nucleus will be mixed with dPCR solution containing both ccc and rcDNA primers / probes and loaded into microfluidic array plate (MAP) for dPCR detection. The dPCR results will be generated using QuantStudio absolute Q digital PCR software 6.0. 24 WO 2025 / 006149 PCT / US2024 / 032725 Threshold.for FAM and Cy5 positive fluorescence

[00127] After extensively evaluating fluorescent intensity and distribution pattern among cccDNA positive and uninfected samples, the 500 rnlue of both FAM and Cy5 fluorescent intensity was set as threshold for positive signal. However, about 5% of positive FAM signal and 1 % Cy5 positive signal was detected among 576 nuclei prepared from 3 uninfected human livers (2 purchased from PheonixBio and one collected before infection) because there were some free fluorescence molecules remained in each probe despite the standard HLPC based purification of FAM and Cy5 labeled probes. Free fluorescence molecules are not associated with the quencher and can be detected at high intensity without amplification if many free fluorescence molecules are distributed in a microchamber. For example, ROX fluorescence (unlabeled and in free form) is included in ABQ dPCR master mix and distributed to each microchamber for quality control.However, the number of ROX molecules distributed to each of 20480 microchambers varied and resulted in high intensity if many molecules are distributed in one microchamber. Using the findings from the 3 uninfected livers as reference, that false positive rates for cccDNA and rcDNA by duplexing dPCR were were assumed at about 5% and 1 %, respectively, implying that the true number of cccDNA positive nuclei in each of 3 infected liver samples could be 5% lower than the number detected. However, they do not significantly impact the main findings of cccDNA­ / rcDNA + nuclei.Detected rcDNA molecules in the nuclei were not non-specifically hound to nuclei

[00128] To evaluate the possibility that detected rcDNA in sorted individual nuclei was non­ specifically bound to nuclear membrane during preparing nuclei suspension through homogenization that released virions and capsids into lysate, nuclei suspensions were prepared from two livers of two uninfected chimeric mice (animal ID HKB-043-020 or B20 and HKB-043-046 or B46 purchased from PheonixBio). Each nuclei suspension was divided into two vials, one was directly used for sorting, the other was mixed with lysate ( containing 0.05% triton-Xl00) from mouse 987 who was an untreated control with average 870 copies of rcDNA / cell for 20 minutes. then removed the lysate and dissolved in isotonic buffer (154: 1 TE with 0.05% triton-XlO0) for sorting. The sorted nuclei from 4 vials were subjected to duplexing ABQ dPCR.Table 4 shows no significant differences in detecting nuclei with Cy5 intensity ~500 between two nuclei suspensions mixed with mouse 987 lysate and the two nuclei suspensions without mixing, suggesting that detected rcDNA molecules in sorted nuclei unlikely derived from released virions and capsids that non-specifically bound nuclei, 25 WO 2025 / 006149 PCT / US2024 / 032725 which is consistent with the concept that HBV capsid mainly utilizes cellular transport machineries, but not diffusion or passive trapping to reach nuclear membrane where interaction between nuclear localization signal on capsid and nuclear import receptors occurs [See, e.g., Blondot M-L, et al., Journal of Hepatology, 2016:64(1):S49-S59: and Gallucci L, et al., Viruses, 2017;9(1):21].Western blot of HBsAg in serum and HBsAg and HBc proteins in liver lysates

[00129] Serum and liver samples were resolved using SDS-PAGE and HBV surface proteins were detected by western blot analysis using a rabbit polyclonal anti-HBs antibody (Virostat) [See, e.g., Hong X, et al., Journal of Virology, 2021;95(3): 10.1128 / jvi. 01695-20; and Xi J, et al., Journal of Virology, 2022:96(1):e01305-21]. Immunohistochemical staining of HBsAg on sections

[00130] Briefly, formalin-fixed paraffine-embedded liver sections were cut at thickness of 5µM and used for HBsAg staining after deparaffinization, proteinase K digestion, and inactivation of endogenous peroxidase with 3% hydrogen peroxide. Rabbit anti-HBs antibody (LS-C683282, LSBio) and goat anti-rabbit IgG conjugated with HRP (LS-C316062, LSBio) were used as primary and secondary antibody. respectively. DAB chromogen kit (ACH500- IFU, CP Lab Chemicals) was used for color development.Statistical analysis

[00131] HBsAg (IU / ml) and HBV DNA (copies / ml) and antibody levels (µg / mL) are expressed as mean± standard deviation (SD). Average intracellular rcDNA and cccDNA levels are expressed as copies / cell. The number of cells per sampling was calculated using sample weight (mg) multiplied by l.39E5 cells per mg liver tissue [Sohlenius-Stembeck A-K, Toxicology in vitro, 2006;20(8): 1582-6], then normalized by factor 0.7 by considering 70% of human liver cells are hepatocytes [Mason WS, et al., Journal of Virology, 2010:84(16):8308-15. Epub 2010 / 06 / 04]. The formula to calculate copies / cell is listed below: Total rcDNA or cccDNA copies in a liver sample Copies / cell=-----------------­ Sample weight (mg) * 1.39e5 * 0.7

[00132] The procedure to demonstrate the method of the present invention included three components: 1. Assessing the impact of efficient HBV replication on the presence of cccDNA in infected cells 26 WO 2025 / 006149 PCT / US2024 / 032725 2.Analyzing cccDNA levels at the bulk-cell and single-nucleus level 3. Evaluating the therapeutic impact on cccDNA levels by blocking cccDNA replenishment In vivo replication kinetics suggested that the inhibition of HBV replication was likely mediated through cccDNA clearance

[00133] To understand the kinetics of in vivo HBV replication, HBV-infected, untreated chimeric mice were euthanized on days 18. 45. 50, 52. 82. 99, 141. and 212 post inoculation (pi) for assaying kinetic serum HBsAg and HBV DNA levels and intrahepatic HBV markers. There were two infection phases (Figures 4A and 4B). The first was the phase of spread of infection to all infectible cells in which both serum HBsAg and HBV DNA levels rapidly increased after inoculation and peaked at around day 82 pi. The second was the persistent infection phase where HBV infection was maintained at a steady level.The observed kinetics of serum HBsAg and HBV DNA in this model recaptures the typical acute HBV infection that becomes persistent in humans [Keating SM, et al., The Journal of Infectious Diseases, 2014:209( 6):845-54].

[00134] The kinetics of intracellular accumulation of viral products also comprises two phases as sho\\n in Figure 4C. The first was the phase of a progressive increase in the accumulation of viral products. For instance, intrahepatic HBsAg levels increased from 230 copies per cell on day 18 to 110,000 copies on day 82 pi, which reflects a robust HBV replication and that the secretion of virions and subviral particles lags behind unrestricted HBV replication during the accumulation phase. The second was the phase of stopping the increase in the accumulation after the peak on day 82 pi. For instance, intracellular HBsAg levels remained at approximately 100,000 copies / cell after the peak.Average cccDNA levels fluctuated 2-fold but also ceased to rise over the next 130 days. Serum HBsAg and HBV DNA levels remained steady (Figures 4A and 4B). indicating the arrest in the accumulation was unlikely caused by an increase in the secretion of viral particles, rather by the inhibition of replication that is required to establish persistent noncytopathic infection [See, e.g., Summers J, et al., Journal of Virology, 1991;65(3): 1310-7; and LenhoffRJ, et al., Journal of Virology. l 994;68(9):5706-13].

[00135] Direct cytopathic effects of HBV infection in this model were reported

[35] . Severely confluent liver necrosis with numerous infiltrates that involved up to 50% of the parenchyma on sections was observed in 4 of 18 HBV-infected livers but was absent in the remaining 14 liver sections. 27 WO 2025 / 006149 PCT / US2024 / 032725

[00136] As noted above, in vivo cccDNA kinetics includes two phases (Figure 4C), and cccDNA can be lost in both phases: 1. Amplification phase.The total cccDNA level in the liver was amplified mainly by expanding the infection in the liver. The cccDNA pool in individual infected cells is amplified through the intracellular recycling pathway in the early phase of infection [See, e.g., Tuttleman JS, et al., Cell, 1986;47(3):451-60; Ko C, et al., Journal of Hepatology. 2018;69(6): 1231-41: Summers J, et al.,Journal of Virology, l 990;64(6):2819-24; and Tuttleman JS, et al., Journal o.f Virology, 1986;58(1):17-25]. The cccDNA level vvas increased from 0.00001 copies / cell ( day 18 pi) to 0.35 copies / cell on day 82 pi. This was not the only event that occurred. Reaching peak infection means that all infectible cells must have been infected, as evidenced by the detection of HBsAg and HBcAg in almost all hepatocytes. The cccDNA level is expected to be ~1 copy / cell because a minimum of one copy of cccDNA is required in each infected cell. However, the average cccDNA level at peak infection (day 82 pi) was 0.35 copies / cell, that is, approximately 1 copy of cccDNA per 3 infected cells, suggesting that cccDNA after the initial establishment may have been lost in a portion of infected cells. 11. Maintenance phase. cccDNA was maintained at a steady level (0.35-0.6 copies / cell) to maintain HBV infection at a steady level upon reaching the peak. With an average cccDNA level of <l copy / cell, the Poisson distribution predicted that some cells may contain> 1 copy / cell and other cells may contain no cccDNA. This suggests that cccDNA was spontaneously cleared from some cells during the maintenance phase. Therefore, a steady HBV infection level in the persistent infection phase is likely reached by establishing an equilibrium between the number of infected cells with cccDNA that maintain HBV replication and those that have lost cccDNA and ceased viral replication. This implies that the infected cells regulate HBV replication mainly by clearing cccDNA.Average cccDNA levels after peak infection were <1 copies / cell

[00137] The analysis of cccDNA levels in untreated mice can be extended to obtain the range of cccDNA levels in livers. To avoid non-representative findings by a single sampling or a few samplings, each liver was routinely sampled 20 times, resulting in 220 cccDNA samples from 11 livers collected between days 82 and 253 pi. The highest average cccDNA 28 WO 2025 / 006149 PCT / US2024 / 032725 level was 2.5 copies / cell while the lowest was 0.003 copies / cell among the 220 cccDNA samples (Figure 5A).

[00138] The average cccDNA levels in 28 (12.7%) of the 220 cccDNA samples were >l copies / cell, whereas there were <l copies / cell in the remaining 192 (87.3%) cccDNA samples (Figure SC), indicating that some cells may not contain cccDNA molecules at different time points.

[00139] The detected cccDNA level per liver varied considerably from 1.2 to 0.16 copies / cell among 11 livers (Figure 5B). An average cccDNA level> 1 copies / cell (1.2 copies / cell) was detected in only 1 of the 11 livers.

[00140] Total HBV RNA levels were assayed in four untreated livers to compare the relative RNA transcription efficiency between two phases of infection. Mice 842 and 836 were sacrificed on day 50pi and 52pi, respectively, representing the amplification phase. Mice 831 and 987 were sacrificed on day 14lpi and 218 pi, representing the maintenance phase. A RT­ qPCR assay was used to determine the total HBV RNA levels in 20 cccDNA and 20 rcDNA samples from each liver.

[00141] HBV RNAs were detected in both cccDNA and rcDNA samples and were more abundantly located in the cytoplasm ranging from a fe" hundred to eight thousand copies / cell than the nuclei ranging from a few copies to several hundred copies / cell. Generally, total HBV RNA copies in cytoplasm were 10-20 times higher than the rcDNA copies / cell.The reported frequency of HBV DNA integration in chronically infected human livers is approximately one integration per 100 cells [Mason WS, et al., Gastroenterology, 2016:151(5):986-98. e4] and HBV DNA integration in this model was detected but appeared transcriptionally silent [Allweiss L, et al., Gut, 2018;67(3):542-52], thus, the detected HBV RN As were likely mainly transcribed from the cccDNA. The ratio of RNA copies / cell to cccDNA copies / cell was used to measure the relative efficiency of RNA transcription from cccDNA.The high ratios of average RNA copies per cell to average cccDNA copies per cell in the same samples were notable, ranging from 6107 to 7518 in mice 842 and 836 representing the amplification phase), and ranging from 4837-fold in mouse 831 to 9187-fold in mouse 987 representing the maintenance phase, These findings suggest that a single copy of cccDNA can undergo transcription over 1000 times, indicating efficient RNA transcription through repeated utilization of a single or few copies of cccDNA in HBV-infected cells. Notably, no discernible differences in relative transcription efficiency were observed between the two phases of infection. 29 WO 2025 / 006149 PCT / US2024 / 032725

[00142] To imestigate if RNA transcription could be affected by reduced cccDNA levels, the total HBV RNA levels were examined in two additional livers (mice 813 and 838) that only contained residual cccDNA after> 100-fold of cccDNA reduction in response to treatment of blocking cccDNA replenishment.Average HBV RNA levels were 5 copies / cell, > 100 -fold lower than those observed in the four untreated mice, indicating the reduced amount ofHBV RNA is proportional to the extent of cccDNA reduction. However, the ratios of RNA copies per cell to cccDNA copies per cell were still over 1000 (averaging from 7000 to 10000), indicating that the relative transcription efficiency remained high even in residual infected cells. In addition, there was a positive correlation bet\veen average cccDNA and HBV RNA levels (copies / cell) among 6 mice (R2=0.93, Figure 6), suggesting that total HBV RNA level is largely determined by cccDNA level in the infected cells of this model. Unlike the latent phase of HIV infection at which viral RNA transcription in reservoir cells is inhibited, the efficient RNA transcription from cccDNA suggests that the suppression of RNA transcription is an unlikely mechanism to stop HBV replication and stay noncytopathic by HBV-infected cells.cccDNA loss detected at a single nucleus level

[00143] One of the criteria used by the vendor PhoenixBio for selecting uP A / SCID chimeric mice with human livers is a liver replacement index (RI) of >70% [Tateno C, et al., PloS ONE, 2015; 10(1 l):e0142145l. Among the 57 mice received, only four had RI between 76- 78% and ranged between 80-93% in the remaining 53 mice, approximately 76-93% of liver cells being human liver cells. As bulk cells are routinely used for cccDNA quantification in our assay, an average of 30% non-human (mouse) liver cells was used to normalize the calculated cccDNA copies / cell. The actual number of non-human liver cells varied in each sample, which may have impacted the calculated copies / cell. Quantitative detection of cccDNA copies at the single nucleus level [Zhang YY, et al., Proceedings of the National Academy of Sciences of the United States of America, 2003; 100(21 ): 12372-7] was sought to corroborate the absence of cccDNA in some infected cells.

[00144] HBV rcDNA is 100-1000-fold more abundant than cccDNA and is also expected to be delivered to the nucleus for cccDNA conversion [Tuttleman JS, et al., Journal o_f Virology, 1986;58(1): 17-25]. cccDNA and rcDNA were simultaneously detected in each nucleus using Absolute Q duplexing digital PCR (ABQ-duplexing dPCR), and the detected rcDNA was used as an HBV infection marker. The strategy, principle, and controls of the simultaneous detection of cccDNA and rcDNA are described in detail herein. 30 WO 2025 / 006149 PCT / US2024 / 032725

[00145] Nuclei from three livers, harvested on day 141,218 or 253pi from untreated mice 831,987, and 907, respectively, were deposited at one nucleus per well in a 96-well plate using a BD F ACSAria II. The total number of analyses performed is listed in Table 4.

[00146] Table 4. Percentages ofHBV-positive nuclei determined by duplexing dPCR Mouse No. wells No. wells No. successful No.HBV positive wells ID analyzed failed in wells in dPCR (%) dPCR 831 208 4 204 66 (32) 987 192 0 192 104 (54) 907 192 11 181 61 (33) Detected cccDNA and rcDNA at the single nucleus level

[00147] cccDNA was detected as cccDNA only or coexisting with rcDNA, and rcDNA was detected coexisting with cccDNA or rcDNA only. cccDNA copies per nucleus

[00148] The cccDNA was detected as a single copy in most of the cccDNA-positive nuclei. Twenty (66.7%) of the 30 cccDNA-positive nuclei in mouse 831 contained only a single copy. while the remaining 10 nuclei had> 1 copy. ranging from two to eight. In mouse 987, 41 (75%) of the 55 cccDNA-positive nuclei contained a single copy of cccDNA, \\hile 14 (25%) nuclei had> 1 copy. In mouse 907, the cccDNA ,vas detected as a single copy in 34 (77%) of the 44 cccDNA-positive nuclei, while the remaining 10 nuclei contained> 1 copy ranging between 2-6 copies / nucleus. Thus, "?:.2 / 3 of the detected cccDNA-positive nuclei contained only a single cccDNA copy.rcDNA copies per nucleus

[00149] A single copy of rcDNA was detected in 24 (57%) of the 42 rcDNA-positive nuclei in mouse 831, and the remaining 18 (43%) nuclei had 2-11 copies / nucleus. In mouse 987, a single copy of rcDNA was detected in 41 (60%) of the 66 rcDNA-positive nuclei, while the remaining 25 rcDNA-positive nuclei contained 2-8 copies / cell. In mouse 907, rcDNA was detected as a single copy in 13 (52%) of the 25 rcDNA-positive nuclei, and the remaining 12 (48%) nuclei had >l copy ofrcDNA, ranging from 2 to 19 copies / nucleus. 31 WO 2025 / 006149 PCT / US2024 / 032725 cccDNA- / rcDNA + nuclei

[00150] A portion of infected cells from 27%, 47%, to 55% of the nuclei among the three livers (Table 5) had no detectable cccDNA, whereas rcDNA was detectable in the same nuclei. Infection kinetics data (Figure 4A and 4B) and the published data on HBV infection kinetics in this model [Ishida Y, et al., Hepatology, 2018;68(2):473-84] show that peak infection can be reached on days 82-90 pi, implying that all infectible human liver cells are likely already infected at approximately 90 days pi. HBsAg and HBcAg staining showed that most cells were positive in mice 831,987, and 907 sections. Thus, cccDNA- / rcDNA+ cells likely represent either a loss of cccDNA from infected cells or cccDNA is yet to be formed with the rcDNA delivered from de novo infection in recently generated uninfected cells after cccDNA loss.

[00151] The detection of cccDNA- / rcDNA+ nuclei corroborated the bulk cell-based finding that cccDNA may have been spontaneously lost from a portion of the infected cells.

[00152] Table 5. Percentages of cccDNA and rcDNA-positive nuclei Animal Bulk cells Positive percentage at single nucleus ID cccDNA copies / cell ccc+ onh· CCC+ re Total CCC+ re+ onlv Total re+ 831 0.3 36 9 45 55 64 987 0.7 37 16 53 47 64 907 0.8 59 14 73 27 41 Average cccDNA levels lowered by >100 fold upon blocking two cccDNA replenishment pathways

[00153] The therapeutic effect of blocking de novo infection with anti-HBs antibodies on cccDNA levels \\as evaluated.

[00154] Two sources of anti-HBs antibody both of which are against "ad and ay" subtypes were used: exogenous mouse anti-HBs antibody (AM31509 PU-N OriGene) and endogenous anti-HBs antibody expressed by an AAV-anti-HBs vector HBVZl0 (described in detail in the Methods section). HBVZlO can express high levels (up to 500 µg / mL) of anti-HBs antibody and was sustained at> 100 µg / mL for at least 252 days in both immunocompetent and immunodeficient mice after a single injection or reached> 100,000 mIU / mL if measured using WHO referenced calibrators, which are the standards for clinical report.

[00155] A total of 15 mice received anti-HBs treatment, 13 of which were injected with the AAV-anti-HBs vector HBVZl Oat a dose of lEl 1 genomic copies in week 7 pi, and the remaining two with mouse anti-HBs antibody triweekly at a dose of 250 µg per injection 32 WO 2025 / 006149 PCT / US2024 / 032725 started in day 74 pi for consecutive 9 times. Anti-HBs antibodies were detectable in all 15 chimeric mice after treatment. However, serum HBsAg remained positive, suggesting that not all viral particles were neutralized, and de novo infection was only partially blocked.

[00156] The first set, consisting of six livers, and the second set, consisting of nine livers, were collected on days 204 and 253 pi, respectively. Each of the 15 livers was randomly sampled 20 times, and a second round of 20 samplings was performed in seven of the 15 livers. resulting in a total of 440 cccDNA samples.The average cccDNA levels in 440 samples are shown in Figure 7 A The average cccDNA levels per liver or per 20 samples are presented in Figure SB (middle samples). The cccDNA levels> 1 copies / cell ,vere only detected in five (1. 1 %) of the 440 samples, which was significantly lower than the 13% of cccDNA samples in untreated mice. The mean cccDNA level in 15 mice with partially blocked de novo infection was 0.2 copies / cell, which is significantly lower (p=0.012) than 0.5 copies / cell in untreated mice (Figure 7B). Lower cccDNA levels in this group were supported by proportionally lower rcDNA levels (Figure 7C). These results suggest that cccDNA levels are sensitive to partial blocking of de novo infection.

[00157] The impact of completely blocking de novo infection or blocking both cccDNA replenishment pathways on cccDNA levels was then evaluated.

[00158] A complete blocking of de novo infection is marked by conversion of serum HBsAg from positive to HBsAg negative / anti-HBs positive (HBsAg- / anti-HBs+). Blocking of both cccDNA replenishment pathways was accomplished using a combination of anti-HB antibodies to block new rounds of infection with 9-12 weeks of entecavir therapy to decrease rcDNA synthesis and intracellular recycling of cccDNA. A cccDNA analysis was conducted on 17 mice that achieved HBsAg negative / anti-HBs positive status. Among these the two mice (mouse 970, which received nine injections of mouse anti-HBs antibody at triweekly inten-al and mouse 819, which received a single dose of 1.8El2 copies ofHBVZl0) undernent anti-HBs antibody monotherapy, while the remaining 15 mice were treated with a combination of anti-HBs antibody and entecavir.

[00159] Each of the 17 livers that were collected after the peak infection between days 123 and 253 pi.were randomly sampled 20 times and a second round of 20 samplings was performed for the two livers, resulting in a total of 380 cccDNA samples (right-most group in Figure 5B). Among these, 140 cccDNA samples from 7 mice were analyzed using qPCR and ABQ dPCR. All cccDNA levels were <l copies / cell, and most were <0.01 copies / cell (Figure 8A). The mean cccDNA level in 17 mice was 0.0028 copies / cell, which is> 100-fold lower (p=0.0001) than 0.5 copies / cell in untreated mice and significantly lower (p=4E-4) than 0.2 33 WO 2025 / 006149 PCT / US2024 / 032725 copies / cell in mice with partially blocked de norn infection (Figure 5B and 8B). In addition, cccDNA was not detected in two mice after 20 samplings of each liver. This demonstrates that complete blocking of de noyo infection is critical for cccDNA elimination.The addition of entecavir to anti-HBs antibody blocks the recycling pathway and makes blocking of de novo infection by anti-HBs antibody more effectiYe because the reduced virion production lowers the potential of de novo infection. These results further support the hypothesis that cccDNA replenishment is required to maintain cccDNA levels. underlining the spontaneous clearance of cccDNA from infected cells.

[00160] Kinetic human albumin levels were similar betvveen untreated and treated mice, suggesting that cccDNA elimination mainly resulted from the blocking of cccDNA replenishment and not from the loss of human hepatocytes in humanized livers. cccDNA was progressively cleared upon blocking replenishment pathways in both infection phases

[00161] Experiments were further run to show the effect of progressive cccDNA clearance upon blocking cccDNA replenishment pathways.

[00162] In HBV-infected chimeric mice, rising serum HBsAg levels paralleled rising viremia follO\ving inoculation (Figure 4A and 4B), suggesting that HBV replication is mainly cccDNA-dri ven. Entecavir treatment is known to reduce serum HBV DNA levels but does not have a parallel impact on serum HBsAg levels, especially over a short duration f Chang TT, et al., Hepatology, 2010;52(3):886-93]. Thus, serum HBsAg levels, but not HBV DNA levels, in entecavir-treated mice can be used as a surrogate for intrahepatic cccDNA levels. Serum HBsAg in all 16 mice (Figure 8C and 8D) experienced a 3-5 log progressive reduction and became undetectable upon blocking the two cccDNA replenishment pathways. The blocking either started before peak infection, that is, during the cccDNA amplification phase (Figure 8C} or the cccDNA maintenance phase (Figure 8D).Additional doses of mouse anti-HBs antibody were administered to boost the levels of anti-HBs antibodies, transitioning from partial blocking to complete blocking after the peak infection. The progressive serum HBsAg reduction correlated with and likely resulted from the progressive elimination of cccDNA. This was further supported by the progressive decrease of serum HBeAg in 16 mice (green in Figure 8E and 8F). HBeAg is synthesized from pre-core mRNA, which is transcribed from cccDNA molecules [Yuh CH, et al., Journal of Virology, 1992;66(7):4073- 841. The cccDNA level is generally reduced by 10-100-fold when HBV infection transitions from the HBeAg-positive to HBeAg-negative phase in chronic HBV infection [See, e.g., 34 WO 2025 / 006149 PCT / US2024 / 032725 Werle-Lapostolle B, et al., Gastroenterology, 2004; 126(7): 1750-8; and Laras A, et al., Hepatology, 2006;44(3):694-702].Thus, a progressive serum HBeAg reduction (Figure 8E and 8F) reflects the progressive reduction of cccDNA in the liver. Both anti-HBs antibodies and entecavir mainly block cccDNA replenishment without directly eliminating cccDNA molecules, therefore, the observed cccDNA elimination was likely mediated through spontaneous clearance (non-treatment-mediated) that occurred in both phases. >100-fold reduction in cccDNA level observed in 80 days

[00163] uP A / SCIO chimeric mice with human livers are fragile and cannot withstand stressful procedures, such as serial liver resections, posing a challenge in establishing baseline cccDNA levels before treatment. Therefore, cccDNA levels from different mice v.ith comparable serum HBsAg levels were used as a reference. Figure 5F shows that baseline HBsAg levels on days 54 and 82 reached approximately 5000IU / mL before a progressive decline in mouse 838, which was treated with anti-HBs antibody expressed by HBVZlO and entecavir.This is comparable to that in mouse 833 who received HBVZlO monotherapy on day 44. Mouse 833 displayed dual positivity for serum HBsAg (Figure 8G) and anti-HBs antibodies after treatment; thus, de novo infection in mouse 833 was considered partially blocked. Serum HBsAg levels remained steady at approximately 5000IU / mL from day 82 and 162 (termination day) in mouse 833. The cccDNA levels in mouse 833 was used as a reference for baseline cccDNA levels before HBsAg clearance in mouse 838. Both the intracellular HBsAg and cccDNA levels in mouse 838 were reduced by> 100-fold during 80 days from day 82 to day 162 pi compared with those in mouse 833 (Figure 8H) The average reduction in cellular HBsAg levels was 423 copies / day.The cccDNA results further support that kinetic serum HBsAg levels can be used as a surrogate for cccDNA levels, and that the observed spontaneous cccDNA clearance was efficient and could be transformed into progressive cccDNA elimination upon blocking both cccDNA replenishment pathways. Human Ki67 RNA levels in 840 cccDNA samples

[00164] Human Ki67 was chosen as a marker to examine the proliferation of human liver cells and its association with observed cccDNA loss in the humanized livers of chimeric mice. This selection was made based on the previous utilization of human Ki67 for proliferation studies within the same model [Allweiss L, et al., Gut, 2018;67(3):542-52]. Ki67 RNA levels were measured using RT-qPCR in existing cccDNA samples containing nuclear RNAs.Ki67 RNA levels were determined in 840 cccDNA samples isolated from 42 livers, comprising 15 untreated, 11 treated with detectable serum HBsAg, and 16 treated with progressive reduction of serum HBsAg to undetectable levels accompanied by> 100-fold 35 WO 2025 / 006149 PCT / US2024 / 032725 reduction in cccDNA levels. In most samples (76%, 639 out of 840), Ki67 RNA levels were <0.01 copies per cell. This implies that only one copy of Ki67 RNA was detected in approximately > 100 cells, or less than 1 % of cells likely expressed Ki67 RNA in those samples (Figure 9A). The highest Ki67 expression levels, ranging from 0.1 to 0.28 copies per cell, were detected in 9 (1.1 %) out of 840 samples. This indicates that 10 to 28 copies of Ki67 RNA were detected in 100 cells, or 10-28% of cells possibly expressed Ki67 RNA, though some cells may contain more than one copy of Ki67 RNA The actual percentages of cells expressing Ki67 RNA may thus be lower than 10-28%.

[00165] No significant differences in average Ki67 RNA level per liver were observed among three groups of untreated, treated with detectable HBsAg, and treated with undetectable HBsAg while there were significant differences in average cccDNA levels among the three groups (Figure 9B).

[00166] If cell proliferation \\ere a primary factor driving cccDNA loss, one would anticipate an inverse correlation between Ki67 RNA and cccDNA levels. However, no correlations were detected between Ki67 RNA and cccDNA kinetics during both the cccDNA amplification and maintenance phases, among treated and untreated mice, or across three distinct experiments utilizing different batches of chimeric mice. The maximum Ki67 RNA level per liver reached 0.08 copies per cell, indicating that approximately 8% of cells expressed detectable Ki67 RNA in one mouse (ID:823) treated with combination therapy. Ki67 RNA levels ranging from 0.1 to 0.21 copies per cell were detected in 6 out of 20 samples.However, no correlations were observed between Ki67 RNA and cccDNA levels in this particular mouse. Serum alanine transaminase (ALT) activity

[00167] ALT activity was assessed in 9 serial serum samples, comprising 3 from untreated mice and 6 from treated mice who achieved a progressive reduction of serum HBsAg to undetectable levels alongside a> 100-fold reduction of cccDNA compared to untreated mice. ALT activity exhibited fluctuations over a 6-month duration, spanning from day 21 to day 207 pi, and remained below 40 U / L in 84 out of 88 samples. In the remaining 4 samples from the treated group, collected on day 35 pi before entecavir (ETV) treatment commenced, ALT levels were borderline or slightly elevated, ranging from 40 to 54 U / L. However, these levels subsequently decreased and remained below 40 U / L during the treatment and follow-up period, spanning from day 60 to day 207 pi.The slight elevation in ALT levels at a single timepoint may simply reflect the upper limit of ALT fluctuation ranges and was deemed insignificant. 36 WO 2025 / 006149 PCT / US2024 / 032725 Confirmation of HBsAg reduction in both serum and liver with ELISA, western blot, and immunohistochemical staining

[00168] Two serial serum samples from untreated mice and t\\o from treated mice, whose serum HBsAg underwent progressive reduction and became undetectable (Figure 1 OA and lOB), were subjected to western blot analysis. This showed similar kinetics as detected by ELISA, confirming the progressive reduction in serum HBsAg in two serial serum samples with anti-HBs treatment (Figure lOC, 10D, and lOE)

[00169] Intrahepatic HBsAg levels in seven mice was also analyzed with progressive serum HBsAg reduction, respectively. Intrahepatic HBsAg was either not detectable or was detectable at low levels by ELISA (Figure lOF), which was confirmed by western blot analysis (Figure lOG).In addition, intrahepatic HBcAg levels were analyzed by western blot in 20 liver lysates of five mice (n=4 lysates for each liver) with progressive serum HBsAg reduction. Cellular HBcAg was not detected in all 20 liver lysates (Figure 1 OH and lOJ), supporting the concept that the progressive serum HBsAg reduction reflects intracellular HBV clearance upon blocking cccDNA replenishment.

[00170] Consistent with ELISA and western blot data, immunohistochemical staining of HBsAg in sections shm,ved that intracellular HBsAg was reduced to undetectable or barely detectable levels among 7 mice that achieved HBsAg- / anti-HBs positive status. In contrast to the dominant view that HBV cccDNA molecules are stable in infected cells [ Alter H, et al. Hepatology. 2018:67(3): 1127-31 ], spontaneous cccDNA loss was observed during both the spread of infection and persistent HBV infection phases in this study using chimeric mice with humanized livers.Moreover, cccDNA replenishment was required to maintain cccDNA levels and persistence.

[00171] The analysis of cccDNA copies at the single nucleus level shows that most infected cells contain a single copy of cccDNA: nonetheless, average intracellular HBsAg levels are accumulated at approximately 100,000 copies / cell upon reaching the peak, highlighting an extraordinary efficiency of both RNA transcription and viral protein synthesis. There are two likely scenarios. In scenario 1. the continuous presence of cccDNA after reaching the peak in infected cells is expected to continuously drive-up transcription and further increase the accumulation of viral products to an intolerable level, leading to cytopathic destruction through which cccDNA will be lost.Furthermore, unlike HIV, HBV is not known to have a latent infection phase, implying the absence of the noticeable inhibition of RNA transcription, which is also supported by high serum HBsAg levels in both HBeAg positive and negative 37 WO 2025 / 006149 PCT / US2024 / 032725 phases [See, e.g., Jaroszewicz J, et al., Journal of Hepatology, 2010;52(4):514-22; and Nguyen T, et al., Journal of Hepatology, 2010;52(4):508-13]. Thus, the long-term presence of cccDNA in infected cells may not be feasible under such circumstances of highly efficient RNA transcription and viral protein synthesis.

[00172] However, HBV is largely noncytopathic. In scenario 2, infected cells may respond well to the stress caused by accumulating high levels of intracellular viral products. As reported during the second phase ofhepadnaviral replication. viral-envelope proteins accumulate in the infected cells.The accumulated L protein alone or in combination with M and / or S proteins inhibits further cccDNA amplification or decreases cccDNA levels [See, e.g., LenhoffRJ, et al.,Journal a / Virology, 1994:68(7):4565-71; Gao W, et al.,Journal of Virology, 2007;81(12):6164-74; and Lentz TB, et al., Journal of Virology, 2011:85(22): 11916-27]. Because the highly efficient RNA transcription and viral-protein synthesis suggest the absence of efficient inhibition of these steps, clearing cccDNA appears to be the only effective option to stop HBV replication and protect cells from destruction.

[00173] Therefore, such replication-driven cccDNA loss can occur either through spontaneous clearance (Figure l lA) or cell destruction (Figure l lB). Cytopathic effects in infected primary hepatocytes and acute liver injury were also observed during in vivo infection with the duck hepatitis B virus (DHBV, a member of the Hepadnaviridae family) L protein mutant Gl33E.which caused a defect in emeloped virus production and increased intracellular levels of cccDNA, RNA, capsid, and rcDNA fSee, e.g., Lenhoff RJ, et al., Journal of Virology, 1994;68(9):5706-13; and LenhoffRJ, et al., Hepatology, 1999:29(2):563-71 ].

[00174] The timeframe from cccDNA establishment to its loss in infected cells represents one cycle of infection. The duration of cccDNA presence in infected cells is likely influenced by both HBV replication efficiency and the infected cells' ability to secrete viral particles. Slower replication or more efficient viral particle secretion likely prolongs cccDNA presence in infected cells, whereas more efficient HBV replication or inefficient viral particle secretion may accelerate cccDNA loss. A new cycle of infection commences when cccDNA is re­ established through the de novo infection of cccDNA-negative cells.This cyclic feature of cccDNA indicates that persistent HBV infection is maintained by multiple cycles of de novo infection (Figure l lA).

[00175] Published studies on kinetic intracellular viral product levels shov. ed that intracellular HBcAg reached a peak level at approximately 2-4-week in HBV infected HepG2-NTCP cells and was dependent upon the efficiency of viral particle secretion from 38 WO 2025 / 006149 PCT / US2024 / 032725 infected cells [See, e.g., Ko C, et al.,Journal of Hepatology, 2018;69(6): 1231-41; and Konig A, et al., Journal of Hepatology. 2019; 71 (2):289-300]. In in vivo DHBV infection, the intracellular L protein peaked around day 5 pi [Zhang YY, et al., Journal of Virology, 2004;78(3): 1195-201], suggesting that intracellular hepadnaviral infection may peak at 1-4 weeks pi on average. In this timeframe, after which cccDNA clearance may occur, each cycle ofHBV infection likely ends with cccDNA loss within a few weeks at the individual cell level.However, HBV infection at the liver level without sufficient anti-HBs antibodies may last for years or decades because there are al\\ays new cycles of infection, whereas early cycles of infection end following cccDNA loss.

[00176] Previous studies have suggested that cccDNA molecules may be lost during cell division [See, e.g., Allweiss L, et al., Gut. 2018:67(3):542-52; and Zhang YY, et al., Proceedings of the National Academy a / Sciences of the United States of America, 2003; 100(21): 12372-7]. Thus, spontaneous cccDNA loss could also be caused by random human liver-cell proliferation. However, our findings indicate infrequent expression of human Ki67 RNA, with levels< 0.01 copies per cell detected in 76% of 840 samples. Moreover, no correlations were obsen,ed between Ki67 RNA and cccDNA levels. These results suggest minimal human hepatocyte turnover.These findings regarding Ki67 RNA levels align with the obsen'ations of the mouse provider (PhoenixBio, personal communication) that the proliferation of human liver cells is negligible after the completion of human liver growth and are consistent with Ki67 immunostaining results, which revealed 3% Ki67-positive cells in liver sections prepared 100 days after hepatocyte transplantation in the same uPA / SCID mouse model [Allweiss L, et al., Gut, 2018;67(3):542-52]. The Ki67 RNA data align with normal serum ALT levels among both treated and untreated mice and the steady levels of serum human albumin. Consequently, the low-level proliferation of human liver cells observed in humanized mice is unlikely to be a significant driver of cccDNA loss in these data.

[00177] The following are exemplary embodiments of the present invention:

[00178] Embodiment 1.A method of curing chronic hepatitis B infection in humans, compnsmg: administering to a subject in need thereof, an effective amount of one or both of an exogenous anti-HBs antibody or an anti-HBs antibody producing vector to reduce cellular and blood hepatitis B surface antigen (HBsAg), by providing a sustained elevated level of anti-HBs antibody in the subject. 39 WO 2025 / 006149 PCT / US2024 / 032725

[00179] Embodiment 2. The method of Embodiment 1, wherein the reduction of cellular and blood HBsAg occurs (i) with blocking of de novo infection mediated cccDNA replenishment or (ii) without direct inhibition of HBsAg synthesis, or both (i) and (ii).

[00180] Embodiment 3. The method of one of Embodiments 1 or 2, wherein the anti- HBs antibody has specificity against the "a" determinant of HBsAg.

[00181] Embodiment 4. The method of Embodiment 3, wherein the anti-HBs antibody has specificity against human hepatocyte attachment site in the "a" determinant of HBsAg.

[00182] Embodiment 5.The method of Embodiment 4, wherein the anti-HBs antibody blocks de novo infection through blocking HBV particles (virions and subviral particles) from attaching to human hepatocytes.

[00183] Embodiment 6. The method of Embodiment 1, wherein the sustained elevated level of anti-HBs antibody is an amount of lO0mIU / ml or higher for a period of 3 months or longer.

[00184] Embodiment 7. The method of Embodiment 6, wherein the sustained elevated level of anti-HBs antibody is an amount of l,000mIU / ml or higher for a period of 3 months or longer.

[00185] Embodiment 8. The method of Embodiment 7, wherein the sustained elevated level of anti-HBs antibody is an amount of 10,000mIU / ml or higher for a period of 3 months or longer.

[00186] Embodiment 9. The method of Embodiment 8, wherein the sustained elevated level of anti-HBs antibody is an amount of 100,000 mIU / ml or higher for a period of 3 months or longer.

[00187] Embodiment 10.The method of any one of Embodiments 1 to 9, wherein the administration is a single or multi-administration of the exogenous anti-HBs antibody or a single administration of the anti-HBs antibody producing vector.

[00188] Embodiment 11. The method of any one of Embodiments 1 to 10, wherein cellular and blood HBsAg is reduced through blocking of de novo infection mediated cccDNA replenishment.

[00189] Embodiment 12. The method of Embodiment 12, wherein the effective amount of exogenous anti-HBs antibody or an anti-HBs antibody producing vector is an amount to maintain a level of anti-HBs antibody sufficient to effectively and completely block de novo infection mediated cccDNA replenishment in the presence of or absence of other anti-HBV drugs. 40 WO 2025 / 006149 PCT / US2024 / 032725

[00190] Embodiment 13. The method of any one of Embodiments 1 to 12, wherein the administration is administration of an effective amount of the anti-HBs antibody.

[00191] Embodiment 14.The method of any one of Embodiments 1 to 12, wherein the administration is administration of an effective amount of the anti-HBs antibody producing vector, which provides an endogenous production of anti-HBs antibody in the subject.

[00192] Embodiment 15. The method of Embodiment 14, wherein the administration is a single dose administration of the anti-HBs antibody producing vector, in an amount of lEl l copies or more.

[00193] Embodiment 16. The method of Embodiment 15, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of 2El 1 copies or more.

[00194] Embodiment 17. The method of Embodiment 16, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of lE12 copies or more.

[00195] Embodiment 18. The method of Embodiment 16, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of 3El2 copies or more.

[00196] Embodiment 19.The method of any one of Embodiments 14 to 18, wherein the anti-HBs antibody producing vector is an AAV vector selected from the group consisting of HBVZl0, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90.

[00197] Embodiment 20. The method of any one of Embodiments 14 to 18, wherein the anti-HBs antibody producing vector is a viral vector, a non-viral vector, or a nanoparticle.

[00198] Embodiment 21. The method of Embodiment 20, wherein the anti-HBs antibody producing vector can be administered singly or in combinations thereof.

[00199] Embodiment 22. The method of Embodiment 1, wherein the exogenous anti- HBs antibody is co-administered with a human anti-HBs antibody, nanoantibody or antibody fragments.

[00200] Embodiment 23. The method of Embodiment 1, wherein the administration produces a reduction in blood HBsAg which can be progressive or precipitous, in either case having blood HBsAg reduced by at least 1-5 log.

[00201] Embodiment 24.The method of Embodiment 23, wherein the administration produces a reduction in blood HBsAg which can be progressive or precipitous, in either case having blood HBsAg reduced to a level of <0.05IU / ml. 41 WO 2025 / 006149

[00202] Embodiment 25. method is a monotherapy.

[00203] Embodiment 26. PCT / US2024 / 032725 The method of any one of Embodiments 1 to 24, wherein the The method of any one of Embodiments 1 to 24, wherein the method is a combinational therapy with one or more additional HBV drugs that inhibit intracellular HBV DNA, HBV RNA or / and viral proteins synthesis.

[00204] Embodiment 27. The method of Embodiment 26, wherein the one or more additional HBV drugs are one or more members selected from the group consisting of reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inihibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunoregulatory drugs.

[00205]

[00206] Numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein. 42 WO 2025 / 006149 PCT / US2024 / 032725 CLAIMS: 1. A method of curing chronic hepatitis B infection in humans, comprising: administering to a subject in need thereof, an effective amount of one or both of an exogenous anti-HBs antibody or an anti-HBs antibody producing vector to reduce cellular and blood hepatitis B surface antigen (HBsAg), by providing a sustained elevated level of anti-HBs antibody in the subject. 2. The method of claim 1, wherein the reduction of cellular and blood HBsAg occurs (i) with blocking of de novo infection mediated cccDNA replenishment or (ii) without direct inhibition of HBsAg synthesis, or both (i) and (ii). 3.The method of one of claims 1 or 2, wherein the anti-HBs antibody has specificity against the "a'' determinant of HBsAg. 4. The method of claim 3, wherein the anti-HBs antibody has specificity against human hepatocyte attachment site in the "a" determinant of HBsAg. 5. The method of claim 4, vvherein the anti-HBs antibody blocks de novo infection through blocking HBV particles (virions and subviral particles) from attaching to human hepatocytes. 6. The method of claim 1, wherein the sustained elevated level of anti-HBs antibody is an amount of 1 00mIU / ml or higher for a period of 3 months or longer. 7. The method of claim 6, wherein the sustained elevated level of anti-HBs antibody is an amount of l,000mIU / ml or higher for a period of 3 months or longer. 8. The method of claim 7, wherein the sustained elevated level of anti-HBs antibody is an amount of 1 0,000mIU / ml or higher for a period of 3 months or longer. 9.The method of claim 8, wherein the sustained elevated level of anti-HBs antibody is an amount of 100,000 mIU / ml or higher for a period of 3 months or longer. 10. The method of any one of claims l to 9, wherein the administration is a single or multi­ administration of the exogenous anti-HBs antibody or a single administration of the anti-HBs antibody producing vector. 11. The method of any one of claims 1 to 10. "herein cellular and blood HBsAg is reduced through blocking of de novo infection mediated cccDNA replenishment. 12. The method of claim 12, wherein the effective amount of exogenous anti-HBs antibody or an anti-HBs antibody producing vector is an amount to maintain a level of anti-HBs 43 WO 2025 / 006149 PCT / US2024 / 032725 antibody sufficient to effectively and completely block de novo infection mediated cccDNA replenishment in the presence of or absence of other anti-HBV drugs. 13.The method of any one of claims 1 to 12, wherein the administration is administration of an effective amount of the anti-HBs antibody. 14. The method of any one of claims 1 to 12, wherein the administration is administration of an effective amount of the anti-HBs antibody producing vector, which provides an endogenous production of anti-HBs antibody in the subject. 15. The method of claim 14, wherein the administration is a single dose administration of the anti-HBs antibody producing vector, in an amount of lEl 1 copies or more. 16. The method of claim 15, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of 2El 1 copies or more. 17. The method of claim 16, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of 1El2 copies or more. 18. The method of claim 16, wherein the single dose administration of the anti-HBs antibody producing vector is in an amount of 3El2 copies or more. 19.The method of any one of claims 14 to 18, wherein the anti-HBs antibody producing vector is an AAV vector selected from the group consisting of HBVZlO, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90. 20. The method of any one of claims 14 to 18, wherein the anti-HBs antibody producing vector is a viral vector, a non-viral vector, or a nanoparticle. 21. The method of claim 20, wherein the anti-HBs antibody producing vector can be administered singly or in combinations thereof. 22. The method of claim 1, wherein the exogenous anti-HBs antibody is co-administered with a human anti-HBs antibody, nanoantibody or antibody fragments. 23. The method of claim 1, wherein the administration produces a reduction in blood HBsAg which can be progressive or precipitous, in either case having blood HBsAg reduced by at least 1-5 log. 24. The method of claim 23, wherein the administration produces a reduction in blood HBsAg which can be progressive or precipitous.in either case having blood HBsAg reduced to a level of <0.05IU / ml. 25. The method of any one of claims 1 to 24, wherein the method is a monotherapy. 26. The method of any one of claims 1 to 24, wherein the method is a combinational therapy with one or more additional HBV drugs that inhibit intracellular HBV DNA. HBV RNA or / and viral proteins synthesis. 44 WO 2025 / 006149 PCT / US2024 / 032725 27. The method of claim 26, wherein the one or more additional HBV drugs are one or more members selected from the group consisting of reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inihibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccmes, immune checkpoint inhibitors, and immunoregulatory drugs. 45 WO 2025 / 006149 PCT / US2024 / 032725 -E -::::> ---Cl) > Cl) C, <C ,n m :::c E ::::, ... Cl) ,n u :.::.Cl) C ~ 1 / 38 G1 : no therapy 1000000-------------- 100000 10000 ---tc--802 --0--803 ----t>----805 --❖---807 1000 -0-831 -D--832 100 10---,.....------1-------i-----i----.... 14 64 114 164 Days post inoculation FIG.1A SUBSTITUTE SHEET (RULE 26) 214 WO 2025 / 006149 PCT / US2024 / 032725 2 / 38 G2: HBVZ10 + ETV HBVZ10 d11 and d58 ! ! 50000-------------+-----+---------< ETV d18 ---¼- 811 :::-- 5000 -+-----+-------+------I --o--812 E ~813 -=> ---o--- 814 ::::.. - --0--816 j 500 -+--~,'!l".,..__=-----+f.,---+------w\--+-+-------l --D-- 856 m ----½- 85 7 <C tn ~ 50--+------H"'--------+---I-+++---+---+--------, E :s ... Cl) tn ~ 5--------+-------.-+----+---+---~ Cl) C ~ 50 100 150 Days post inoculation FIG.1B SUBSTITUTE SHEET (RULE 26) 200 WO 2025 / 006149 PCT / US2024 / 032725 :::::=- E -:::J ---a, > a, en <C U) m :::c E ::l .... a, U) 0 +::i a, C S2 3 / 38 G3: HBVZ10 + ETV HBVZ10 d22 i 50000------,_E_TV_d_32-------------. 5000 500 50 5 0.5 0.05 14 -¼-822 --0--823 ----C>---- 82 4 ~ 825 --0--826 --D--828 ---tr-s29 64 114 164 214 Days post inoculation FIG.1C SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 4 / 38 G4: HBVZ10 + ETV HBVZ10 d44 500000--t----+-------+----- :::::- E -:::::, ---G) > G) -en <C tn m :::c E ~ L. G) tn CJ .. G) C ~ ETV d54 50000 5000 500 --o-- 835 ~ 837 50 ---<>- 838 --0- 843 --D-- 84 7 ----fr- 848 5 0.5 ---1-------+-------+----+-------, 0.05 __.....,_ __ ...,__ _ ____.._----<),,,------, 33 83 133 Days post inoculation FIG.1D SUBSTITUTE SHEET (RULE 26) 183 o 10 00 00 0 .... .!? - Cl,) V' I (. ) 10 00 00 - C :::: s ca a. . V' I C --, - --, 0 10 00 0 C I!! --, C l) C m .c 0 V' I E -- I ~ ~ 10 00 m m "' C - --, C C l) - ca " C :::c - C l,) 10 0 C (. ) r - m u , C l,) l' J a. . O" I 0 10 ..... .... (. ) ~ u , m 1 ::c U nd et ec ta bl e se ru m H Bs Ag U nt re at ed 47 53 80 81 06 48 I □ H Bs Ag c op ie s / ce ll 0 No o f i np ut c el l 17 42 70 08 30 19 08 37 11 30 ..20 51 64 18 26 4~ ~t sj U 4 95 79 5 96 65 0 95 27 7 32 35 92 34 86 12 V .... lb U lU tl 7 ' 19 76 58 ,.. "" 41 78 0 V - v I~ ~ V / I / v' .I 17 - VV II V / II / VVV / / / V v VV II / VVVI / V / v V / VV / .I / VV / v V v V t - - - I / VVVVV II V / V / VVV / V / v VVVVV v I / V / v 10 2 VV / V 13 07 78 7 / VVV / / 63 1 VV / VVVV .... ,. ._ VVVVI / r - - - - - .... V v / VVVV / i;:; VI / VVV / VI / V / v V / VVV v II v VV v II / VVVV / / VVV v / VI / V / V II V / _ VVV v V vt - - v - VVI / r - - - - v - V v / I / VVV / VV II V 39 .5 ,,, VV v V / V II V v VVVVV II ... . I / V v VV v II / VVV II VVV / v V / 7. 6 VV v VV v VV - V - v _ VVVI . I _ I / f - - - - v - VVVI / "° VVV .I .IV _ v V II VVVVVV v VV / V Iv VV / VV v VV v V II V / VV / / 1. 5 v / VVVVV , V / I / VV / VVVV n VVVVV 81 2 81 3 81 4 82 4 82 5. 1 82 5. 2 82 5. 3 82 5. 4 83 8. 1 83 8. 2 83 8. 3 83 8. 4 83 1. 1 83 1. 2 83 1.3 83 1. 4 FI G . 2 3 V I ~ oe :E 0 N 0 N U 'I -0 0 O 'I .... .i:: :,, ID ,, n ~ C : U l N 0 N .i:: :,, -0 IN N ..... N U 'I WO 2025 / 006149 PCT / US2024 / 032725 6 / 38 B 100000 --------------~98=.-3-=-04~95_1.=--=95~96_65;=---=o~95=21~1--~ 10000 □ HBsAg copies 8 1 000 --1-----=□=rc=D N=A=c=op=ie=s =----------1 ,_________. ,______, ,_________. ~ 100 -+---- 147 128 39.5 C ~ 0 -+--------I t-------'--''-=-------1 "C C ca en er: 1 0.1 307" Cl) m ::c 0.01 __ ..........,_..,.._ ___ ........... ___.,,.___...........,. ___ .........,,. ___ ___.,.__ 825.4 838.2 838.4 831.1 831.2 831.3 831.4 FIG. 3A SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 7 / 38 825.4 838.2 838.4 831.1 831.2 831.3 831.4 Ratio of cellular 4 402 91 668 2135 755 311 HBsAg and rcDNA FIG. 3B SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 -Cl,) > Cl,) en <C ,n m_ :::c - E~ ~ :::::, .__ Cl,) ,n CJ -Cl) C ~ 8 / 38 Serum HBsAg 1000000-----------.---------- --o-802 --<>-805 -o-831 --½-832 1000 ---+-ll,,IIC.......,----+-----1 ---<J---806 --tr----834 ----v-836 ---o---842 100 ___...,__. _________ ......,_ _ ......,.. _______ ____., 14 64 114 164 Days post infection FIG. 4A SUBSTITUTE SHEET (RULE 26) 214 264 WO 2025 / 006149 PCT / US2024 / 032725 9 / 38 a, > a, 1.00E+09 _______ s_er_um_H_BV_DN_A ____ _ - ~ s 1.00E+08 -+---~~::::A,.,~:::::::~~~~::Q_--------1 c m 1.00E+07 -+-------,,,..,,,;~~~--+----+----+-----I >o ~ i 1.00E+06 E en 1. 00 E +05 -111-~~--+----1 --o-802 --<>-805 -o-831 --½-832 ~ -~ 1.00E+04 ---<J---806 --tr----834 ----v-836 ---o---842 fl) 0 u ~ 1.00E+03 -+------+------+-----+-----+-----I .:; ~ 1.00E+02 ___...,_ _ ...,..... __ ......,__ _ ......,... __ .......,.. __ .....,. S2 14 64 114 164 Days post infection FIG. 4B SUBSTITUTE SHEET (RULE 26) 214 264 WO 2025 / 006149 PCT / US2024 / 032725 10 / 38 DHBsAg □ rcDNA Hepatic HBsAg, rcDNA and cccDNA □ cccDNA Progressiveincrease Increase stopped FIG. 4C SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 11 / 38 C, G) N .!::! "'E 10 C>,::, C G) o_ E ns B ~ ns E I> I! -- 1 0 I> I! I • c ff 0 G) :::::s 8 V I> □ 0 <I I u ! 8 a tF -.... 0 0 □ I <I en ... 3 ~ <I l I G) 8 0 ~ ·a E 0.1 ~ ~ oo 0 V 0 <> ~ u .::: 8 ~ <C en 0 I> z G) 0 . <i 'ei 0.01 i>I> u ns <> u en 8 G) <C iz ~ C 0.001 ~8 907 905 998 908 980 987 4 71 805 831 832 802 FIG. SA SUBSTITUTE SHEET (RULE 26) (gz: 37fftl) .133HS 3.1n.11.1ssns Average cccDNA level per 20 samples(copies / cell) 0 ~ §= 907 .g ~ 908 -m CD ..+ ~~ 980 ::::, II 471 ~ ~ -. 805 I'\.) I'\.) 0 802 ~i 968 (I) ;g~ 959 -CD ~oJ 964 --""C I",< ffi ~-972 (I) ..+ -.:t~ 967 ::!! z;:?. G') II T" 956 ■ ~ :::c u, 0, CJ CD ~"" 911 .,l::=,.0) ~ 3: 972.21 0) C'" 3 g_ 965.21 ""C "< m 996.21 -909.21 ::::, 0) C") II ;:?_ O 475 ~ci3 --g_ sr. 984 wL..,'::::, 00 ....... 0) ~§ o" 479 0) a_::, 3 mst 497 ""C ~ ~ m _~ 981.21 -:i:"< g' :E, 983 ►..+ ~~ 825 0) ::::, ;:?. 7-824 i·I ffi g' 812 en + - SZLZE0 / 17ZOZSn / .L:>d 905 998 987 831 832 909 996 999 965 1000 973 997 969 964.21 959.21 968.41 970 478 988 479.21 981 971 838 819 856 • 0 0 . 0 0 0 . o 0 0 0 , o 0 0 0 0 . 0 0 0 0 0 ~ ~ ~ ~ ~ ~ ~ ~ ~ 0 , , , , , ND 814-ND 8£ / Zl s::: CD 0) ::::, C') C') n ? CJ1 C') 0 ""C CD. en n" CD "U -II 0 s::: ~ CD ~ 0) ::::, C') C') n ? I\,) C') 0""C c6 (I) n" CD ""(J II .,I::=,. 00 ""(J m II I s::: 0 0, CD 0 0) 0 ::::, 0 C') .,I::=,. C') n ? c:, c:, I\,) 00 C') 0 ""C CD. (I) n" CD 6171900 / SZOZ OM WO 2025 / 006149 "C G) N 2'a. ~ S 1200 ca._ m: 1000 -u a. ca E m 800 ca c: u,,_ <C= 600 z G) c~ 8 ~ 400 uo 0~ 200 en A ... "C 0 G) C: ~ ca ::::I z PCT / US2024 / 032725 13 / 38 1040 ~ D No. samples - >--- ->--- EZJ No. samples >1 copies / cell ->--- 440 380 ~ -~ ~ (3.2%) 220 (13%) (1.1 %) ->--- 33 28 5 0 ..,.......,,. - I I Total Untreated Partial HBs- / anti-HBs+ blocking FIG. SC SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 8000 - ~ 7000 en .!!! 6000 Q. 8 5000 ~ 4000 a:: > 3000 m :::c: 2000 G) e 1000 G) -.. ,,.~ PCT / US2024 / 032725 14 / 38 Correlation of cccDNA and total HBV RNA level 0 R2 = 0.9258 ... ,. ... ... ... ... ... ,. ,. ,,. ... ,. ,,. ,,. ,. ,. ,. 0 ,. ,. ... ... ,. -,,. 0, ... () ... ... ,. .. ,. ... ... ,. ~ 0 -10000.00 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 Average cccDNA copies / cell FIG. 6 SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149PCT / US2024 / 032725 :::::--G) ~ rn rn a., a.,- ■- C. c.E o ca ~rn rn <C mz >c G) u -u <Cu Zo C-.:t u "q' u en u C: G) 0 cnE I! ca G) ~ 15 / 38 10-------------- 1 -0 ---u------------1!-~ ,-~-~ - 0 0 8 a ~ I 0 0.01 --------v--~~~---­ o t] 0.001 ---1-1-1-1 -1 -1 -1-1-1-1 -1 -1 -1-1-1-1-i -1 -1 -1-1-1 mooIDmm~~No~~ID~~m~~~~~~~ OIDm~mIDID~OID~~m~IDNNNNN~N mmmmmmmmommmmmmN~~m~oom ~~ ~IDID~mIDO mmmmmmm FIG. 7A SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 C: a, J a, .c U) - U) a, a. ~ ::I -o ,cc .... z C) ce u ... u­u a, C) ~ a, ~ 16 / 38 P=0.012 1---0.50--------- 0.20 0.1-----1 0.01 ----I 0.001 -----t Untreated HBsAg+ / Anti-HBs+ FIG. 7B SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 17 / 38 0 0 0) 0) C'J 0) C'J T""" T""" c.o I I I I UJ T""" UJ UJ UJ T""" I I I I 00 UJ 00 T""" 00 UJ T""" v I'-- c.o 0) v II II II II II II a.. a.. a.. C. a.. a.. 0 ::::::- 1000---------------a, ... (.) a, -> "'·-a,- ·- .c a.(.) o ca ~a, -Il- a, 0 > tn .!!!c, <C.5 z­ca. u E ._ ca a, tn c,O caN... a, ~ 100 416 197 269 73 905 908 998 911 956 969 973 997 999 Mouse ID FIG. 7C SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 18 / 38 -m 0 475 1>970 <> 478 ° 984 □ 988 t. 479 ° 497 ~ 0 479.21 <1981 •981.21 v971 °983 °838 1>825 Cl) <>819 ° 824 □ 856 t. 812 ° 814 ·aw 1 _ _..__ _____________ __. 8 -2:! I> -;;-e o.1 i •6_ m 0.01 --1> -~----~vn---------------<~H------ 8 i O .001 ~-~ ---<>----D--..,._____.._________,.. ____ ----<1---~-----------------n------- ~ ~ 0.0001 -------1>-~6---------------_____,,,._______,.._____.,._ ________ _ Cc: <> 8 ~ 0.00001 ~ 0 0 ~ ns 0.000001 ----1 ---c-f -1--1 -1 -1--1 ........ ~ -1--1 -1 -1---0?----o-~ -1--1 -1 ..;;;;;;~-- 2 ... 1 - ~ 1 2 3 4 5 6 7 8 910111213141516171819 Cl) ~ FIG. BA SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 19 / 38 P=0.012 - P=0.00036 P=4.9E-5 PCT / US2024 / 032725 G) u 1-------------- U) .!!! rn c.c. 0 ~ uo - ... <C en zcw, Cc, Uc uo ue a, ca en I! G) ~ Untreated HBsAg- / anti-HBs+ HBsAg- / anti-HBs+ FIG. 8B SUBSTITUTE SHEET (RULE 26)WO 2025 / 006149 PCT / US2024 / 032725 -E -::::> ::::.. G) > G) - C) <C tn m :I: E :s ... G) tn (.) -G) C ~ 20 / 38 AAVZ10 injection at day 11, 22 or 44 500000---r----::::::;::====i:::c;;:~;:i::=i:i==c::i====;::::F=:c:r----, 500QQ----1-----------F---~-=--------'"~ll----+----+--------I 5000-+-----r-r~~~------o--,---+----+-------I ··0··---500 --+-----',~--------=-------------o--+---------.---------+--------I ' so--fLl-l~O------t+-Q--~:-+----.....:.,,-1--------1 5 -;.......+-~---------------'i,----++----~' --+------- 0 .5 -+-+---~--------~------ 0 .05 ---i(J,,,,(___i----o-+-----<:>---o---t----O-----c:J~-0-----0--....... 11 61 111 161 --o-8Q1 ····D···8Q3-o--8Q5-·0·· 831--o-832 ---0-819····0···856- --0- -812- -0- 813---o- -814 -o--824---o- -825- ·-0- •• 838 Days post infection FIG. BC SUBSTITUTE SHEET (RULE 26) 211 WO 2025 / 006149 PCT / US2024 / 032725 ==-E -:::) ---cu > .!! C> <C rn m :I: E ::I ... cu rn u .:. cu C ~ 500000 50000 5000 500 50 5 0.5 0.05 AAVZ10& at day 43 i 21 71 21 / 38 *Boosting anti-HBs antibody level \ \\ ' 121 I \ \ I \ \ I 171 221 271 ---o--471----D---980--o- 972--o- 987--<>-475----0----478 - --o- - 479- -0- -497- -0- -971-o--983--o- -984- --0- -- 988 Days post infection &HBVZ10 administered at dose of 1 E11 copies *Anti-HBs antibody level boosted by injection of mouse anti-HBs antibody at dose of 250 µg / injection triweekly started on day 99 {mouses 475, 478, 479,497), day 141 (mouse 983), or day 162 {mouses 971,984,988) FIG. 8D SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 Cl) ~ -c,- <C (.) Cl)Z mo :::c - e.2 ::::,­... e Cl) C ~o ■---Cl) C ~ 22 / 38 AAVZ10 injection at day 11, 22 or 44 100--------------- 1 ---u-......__---+-_____ ___,_, ......... ____ if--____ -+--__ ...,. 14 64 114 164 214 ····D··· 801 --o - 803--o--805- ·O •• 832 --0- 831 --o--819 ····0··· 812- -0- -813- -o- - 814- -0- -856 -·-0-·-824 -o--825- ·0- •• 838 Days post infection FIG. SE SUBSTITUTE SHEET (RULE 26) 264 WO 2025 / 006149 PCT / US2024 / 032725 -a., > a., c,- <(O a., z mo :::c -0E.:. ::l ca ...... a., C ~o ■---a., C: ~ 23 / 38 AAVZ1Q& *Boosting anti-HBs antibody level at day 43 i 100--------------- 10-n'--J~=---~r,>-,,;---------=-='1--=n:-------t------1 ·-----o----- ;, .--0·--- .. ..•• •· ........... ··- .. .. 1 L __ J_-■■=···:·•--i··-o~----E:::=:::!:~~J 35 85 135 185 235 --o--471 ····D··· 98Q--o- 987--D- 972-<>-475····0-··· 478 - -o- - 479- -0- -497--o- 971-o--983---o---984- ·-0- •• 988 Days post infection &HBVZ10 administered at dose of 1 E11 copies *Anti-HBs antibody level boosted by injection of mouse anti-HBs antibody at dose of 250 µg / injection triweekly started on day 99 (mouses 475, 478, 479,497), day 141 (mouse 983), or day 162 (mouses 971,984,988) FIG. SF SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 24 / 38 HBVZ10 injected at day 44 for 833 and 838 ETVfor 838 - 500000 Cl) > -9:! 50000 c,- c:( o 5000 u,Z ~ .S 500 e-2 2e 50 a, C ~o 5 ■-- r - - - J --· ····~---'-- --"-- - ......1... r;.,:';;. ...- ~ ~-- --□-- ... •□······- I I I I ! I I -~0.5 ~ 0.05 I I 1 -1 - - ... - - ... - ft y . . . . :... - 14 64 114 164 214 I --o-805- ➔- -833····D··· 838 I Days post inoculation FIG. BG SUBSTITUTE SHEET (RULE 26) 264 WO 2025 / 006149 PCT / US2024 / 032725 "C C ns u ... _ --a; c,u <C­ CI) ( / ) m .!!! :::c C. ... 0 ns u :i<C =z CDC Uu CD U c,U f! CD ~ 25 / 38 HBsAG reduced>100-fold I I cccDNA reduced>100-fold I I 1000000-------------- 100000 -........+--r--------------1D HBsAg 10000 □rcDNA 1000 IJcccDNA 100 10 1 0.1 0.01 0.001 __ .....,..... _____ ..........,. ____ ....,..._.....___ 805 833 838 FIG. SH SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 <> fl 0 0 0 WRRRV 0 00 □CIIID[I] □ 0 amooo <> ""'""" ""'""" 0 0 0 26 / 38 0 0 0 () () co 0 0 a> 00 0 0 0 □ WVflV V Cl 0 <> l:Jlll 1 / / lM t:. CXXX) 0000 ""'""" ""'""" ""'""" 0 0 0 0 0 0 0 0 0 0 0 0 11a~1sa1do~ VN~ l9!>1 0 ""'""" 0 0 0 0 0 0 SUBSTITUTE SHEET (RULE 26) PCT / US2024 / 032725 <C en ■ C) -LL WO 2025 / 006149 Cl) (.) -Cl) Cl) ·a. -o C) (.) <:Cm cno mo Io -·· "'O ....... Cl)~ ..... ~ ca Cl) C: .::. cac:.o Cl) T""" ~ c:.o LO 0 II Cl) a.. (.) -Cl) Cl) _c.. + 0 C) (.) <:( ....... Cl) T""" al 0 Io -·. "'O ~ 0) Cl)·-..... ~ 0 ca II Cl) C: L.. ca a.. ..... Cl) ~ ~ ('I) 0 II a.. a5 (.) -Cl) Cl) c.. 0 (.) 0) 0 0 "'O 0 Cl) •• ............ ca c:.o Cl)"- L..~ ..... C: C: ::::J ca LO Cl) T""" ~ T""" □ T""" T""" 0 0 0 27 / 38 I T""" 0 0 0 ' I ' I T""" 0 0 0 0 ' ' ' T""" 0 0 0 0 0 0L6 ~L6 £86 886 v86 L617 8Lv 9Lv 8£8 9zs vZ8 6~8 998 17~8 £~8 Z~8 606 LZ8 0Z8 8~8 £Z8 9~8 ~~8 L98 9£8 £98 ££8 L06 ZL6 L86 086 ~Lv 908 ~£8 £08 Z£8 ~08 Z08 9£8 Zv8 v£8 908 (11a~1sa1do~) JaA!I Jad 1aAa1 VN~ L91}1 a6eJaAy SUBSTITUTE SHEET (RULE 26) PCT / US2024 / 032725 Cl) (.) -Cl) Cl) ·c.. 0 (.) ('I) 0 0 0 <:( z 0 t:> (.) (.) C: c:.o cao Cl) • 0 ~II a.. ci5 u en Q) ·5. 8 T""" co 0 C) 0 C) 0 <( II al :z: a.. en Cl ■ u C) u u -c:: LL ca Q) ~ ('I) 0 0 -0 Cl) 11 ~a.. Cl) Cl) ·c.. 0 (.) LO 0 <( z 0 (.) (.) (.) C: co Cl) ~ WO 2025 / 006149 PCT / US2024 / 032725 28 / 38 ::::- -1r- 831 ~ 500000---------------i -- -o- 838500QQ---1------------:b___..dL___----t---------l-------'====-----------I 5000--+----K-~..0-,,,,,,,j==,,,-(k----+-----+--------I 500---+-+---+---+---+------+----------+-------I 50----r--------------,---------F--t--i,r----------t---t------i-----------t1 -cc 5 -------__,__~a~--+-------+-------+---+-----------11 T""" N 1 ---+-----,f---------+------+-----+--+-------1 en 0 ----o-,,(>--_:r:_ ........ ___ ......., ___ ....,o, ___ ____,, 14 64 114 164 214 Days post infection FIG.10A SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 29 / 38 Mouse anti-HBs antibody 250µg / injection started day7 4pi triweekly for 9 times 500000 50000 5000 500 50 5 0.5 0.05 1 / f I I I I 14 / ,,c / -~ \ \ \ ~ - - -- - - - 64 114 164 FIG.108 -- - -- - 214 SUBSTITUTE SHEET (RULE 26) PCT / US2024 / 032725 -1r- 907 _A -o- 970 -- 264 314 WO 2025 / 006149 PCT / US2024 / 032725 30 / 38 HBVZ10 at d44 ETV L... ~ "q" i Q) T'"" T'"" ~~ OT"""~ T"""C'\IC'\I ~IT'""IN (Y) ~Nm N -q-;oo·,N (Y) "q" Nm N "q" co co (Y) N (Y) Ln 00 O'> T'"" T'"" , M , N (Y) i.n00 O'> T'"" T'"" T'"" ...J 00 o o o o o o 0:99_:o o o o o o o o FIG.10C SUBSTITUTE SHEET (RULE 26) e -C: Q) 0 c.. (.) E ~ co ~ V, ·v, 0 0 z a.. WO 2025 / 006149 31 / 38 Mouse 907 FIG.10D SUBSTITUTE SHEET (RULE 26) PCT / US2024 / 032725 T""" N E E ::::::, ::::::, ........ Q) Q) en en Q) Q) > > :.;::::::; :.;::::::; cc cc C) C) Q) Q) z z WO 2025 / 006149 PCT / US2024 / 032725 32 / 38 Mouse 970 FIG.10E SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 PCT / US2024 / 032725 33 / 38 □ HBsAg copies / cell 1oooooo---------L121_N_o_o_f_in:.._pu_tc_e_lls__J~ -Cl) .i! 100000 c,_ 1-; 10000 mu ::I:cn .._ C1) 1000 ca·-_ a. ::::, 0 = u 100 m- u ~ 10 -C: 907 987 471 970 475 478 479 984 988 971 FIG. 10F SUBSTITUTE SHEET (RULE 26) WO 2025 / 006149 34 / 38 PCT / US2024 / 032725 FIG.10G SUBSTITUTE SHEET (RULE 26) ..... . ..... . ~ W W 0 1 -. J ~ :E ~ -. J ..s: ::,.. .... .. co ~ O ') ~ 0 N 0 N 10 0X H ep A D - Su l U 'I -0 0 1 0 0X G FP H ep G 2 -4 0u l O 'I .... B H K - 02 0 .i:: :,, ID X V 'I 81 2. 1 C ca 81 2. 2 00 V 'I --, ... a. --, 81 2.3 N C 81 2. 4 --, m 81 3. 1 ~ V 'I 'T l U I - c:i: l I G ') ::c 81 3. 2 00 0C I m ■ D J ... a. m .. .J I, , n 81 3. 3 w --, C ) - ::c 81 3. 4 :::c 83 1. 5 C r m 83 1. 6 00 l' J 83 1. 7 ~ O "I ..... .... 83 1. 8 83 3. 11 ,, n 83 3. 12 00 -I - w C : 83 3. 13 W U l N 83 3. 14 0 N .i:: :,, -0 IN N ..... N U 'I WO 2025 / 006149 22 76 52 --1 :::::,:j:;::: 38 31 24 17 12 36 / 38 HBc FIG. 10J SUBSTITUTE SHEET (RULE 26) PCT / US2024 / 032725 V 'I C ca V 'I --, --, C --, m V 'I I m m --, - :::c C r m l' J O "I ..... .... @ r -...... . 0 ' 1. V iri on at ta ch m en t f or in fe ct io n @ 0 l 1. V iri on at ta ch m en t f or in fe ct io n ~ / @ ~ I @ )0 0 '- • H B sA g c cc cD N A o C ap si d 0 • • 0 _ 1• V iri on I 0 . . - - - - - - ~ - - - ~ - - - - - · ' r • • O o o • • O • o r• ' ~ l: .® ~ .~ :. o .~ .~ -. o 0 0 O O O O O O • • ~ o o O O • o o • '- • 0 0 2. cc cD N A fo rm at io n 3. A cc um ul at in g vi ra l 4. cc cD N A lo st to st op r ep lic at io n 5. V ira l p ro du ct s re du ce d an d in itiat io n of pr od uc ts re pl ic at io n r @ ~ I @ O 0 '- C yc le 1 • • • • • • • 0 • __, , ' r o o O o O o • O • o r• ' ~ I : o ® ~O ~ : . o : 0 0 ~ - 0 0 0 o O O O O o '-- o • • 0 • o o • • \ • • • . ~ 2. cc cD N A fo rm at io n 3. A cc um ul at in g vi ra l 4. cc cD N A lo st to 5. V ira l p ro du ct s re du ce d an d in iti at io n of pr od uc ts st op r ep lic at io n re pl ic at io n C yc le 2 FI G . 1 1A tH -- -I ~ Q C :E 0 N 0 N U 'I -0 0 O 'I .... .i:: :,, ID ,, n ~ C : U l N 0 N .i:: :,, -0 IN N ..... N U 'I V 'I C ca V 'I --, --, C --, m V 'I I m m --, - :::c C r m l' J O" I ..... .... @ , "' I 0 ' 1. V iri on at ta ch m en t f or in fe ct io n --- . ® ® o 0 2. cc cD N A fo rm at io n an d in iti at io n of re pl ic at io n 0 • • • • 0 0 0 -- -- .1 . ·® 0 •• • .o o o •- :. o • 3. A cc um ul at in g vi ra l pr od uc ts --- . FI G . 11 B • ••• ••o •• c) • 0 o • ~ • ~ I 0 -- -- . • •~ •o • o o •• • •• o o • • • • 4. V ira l p ro du ct s K ee p ac cu m ul at in g w ith ou t cc cDNA loss • . . . . . 0 • • 0 o • @ • • • oo O • oo •• •• • oo • • • • 5. High level lofviral products cause scy to pathic c hanges an and de structs th e cell tH QC ~ QC :E 0 N 0 NU 'I -0 0 O 'I .... .i:: :,, ID ,, n ~ C : U l N 0 N .i:: :,, -0 IN N ..... NU 'I (19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480042646.8 (22) Application date 2024.06.06 (30) Priority data 63 / 506,582 2023.06.27 US (85) PCT international application entered the national phase date 2025.12.24 (86) PCT international application application data PCT / US2024 / 032725 2024.06.06 (87) PCT international application publication data WO2025 / 006149 EN 2025.01.02 (71) Applicant HBV Technology LLC Address Maryland, USA (72) Inventor Yongyuan Zhang (74) Patent agency Beijing Gewen Law Firm 16168 Patent attorneys Xinhua Wang and Chengxin Zhang (51) Int.Cl. A61K 39 / 42 (2006.01) A61P 1 / 16 (2006.01) A61P 31 / 20(2006.01) C07K 16 / 082(2026.01) (54) Invention Title: Method for Reducing Hepatitis B Virus Surface Antigen (HBsAg) and Hepatitis B Drug Used in the Method (57) Abstract: A method for curing chronic hepatitis B infection in a human being is provided, the method comprising administering to a subject in need an effective amount of one or both of an exogenous anti-HBs antibody or a carrier that produces anti-HBs antibody to reduce cellular and blood hepatitis B surface antigen (HBsAg) by providing a sustained increase in anti-HBs antibody levels in the subject. Claims 2 pages Description 27 pages Sequence Listing (Electronic Publication) Drawings 28 pages CN 121548432 A 2026.02.17 CN 1 21 54 84 32 A 1. A method for curing chronic hepatitis B infection in a human being, the method comprising:1. Administer an effective amount of exogenous anti-HBs antibody or a carrier that produces anti-HBs antibody to a subject in need to reduce cellular and blood hepatitis B surface antigen (HBsAg) by providing a sustained increase in anti-HBs antibody levels in the subject. 2. The method of claim 1, wherein the reduction in cellular and blood HBsAg occurs by: (i) blocking new infection-mediated cccDNA supplementation, or (ii) not directly inhibiting HBsAg synthesis, or both (i) and (ii). 3. The method of claim 1 or 2, wherein the anti-HBs antibody is specific for the "a" determinant of HBsAg. 4. The method of claim 3, wherein the anti-HBs antibody is specific for the human hepatocyte attachment site in the "a" determinant of HBsAg. 5. The method of claim 4, wherein the anti-HBs antibody blocks new infection by blocking the attachment of HBV particles (viral particles and subviral particles) to human hepatocytes. 6. The method of claim 1, wherein the persistently elevated anti-HBs antibody level is 100 mIU / ml or higher, lasting for 3 months or longer. 7. The method of claim 6, wherein the persistently elevated anti-HBs antibody level is 1,000 mIU / ml or higher, lasting for 3 months or longer. 8. The method of claim 7, wherein the persistently elevated anti-HBs antibody level is 10,000 mIU / ml or higher, lasting for 3 months or longer. 9. The method of claim 8, wherein the persistently elevated anti-HBs antibody level is 100,000 mIU / ml or higher, lasting for 3 months or longer. 10. The method of any one of claims 1 to 9, wherein the administration is a single or multiple administration of the exogenous anti-HBs antibody, or a single administration of the vector that generates the anti-HBs antibody. 11. The method of any one of claims 1 to 10, wherein cellular and blood HBsAg is reduced by blocking new infection-mediated cccDNA supplementation. 12. The method of claim 12, wherein the effective amount of the exogenous anti-HBs antibody or the anti-HBs antibody-generating vector is an amount sufficient to maintain a level of anti-HBs antibody sufficient to effectively and completely block new infection-mediated cccDNA supplementation, in the presence or absence of other anti-HBV drugs. 13. The method of any one of claims 1 to 12, wherein the administration is the administration of an effective amount of the anti-HBs antibody. 14. The method of any one of claims 1 to 12, wherein the administration is the administration of an effective amount of the anti-HBs antibody-generating vector, the anti-HBs antibody-generating vector providing endogenous production of anti-HBs antibodies in the subject.15. The method of claim 14, wherein the administration is a single dose of the anti-HBs antibody-generating vector administered in an amount of 1E11 copies or more. 16. The method of claim 15, wherein the single dose administration of the anti-HBs antibody-generating vector is an administration in an amount of 2E11 copies or more. 17. The method of claim 16, wherein the single dose administration of the anti-HBs antibody-generating vector is an administration in an amount of 1E12 copies or more. 18. The method of claim 16, wherein the single dose administration of the anti-HBs antibody-generating vector is an administration in an amount of 3E12 copies or more. 19. The method of any one of claims 14 to 18, wherein the anti-HBs antibody-generating vector is an AAV vector selected from the group consisting of: HBVZ10, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90. 20. The method of any one of claims 14 to 18, wherein the carrier for generating anti-HBs antibodies is a viral vector, a non-viral vector, or nanoparticles. 21. The method of claim 20, wherein the carrier for generating anti-HBs antibodies can be administered alone or in combination thereof. 22. The method of claim 1, wherein the exogenous anti-HBs antibody is co-administered with human anti-HBs antibodies, nanobodies, or antibody fragments. 23. The method of claim 1, wherein the administration results in a reduction of blood HBsAg, the reduction being gradual or abrupt, and in either case, a reduction of blood HBsAg of at least 1-5 log. 24. The method of claim 23, wherein the administration results in a reduction of blood HBsAg, the reduction being gradual or abrupt, and in either case, a reduction of blood HBsAg to a level < 0.05 IU / ml. 25. The method of any one of claims 1 to 24, wherein the method is a monotherapy. 26. The method of any one of claims 1 to 24, wherein the method is a combination therapy with one or more additional HBV drugs that inhibit the synthesis of intracellular HBV DNA, HBV RNA, and / or viral proteins. 27. The method of claim 26, wherein the one or more additional HBV drugs are members selected from the group consisting of: reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inhibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunomodulatory drugs. Claims 2 / 2 Page 3 CN 121548432 AMethods for reducing hepatitis B virus surface antigen (HBsAg) and hepatitis B drugs used in the methods thereof

[0001] Cross-Reference to Related Applications

[0002] This application relates to and claims priority to U.S. Provisional Application No. 63 / 506,582, filed June 6, 2023, the contents of which are hereby incorporated by reference in their entirety.

[0003] Statement Regarding Federally Funded Research

[0004] This invention was carried out with government support under Contract No. 75N930220C00042 granted by the National Institutes of Health. The government enjoys certain rights in this invention. Technical Field

[0005] This invention relates to methods for reducing cellular and serum hepatitis B virus surface antigen (HBsAg) levels in chronic hepatitis B virus (HBV) infection by maintaining high levels of anti-HBs antibodies and blocking new infection-mediated cccDNA supplementation. Background Art

[0006] Hepatitis B virus (HBV) has chronically infected 316 million people worldwide, and nearly one million people die from HBV-related diseases each year. Current HBV drugs rarely deliver durable HBV replication suppression after years of drug treatment, let alone HBV functional cure.

[0007] Currently, in establishing HBV functional cure, both serum HBsAg and HBV DNA markers need to become undetectable; that is, HBV functional cure is defined as the undetectability of serum HBsAg and HBV DNA after a limited period of HBV treatment (Alter et al., Hepatology 67, 1127-1131 (2018)). After long-term treatment with approved HBV drugs using nucleoside / nucleotide analogs (NA), serum HBV DNA can be suppressed and reduced to undetectable levels, but the most difficult challenge is how to effectively reduce serum HBsAg to undetectable levels.

[0008] Currently, the strategy for reducing serum HBsAg levels is to directly inhibit intracellular HBsAg synthesis using siRNA or antisense oligonucleotide (ASO) drugs. However, the efficacy of this strategy and siRNA / ASO-based therapies is limited; both preclinical evaluations and clinical assessments show an average reduction of <2 log in serum HBsAg, and serum HBsAg levels rebound after treatment cessation.

[0009] A more efficient method for reducing HBsAg levels is needed to establish effective functional cure for HBV. Summary of the Invention

[0010] This invention discloses how to effectively reduce cellular and serum HBsAg levels, and the invention comprises the following elements:

[0011] 1. In contrast to the current strategy of reducing serum HBsAg by directly inhibiting intracellular HBsAg synthesis, this invention...The method does not require direct inhibition of intracellular HBsAg synthesis.

[0012] 2. cccDNA is the main HBsAg transcription template, but it is often spontaneously deleted in infected cells. HBV-infected cells continue to secrete HBsAg into the bloodstream, and if the missing cccDNA library is not replenished, it will lead to the emptying of HBsAg in infected cells. Therefore, the method of the present invention, which reduces cellular and serum HBsAg, aims to block new infection-mediated cccDNA replenishment using sustained high levels of anti-HBs antibodies in the presence or absence of other anti-HBV drugs.

[0013] 3. The present invention provides a method for expressing sustained high levels of anti-HBs antibodies using an AAV anti-HBs vector after a single injection, and can be used to block new infection-mediated cccDNA replenishment. Instruction manual 1 / 27 page 4 CN 121548432 A

[0014] The advantages of the present invention (whether alone or in combination) can be achieved by a method for curing chronic hepatitis B infection in humans, the method comprising:

[0015] administering an effective amount of exogenous anti-HBs antibody or a carrier that produces anti-HBs antibody or both to a subject in need by providing a sustained increase in anti-HBs antibody levels in the subject, to reduce cellular and blood hepatitis B surface antigen (HBsAg), wherein the reduction of cellular and blood HBsAg occurs if: (i) new infection-mediated cccDNA supplementation is blocked, or (ii) HBsAg synthesis is not directly inhibited, or both (i) and (ii).

[0016] A more complete understanding of the invention and its many accompanying advantages will readily be obtained when considered in conjunction with the accompanying drawings, which are further understood by referring to the following detailed description, in which:

[0017] Figures 1A-1D show the dynamic HBsAg levels in the blood of HBV-infected uPA / SCID chimeric mice with humanized livers (day 14 to day 162 post-infection), wherein Figure 1A shows untreated group 1 (G1); Figures 1B-1D show groups 2 and 3 (G2-G4) treated with HBVZ10 and entecavir for 12 weeks, but starting at different time points to allow HBsAg to reach different levels. HBVZ10 was administered as follows: in G2, at a dose of 2.5E11 copies on day 11 (d11) and at a dose of 4E11 copies on day 58 (Figure 1B); in G3, at a dose of 1.8E12 copies on day 22 (Figure 1C); and in G4, at a dose of 7.2E12 copies on day 44 (Figure 1D). Time points were truncated in mice that died before day 162. The lower limit of acceptance for HBsAg was 0.05 IU / ml (HBsAg EIA kit, Bio-rad).

[0018] Figure 2 shows the copy number of HBsAg per cell and the number of input cells used to determine HBsAg in liver lysates from HBV-infected uPA / SCID chimeric mice with humanized livers. Cellular HBsAg levels were titrated with sequential dilutions of 1 / 1000, 1 / 100, 1 / 10, 1 / 2, 1 / 3.3, and 1 / 2.5. Inhibition was detected at a 1 / 2.5 dilution, and a dilution of 1 / 3.3 was permissible. Four total lysates from each of animals 825, 838, and 831 were analyzed and numbered .1, .2, .3, and .4, respectively.

[0019] Figure 3 shows the numerical relationship between cellular HBsAg and rcDNA in each cell of the mice in Figure 2. Figure 3A provides a graphical representation showing the copy number of HBsAg and rcDNA in each cell of two mice with undetectable serum HBsAg and one untreated mouse control. Figure 3B shows the ratio of cellular HBsAg to rcDNA in the mice of Figure 3A.

[0020] Figures 4A-4C provide a graphical representation showing serum HBsAg levels, serum HBV DNA levels, and intracellular HBsAg, rcDNA, and cccDNA levels during the HBV infection phase.

[0021] Figures 5A-5C provide a graphical representation showing cccDNA levels in analyzed mouse liver samples.

[0022] Figure 6 provides a graphical representation showing the correlation between mean cccDNA and HBV RNA levels during HBV infection.

[0023] Figures 7A-7C provide a graphical representation showing the effect of treatment with the AAV anti-HBs vector HBVZ10 according to one embodiment of the present invention on mean cccDNA and rcDNA levels in mice.

[0024] Figures 8A-8H provide a graphical representation showing the effect on mean cccDNA levels, kinetic serum HBsAg levels, and kinetic serum HBeAg, demonstrating the progressive clearance of cccDNA after treatment with the embodiment of the present invention.

[0025] Figures 9A-9B provide a graphical representation showing that subjects treated using embodiments of the present invention showed no significant difference in mean Ki67 RNA levels compared to untreated subjects, but a significant difference in mean cccDNA levels.

[0026] Figures 10A-10J provide a graphical representation showing kinetic serum HBsAg levels and intracellular HBsAg levels, which are also confirmed by the Western blot analysis shown in these figures.

[0027] Figures 11A-11B provide a schematic representation of cccDNA deletion driven by replication through spontaneous clearance or cell disruption pathways. Detailed Description

[0028] The embodiments identified as exemplary herein are intended to be illustrative and not restrictive. Table 1 outlines some of the key features of the invention compared to current conventional therapies for reducing HBsAg, and these key features are further set forth in the description below.

[0029] Table 1.

[0030]

[0031] Hepatitis B virus (HBV) is a hepatotropic DNA virus that, if contracted in infancy, can cause persistent and substantially non-cytopathic infection [see, for example, Summers J., Hepatology, 1981;1(2):179-83; and Seeger C et al., The Liver: Biology and Pathobiology, 2020:793-820]. Establishing and maintaining HBV infection in hepatocytes requires the formation of free, covalently closed circular DNA (cccDNA) molecules, which serve as templates for viral transcription in the cell nucleus [see, for example, Summers J et al., Cell, 1982;29(2):403–15; and Tuttleman JS et al., Cell, 1986;47(3):451–60]. Therefore, a single copy of cccDNA in an infected cell is the minimum required. cccDNA molecules are considered long-lived [Alter H et al. Hepatology. 2018;67(3):1127–31] because chronic HBV infection typically lasts for years or decades [Seto W-K et al., The Lancet. 2018;392(10161):2313–24]. Chronic HBV infection is thought to be due to the host's immune system's failure to clear an established infection [Guidotti LG et al., Annual Review of Pathology. 2006;1:23-61]; therefore, chronic HBV infection is generally considered a continuation of an established initial infection. Conventional HBV cure strategies aim to directly eliminate or permanently silence cccDNA [Alter H et al. Hepatology. 2018;67(3):1127-31], or clear infected cells from the liver [Fanning GC et al., Nature Reviews Drug discovery, 2019;18(11):827-44].

[0032] HBV replicates robustly in infected human hepatocytes, as indicated by high serum hepatitis B surface antigen (HBsAg) and HBV DNA levels [see, for example, Keating SM et al., The Journal of Infectious Diseases, 2014;209].(6):845-54; Jaroszewicz J et al., Journal of Hepatology, 2010;52(4):514-22; and Nguyen T et al., Journal of Hepatology, 2010;52(4):508-13], and HBsAg and hepatitis B core antigen (HBcAg) proteins accumulated in infected cells during chronic HBV infection [see, for example, Naoumov NV et al., Gastroenterology, 1990;99(4):1248-5312; and Chu CM et al., Journal of Clinical Pathology, 1995;48(5):470-3] or in vitro infection [see, for example, Ko C et al., Journal of Hepatology, 2018;69(6):1231-41; and König A et al., Journal of Hepatology, 3 / 27 pages 6 CN 121548432 A Hepatology, 2018;69(6):1231-41; and König A et al., Journal of Hepatology, As demonstrated in [2019; 71(2):289-300]. Intracellular accumulation of viral products can indicate that the ability of infected cells to secrete viral particles lags behind the ability to replicate HBV, which, if not stopped, can lead to cytopathic changes. Retention of the L protein in hepatocytes of HBV transgenic mice causes a range of pathologies, including necrosis and persistently elevated ALT levels, and the severity of the pathology is correlated with the concentration of intracellular envelope proteins [Chisari FV et al., Proceedings of the National Academy of Sciences of the United States of America, 1987;84(19):6909-13]. Intracellular HBsAg accumulation in the smooth endoplasmic reticulum (ER) causes ER proliferation and displaces other organelles to the periphery, resulting in a "ground glass" appearance in some hepatocytes during chronic infection [Hadziyannis S et al., Arch Pathol, 1973;96(5):327-30], [Gerber MA et al., The American Journal of Pathology, 1974;75(3):489]. However, most HBsAg-positive cells in liver sections do not show a ground glass appearance [Deodhar K et al., Journal of Clinical Pathology, 1975;28(1):66-70]. In the early 1990s,Summers et al. discussed the following principles regarding the replication and persistent infection of hepatotropic DNA viruses: i. Persistent infection of hepatotropic DNA viruses depends on the suppression of replication in the late stages of infection; ii. Control of cccDNA copy number is required to maintain persistent non-cytopathic infection, since high levels of cccDNA are always associated with cytopathic effects in infected hepatocytes; and iii. Intracellular accumulation of L protein acts as an overall inhibitor of replication and allows persistent infection [see, for example, Summers J et al., Journal of Virology, 1991;65(3):1310-7; and Lenhoff RJ et al., Journal of Virology, 1994;68(9):5706-13].

[0033] Clinical evidence suggests the dynamic evolution of the cccDNA population. During chronic hepatitis B infection, wild-type viral populations in serum or cccDNA in the liver can be cleared and replaced with mutant populations [see, for example, Brunetto MR et al., Proceedings of the National Academy of Sciences of the United States of America, 1991;88(10):4186-90; Carman WF et al., Lancet, 1989;2(8663):588-91; Jiang B et al., Alimentary Pharmacology & Therapeutics, 2019;50(8):940-54; Chen Q-Y et al., Infection, Genetics and Evolution, 2021:105184; and Huang Q et al., Hepatology (Baltimore, Md), 2020]. In patients with chronic hepatitis B receiving nucleoside analogue (NA) therapy, complete cccDNA turnover occurred over a period as short as 24 weeks [Huang Q et al., Hepatology (Baltimore, MD), 2020].

[0034] Quantitative detection of cccDNA levels in serial liver tissue supported the absence of pre-existing cccDNA, indicating that cccDNA levels progressively decreased by 20- to 100-fold during NA treatment in prairie dogs chronically infected with prairie hepatitis virus (an animal model very similar to chronic HBV infection in humans) [Zhu Y et al., Journal of Virology, 2020].2001;75(1):311-22]. It has been reported that cccDNA levels were also reduced by 1-2.9 log in human patients treated with NA [see, for example, Werle-Lapostolle B et al., Gastroenterology, 2004;126(7):1750-8; Wong DK et al., Antiviral Therapy, 2006;11(7):909-16; Wursthorn K et al., Hepatology, 2006;44(3):675-84; Lutgehetmann M et al., Antiviral Therapy, 2008;13(1):57-66; Boyd A et al., Journal of Hepatology, 2016;65(4):683-91; and Lai C-L et al., Journal of Hepatology, 2017;66(2):275-81]. The detected reduction in cccDNA increases the likelihood that cccDNA molecules can be spontaneously cleared from infected cells.

[0035] In summary, the inventors hypothesize that HBV-infected cells in vivo spontaneously clear cccDNA. This hypothesis was tested in uPA / SCID chimeric mice with humanized livers that support robust persistent HBV infection in the absence of functional T-cell and B-cell immunity [Tateno C et al., PloS ONE, 2015;10(11):e0142145]. This specification, page 4 / 27, CN 121548432 A, provides evidence supporting the concept of spontaneous cccDNA loss in HBV-infected cells, and a cccDNA elimination strategy that transforms spontaneous cccDNA clearance into progressive cccDNA elimination by blocking cccDNA replenishment. Therefore, this invention relates to the treatment of persistent HBV infection by blocking cccDNA replenishment and providing highly effective cccDNA elimination therapy.

[0036] Anti-hepatitis B drugs used in this invention

[0037] Any existing or newly developed anti-hepatitis B drug that can block the supplementation and / or synthesis of cccDNA and / or rcDNA can be used in the treatment methods described above. Such drugs include, but are not limited to, exogenously or endogenously expressed antibody drugs, small molecule drugs against any step of HBV infection and replication, peptide drugs, and carrier drugs. The following AAV anti-HBs vector-based HBV drugs were designed and tested in this invention. These AAV anti-HBs vector-based HBV drugs endogenously express anti-HBs antibodies after a single injection, and it was found that when used in the treatment methods described above, the AAV anti-HBs vector-based HBV drugs...The HBV drug in vivo is effective against chronic hepatitis infection by blocking cccDNA supplementation in cells. A total of nine AAV anti-HBs vectors contain the following sequences:

[0038] Nucleic acid sequence ID NO: 1 encodes the amino acid sequence of sequence ID NO: 2. Sequence ID NO: 2 is the variable region of the heavy chain of HBVZ10 human anti-HBs monoclonal IgG1 antibody against four serotypes of HBsAg.

[0039] Nucleic acid sequence ID NO: 3 encodes the amino acid sequence of sequence ID NO: 4. Sequence ID NO: 4 is the variable region of the light chain of HBVZ10 human anti-HBs monoclonal IgG1 antibody against four serotypes of HBsAg.

[0040] Nucleic acid sequence ID NO: 5 encodes the amino acid sequence of sequence ID NO: 6. Sequence ID NO: 6 is the variable region of the heavy chain of HBVZ20 human anti-HBs monoclonal IgG1 antibody against four serotypes of HBsAg.

[0041] Nucleic acid sequence ID NO: 7 encodes the amino acid sequence of sequence ID NO: 8. Sequence ID NO: 8 is the variable region of the light chain of HBVZ20 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0042] Nucleic acid sequence ID NO: 9 encodes the amino acid sequence of sequence ID NO: 10. Sequence ID NO: 10 is the variable region of the heavy chain of HBVZ30 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0043] Nucleic acid sequence ID NO: 11 encodes the amino acid sequence of sequence ID NO: 12. Sequence ID NO: 12 is the variable region of the light chain of HBVZ30 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0044] Nucleic acid sequence ID NO: 13 encodes the amino acid sequence of sequence ID NO: 14. Sequence ID NO: 14 is the variable region of the heavy chain of HBVZ40 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0045] Nucleic acid sequence ID NO: 15 encodes the amino acid sequence of sequence ID NO: 16. Sequence ID NO: 16 is the variable region of the light chain of HBVZ40 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0046] Nucleic acid sequence ID NO: 17 encodes the amino acid sequence of sequence ID NO: 18. Sequence ID NO: 18 is the variable region of the heavy chain of HBVZ50 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0047] Nucleic acid sequence ID NO: 19 encodes the amino acid sequence of sequence ID NO: 20. Sequence ID NO: 20 is the variable region of the heavy chain of HBVZ40 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.The variable region of the light chain of HBVZ50 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0048] Nucleic acid sequence ID NO: 21 encodes the amino acid sequence of sequence ID NO: 22. Sequence ID NO: 22 is the variable region of the heavy chain of HBVZ60 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0049] Nucleic acid sequence ID NO: 23 encodes the amino acid sequence of sequence ID NO: 24. Sequence ID NO: 24 is the variable region of the light chain of HBVZ60 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0050] Nucleic acid sequence ID NO: 25 encodes the amino acid sequence of sequence ID NO: 26. Sequence ID NO: 26 is the variable region of the heavy chain of HBVZ70 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0051] Nucleic acid sequence ID NO: 27 encodes the amino acid sequence of sequence ID NO: 28. Sequence ID NO: 28 is the variable region of the light chain of HBVZ70 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg. Specification 5 / 27 page 8 CN 121548432 A

[0052] Nucleic acid sequence ID NO: 29 encodes the amino acid sequence of sequence ID NO: 30. Sequence ID NO: 30 is the variable region of the heavy chain of HBVZ80 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0053] Nucleic acid sequence ID NO: 31 encodes the amino acid sequence of sequence ID NO: 32. Sequence ID NO: 32 is the variable region of the light chain of HBVZ80 human anti-HBs monoclonal IgG1 antibody against 4 serotypes of HBsAg.

[0054] Nucleic acid sequence ID NO: 33 encodes the amino acid sequence of sequence ID NO: 34. Sequence ID NO: 34 is the variable region of the heavy chain of the HBVZ90 human anti-HBs monoclonal IgG1 antibody against four serotypes of HBsAg.

[0055] Nucleic acid sequence ID NO: 35 encodes the amino acid sequence of sequence ID NO: 36. Sequence ID NO: 36 is the variable region of the light chain of the HBVZ90 human anti-HBs monoclonal IgG1 antibody against four serotypes of HBsAg.

[0056] Nucleic acid sequence ID NO: 37 is the nucleic acid sequence of the AAV vector, consisting of 3758 bp (including two ITRs (inverted terminal repeats from AAV)), a chicken β-actin promoter, constant regions of the human IgG1 heavy and light chains, WPRE (posttranscriptional regulatory element of marmot hepatitis virus), and SV40 polyadenylation signal. This AAV vector (sequence ID NO: 37) allows the cloning of the heavy chain.Both the light chain and two variable regions are used to express a complete human IgG1 monoclonal anti-HBs antibody.

[0057] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 2 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 4 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0058] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 6 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 8 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0059] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV virus particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 10 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 12 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0060] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV virus particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 14 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 16 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0061] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles comprising antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 18 and antibody VL, wherein VL comprises SEQ ID NO: 18.The amino acid sequence of SEQ ID NO: 20 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0062] In one embodiment, the present invention relates to an isolated binding molecule or an antigen-binding fragment thereof specifically binding to HBV viral particles and / or HBsAg subviral particles comprising antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 22 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 24 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described isolated binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0063] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 26 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 28 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0064] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles containing antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 30 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 32 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0065] In one embodiment, the present invention relates to a separate binding molecule or antigen-binding fragment thereof that specifically binds to HBV viral particles and / or HBsAg subviral particles comprising antibody VH, wherein VH comprises the amino acid sequence of SEQ ID NO: 34 and antibody VL, wherein VL comprises the amino acid sequence of SEQ ID NO: 36 or a variant thereof having at least 95% sequence homology. In one embodiment, the present invention relates to a nucleic acid molecule encoding the above-described separate binding molecule or antigen-binding fragment. In one embodiment, the present invention relates to a vector comprising the above-described nucleic acid molecule.

[0066] In one embodiment, the present invention relates to a method for curing chronic hepatitis B infection in a human, the method comprising administering an effective amount of a carrier for generating anti-HBs antibodies to a subject in need to reduce cellular and blood hepatitis B surface antigen (HBsAg) by providing a sustained increase in anti-HBs antibody levels in the subject. In some embodiments, the sustained increase in anti-HBs antibody levels is 100 mIU / ml, 1000 mIU / ml, 10,000 mIU / ml, 100,000 mIU / ml or higher, for a period of 3 months or longer. In a preferred embodiment, these levels of anti-HBs antibodies are generated during the period by a single administration of the carrier for generating anti-HBs antibodies.

[0067] In a preferred embodiment, the single dose of the carrier for generating anti-HBs antibodies is an amount of 1E11 copies or more, more preferably 2E11 copies or more, still more preferably 1E12 copies or more, and most preferably 3E12 copies or more.

[0068] If the concept of spontaneous cccDNA clearance from infected cells is valid, then continuous cccDNA replenishment is required to maintain cccDNA levels. The method of the present invention provides a therapeutic intervention designed to block cccDNA replenishment.

[0069] Two known pathways facilitate cccDNA replenishment: intracellular recycling and neo-infection. The intracellular recycling pathway involves the delivery of newly synthesized rcDNA molecules to the nucleus for cccDNA conversion [see, for example, Tuttleman JS et al., Cell, 1986;47(3):451-60; and Nassal M., Gut, 2015;64(12):1972-84]. However, this pathway mainly functions during the early stages of replication and is impeded by the accumulation of envelope proteins during the late stages of replication [Lenhoff RJ et al., Journal of Virology, 1994;68(9):5706-13]. Previous studies have shown that new infection is a major pathway for cccDNA replenishment [see, for example, König A et al., Journal of Hepatology, 2019;71(2):289-300; Allweiss L et al., Gut, 2018;67(3):542-52; and Volz T et al., Journal of Hepatology, 2013;58(5):861-7].

[0070] This invention rethinks cccDNA elimination strategies. Direct targeting of cccDNA or killing of infected cells is generally recommended for cccDNA elimination and complete cure of chronic HBV infection. Based on this invention, such strategies may not be necessary. Instead, see page 10 of this specification 7 / 27.CN 121548432 A provides an unconventional cccDNA elimination strategy that does not require direct targeting of cccDNA molecules, but rather aims to transform spontaneous cccDNA loss into progressive cccDNA elimination by blocking cccDNA replenishment.

[0071] In some embodiments of the method of the present invention, the reduction of cellular and blood HBsAg occurs when: (i) new infection-mediated cccDNA replenishment is blocked, or (ii) HBsAg synthesis is not directly inhibited, or both (i) and (ii).

[0072] In some embodiments, anti-HBs antibodies provide blocking of new infection-mediated cccDNA replenishment. In some embodiments, anti-HBs antibodies block new infection by blocking the attachment of HBV particles (viral particles and subviral particles) to human hepatocytes. In some embodiments, anti-HBs antibodies are specific for the "a" determinant of HBsAg, and preferably specific for the human hepatocyte attachment site in the "a" determinant of HBsAg.

[0073] In some embodiments, anti-HBs antibodies are provided by one or more administrations, wherein said administration is performed by a procedure selected from: injection, infusion, oral administration, or transdermal administration. In embodiments of the invention, sustained high levels of anti-HBs antibodies are provided endogenously or exogenously. In some embodiments, anti-HBs antibodies can be expressed by administration of a virus, non-viral vector, or nanoparticles that deliver a human anti-HBs antibody gene or mRNA to express anti-HBs antibodies or a vaccine that expresses or directly delivers HBsAg protein or peptide to elicit an anti-HBs antibody response in a receptor.

[0074] In some embodiments, anti-HBs antibodies are expressed by administration of a viral vector (including, but not limited to, AAV-based therapies) to express sustained high levels of anti-HBs antibodies. In a preferred embodiment, the AAV-based therapy comprises administering one or more members selected from the group consisting of HBVZ10, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90. In some embodiments, exogenous anti-HBs antibodies are infused or human anti-HBs antibodies, nanobodies, or antibody fragments are injected.

[0075] In the method of the present invention, the reduction of HBsAg in the blood can be gradual or abrupt, both resulting in a reduction of 1-5 log, preferably 3-5 log, or to undetectable levels or < 0.05 IU / ml.

[0076] In one embodiment, treatment of chronic HBV infection comprises treating a newborn / child infected with HBV.

[0077] In one embodiment, treatment of chronic HBV infection comprises treating an adult infected with HBV.

[0078] In one embodiment, the HBV-infected human patient is an individual with chronic HBV infection who has been HBsAg positive for more than 6 months and has normal or elevated alanine aminotransferase (ALT) levels.

[0079] In one embodiment, the HBV-infected human patient is an HBV-positive pregnant woman, or an organ transplant recipient who is HBsAg positive or HBsAg negative / anti-HBc positive after transplantation and is prone to relapse of HBV infection.

[0080] In one embodiment, the HBV neutralizing antibody or antibody fragment is generated by an HBV therapeutic vector.

[0081] In one embodiment, the HBV therapeutic vector comprises a mixed population of vectors, wherein each vector encodes a specific anti-HBs antibody or antibody fragment that binds to one or more epitopes of the HBV envelope protein, or comprises a single vector that encodes an HBV neutralizing antibody or antibody fragment that binds to one or more epitopes of the HBV envelope protein.

[0082] In some embodiments, the method is a monotherapy. In other embodiments, the method is a combination therapy with one or more additional HBV drugs that inhibit the synthesis of intracellular HBV DNA, HBV RNA, or / and viral proteins. In such combination therapy embodiments, the one or more additional HBV drugs are preferably members of the group consisting of: reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inhibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunomodulatory drugs.

[0083] In an important embodiment, the present invention utilizes the discovery of the cccDNA molecule, which is the primary transcriptional template directing cellular HBsAg synthesis and is frequently spontaneously deleted from infected cells. HBsAg is continuously secreted from infected cells into the bloodstream. The deletion of cccDNA and the continuous secretion of HBsAg will lead to the emptying of HBsAg from infected cells. Therefore, if the replenishment of the depleted cccDNA library is prevented, HBsAg can be cleared from infected cells by secretion alone. This understanding forms the basis of the present invention.

[0084] In a preferred embodiment, the present invention recognizes that if the cccDNA library in infected cells remains replenished, HBsAg cannot be cleared even if HBsAg secretion or HBsAg synthesis is inhibited, because, as demonstrated by preclinical evaluations and clinical trials, inhibiting HBsAg synthesis alone does not address the root cause of maintaining HBsAg production in infected cells.

[0085] In another embodiment, the present invention utilizes the function of HBsAg secretion, the natural process of HBV-infected cells, and the properties of HBsAg proteins to clear HBsAg from infected cells.

[0086] There are two pathways for replenishing the cccDNA library: one is the recycling pathway, which transports newly synthesized rcDNA molecules to the cell nucleus for cccDNA conversion, and the other is neo-infection, in which viral particles circulating in the blood attach to and enter hepatocytes, initiating a new round of infection by establishing a cccDNA library in the nucleus of the infected hepatocytes. However, these two cccDNA replenishment pathways are not being utilized equally. The inventors have found that the recycling pathway is generally limited, and neo-infection is the main pathway for replenishing the cccDNA library. Therefore, an extended embodiment of the present invention aims to block neo-infection to effectively prevent cccDNA replenishment.

[0087] To further demonstrate the present invention, durable blocking of neo-infection can be achieved by using an AAV anti-HBs vector that expresses a sustained high level of anti-HBs antibodies after a single intramuscular injection. This not only delivers durable efficacy without HBsAg relapse but also simplifies therapies for HBsAg reduction.

[0088] In one combined implementation, in contrast to current methods of reducing serum HBsAg levels by directly inhibiting intracellular HBsAg synthesis, the present invention reduces cellular and serum HBsAg by blocking cccDNA supplementation (which eliminates the root cause of HBsAg production). Furthermore, this method does not require direct inhibition of cellular HBsAg synthesis.

[0089] Examples

[0090] Example 1. Experimental procedure for HBV infection and treatment using uPA / SCID chimeric mice.

[0091] A total of 49 HBV-infected uPA / SCID chimeric mice were divided into 7 groups, as shown in Table 2 below.

[0092] Table 2. Animal experimental design

[0093]

[0094]

[0095] Continuous blood samples were collected every two or three weeks until termination, at which point liver tissue was collected and rapidly frozen.

[0096] Example 2. Analysis of HBV infection in blood and liver samples. Instruction manual 9 / 27 pages 12 CN 121548432 A

[0097] Quantitative analysis was performed on the levels of HBsAg, HBeAg, HBV DNA, anti-HBs antibody, and human albumin in consecutive blood samples.

[0098] The mean intracellular HBsAg, rcDNA, and cccDNA were determined by quantitative determination of 20 samples from each liver.

[0099] Western blotting of HBsAg in liver lysates and immunohistochemical staining of HBsAg and HBcAg in liver sections were also performed.

[0100] Figures 1A-1D provide a graphical representation of the dynamic HBsAg levels in the blood of HBV-infected uPA / SCID chimeric mice with humanized livers (day 14 to day 162 post-infection), where Figure 1A shows the untreated Group 1 (G1);Figures 1B-1D illustrate the treatment of groups 2 and 4 (G2-G4) with HBVZ10 and entecavir for 12 weeks, but starting at different time points to achieve different HBsAg levels. HBVZ10 was administered as follows: in G2, at a dose of 2.5E11 copies on day 11 (d11) and at a dose of 4E11 copies on day 58 (Figure 1B); in G3, at a dose of 1.8E12 copies on day 22 (Figure 1C); and in G4, at a dose of 7.2E12 copies on day 44 (Figure 1D). Time points were truncated in mice that died before day 162. The lower limit of acceptable HBsAg concentration was 0.05 IU / ml (HBsAg EIA kit, Bio-rad).

[0101] Figure 2 provides a graphical representation of the copy number of HBsAg per cell and the number of input cells used to determine HBsAg in liver lysates from HBV-infected uPA / SCID chimeric mice with humanized livers. Cellular HBsAg levels were titrated with sequential dilutions of 1 / 1000, 1 / 100, 1 / 10, 1 / 2, 1 / 3.3, and 1 / 2.5. Inhibition was detected at a 1 / 2.5 dilution, and a dilution of 1 / 3.3 was permissible. Four total lysates from each of animals 825, 838, and 831 were analyzed and numbered .1, .2, .3, and .4, respectively.

[0102] Figures 3A-3B show the numerical relationship between cellular HBsAg and rcDNA in each cell of the mice in Figure 2. Figure 3A provides a graphical representation showing the copy number of HBsAg and rcDNA in each cell of two mice with undetectable serum HBsAg and one untreated mouse control. Figure 3B shows the ratio of cellular HBsAg to rcDNA in the mice of Figure 3A.

[0103] Example 3. The method of the present invention shows a more effective reduction in serum HBsAg than reported using siRNA or ASO drugs that directly inhibit intracellular HBsAg synthesis, particularly in the following aspects:

[0104] 1. All mice treated with the method of the present invention showed a reduction in serum HBsAg. Furthermore, a progressive reduction of 3-5 log in serum HBsAg was observed, and by 162 days post-vaccination, serum HBsAg became undetectable in 8 out of 11 mice. Note: In both preclinical evaluation and clinical trials, direct inhibition of intracellular HBsAg synthesis showed an average reduction of < 2 log.

[0105] 2. The progressive reduction in serum HBsAg closely resembled the progressive reduction in serum HBeAg levels, which means that the observed progressive reduction in serum HBsAg reflects progressive HBV clearance in the liver.

[0106] 3.Compared with untreated control mice, mice with undetectable serum HBsAg showed a 3–4 log reduction in intrahepatic HBsAg, rcDNA, and cccDNA levels.

[0107] Materials and Methods

[0108] Animals and HBV Infection

[0109] All animal experiments were conducted at Noble Life Sciences Inc. (Sykesville, MD), a preclinical research contract service provider. The selection of Noble Life Sciences Inc. as a subcontractor for animal experiments was approved by the NIH’s NIAID Contract Office (NIH Approved Animal Welfare Protection Number, A4633-01). All animal studies were approved by Noble Life Sciences’ Institutional Animal Care and Use Committee (IACUC) protocol NLS-614. All animals received humane care. Instructions for Use, page 10 / 27, 13 CN 121548432 A

[0110] Immunoactive female mice (CD1) were purchased from Charles River Laboratories (Boston, MA, USA), and immunodeficient male mice (uPA / SCID chimeric mice) were provided by PhoenixBio USA (New York, NY, USA). All mice were kept in cages in BSL-2 chambers (TP107, One Corporation, Osaka, Japan) at a temperature of 23°C and a 12-hour light / dark cycle. All animals were fed freely with γ-irradiated CRF1 food and autoclaved water. HBV inoculum (HBsAg ADR subtype / genotype C) was prepared from mouse serum (project number H01-108 Animal 4) by diluting 5E9 HBV DNA copies / mL to 2E7 HBV DNA copies with 100 μl of PBS and administered intravenously (tail vein) to each chimeric mouse.

[0111] AAV anti-HBs vector (HBVZ10)

[0112] This invention provides a novel HBV therapy candidate known as an AAV anti-HBs vector that utilizes an optimized adeno-associated virus (AAV) vector [see, for example, Balazs A et al., Nature Medicine, 2014;20(3):296-300; Balazs A et al., Nature Biotechnology, 2013;31(7):647-52; de[Jong YP et al., Science Translational Medicine, 2014;6(254):254ra129; and Deal C et al., Proceedings of the National Academy of Sciences of the United States of America, 2014;111(34):12528-32] deliver human anti-hepatitis B surface antigen (anti-HBs) antibody genes. The AAV anti-HBs vector of the preferred embodiment of the present invention expresses sustained high levels of anti-HBs antibodies after a single injection. By using these AAV anti-HBs vectors as candidates for novel HBV therapies, the method of the present invention compensates for the insufficient production of anti-HBs antibodies in chronic HBV infection. The most preferred AAV anti-HBs vector is HBVZ10. Intramuscular administration of HBVZ10 in chimeric mice endogenously expresses human anti-HBs antibodies and blocks new infections in the presence or absence of entecavir.

[0113] Generation of AAV Anti-HBs or Anti-malarial Antibody Vectors

[0114] Briefly, 293 cells were co-transfected with an AAV vector encoding anti-HBs or anti-malarial antibodies and the plasmid pDP8.ape (Plasmid Factory, Bielefeld, Germany), which provides pHELP plasmid function and trans-encodes AAV2 rep and AAV8 cap proteins for packaging the AAV vector. The resulting AAV vectors contained no viral open reading frames (ORFs). AAV was purified by PEG precipitation and cesium chloride ultracentrifugation. The infectivity of AAV aliquots was confirmed in vitro by transducing 293 cells and quantifying antibody concentrations in the medium using ELISA. After generation, purification, and concentration, a total of 1E14 genome copies were obtained for each vector.

[0115] HBVZ10 Dosage

[0116] In Animal Experiments 1 and 2, a small dose of HBVZ10 of 1E11 genomic copies was administered intramuscularly, and in Animal Experiment 3, a higher dose of HBVZ10 of 2.5E11, 1.8E12, or 7E12 genomic copies was administered.

[0117] Monitoring of HBV Infection and Human Albumin Levels in Blood

[0118] Blood was collected every three weeks to quantify serum HBV using ELISA with calibrators (MONOLISA Anti-HBs 20 Calibration Kit 25219, Bio-Rad) and human albumin (Human Albumin ELISA Kit E-80AL, Immunology Consultants Laboratory) as directed.DNA (qPCR, see below), HBeAg (CSB-E13557h, CUSABIO), HBsAg (GS HBsAg EIA 32591, Bio-Rad), anti-HBs antibody (MONOLISA anti-HBs EIA 25200, Bio-Rad).

[0119] In addition, serum HBsAg in the selected samples was analyzed by Western blotting.

[0120] Alanine transaminase (ALT) activity in serum

[0121] Serum ALT activity was assessed using an alanine transaminase colorimetric assay kit (Cayman Chemical, trade number 700260) according to the assay manual. The absorbance was measured at 340 nm every minute for 10 minutes, and the resulting 10 absorbance values ​​were plotted against time. Due to the limited serum volume, a modification was made: 20 μl of serum sample was adjusted to 10 μl and compensated with 10 μl of H2O. Therefore, in the calculation formula, 0.02 ml of serum sample is adjusted accordingly to 0.01 ml on page 14 of the instruction manual 11 / 27.

[0122] Analysis of intrahepatic HBV DNA

[0123] Each liver was randomly sampled 20-40 times by cutting 20-40 mg of liver tissue (weighed and recorded) and placed in a disposable microhomogenizer (BioMasher, Takara catalog number: 9790B) in 500 μl of isotonic buffer (154 mM Tris-HCl, pH 7.5, 1 mM EDTA and 0.05% Triton X-100) for 10 strokes. The homogenized tissue suspension was rotated at 14,000 rpm for 2 minutes, and 100 μl of the lysate was reserved for Western blotting or ELISA of intracellular HBsAg, while the remaining 400 μl was transferred to a new microtube for the isolation of replication intermediates (RI), while the nuclear precipitate was left in the tube for cccDNA isolation.

[0124] Each extraction round included two negative controls, one placed in the first sample position and the other in the last position, to monitor for any contamination during extraction.

[0125] rcDNA was extracted from 400 μl of supernatant using the following procedure: [Zhang YY et al., Journal of Virology, 2004;78(3):1195-201]

[0126] 1. 110 μl of proteinase K (final 0.5 mg / mL) and 1% SDS were added and incubated at 50 °C for one hour.

[0127] 2. Add 500 μl of phenol, vortex and cool on ice for 3 minutes, and centrifuge at 14,000 rpm for 2 minutes.

[0128] 3. Transfer the supernatant to a new tube and add 1000 μl of phenol.Precipitate with 100% ethanol and centrifuge the sample at 14,000 rpm for 15 minutes.

[0129] 4. Wash the precipitate with 1000 μl of 100% ethanol at 14,000 rpm for 10 minutes.

[0130] 5. Remove residual ethanol and air dry for 5 minutes.

[0131] 6. Dissolve the precipitate in 200 μl of 10:1 TE buffer (pH 7.4) and then rcDNA is ready for qPCR.

[0132] cccDNA was extracted from the nuclear precipitate by the following procedure: [Zhang YY et al., Proceedings of the National Academy of Sciences of the United States of America, 2003;100(21): 12372-7]

[0133] 1. Resuspend the precipitate in 200 μl of 10:1 TE (with 0.05% Triton-X100, pH 7.4).

[0134] 2. Add 200 μl of 6% SDS-0.1M NaOH solution and incubate at 37°C for 15 minutes.

[0135] 3. Add 100 μl of 3M KAc (pH 5.07) and mix thoroughly. Cool on ice for 5 minutes, and then microcentrifuge at 14,000 rpm for 2 minutes to remove the KSDS-protein-ssDNA complex (precipitate).

[0136] 4. Transfer the supernatant to a new tube, add 500 μl of phenol, and centrifuge at 14,000 rpm for 2 minutes.

[0137] 5. Recover the supernatant and add 5 μl of glycogen (4 μg / μl, 20 μg total).

[0138] 6. Add 1000 μl of ethanol and centrifuge at 14,000 rpm for 15 minutes.

[0139] 7. Wash with 1000 μl ethanol and centrifuge at 14,000 rpm for 10 minutes.

[0140] 8. Dissolve in 50 μl EcoRI buffer at 37°C for 15 minutes and inactivate at 80°C for 20 minutes. The cccDNA samples are ready for qPCR.

[0141] RT-qPCR detection of total HBV RNA in cccDNA and rcDNA samples

[0142] Total HBV RNA levels were determined in each of 120 cccDNA and 120 rcDNA samples prepared from untreated mice 842 and 836 (representing the amplification phase), 831 and 987 (representing the maintenance phase), and 38 and 813 (where serum HBsAg was progressively reduced to undetectable levels while cccDNA was reduced >100-fold in treated mice).Specifically, 20 cccDNA and 20 rcDNA samples from each liver were tested. The average RNA concentration in the cccDNA samples was approximately 1.5 μg / μl, and the average RNA concentration in the rcDNA samples was 0.5 μg / μl. The A260 / 280 ratio varied minimally between 1.98 and 2.08. All RNA samples were diluted 10-fold and then RT-qPCR was performed using 2 μl of the TaqMan™ Rapid Virus 1-Step Master Mixture (Thermo Fisher 4444432) and primers / probes located on the S gene (rcDNA for qPCR in Table 3). In addition to cccDNA detection in the same cccDNA samples, rcDNA was also detected in the same cccDNA samples with the same primers / probes on the same plate and in the un-RT rcDNA samples. In the same samples, the detected HBV RNA level was approximately 10-fold higher than the rcDNA level. After subtracting rcDNA copies from the same samples, net RNA copies were plotted. The ratio of RNA copy number / cell to cccDNA copy number / cell was calculated using the total net RNA copy number (nuclear RNA copy number + cytoplasmic RNA copy number).

[0143] RT-qPCR detection of human Ki67 RNA levels in 840 cccDNA samples

[0144] A pre-stored human Ki67 RNA primer / probe system (FAM-MGB, Hs01032435_g1) was purchased from ThermoFisher Scientific. This detection system produces 179 bp amplicons, which are isolated for the preparation of qPCR standards. Human Ki67 RNA was detected by RT-qPCR using two μL of total nuclear RNA containing cccDNA with the same TaqMan™ Rapid Virus 1-Step Master Mixture (ThermoFisher 4444432). To first establish the full picture of Ki67 RNA expression in humanized livers of chimeric mice, 840 cccDNA samples from 42 livers were analyzed, including 15 untreated livers, 11 livers treated with anti-HBs antibody or a combination of HBVZ10 and entecavir but with detectable serum HBsAg (HBsAg+), and 16 treated livers with progressively decreased serum HBsAg levels to undetectable levels (HBsAg-). Subsequently, correlation analysis between Ki67 RNA and cccDNA in the same sample was performed using scatter plots to generate correlation trend lines and R² values.

[0145] cccDNA samples were always stored at -20°C and all processing procedures were performed under biosafety conditions with the blower on.The experiment was conducted in a cabinet. All tips, plates, tubes, and solutions used were nuclease-free. Analysis of the differences in Ki67 RNA levels between existing cccDNA and freshly isolated cccDNA samples from five livers (mouse 907, 471, 987, 831, and 805) revealed no significant results (data not shown), indicating that RNA samples in existing cccDNA samples were not significantly degraded.

[0146] qPCR of serum HBV DNA, intrahepatic rcDNA, and cccDNA

[0147] Table 3 lists the primer and probe sequences for detecting serum HBV DNA and intracellular rcDNA by qPCR, while the primer sequences for detecting cccDNA are located on the flanking side of the gap region, and the probe is placed immediately after the DR1 sequence (Table 3).

[0148] Table 3. Location and sequence of cccDNA and rcDNA primers and probes, specification 13 / 27 pages, 16 CN 121548432 A

[0149]

[0150]

[0151] The listed cccDNA primers and probes are specific enough to distinguish rcDNA amplifications of 300–6000 times. qPCR was performed using a Taqman Rapid Advanced Master Mixture (ThermoFisher catalog number: 4444558) on a QuantStudio 3 instrument (ThermoFisher catalog number: A28136) that accommodates 0.1 ml 96-well hard-shell plates.

[0152] All standards used for qPCR were calibrated using Absolute Q digital PCR.

[0153] Absolute Q (ABQ) Digital PCR of cccDNA

[0154] The cccDNA copy number / cell was initially calculated based on qPCR and then retested using Absolute Q digital PCR (ThermoFisher catalog number: A52864). In short, the procedure includes the following steps:

[0155] 1. Prepare 9.1 μl of reaction mixture consisting of 1.8 μl of 5x DNA dPCR mixture (ThermoFisher catalog number: A52490), 0.5 μl of 20x primer / probe mixture (the final concentration of each primer and 250 nM probe is 900 nM), 1 μl of cccDNA sample, and 5.8 μl of DNase and RNase-free H2O.

[0156] 2. Load 9 μl of reaction mixture into one well of a microfluidic array plate (MAP, ThermoFisher catalog number: A53301).

[0157] 3. Run dPCR, which consists of the following: preheating at 96°C for 10 minutes, and 40 cycles of 5 seconds at 96°C followed by 15 seconds at 60°C.

[0158] 4. Generate a data report using QuantStudio Absolute Q digital PCR software.

[0159] The sensitivity of dPCR is a single copy per microcompartment, and the result is considered valid if >19,000 microcompartments out of 20,480 microcompartments of each sample read the Rox fluorescence signal.

[0160] Procedure and principle for simultaneous detection of cccDNA and rcDNA in the same cell nucleus by ABQ dual digital PCR

[0161] The main procedure for detecting both cccDNA and rcDNA in the same cell nucleus is as follows:

[0162] 1. Homogenize 20-30 mg of liver tissue in 500 μl homogenization buffer (10 mM Tris-HCl (pH 7.5), 3 mM MgCl2, 0.25 M sucrose and 0.05% Triton X-100). The cell nuclei are precipitated by centrifugation and resuspended in homogenization buffer containing 2 μg / ml ethidium bromide. Instruction manual 14 / 27 pages 17 CN 121548432 A

[0163] 2. Individual cell nuclei are individually sorted and deposited in the wells of a 96-well plate.

[0164] 3. The deposited cell nuclei are digested with proteinase K at a concentration of 0.5 mg / ml for 60 minutes, and then inactivated at 80°C for 15 minutes.

[0165] 4. The released HBV DNA is linearized by digestion with NcoI.

[0166] 5. The linearized HBV DNA is subjected to ABQ dPCR detection of both cccDNA and rcDNA.

[0167] Principle of simultaneous detection of cccDNA and rcDNA in the same cell nucleus by ABQ dual digital PCR

[0168] The ABQ digital PCR instrument can simultaneously detect four fluorescence signals of FAM, VIC, ABY and JUN / Cy5, which allows for the detection of four different targets (multiplex) in the same reaction. The emission wavelengths of FAM and Cy5 are 517 nm and 670 nm, respectively, and their wavelength spectra do not overlap. Therefore, FAM was chosen to label the cccDNA probe, and Cy5 was chosen to label the rcDNA probe to detect both molecules in the same reaction, which is called dual dPCR.

[0169] The specificity of cccDNA detection is provided by cccDNA-specific primers located on the flanking side of the gap region in the HBV genome and cccDNA-specific probes placed immediately after the DRI sequence (Table 3).

[0170] Linearized cccDNA templates cannot generate fluorescent signals with the rcDNA primer / probe detection system.

[0171] HBV DNA released from each deposited nucleus will undergo NcoI digestion to be detected using the rcDNA primer / probe system.cccDNA was excluded from the needle detection. The positive strand of rcDNA is only partially synthesized, containing a single-stranded gap of 600-2100 nucleotides at the 3' end [Summers J et al., Proceedings of the National Academy of Sciences of the United States of America, 1975;72(11):4597-601]. Since NcoI is located between nt1372 and 1376, close to the 3' end of the positive strand, it is most likely to exist in the single-stranded sequence of the rcDNA molecule [Summers J et al., Proceedings of the National Academy of Sciences of the United States of America, 1975;72(11):4597-601]. Therefore, NcoI will linearize cccDNA, but cannot cleave rcDNA.

[0172] The NcoI linearized cccDNA sequence starts at C at nt1373 (5') and ends at C at nt1372 (3'). The rcDNA forward primer will bind to the 3' end of the linearized cccDNA, but the rcDNA probe binds to its 5' end. The Taq DNA polymerase bound to the forward primer at the 3' end cannot reach the probe at the 5' end, and therefore cannot cleave the first base C with Cy5 dye by its 5'-3' exonuclease activity, nor can it generate a Cy5 fluorescent signal. If both the rcDNA forward primer and probe bind to the sequential template containing nt1345 to nt1454, that is, if the F primer binds upstream of the probe binding site, a Cy5 fluorescent signal will be generated, which only occurs in rcDNA after NcoI cleavage. Therefore, after NcoI cleavage, rcDNA (not cccDNA) will be specifically detected by the rcDNA primer / probe.

[0173] The failure of the rcDNA probe / primer to detect cccDNA was verified using an HBV DNA plasmid (ADW isotype monomer cloned into the Psp65 vector) as an alternative cccDNA molecule (linearized by NcoI). The NcoI-digested plasmids were serially diluted and tested using ABQ dual dPCR containing both cccDNA probe / primer and rcDNA probe / primer. Serially diluted cccDNA molecules were detected using the FAM-labeled cccDNA probe; however, no positive signal was detected using the Cy5-labeled rcDNA probe, which detects extracted rcDNA.

[0174] Simultaneous detection of both cccDNA and rcDNA was tested.

[0175] A modified Hirt method [Zhang YY et al.,The extracted cccDNA samples contained rcDNA molecules. Deproteinized rcDNA molecules were detected in the extracted cccDNA samples using DNA blotting [see, for example, Tuttleman JS et al., Cell, 1986;47(3):451-60; Gao W et al., Journal of Virology, 2007;81(12):6164-74; and Blondot M-L et al., Journal of Hepatology, 2016;64(1):S49-S59]. Therefore, the extracted cccDNA samples were used to evaluate the ability of dual dPCR to detect cccDNA and rcDNA. rcDNA was detected in the extracted cccDNA samples by conventional qPCR using a FAM-labeled rcDNA probe. (Instructions 15 / 27, page 18, CN 121548432 A) Both cccDNA and rcDNA were detected in the extracted cccDNA samples by ABQ duplex dPCR. These results not only demonstrate the ability of duplex dPCR to detect both cccDNA and rcDNA molecules, but also support the view that nuclear rcDNA molecules can be used as a biomarker for HBV infection.

[0176] Sorted cell nuclei in each well were subjected to NcoI digestion. DNA samples from single cell nuclei were mixed with dPCR solutions containing both ccc primers / probes and rcDNA primers / probes and loaded into a microfluidic array plate (MAP) for dPCR detection. dPCR results were generated using QuantStudio absolute Q digital PCR software 6.0.

[0177] Thresholds for FAM and Cy5 positive fluorescence

[0178] After extensive evaluation of fluorescence intensity and distribution patterns between cccDNA positive and uninfected samples, a 500 value for both FAM and Cy5 fluorescence intensities was set as the threshold for a positive signal. However, approximately 5% FAM-positive signal and 1% Cy5-positive signal were detected in 576 cell nuclei prepared from three uninfected human livers (two purchased from PheonixBio, and one collected pre-infection). This is because, despite the standard HLPC-based purification of the FAM and Cy5-labeled probes, each probe still contained some free fluorescent molecules. These free fluorescent molecules are independent of quenchers, and if a large number of free fluorescent molecules are distributed within the microcompartment, they can be detected at high intensity without amplification. For example, ROX fluorescence (unlabeled and in free form) was included in the ABQ dPCR master mix and distributed to each microcompartment for quality control. However, distribution to 20480The number of ROX molecules in each microcompartment varies, and high intensity is generated if many molecules are distributed in one microcompartment. Using findings from three uninfected livers as a reference, the false positive rates for cccDNA and rcDNA by dual dPCR were assumed to be approximately 5% and 1%, respectively, meaning that the true number of cccDNA-positive nuclei in the three infected liver samples may be 5% lower than the number detected. However, they did not significantly affect the main finding of cccDNA- / rcDNA+ nuclei.

[0179] rcDNA molecules detected in the nuclei did not bind nonspecifically to the nucleus.

[0180] To evaluate the likelihood of nonspecific binding of rcDNA detected in individual sorted nuclei to the nuclear membrane during the preparation of a nuclear suspension by homogenization of viral particles and capsids into the lysate, nuclear suspensions were prepared from two livers of two uninfected chimeric mice (animal IDs HKB-043-020 or B20 and HKB-043-046 or B46, purchased from PheonixBio). Each type of nucleus suspension was aliquoted into two vials. One vial was used directly for sorting, while the other vial was mixed for 20 minutes with lysates from mouse 987 (an untreated control with an average of 870 copies of rcDNA / cell). The lysates were then removed and dissolved in isotonic buffer (154:1 TE, with 0.05% Triton-X100) for sorting. The sorted nuclei from the four vials were then subjected to double ABQ dPCR. Table 4 shows that there was no significant difference between the two nuclear suspensions mixed with mouse 987 lysate and the two unmixed nuclear suspensions in detecting nuclei with Cy5 intensity ≥ 500. This suggests that the rcDNA molecules detected in sorted nuclei are unlikely to originate from released viral particles and capsids that bind nonspecifically to the nucleus. This is consistent with the concept that the HBV capsid primarily utilizes cellular transport mechanisms rather than diffusion or passive capture to reach the nuclear membrane, where nuclear localization signals on the capsid interact with nuclear import receptors [see, for example, Blondot M-L et al., Journal of Hepatology, 2016;64(1):S49-S59; and Gallucci L et al., Viruses, 2017;9(1):21].

[0181] Western blot analysis of HBsAg in serum and HBsAg and HBc proteins in liver lysates

[0182] Serum and liver samples were analyzed using SDS-PAGE, and HBV surface proteins were detected by Western blot analysis using rabbit polyclonal anti-HBs antibody (Virostat) [see, for example, Hong X et al.,Journal of Virology, 2021;95(3):10.1128 / jvi.01695-20; and Xi J et al., Journal of Virology, 2022;96(1):e01305-21]. Instructions 16 / 27 pages 19 CN 121548432 A

[0183] Immunohistochemical staining of HBsAg on sections

[0184] Briefly, formalin-fixed paraffin-embedded liver sections were cut to a thickness of 5 μM and used for HBsAg staining after dewaxing, digestion with proteinase K and inactivation of endogenous peroxidase with 3% hydrogen peroxide. Rabbit anti-HBs antibody (LS-C683282, LSBio) and HRP-conjugated goat anti-rabbit IgG (LS-C316062, LSBio) were used as primary and secondary antibodies, respectively. DAB chromogenic kit (ACH500-IFU, CP Lab Chemicals) was used for chromogenic development.

[0185] Statistical analysis

[0186] HBsAg (IU / ml) and HBV DNA (copy number / ml) and antibody levels (μg / mL) are expressed as mean ± standard deviation (SD). Mean intracellular rcDNA and cccDNA levels are expressed as copy number / cell. The number of cells sampled each time was calculated by multiplying the sample weight (mg) by 1.39E5 cells per mg of liver tissue [Sohlenius-Sternbeck A-K, Toxicology in vitro, 2006;20(8):1582-6], and then normalized to a factor of 0.7, taking into account that 70% of human hepatocytes are hepatocytes [Mason WS et al., Journal of Virology, 2010;84(16):8308-15. Epub 2010 / 06 / 04]. The formula for calculating copy number / cells is listed below:

[0187]

[0188] The procedure demonstrating the method of the present invention comprises three components:

[0189] 1. Assessing the effect of efficient HBV replication on the presence of cccDNA in infected cells

[0190] 2. Analyzing cccDNA levels at the somatic cell and single-nucleus levels

[0191] 3. Evaluating the therapeutic effect on cccDNA levels by blocking cccDNA supplementation

[0192] In vivo replication kinetics suggest that inhibition of HBV replication may be mediated by cccDNA clearance

[0193] To understand the kinetics of HBV replication in vivo, untreated chimeric mice infected with HBV were euthanized on days 18, 45, 50, 52, 82, 99, 141, and 212 post-inoculation (pi) to determine kinetic serum HBsAg and HBV levels.DNA levels and intrahepatic HBV markers. There are two infection phases (Figures 4A and 4B). The first phase is the spread of infection to all infectable cells, in which both serum HBsAg and HBV DNA levels rise rapidly after inoculation and peak around day 82. The second phase is the persistent infection phase, in which HBV infection remains at a stable level. The kinetics of serum HBsAg and HBV DNA observed in this model recapture the typical acute HBV infection that persists in humans [Keating SM et al., The Journal of Infectious Diseases, 2014; 209(6):845-54].

[0194] The kinetics of intracellular accumulation of viral products also consist of two phases, as shown in Figure 4C. The first phase is a phase of gradual increase in the accumulation of viral products. For example, intrahepatic HBsAg levels increased from 230 copies / cell on day 18 post-inoculation to 110,000 copies / cell on day 82 post-inoculation, reflecting robust HBV replication, with the secretion of viral particles and subviral particles lagging behind unrestricted HBV replication during the accumulation phase. The second phase is the stage where the accumulation stops increasing after reaching a peak on day 82 post-inoculation. For example, intracellular HBsAg levels remain at approximately 100,000 copies / cell after the peak. Average cccDNA levels fluctuate by two-fold but also cease rising over the next 130 days. Serum HBsAg and HBV DNA levels remained stable (Figs. 4A and 4B), indicating that the cessation of accumulation was unlikely to be caused by increased viral particle secretion, but rather by inhibition of replication required to establish persistent non-cytopathic infection [see, for example, Summers J et al., Journal of Virology, 1991;65(3):1310-7; and Lenhoff RJ et al., Journal of Virology, 1994;68(9):5706-13].

[0195] The direct cytopathic effect of HBV infection in this model was reported

[35] . Of the 18 HBV-infected livers, 4 showed extensive confluent hepatic necrosis with extensive infiltration involving up to 50% of the parenchyma on the sections, but this was not present in the remaining 14 liver sections on page 17 / 27 of the specification, 20 CN 121548432 A.

[0196] As described above, the in vivo cccDNA dynamics comprise two phases (Figure 4C), and cccDNA may be absent in both phases:

[0197] i. Amplification phase. The total cccDNA level in the liver is primarily amplified by expanding the infection in the liver.In the early stages of infection, the cccDNA library in individually infected cells is amplified via intracellular recycling pathways [see, for example, Tuttleman JS et al., Cell, 1986;47(3):451-60; Ko C et al., Journal of Hepatology, 2018;69(6):1231-41; Summers J et al., Journal of Virology, 1990;64(6):2819-24; and Tuttleman JS et al., Journal of Virology, 1986;58(1):17-25]. cccDNA levels increased from 0.00001 copies / cell (day 18 post-inoculation) to 0.35 copies / cell on day 82 post-inoculation. This is not the only event that occurs. Reaching peak infection means that all infectable cells must be infected, as evidenced by the detection of HBsAg and HBcAg in almost all hepatocytes. The cccDNA level was expected to be ≥ 1 copy / cell, as at least one copy of cccDNA is required in each infected cell. However, the mean cccDNA level at peak infection (day 82 post-inoculation) was 0.35 copies / cell, meaning approximately 1 copy of cccDNA per 3 infected cells, suggesting that cccDNA may be absent in some infected cells after initial establishment.

[0198] ii. Maintenance phase. cccDNA was maintained at a stable level (0.35–0.6 copies / cell) to maintain HBV infection at a stable level upon reaching peak. When the mean cccDNA level was < 1 copy / cell, the Poisson distribution predicted that some cells might contain > 1 copy / cell, and others might not contain cccDNA. This suggests that cccDNA is spontaneously cleared from some cells during the maintenance phase. Therefore, a stable HBV infection level may be achieved during the persistent infection phase by establishing a balance between the number of infected cells with cccDNA that maintains HBV replication and the number of cells lacking cccDNA and ceasing viral replication. This means that infected cells primarily regulate HBV replication by clearing cccDNA.

[0199] The average cccDNA level after peak infection was < 1 copy / cell.

[0200] Analysis of cccDNA levels in untreated mice can be extended to obtain a range of cccDNA levels in the liver. To avoid unrepresentative findings from single or multiple samplings, each liver was routinely sampled 20 times, resulting in 220 cccDNA samples from 11 livers between day 82 and day 253 post-inoculation. Among the 220 cccDNA samples, the highest average...The cccDNA level was 2.5 copies / cell, while the lowest mean cccDNA level was 0.003 copies / cell (Fig. 5A).

[0201] Of the 220 cccDNA samples, 28 cccDNA samples (12.7%) had a mean cccDNA level > 1 copy / cell, while the remaining 192 cccDNA samples (87.3%) had a mean cccDNA level < 1 copy / cell (Fig. 5C), indicating that some cells may not contain cccDNA molecules at different time points.

[0202] In 11 livers, the cccDNA levels detected varied considerably from 1.2 copies / cell to 0.16 copies / cell (Fig. 5B). In 1 of the 11 livers, only 1 liver had a mean cccDNA level > 1 copy / cell (1.2 copies / cell).

[0203] Total HBV RNA levels were measured in four untreated livers to compare the relative RNA transcription efficiency between the two infection stages. Mice 842 and 836 were sacrificed on day 50 and day 52 post-inoculation (representing the amplification phase), respectively. Mice 831 and 987 were sacrificed on day 141 and day 218 post-inoculation (representing the maintenance phase), respectively. Total HBV RNA levels in 20 cccDNA samples and 20 rcDNA samples from each liver were determined using RT-qPCR.

[0204] HBV RNA was detected in both cccDNA and rcDNA samples, and HBV RNA was more abundant in the cytoplasm (ranging from several hundred to eight thousand copies / cell) than in the nucleus (ranging from a few to several hundred copies / cell). Typically, the total HBV RNA copy number in the cytoplasm was 10–20 times that in the rcDNA copy number / cell. The frequency of reported HBV DNA integration in chronically infected human liver (page 18 / 27, CN 121548432 A) is approximately one integration per 100 cells [Mason WS et al., Gastroenterology, 2016;151(5):986-98. e4], and HBV DNA integration was detected in this model, but transcriptional silencing appeared [Allweiss L et al., Gut, 2018;67(3):542-52], therefore, the detected HBV RNA is likely mainly transcribed from cccDNA. The ratio of RNA copy number / cell to cccDNA copy number / cell was used to measure the relative efficiency of RNA transcription from cccDNA. In the same samples, a high ratio of mean RNA copy number / cell to mean cccDNA copy number / cell was evident, ranging from 6107 to 7518 in mice 842 and 836 (indicating the amplification phase), and from 831 in miceThe levels ranged from 4837-fold in mice 987 to 9187-fold in mice 987 (representing the maintenance phase). These findings suggest that a single copy of cccDNA can undergo more than 1000 transcriptions, indicating that efficient RNA transcription can be performed by reusing single or several copies of cccDNA in HBV-infected cells. Notably, no significant difference in relative transcription efficiency was observed between the two phases of infection.

[0205] To investigate whether RNA transcription could be affected by a reduction in cccDNA levels, total HBV RNA levels were examined in two additional livers (mice 813 and 838) in response to treatment that blocked cccDNA supplementation, after which cccDNA was reduced by >100-fold and contained only residual cccDNA. The mean HBV RNA level was 5 copies / cell, less than 1 / 100th of the mean HBV RNA level observed in four untreated mice, indicating that the amount of HBV RNA reduction was proportional to the degree of cccDNA reduction. However, the ratio of RNA copy number / cell to cccDNA copy number / cell remained above 1000 (average 7000 to 10000), indicating that relative transcriptional efficiency remained high even in residual infected cells. Furthermore, a positive correlation was found between mean cccDNA levels and HBV RNA levels (copy number / cell) in the six mice (R² = 0.93, Figure 6), suggesting that total HBV RNA levels are largely dependent on cccDNA levels in infected cells in this model. Unlike the latent phase of HIV infection, during which viral RNA transcription in stored cells is suppressed, the efficient RNA transcription from cccDNA suggests that suppression of RNA transcription is an unlikely mechanism for preventing HBV replication and maintaining non-cytopathic effects in HBV-infected cells.

[0206] cccDNA deletion was detected at the single-cell nucleus level.

[0207] One of the criteria used by the supplier PhoenixBio to select uPA / SCID chimeric mice with human livers was a liver replacement index (RI) > 70% [Tateno C et al., PloS ONE, 2015;10(11):e0142145]. Of the 57 mice received, only four had an RI of 76–78%, and the remaining 53 mice had an RI of 80–93%, with approximately 76–93% of the hepatocytes being human hepatocytes. Since somatic cells are routinely used for cccDNA quantification in our assay, an average of 30% non-human (mouse) hepatocytes was used to normalize the calculated cccDNA copy number / cell ratio. The actual number of non-human hepatocytes in each sample varies, which may affect the calculated copy number / cell ratio. At the single-cell nucleus level [Zhang YY et al., Proceedings of the National[Academy of Sciences of the United States of America, 2003;100 (21):12372-7] Quantitative detection of cccDNA copies aims to confirm the absence of cccDNA in some infected cells.

[0208] HBV rcDNA is 100-1000 times more abundant than cccDNA and is also expected to be delivered to the nucleus for cccDNA conversion [Tuttleman JS et al., Journal of Virology, 1986;58(1):17-25]. Absolute Q dual digital PCR (ABQ dual dPCR) was used to simultaneously detect cccDNA and rcDNA in each nucleus, and the detected rcDNA was used as a biomarker for HBV infection. This article describes in detail the strategy, principle, and control of simultaneous detection of cccDNA and rcDNA.

[0209] Using BD FACSAria II, cell nuclei from three livers collected from untreated mice 831, 987, and 907 at day 141, day 218, or day 253 post-inoculation were deposited in 96-well plates at a rate of one nucleus per well. Table 4 lists the total number of analyses performed.

[0210] Table 4. Percentage of HBV-positive cell nuclei identified by dual dPCR (Instruction manual 19 / 27 pages 22 CN 121548432 A)

[0211]

[0212] cccDNA and rcDNA detected at the single-nucleus level

[0213] cccDNA was detected as either cccDNA alone or co-occurring with rcDNA, and rcDNA was detected as either co-occurring with cccDNA or co-occurring with rcDNA alone.

[0214] cccDNA copy number / nucleus

[0215] In most cccDNA-positive cell nuclei, cccDNA was detected as a single copy. Of the 30 cccDNA-positive cell nuclei in mouse 831, 20 (66.7%) contained only a single copy, while the remaining 10 nuclei contained >1 copy, ranging from two to eight copies. In mouse 987, 41 (75%) of the 55 cccDNA-positive cell nuclei contained a single copy of cccDNA, while 14 (25%) nuclei contained >1 copy. In mouse 907, cccDNA was detected as a single copy in 34 (77%) of the 44 cccDNA-positive cell nuclei, while the remaining 10 nuclei contained >1 copy, ranging from 2 to 6 copies / nucleus. Therefore, ≥ 2 / 3 of the detected cccDNA-positive cell nuclei contained only a single copy of cccDNA.

[0216] rcDNA Copy Number / Nucleus

[0217] In mouse 831, a single copy of rcDNA was detected in 24 (57%) of the 42 rcDNA-positive nuclei, and the remaining 18 (43%) nuclei had 2–11 copies / nucleus. In mouse 987, a single copy of rcDNA was detected in 41 (60%) of the 66 rcDNA-positive nuclei, while the remaining 25 rcDNA-positive nuclei contained 2–8 copies / nucleus. In mouse 907, a single copy of rcDNA was detected in 13 (52%) of the 25 rcDNA-positive nuclei, and the remaining 12 (48%) nuclei had >1 copy of rcDNA, ranging from 2 to 19 copies / nucleus.

[0218] cccDNA- / rcDNA+ nuclei

[0219] In three livers, a subset of infected cells (Table 5) from 27%, 47% to 55% of the nuclei had no detectable cccDNA, while rcDNA was detectable in the same nuclei. Infection kinetic data (Figs. 4A and 4B) and published data on HBV infection kinetics in this model [Ishida Y et al., Hepatology, 2018;68(2):473-84] suggest that peak infection can be reached between 82 and 90 days post-inoculation, meaning that all infectable human hepatocytes may be infected approximately 90 days post-inoculation. HBsAg and HBcAg staining showed that most cells in mouse sections 831, 987, and 907 were positive. Therefore, cccDNA- / rcDNA+ cells may indicate the absence of cccDNA in infected cells, or the absence of cccDNA followed by the formation of rcDNA delivered by a newly generated infection in recently uninfected cells.

[0220] Detection of cccDNA- / rcDNA+ nuclei confirmed the ontological finding that cccDNA may have been spontaneously lost from a subset of infected cells.

[0221] Table 5. Percentage of cccDNA and rcDNA positive nuclei

[0222] Specification 20 / 27 pages 23 CN 121548432 A

[0223] After blocking the two cccDNA replenishment pathways, the average cccDNA level decreased by >100-fold.

[0224] The therapeutic effect of blocking new infections with anti-HBs antibodies at the cccDNA level was evaluated.

[0225] Two sources of anti-HBs antibodies were used, both of which are against the "ad and ay" subtypes: exogenous mouse anti-HBs antibody (AM31509 PU-N OriGene) and endogenous anti-HBs antibody expressed by the AAV anti-HBs vector HBVZ10.HBs antibodies (described in detail in the "Methods" section). HBVZ10 can express high levels (up to 500 μg / mL) of anti-HBs antibodies and maintain >100 μg / mL for at least 252 days after a single injection in both immunocompetent and immunodeficient mice, or >100,000 mIU / mL if measured using a WHO-referenced calibrator (as a standard for clinical reporting).

[0226] A total of 15 mice received anti-HBs treatment, of which 13 mice were injected with the AAV anti-HBs vector HBVZ10 at a dose of 1E11 genomic copies at week 7 post-inoculation, and the remaining two mice were injected with mouse anti-HBs antibodies nine times every three weeks starting at day 74 post-inoculation, each injection being 250 μg. Anti-HBs antibodies were detectable in all 15 chimeric mice after treatment. However, serum HBsAg remained positive, indicating that not all viral particles were neutralized and that new infections were only partially blocked.

[0227] The first group consisted of six livers, and the second group consisted of nine livers, collected on day 204 and day 253 post-inoculation, respectively. Each of the 15 livers was randomly sampled 20 times, and a second round of 20 samplings was performed in seven of the 15 livers, resulting in a total of 440 cccDNA samples. Figure 7A shows the average cccDNA levels in the 440 samples. Figure 5B presents the average cccDNA levels per liver or per 20 samples (intermediate samples). Only five (1.1%) of the 440 samples had cccDNA levels > 1 copy / cell, which was significantly lower than the 13% of cccDNA samples in untreated mice. The average cccDNA level in the 15 mice with partially blocked new infection was 0.2 copies / cell, which was significantly lower (p = 0.012) than the 0.5 copies / cell in untreated mice (Figure 7B). The lower cccDNA levels in this group were supported by proportionally lower rcDNA levels (Figure 7C). These results indicate that cccDNA levels are sensitive to partial blocking of neonatal infection.

[0228] The effects of complete blocking of neonatal infection or blocking of both cccDNA supplementation pathways on cccDNA levels were then evaluated.

[0229] Complete blocking of neonatal infection was marked by a change in serum HBsAg from positive to HBsAg negative / anti-HBs positive (HBsAg- / anti-HBs+). Blocking of both cccDNA supplementation pathways was achieved by using a combination of anti-HB antibodies to block neonatal infection and entecavir therapy for 9–12 weeks to reduce cccDNA rcDNA synthesis and intracellular recycling. CccDNA analysis was performed on 17 mice that achieved HBsAg negative / anti-HBs positive status. These mice (Mice 970, intermittently every three weeks) were used to block the neonatal infection.Mice received nine injections of anti-HBs antibody at intervals (Mice 819 received a single dose of 1.8E 12 copies of HBVZ10) underwent anti-HBs antibody monotherapy, while the remaining 15 mice were treated with a combination of anti-HBs and entecavir.

[0230] Each of the 17 livers collected after peak infection between day 123 and day 253 post-inoculation was randomly sampled 20 times, and a second round of 20 sampling was performed on two livers, resulting in a total of 380 cccDNA samples (the rightmost group in Figure 5B). Of these, 140 cccDNA samples from 7 mice were analyzed using qPCR and ABQ dPCR. All cccDNA levels were < 1 copy / cell, and most were < 0.01 copies / cell (Figure 8A). The mean cccDNA level in the 17 mice was 0.0028 copies / cell, less than 1 / 100th of the 0.5 copies / cell level in untreated mice (p = 0.0001), and significantly lower than the 0.2 copies / cell level in mice with partially blocked neopregnancy (p = 4E-4) (Figures 5B and 8B). Furthermore, cccDNA was not detected in either mouse after 20 samplings of each liver. This indicates that complete blocking of neopregnancy is crucial for cccDNA elimination. Adding entecavir to the anti-HBs antibody blocked the recycling pathway and made the anti-HBs antibody more effective at blocking neopregnancy, as the reduction in viral particle production lowered the likelihood of neopregnancy. These results further support the hypothesis that cccDNA replenishment is necessary to maintain cccDNA levels, highlighting the spontaneous clearance of cccDNA from infected cells. Instructions for Use, pages 21 / 27, 24 CN 121548432 A

[0231] The kinetic human albumin levels were similar between untreated and treated mice, indicating that cccDNA elimination was primarily due to the blockade of cccDNA supplementation rather than the absence of human hepatocytes in the humanized liver.

[0232] cccDNA was progressively cleared when the supplementation pathway was blocked in both stages of infection.

[0233] Further experiments were run to show the effect of progressive cccDNA clearance on the blockade of the cccDNA supplementation pathway.

[0234] In chimeric mice infected with HBV, the increase in serum HBsAg levels after inoculation paralleled the increase in viremia (Figures 4A and 4B), indicating that HBV replication was primarily driven by cccDNA. Entecavir treatment is known to reduce serum HBV DNA levels, but has no parallel effect on serum HBsAg levels, especially over a short period of time [Chang TT et al., Hepatology, 2010;52(3):886-93]. Therefore, the serum HBsAg level in entecavir-treated mice, rather than HBV, is...DNA levels can be used as a substitute for intrahepatic cccDNA levels. Serum HBsAg in all 16 mice (Fig. 8C and 8D) experienced a progressive decrease of 3–5 log and became undetectable upon blocking of both cccDNA supplementation pathways. Blockage either began before peak infection (i.e., during the cccDNA amplification phase (Fig. 8C)) or during the cccDNA maintenance phase (Fig. 8D). Administering additional doses of mouse anti-HBs antibodies to increase anti-HBs antibody levels resulted in a transition from partial to complete blockage after peak infection. The progressive decrease in serum HBsAg was associated with and likely caused by the progressive elimination of cccDNA. The progressive decrease in serum HBeAg in all 16 mice further supports this (green in Fig. 8E and 8F). HBeAg is synthesized from precore mRNA, which is transcribed from cccDNA molecules [Yuh CH et al., Journal of Virology, 1992;66(7):4073–84]. In chronic HBV infection, cccDNA levels typically decrease 10–100-fold as HBV infection transitions from an HBeAg-positive to an HBeAg-negative phase [see, for example, Werle-Lapostolle B et al., Gastroenterology, 2004;126(7):1750–8; and Laras A et al., Hepatology, 2006;44(3):694–702]. Therefore, the progressive decrease in serum HBeAg (Figures 8E and 8F) reflects a progressive decrease in cccDNA in the liver. Since both anti-HBs antibodies and entecavir primarily block cccDNA replenishment without directly eliminating cccDNA molecules, the observed cccDNA elimination is likely mediated by spontaneous (non-treatment-mediated) clearance occurring in both phases.

[0235] A >100-fold decrease in cccDNA levels was observed within 80 days.

[0236] uPA / SCID chimeric mice with human livers are fragile and cannot withstand stressful procedures such as successive hepatectomies, which poses a challenge to establishing baseline cccDNA levels before treatment. Therefore, cccDNA levels from different mice with comparable serum HBsAg levels were used as a reference. Figure 5F shows that mouse 838 (treated with anti-HBs antibody expressed with HBVZ10 and entecavir) reached a baseline HBsAg level of approximately 5000 IU / mL on days 54 and 82, which then gradually decreased. This is comparable to mouse 833, which received HBVZ10 monotherapy on day 44. Mouse 833 showed serum HBsAg levels after treatment.The mice 833 showed double positivity for HBsAg (Fig. 8G) and anti-HBs antibody; therefore, neonatal infection in mice 833 was considered partially blocked. Serum HBsAg levels in mice 833 remained stable at approximately 5000 IU / mL from day 82 to day 162 (the termination day). CCCDNA levels in mice 833 were used as a reference for baseline CCCDNA levels prior to HBsAg clearance in mice 838. Compared to intracellular HBsAg and CCCDNA levels in mice 833, intracellular HBsAg and CCCDNA levels in mice 838 decreased by >100-fold over an 80-day period from day 82 to day 162 post-inoculation (Fig. 8H). The mean reduction in cellular HBsAg levels was 423 copies / day. The CCCDNA results further support the use of kinetic serum HBsAg levels as a substitute for CCCDNA levels, and that the observed spontaneous CCCDNA clearance was efficient and could be converted into gradual CCCDNA elimination upon blocking of both CCCDNA replenishment pathways.

[0237] Human Ki67 RNA Levels in 840 cccDNA Samples

[0238] Human Ki67 was chosen as a biomarker to examine the proliferation of human hepatocytes and its correlation with the cccDNA deletion observed in humanized livers of chimeric mice. This choice was based on previous proliferation studies using human Ki67 in the same model [Allweiss L et al., Gut, 2018;67(3):542-52]. Ki67 RNA levels were measured using RT-qPCR in cccDNA samples containing nuclear RNA. Ki67 RNA levels were determined in 840 cccDNA samples isolated from 42 livers, including 15 untreated livers, 11 livers treated with detectable serum HBsAg, and 16 livers treated with progressively decreasing serum HBsAg to undetectable levels, accompanied by a >100-fold reduction in cccDNA levels. In the majority of samples (76%, 639 out of 840 samples), Ki67 RNA levels were <0.01 copies / cell. This means that only one copy of Ki67 RNA was detected in approximately >100 cells, or that fewer than 1% of cells in these samples likely expressed Ki67 RNA (Figure 9A). The highest Ki67 expression levels were detected in 9 samples (1.1%), ranging from 0.1 to 0.28 copies / cell. This indicates that 10 to 28 copies of Ki67 RNA were detected in 100 cells, or that 10–28% of the cells may express Ki67 RNA, although some cells may contain more than one copy of Ki67 RNA. Therefore, Ki67 expression...The actual percentage of cells with RNA may be less than 10–28%.

[0239] There were no significant differences in mean Ki67 RNA levels per liver among the three groups: untreated, treated with detectable HBsAg, and treated with undetectable HBsAg, while there were significant differences in mean cccDNA levels among the three groups (Figure 9B).

[0240] If cell proliferation is the primary driver of cccDNA loss, a negative correlation between Ki67 RNA and cccDNA levels could be expected. However, no correlation was detected between Ki67 RNA and cccDNA kinetics during both the cccDNA amplification and maintenance phases, between treated and untreated mice, or between three different experiments using different batches of chimeric mice. The maximum Ki67 RNA level per liver reached 0.08 copies / cell, indicating that approximately 8% of cells in one mouse (ID: 823) treated with combination therapy expressed detectable Ki67 RNA. Of the 20 samples, Ki67 RNA levels were detected in 6 samples, ranging from 0.1 to 0.21 copies / cell. However, no correlation was observed between Ki67 RNA levels and cccDNA levels in this specific mouse.

[0241] Serum Alanine Transaminase (ALT) Activity

[0242] ALT activity was assessed in 9 consecutive serum samples, comprising 3 serum samples from untreated mice and 6 serum samples from treated mice (which achieved a progressive reduction in serum HBsAg to undetectable levels and a >100-fold reduction in cccDNA compared to untreated mice). ALT activity fluctuated over a 6-month period (spanning from day 21 to day 207 post-vaccination), and 84 of the 88 samples remained below 40 U / L. Prior to the start of entecavir (ETV) treatment, ALT levels were borderline or slightly elevated in the remaining four samples collected from the treated group on day 35 post-vaccination, ranging from 40 U / L to 54 U / L. However, during the treatment and follow-up period (spanning from day 60 to day 207 post-vaccination), these levels subsequently decreased and remained below 40 U / L. Slight elevations in ALT levels at a single time point may simply reflect the upper limit of the ALT fluctuation range and are considered insignificant.

[0243] The reduction in HBsAg in both serum and liver was confirmed by ELISA, Western blot, and immunohistochemical staining.

[0244] Two consecutive serum samples from untreated mice and two serum samples from treated mice, in which serum HBsAg experienced a progressive reduction and became undetectable, were subjected to Western blot analysis.(Figs. 10A and 10B). This shows a kinetic similar to that detected by ELISA, confirming a progressive decrease in serum HBsAg in two consecutive serum samples treated with anti-HBs (Figs. 10C, 10D, and 10E).

[0245] Intrahepatic HBsAg levels in seven mice were also analyzed, with serum HBsAg progressively decreasing. Intrahepatic HBsAg was either undetectable or detectable at low levels by ELISA (Fig. 10F), which was confirmed by Western blot analysis (Fig. 10G). In addition, intrahepatic HBcAg levels in 20 liver lysates (n = 4 lysates per liver) from five mice were analyzed by Western blot analysis, with serum HBsAg progressively decreasing. Cellular HBcAg was not detected in any of the 20 liver lysates (Figs. 10H and 10J), supporting the concept that the progressive reduction in serum HBsAg reflects the clearance of intracellular HBV upon blocking cccDNA supplementation.

[0246] Consistent with ELISA and Western blot data, immunohistochemical staining of HBsAg in the sections showed that intracellular HBsAg was reduced to undetectable or nearly undetectable levels in the seven mice that achieved HBsAg- / anti-HBs positivity.

[0247] Contrary to the prevailing view that HBV cccDNA molecules are stable in infected cells [Alter H et al. Hepatology. 2018;67(3):1127-31], spontaneous cccDNA loss was observed in this study, using chimeric mice with humanized livers, during both the infection transmission phase and the persistent HBV infection phase. Furthermore, cccDNA supplementation is required to maintain cccDNA levels and persistence.

[0248] Analysis of cccDNA copies at the single-nuclear level showed that most infected cells contained a single copy of cccDNA; however, at peak levels, the average intracellular HBsAg level accumulated to approximately 100,000 copies / cell, highlighting the remarkable efficiency of both RNA transcription and viral protein synthesis. Two possible scenarios exist. In scenario 1, the persistent presence of cccDNA after peak levels in infected cells is expected to continue driving transcription and further increase the accumulation of viral products to intolerable levels, leading to cytopathic destruction through which cccDNA will be lost. Furthermore, unlike HIV, HBV does not have a known latent infection phase, meaning there is no significant repression of RNA transcription, which is also supported by high serum HBsAg levels in both HBeAg-positive and HBeAg-negative phases [see, for example, Jaroszewicz J et al., Journal of Hepatology,2010;52(4):514-22; and Nguyen T et al., Journal of Hepatology, 2010;52(4):508-13]. Therefore, in the case of such highly efficient RNA transcription and viral protein synthesis, long-term presence of cccDNA in infected cells may be infeasible.

[0249] However, HBV is largely non-cytopathic. In scenario 2, infected cells may respond well to stress caused by the accumulation of high levels of intracellular viral products. As reported during the second phase of hepatotropic DNA virus replication, viral envelope proteins accumulate in infected cells. Accumulated L protein, alone or in combination with M and / or S protein, inhibits further cccDNA amplification or reduces cccDNA levels [see, for example, Lenhoff RJ et al., Journal of Virology, 1994;68(7):4565-71; Gao W et al., Journal of Virology, 2007;81(12):6164-74; and Lentz TB et al., Journal of Virology, 2011;85(22):11916-27]. Since highly efficient RNA transcription and viral protein synthesis suggest that these steps are not subject to efficient inhibition, clearing cccDNA appears to be the only effective option to prevent HBV replication and protect cells from damage.

[0250] Therefore, such replication-driven cccDNA loss can occur through spontaneous clearance (Fig. 11A) or cell destruction (Fig. 11B). Cytopathic effects on infected primary hepatocytes and acute liver injury were also observed during in vivo infection with the duck hepatitis B virus (DHBV, a member of the Hepadnaviridae family) L protein mutant G133E, which caused defects in enveloped virus production and increased intracellular levels of cccDNA, RNA, capsid, and rcDNA [see, for example, Lenhoff RJ et al., Journal of Virology, 1994;68(9):5706-13; and Lenhoff RJ et al., Hepatology, 1999;29(2):563-71].

[0251] The time range from cccDNA establishment to its disappearance in infected cells represents one cycle of infection. The duration of cccDNA presence in infected cells may be influenced by both HBV replication efficiency and the ability of infected cells to secrete viral particles. Slower replication or more efficient viral particle secretion may prolong the presence of cccDNA in infected cells.More efficient HBV replication or inefficient viral particle secretion may accelerate cccDNA loss. When cccDNA is re-established through neo-infection of cccDNA-negative cells, a new infection cycle begins. This cyclical characteristic of cccDNA indicates that persistent HBV infection is maintained by multiple cycles of neo-infection (Fig. 11A).

[0252] Published studies on the dynamics of intracellular viral product levels have shown that in HBV-infected HepG2-NTCP cells, intracellular HBcAg levels peak at approximately 2–4 weeks and depend on the efficiency of viral particle secretion from infected cells [see, for example, Ko C et al., Journal of Hepatology, 2018;69(6):1231–41; and König A et al., Journal of Hepatology, 2019;71(2):289–300]. In vivo DHBV infection, intracellular L protein peaks around day 5 post-inoculation [Zhang YY et al., Journal of Virology, 2004;78(3):1195-201], suggesting that intracellular hepatotropic DNA virus infection may peak on average 1–4 weeks post-inoculation. Within this timeframe (after which cccDNA clearance may occur), each cycle of HBV infection may end within a few weeks with isolated cccDNA deletion at the cellular level. However, in the absence of sufficient anti-HBs antibodies, hepatic HBV infection may persist for years or even decades because new infection cycles are always emerging, while the early cycles of infection end after cccDNA deletion.

[0253] Previous studies have shown that cccDNA molecules may be lost during cell division [see, for example, Allweiss L et al., Gut, 2018;67(3):542-52; and Zhang YY et al., Proceedings of the National Academy of Sciences of the United States of America, 2003;100(21):12372-7]. Therefore, spontaneous cccDNA loss may also be caused by random human hepatocyte proliferation. However, our findings indicate that human Ki67 RNA expression is not common, with levels <0.01 copies / cell detected in 76% of 840 samples. Furthermore, no correlation was observed between Ki67 RNA levels and cccDNA levels. These results suggest that human hepatocyte turnover is low. These findings regarding Ki67The findings regarding RNA levels are consistent with observations from the mouse provider (PhoenixBio, Personal Communications) that human hepatocyte proliferation is negligible after human liver growth is complete, and are also consistent with Ki67 immunostaining results, which revealed 3% Ki67-positive cells in liver sections prepared 100 days after hepatocyte transplantation in the same uPA / SCID mouse model [Allweiss L et al., Gut, 2018;67(3):542-52]. The Ki67 RNA data are consistent with normal serum ALT levels and stable serum human albumin levels in both treated and untreated mice. Therefore, the low-level proliferation of human hepatocytes observed in humanized mice is unlikely to be a significant driver of cccDNA loss in these data.

[0254] The following are exemplary embodiments of the present invention:

[0255] Embodiment 1. A method for curing chronic hepatitis B infection in a human, the method comprising:

[0256] administering to a subject in need an effective amount of one or both of an exogenous anti-HBs antibody or a carrier that produces an anti-HBs antibody to reduce cellular and blood hepatitis B surface antigen (HBsAg) by providing a sustained increase in anti-HBs antibody levels in the subject.

[0257] Embodiment 2. The method of Embodiment 1, wherein the reduction in cellular and blood HBsAg occurs if: (i) new infection-mediated cccDNA supplementation is blocked, or (ii) HBsAg synthesis is not directly inhibited, or both (i) and (ii).

[0258] Embodiment 3. The method of Embodiment 1 or 2, wherein the anti-HBs antibody is specific for the "a" determinant of HBsAg.

[0259] Embodiment 4. The method of Embodiment 3, wherein the anti-HBs antibody is specific for the human hepatocyte attachment site in the "a" determinant of HBsAg.

[0260] Embodiment 5. The method of Embodiment 4, wherein the anti-HBs antibody blocks new infection by blocking the attachment of HBV particles (viral particles and subviral particles) to human hepatocytes.

[0261] Embodiment 6. The method of Embodiment 1, wherein the persistently elevated anti-HBs antibody level is 100 mIU / ml or higher, lasting for 3 months or longer.

[0262] Embodiment 7. The method of Embodiment 6, wherein the persistently elevated anti-HBs antibody level is 1,000 mIU / ml or higher, lasting for 3 months or longer.

[0263] Embodiment 8. The method of Embodiment 7, wherein the persistently elevated anti-HBs antibody level is10,000 mIU / ml or higher, for a period of 3 months or longer.

[0264] Embodiment 9. The method according to Embodiment 8, wherein the sustained increase in anti-HBs antibody level is 100,000 mIU / ml or higher, for a period of 3 months or longer.

[0265] Embodiment 10. The method according to any one of Embodiments 1 to 9, wherein the administration is a single or multiple administration of the exogenous anti-HBs antibody, or a single administration of the carrier that generates anti-HBs antibody.

[0266] Embodiment 11. The method according to any one of Embodiments 1 to 10, wherein cellular and blood HBsAg is reduced by blocking new infection-mediated cccDNA supplementation.

[0267] Embodiment 12. The method according to Embodiment 12, wherein the effective amount of exogenous anti-HBs antibody or the carrier that generates anti-HBs antibody is an amount sufficient to maintain an anti-HBs antibody level that effectively and completely blocks new infection-mediated cccDNA supplementation in the presence or absence of other anti-HBV drugs.

[0268] Embodiment 13. The method according to any one of Embodiments 1 to 12, wherein the administration is the administration of an effective amount of the anti-HBs antibody.

[0269] Embodiment 14. The method according to any one of Embodiments 1 to 12, wherein the administration is the administration of an effective amount of the anti-HBs antibody-generating vector, the anti-HBs antibody-generating vector providing endogenous production of anti-HBs antibodies in the subject.

[0270] Embodiment 15. The method according to Embodiment 14, wherein the administration is a single dose of the anti-HBs antibody-generating vector administered in an amount of 1E11 copies or more.

[0271] Embodiment 16. The method according to Embodiment 15, wherein the single dose administration of the anti-HBs antibody-generating vector is an administration of an amount of 2E11 copies or more.

[0272] Embodiment 17. The method according to Embodiment 16, wherein the single dose administration of the anti-HBs antibody-generating vector is an administration of an amount of 1E12 copies or more.

[0273] Embodiment 18. The method according to Embodiment 16, wherein the single-dose administration of the vector generating anti-HBs antibodies is administered in an amount of 3E12 copies or more.

[0274] Embodiment 19. The method according to any one of Embodiments 14 to 18, wherein the vector generating anti-HBs antibodies is an AAV vector selected from the group consisting of: HBVZ10, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80, and HBVZ90.

[0275] Embodiment 20.According to any one of embodiments 14 to 18, the carrier for generating anti-HBs antibodies is a viral vector, a non-viral vector, or nanoparticles.

[0276] Embodiment 21. According to the method of embodiment 20, the carrier for generating anti-HBs antibodies may be administered alone or in combination thereof.

[0277] Embodiment 22. According to the method of embodiment 1, the exogenous anti-HBs antibody is co-administered with human anti-HBs antibody, nanobody, or antibody fragment.

[0278] Embodiment 23. According to the method of embodiment 1, the administration results in a reduction of blood HBsAg, which may be gradual or abrupt, and in either case, the reduction of blood HBsAg is at least 1-5 log.

[0279] Embodiment 24. According to the method of embodiment 23, the administration results in a reduction of blood HBsAg, which may be gradual or abrupt, and in either case, the reduction of blood HBsAg is to a level < 0.05 IU / ml.

[0280] Embodiment 25. The method according to any one of Embodiments 1 to 24, wherein the method is a single therapy.

[0281] Embodiment 26. The method according to any one of Embodiments 1 to 24, wherein the method is a combination therapy with one or more additional HBV drugs that inhibit the synthesis of intracellular HBV DNA, HBV RNA, or / and viral proteins.

[0282] Embodiment 27. The method according to Embodiment 26, wherein the one or more additional HBV drugs are one or more members selected from the group consisting of: reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inhibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunomodulatory drugs.

[0283] In view of the above teachings, many modifications and variations of the invention are possible. Therefore, it should be understood that the invention may be practiced in ways different from those specifically described herein within the scope of the appended claims. Instruction manual, page 27 / 27, 30 CN 121548432 A, Figure 1A; Instruction manual drawing, page 1 / 28, 31 CN 121548432 A, Figure 1B; Instruction manual drawing, page 2 / 28, 32 CN 121548432 A, Figure 1C; Instruction manual drawing, page 3 / 28, 33 CN 121548432 A, Figure 1D; Instruction manual drawing, page 4 / 28, 34 CN 121548432 A, Figure 2; Instruction manual drawing, page 5 / 28, 35 CN 121548432 A, Figure 3A, Figure 3B.Figure 4A Appendix to the Instruction Manual, Page 6 / 28, 36 CN 121548432 A Figure 4B Figure 4C Appendix to the Instruction Manual, Page 7 / 28, 37 CN 121548432 A Figure 5A Appendix to the Instruction Manual, Page 8 / 28, 38 CN 121548432 A Figure 5B Appendix to the Instruction Manual, Page 9 / 28, 39 CN 121548432 A Figure 5C Figure 6 Appendix to the Instruction Manual, Page 10 / 28, 40 CN 121548432 A Figure 7A Figure 7B Appendix to the Instruction Manual, Page 11 / 28, 41 CN 121548432 A Figure 7C Figure 8A Appendix to the Instruction Manual, Page 12 / 28, 42 CN 121548432 A Figure 8B Figure 8C Appendix to the Instruction Manual, Page 13 / 28, 43 CN 121548432 A Figure 8D Appendix to the Instruction Manual, Page 14 / 28, 44 CN 121548432 A Figure 8E: Appendix to the instruction manual, page 15 / 28, 45 CN 121548432 A Figure 8F: Appendix to the instruction manual, page 16 / 28, 46 CN 121548432 A Figure 8G: Appendix to the instruction manual, page 17 / 28, 47 CN 121548432 A Figure 8H: Appendix to the instruction manual, page 18 / 28, 48 CN 121548432 A Figure 9A: Appendix to the instruction manual, page 19 / 28, 49 CN 121548432 A Figure 9B: Appendix to the instruction manual, page 20 / 28, 50 CN 121548432 A Figure 10A: Appendix to the instruction manual, page 21 / 28, 51 CN 121548432 A Figure 10C: Appendix to the instruction manual, page 22 / 28, 52 CN 121548432 A Figure 10E: Appendix to the instruction manual, page 23 / 28, 53 CN 121548432 A Figure 10G Instruction Manual Drawings, Page 24 / 28, 54 CN 121548432 A Figure 10H Instruction Manual Drawings, Page 25 / 28, 55 CN 121548432 A Figure 10J Instruction Manual Drawings, Page 26 / 28, 56 CN 121548432 A Figure 11A Instruction Manual Drawings, Page 27 / 28, 57 CN 121548432 A Figure 11B Instruction Manual Drawings, Page 28 / 28, 58 CN 121548432 A

Claims

1. A method for curing chronic hepatitis B infection in humans, the method comprising: Administer an effective amount of exogenous anti-HBs antibody or a carrier that produces anti-HBs antibody to subjects in need to reduce cellular and blood hepatitis B surface antigen (HBsAg) by providing sustained elevated levels of anti-HBs antibody in said subjects.

2. The method according to claim 1, wherein the reduction of HBsAg in cells and blood occurs when: (i) the novel infection-mediated cccDNA supplementation is blocked, or (ii) HBsAg synthesis is not directly inhibited, or both (i) and (ii).

3. The method according to claim 1 or 2, wherein the anti-HBs antibody is specific for the "a" determinant of HBsAg.

4. The method according to claim 3, wherein the anti-HBs antibody is specific for the human hepatocyte attachment site in the "a" determinant cluster of HBsAg.

5. The method according to claim 4, wherein the anti-HBs antibody blocks new infection by blocking HBV particles (viral particles and subviral particles) from attaching to human hepatocytes.

6. The method of claim 1, wherein the continuously elevated level of anti-HBs antibody is 100 mIU / ml or higher, and lasts for 3 months or longer.

7. The method of claim 6, wherein the continuously elevated anti-HBs antibody level is 1,000 mIU / ml or higher, and lasts for 3 months or longer.

8. The method of claim 7, wherein the continuously elevated anti-HBs antibody level is 10,000 mIU / ml or higher, and lasts for 3 months or longer.

9. The method of claim 8, wherein the continuously elevated anti-HBs antibody level is 100,000 mIU / ml or higher, and lasts for 3 months or longer.

10. The method according to any one of claims 1 to 9, wherein the application is a single or multiple application of the exogenous anti-HBs antibody, or a single application of the carrier that generates the anti-HBs antibody.

11. The method according to any one of claims 1 to 10, wherein cellular and blood HBsAg is reduced by blocking new infection-mediated cccDNA supplementation.

12. The method of claim 12, wherein the effective amount of exogenous anti-HBs antibody or the vector that generates anti-HBs antibody is an amount sufficient to maintain a level of anti-HBs antibody sufficient to effectively and completely block new infection-mediated cccDNA supplementation, in the presence or absence of other anti-HBV drugs.

13. The method according to any one of claims 1 to 12, wherein the application is the application of an effective amount of the anti-HBs antibody.

14. The method according to any one of claims 1 to 12, wherein the administration is the administration of an effective amount of the carrier for generating anti-HBs antibodies, the carrier for generating anti-HBs antibodies providing endogenous production of anti-HBs antibodies in the subject.

15. The method of claim 14, wherein the administration is a single dose of the vector that generates anti-HBs antibodies, administered in an amount of 1E11 copies or more.

16. The method of claim 15, wherein the single-dose administration of the vector generating the anti-HBs antibody is administered in an amount of 2E11 copies or more.

17. The method of claim 16, wherein the single-dose administration of the vector generating the anti-HBs antibody is administered in an amount of 1E12 copies or more.

18. The method of claim 16, wherein the single-dose administration of the vector generating the anti-HBs antibody is administered in an amount of 3E12 copies or more.

19. The method according to any one of claims 14 to 18, wherein the vector for generating anti-HBs antibodies is an AAV vector selected from the group consisting of: HBVZ10, HBVZ20, HBVZ30, HBVZ40, HBVZ50, HBVZ60, HBVZ70, HBVZ80 and HBVZ90.

20. The method according to any one of claims 14 to 18, wherein the carrier for generating anti-HBs antibodies is a viral vector, a non-viral vector, or nanoparticles.

21. The method of claim 20, wherein the vector for generating anti-HBs antibodies may be administered alone or in combination thereof.

22. The method of claim 1, wherein the exogenous anti-HBs antibody is administered in combination with human anti-HBs antibody, nanobody, or antibody fragment.

23. The method of claim 1, wherein the administration results in a reduction of blood HBsAg, the reduction being either gradual or abrupt, and in either case, a reduction of blood HBsAg of at least 1-5 log.

24. The method of claim 23, wherein the administration results in a reduction of blood HBsAg, the reduction being gradual or abrupt, in either case, the reduction of blood HBsAg to a level < 0.05 IU / ml.

25. The method according to any one of claims 1 to 24, wherein the method is a monotherapy.

26. The method according to any one of claims 1 to 24, wherein the method is a combination therapy with one or more additional HBV drugs that inhibit the synthesis of intracellular HBV DNA, HBV RNA, or / and viral proteins.

27. The method of claim 26, wherein the one or more additional HBV drugs are members of one or more selected from the group consisting of: reverse transcription inhibitors, capsid inhibitors, cccDNA inhibitors, RNA transcription inhibitors, viral protein synthesis inhibitors, entry inhibitors, interferons, therapeutic vaccines, immune checkpoint inhibitors, and immunomodulatory drugs.

Images