Oligonucleotides for modulating kcnt1 expression

Abstract

The present disclosure provides antisense oligonucleotides for modulating the expression of potassium sodium activated channel T subfamily member 1 (KCNT1) encoded by the KCNT1 gene, and their use for the treatment of developmental epileptic encephalopathy (DEE).

Description

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) ™ (19) World Intellectual Property ~S Organization : YAY YA TA International Bureau —— (10) International Publication Number (43) International Publication Date. = =~ WO 2025 / 036916 Al 20 February 2025 (20.02.2025) WIPOI|PCT (51) International Patent Classification: Published: CI2N 15 / 113 (2010.01) A61K 31 / 7125 (2006.01) - avah ; ternational search report (Art. 21(3)) AOIK 31 / 712 (2006.01) AGIP 25 / 08 (2006.01) — with sequence listing part of description (Rule 5.2(a)) (21) International Application Number: — in black and white; the international application as filed PCT / EP2024 / 072847 contained color or greyscale and is available for download (22) International Filing Date: from FATENTSCOPE 14 August 2024 (14.08.2024) (25) Filing Language: English (26) Publication Language: English (30) Priority Data: 2330638 1.7 16 August 2023 (16.08.2023) EP (71) Applicant: LES LABORATOIRES SERVIER [FR / FR]; 35 rue deVerdun, 92284 SURESNES Cedex (FR). (72) Inventors: TRAN, Héléne; 22 route 128 / Rue Francis Per- rin, 91190 Gif-Sur-Yvette (FR). DAS DORES, William; 22 Route 128 / Rue Francis Perrin, 91190 Gif-Sur-Yvette (FR). CHANRION, Benjamin; | Clos de la Chartreuse, — 31170 Tournefeuille (FR). m= (74) Agent: BESTEL, Delphine, 35 re de Verdun, 92284 — Suresnes Cedex (FR). m=== (81) Designated States (unless otherwise indicated, for every — kind of national protection available); AE, AG, AL, AM, — AO, AT, AU, AZ, BA, BB, BG, BH, BH, BN, BR, BW, BY, BZ, — CA, CH, CL, CN, CO, CR, CU, CV, CZ, DE, DJ, DK, DM, — DO, DZ, EC, EG, EG, GFI, GFI, GB GE, GH, GM, GT, — HN, HR, HU, ID, IL, IN, IQ, IR, IS, IT, JM, JO, JP, KE, KG, = KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, — MA, M, MD, MN, MW, MW, MW MX, MY, MZ, NA, — NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, — RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, == TJ, TM, TN, US, TUA, TUA UZ, VC, VN, WS, — ZA, ZM, ZW. == (84)Designated States (unless otherwise indicated, for every — kind of regional protection available): ARIPO (BW, CV, =—— GH, GM, KE, LR, LS, MW, MZ, NA, RW, SC, SD, SL, ST, — SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, = RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, — DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, — LU, LV, MC, ME, MK, MT, NL, NO, PL, PT, RO, RS, SE, — SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, — GQ, GW, KM, ML, MR, NE, SN, TD, TG). = <f Declarations under Rule 4.17: oO to applicant's entitlement to apply for and be granted a —_ patent (Rule 4.17(ii)) N = 64) Title: OLIGONUCLEOTIDES FOR MODULATING KCNT1 EXPRESSION ~— a (57) Abstract: The present disclosure provides antisense oligonucleotides for regulating expression of potassium sodium-activated e@ channel subfamily T member | (KCNT1) encoded by the KCNT 1 gene and use thereof to treat developmental epileptic encephalopathies GV (DEE). WO 2025 / 036916 PCT / EP2024 / 072847 OLIGONUCLEOTIDES FORMODULATING KCNT1 EXPRESSION BACKGROUND OF THE INVENTION KCNT1 gene encodes an intracellular sodium-activated potassium channel (potassium sodium-activated channel subfamily T member 1- UNIPROT ID Q5JUK3- 5 3) that is expressed in the central nervous system. Also Known as Slack, KCNT7 is a member of the Slo-type family of potassium channel genes and can co-assemble with other Slo channel subunits. These channels can mediate a sodium-sensitive potassium current, which is triggered by an influx of sodium channels ions through sodium channels or neurotransmitter receptors. Delayed outward current may be 10 involved in regulating neuronal excitability. Pathogenic variants in the KCNT1 gene encoding the potassium sodium- activated channel subfamilyT member 1 are associated with a spectrum of epilepsies and neurodevelopment disorders (Barcia et al., Neuro! Genet. (2019) 5(6):e363). They cause developmental and epileptic encephalopathies (DEEs) 15 including epilepsy of infancy with migratingfocal seizures (EIMFS) and early onset epileptic encephalopathy (EOEE). DEEs associated with KCNT7 pathogenic variants are characterized by normal prenatal development and birth. EIMFS, the most frequent and severe DEE phenotype, usually presents in early infancy and is defined by an extremely high seizure burden. Similar to EIMFS, patients with EOEE usually 20 ~—s present with symptoms before one year of age and have a high seizure burden and experience seizures almost daily; these patients also have severe developmental delays and early mortality (Bonardi et al., Brain (2021) 144(12):3635-3650). A recent review of the literature reports 189 individuals affected by KCNT7 associated DEEs (Bonardi, supra), although the actual number of patients may be higher, with The 25 KCNT1 Foundation reporting 3,000 cases worldwide. This incidence rate would characterize DEE as an ultra-rare disease. Typically, DEE disease progression occurs in three phases: a sporadic seizure phase, a stormy phase,and a chronic phase. In the stormy phase, patients can experience hundreds of seizures a day, which usually arises between three and 30. ~=sixmonths of life. This phase is characterized by frequent and / or prolonged seizures or status epilepticus, leading to severe developmental delay and an increased risk of death. The chronic phase typically occurs around 1-2 years of age and patients experience fewer seizures. However, a higher level of clinical heterogeneity is observed, and some patients enter the stormy phase without the sporadic phase and 1 WO 2025 / 036916 PCT / EP2024 / 072847 the time course of the different phases can be highly variable among the affected children (Kuchenbuch et al., Brain (2019) 142(10):2996-3008). Death may occur at any stage in the disease course. Death may have different causes including heart failure and other comorbidities, but sudden unexpected death in epilepsy has been 5 reported as being the most prominent in EIMFS. The seizures are primarily focal motor,with variable secondary generalization, including tonic, clonic, tonic clonic, myoclonic and epileptic spasms. In the chronic phase, the seizures are mainly tonic with dysautonomic manifestations. For example, perioral cyanosis and apnea are common. The characteristic features on 10 electroencephalograms (EEGs) are focal ictal discharges that migrate across neighbouring cortical regions and may arise independently at multiple loci. Other neurological features in these patients include hypotonia, microcephaly, and severe developmental disabilities. Variable delayed myelination, hippocampal volume loss, and cerebellar atrophy have been noted on brain magnetic resonance imaging 15 (MRI). Seizure control has been attempted with multiple interventions, including benzodiazepines, vigabatrin, stiripentol, pnenobarbital, topiramate, quinidine, and a ketogenic diet. Their lack of efficacy has been widely reported (Landmark et al., Epilepsia (2021) 62(4):857-873). Seizures can become rapidlyresistant to the 20 medications. Quinidine, an anti-arrnythmic drug, was explored as an anti-seizure treatment in DEEs, but in some patients it worsened the disease or even caused serious adverse events (e.g., QT interval prolongation) (Liu et al., Neuro! Sci. (2023) 44(4):1201-1206). Valeriasen, an antisense oligonucleotide that was designed to degrade KCNT7 mRNA, was administered in two pediatric carriers of KCNT1 25 mutants who responded with a decrease of seizure number. However, treatment had to be paused due to the emergence of severe adverse events including hydrocephalus. DEE associated with KCNT7 pathogenic variants is a devastating pediatric 30 neurodevelopmental disorder with prognosis varying from severe encephalopathy to early death. This dismal prognosis and a lack of effective therapies highlight the urgent medical need for this disease. 2 WO 2025 / 036916 PCT / EP2024 / 072847 SUMMARY OF THE INVENTION The present disclosure provides antisense oligonucleotides (ASOs) thatreduce the abundance or activity of RNA transcribed from the KCNT?7 gene. By reducing levels of KCNT7 RNA, the compounds of the present disclosure decrease 5 the abundance of KCNT1 protein in the cell, thereby reducing the activity of the channel and hyperexcitability associated to the mutated channels. The compounds may alleviate the symptoms and / or delay disease progression. In some aspects, the present disclosure provides an antisense oligonucleotide reducing KCNT7 expression, wherein the antisense oligonucleotide has a 10 nucleobase sequence that comprises at least 12 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4-12. In particular embodiments, the antisense oligonucleotide described herein has a nucleobase sequence that comprises at least 15 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4-12. 15 In some embodiments, the nucleobase sequence of the antisense oligonucleotide may be selected from SEQ ID NOs: 4-12. In furtherembodiments, the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 7, 8, and 9. In some embodiments, the antisense oligonucleotide described herein has 18 20 to 20 linked nucleosides. In some embodiments, an oligonucleotide described herein may comprise a modified internucleoside linkage, e.g., a phosphodiester internucleoside linkage. In some embodiments, an_ oligonucleotide described herein may comprise phosphodiester internucleoside linkage(s) and / or phosphorothioate internucleoside 25 linkage(s). In certain embodiments, the oligonucleotide may comprise at least 1, 2, 3, 4, 5 or 6 phosphodiester internucleoside linkages. In certain embodiments, at least 1, 2, 3, 4, 5, or more, or all internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the phosphorothioate internucleoside linkages are at 30 one or more, or all, of positions 1-2 (i.e., between nucleosides 1 and 2), 5-16 (i.e., betweenadjacent nucleosides starting at nucleoside 5 and ending at nucleoside 16; that is, between nucleosides 5 and 6, nucleosides 6 and 7, nucleosides 7 and 8, nucleosides 8 and 9, nucleosides 9 and 10, nucleosides 10 and 11, nucleosides 11 and 12, nucleosides 12 and 13, nucleosides 13 and 14, nucleosides 14 and 15, and 3 WO 2025 / 036916 PCT / EP2024 / 072847 nucleosides 15 and 16), and 19-20 (i.e., between nucleosides 19 and 20) in the antisense oligonucleotide of the present disclosure. In some embodiments, the antisense oligonucleotide described herein has at least one nucleoside comprising a modified sugar moiety (e.g., a modified ribose or 5 modified deoxyribose moiety). In further embodiments, the modified sugar moiety comprises a 2’-O-methoxyethyl group (e.g., 2’-O-methoxyethyl ribose). In some embodiments, an oligonucleotide described herein comprises the following formula: i) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds 10 mCds Geo Aeo Teo Tes mCe (SEQ ID NO: 7); iil)Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 8); ili) Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds mCds mCeo Geo Aeo Tes Te (SEQ ID NO:9); 15 iv) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (SEQ ID NO:10): v) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 11); vi) Tes Aeo Teo mCeo mCes Cds Ads Gds Gds Tds Tds Tds Ads Cds Cds 20 mCeo Geo Aeo Tes Te (SEQ ID NO:12) wherein A = an adenine C =acytosine mC = a 5-methylcytosine 25 G = a guanine T =a thymine e = a 2’-O-methoxyethylribose modified sugar d = a 2’-deoxyribose s = a phosphorothioate internucleoside linkage 30 0 = a phosphodiester internucleoside linkage. In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula: 4 WO 2025 / 036916 PCT / EP2024 / 072847 | 4 Q Liki 15 5 sn PO se pt _ i _“ ° i 4 nH, i _f . i * Qs HOP =O 4 KS —0eo ; " a re |vT, 4 ok fi ” wok i ~ NRg \ we_deo rfl \ Konto my ts - oad | 6 We \ . i 2 ; Sw us i, a soles oe “ents ‘ ss a e., e ; w 4 ¢ \ S. AT “ ph See Sep he ae ° i \ i _ Ho a a R. ne ne—pee a at : & { é ar 7 & rt wy nates wT noise rm ic dl , o % % GH a In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula: 5 WO 2025 / 036916 PCT / EP2024 / 072847 HG ok i re . . Pity We—ftee ( Sy A if Mn | — Hy o & \ | i OL ‘Wt , he 8 W Mie a o I ‘i oJ VAS no—hme s wees a0 men oN, L "en 2 , CJ 2 . No Fa 2 io 7 I \ neteso Oy \ Nenfiae on a 3B a4 o Ed a. a \ . i Ve" \ Howbee oa nSabee is NH mee ra *y é ok 4 € ok ~ “et \ a f ke W WHy \ wy 8 L oe ; i ws_tee es Hote rr, ~ , \s an \ ° wd ° 2 ns_teco Bante RSP oO N sy Ott od In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula: 6 WO 2025 / 036916 PCT / EP2024 / 072847 Ho ok yy, | NHe & %. Re Hs—PO ba Shay ste on ii My HO. L. ml Hemtne i Aw, meme f “a ee Aa RS + am s eonte® symimo oy ' | yr ' i . Cr o {5 he \ a wl vooteo i AL renee os \ A od \ e CA... 4 ro, NHe vedas yl no-tme Ay Ly BEY { " \ ee f HE—Pad x ony = 5 . an] a] “ i HE me Pme e_bee i ‘i _ oH a The present disclosure also provides an oligonucleotide conjugate comprising an antisense oligonucleotide described herein wherein at least one conjugate moiety 5 is covalently attached to said oligonucleotide. In some aspects, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide described herein or a conjugate as described herein and a pharmaceutically acceptable excipient. Also provided is a method of reducing KCNT1 expression in a mammalian 10 cell, comprising contacting the cell with an antisense oligonucleotide, a conjugate or a pharmaceutical composition described herein, thereby reducing KCNT1 expression in the cell. In some embodiments, the cell is a central nervous system cell, such as a cell in the human brain. In some embodiments, the present disclosureprovides a method for treating a 15 DEE in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antisense oligonucleotide, a conjugate or a 7 WO 2025 / 036916 PCT / EP2024 / 072847 pharmaceutical composition described herein. The oligonucleotide, conjugate, or pharmaceutical composition may be, e.g., injected intrathecally or intracranially to the subject. It is understood that any of the antisense oligonucleotides, conjugates, or 5 pharmaceutical compositions described herein may be used in any methods described herein for the manufacture of a medicament for treating a DEE in a (human) subject in need thereof. In some embodiments, the oligonucleotide, the conjugate or the pharmaceutical composition described herein may be used in any treatment of DEE (e.g., EIMFS or EOQEE) in a (human) subject in need thereof. 10 Other features, objectives, and advantages of the invention are apparent in the detailed description that follows. It shouldbe understood, however, that the detailed description, while indicating embodiments and aspects of the invention, is given by way of illustration only, not limitation. Various changes and modification within the scope of the invention will become apparent to those skilled in the art from 15 the detailed description. BRIEF DESCRIPTION OF THE FIGURES FIG.1 is a pair of graphs showing dose-dependent percent reduction of human KCNT?7 RNA upon treatment with the indicated KCNT7 ASOs. 20 FIG. 2 is pair of bar graphs comparing the MRNA reduction in wildtype (WT) and mutated P924L induced pluripotent stem (iPS) cell derived neurons by KCNT1_ASO_00849 and KCNT1_Valeriasen. FIG. 3 is a table showing the tolerability scoring system for mice and rats utilized in the in vivo assays described herein. 25 FIG. 4 is a pair of bar graphs showing the efficacy and tolerability of the tested ASOs in mice. The left Y axis and solid bars depict the expression level of KCNT1 mRNA expressed in mouse neurons / nvivo two or six weeks after treatment with the ASOs relative to PBS-treated samples. The right Y axis and black circles depict the functional observational battery (FOB) absolute score observed in mice one hour 30 ~— after treatment with the ASOs. FIG. 5 is panel of bar graphs showing the efficacy of KCNT1_ASO_0815, KCNT1_ASO_0849, and KCNT1_Valeriasen at doses of 1, 5, 10, 30 and 100 nmol. The left Y axis and solid bars depict the expression level of KCNT? mRNA 8 WO 2025 / 036916 PCT / EP2024 / 072847 expressed in mouse neurons in vivo four weeks after treatment with the ASOs relative to PBS-treated samples. FIG. 6 is a dot graph showing the concentration of KCNT1_ASO_00849 and KCNT1_Valeriasen quantified by HPLC fluorescence in cortical tissue homogenate 5 four weeks after a single injection of 5, 15, 30, 60, or 100 nmol of the ASOs. FIG. 7 is a dot graph comparing inhibition of KCNT7 mRNA expression in the cortex by KCNT1_ASO_00815 and KCNT1_ASO_00849 at the dose of 20 or 60 nmol asquantified by gGRT-PCR. FIG. 8 is a dose response graph that compares the KCNT1_Valeriasen and 10 KCNT1_ASO_00849 based on dose effect relationship on mRNA expression level in target tissue. FIG. 9 is an anatomical set of MRI images of rat brain used to quantify the volume of lateral ventricles (LV). Volumes of LV were assessed by manual delineation_on the MRI images. The rostral and caudal margins of the corpus 15 callosum served as anatomical landmarks to limit segmentation. Of the 70 sections covering the brain, approximately 35 to 40 sections were segmented to estimate LV volumes. the total LV volume is the sum of all these values. The top panel corresponds to T2-weighted brain images and the bottom panel corresponds to manually defined regions of interest delimitating LV which are colored in bright. 20 FIG.10 is a bar graph showing the total lateral ventricles (LV) volume following administration of aCSF, KCNT1_Valeriasen or KCNT1_ASO_815. The left Y axis depicts the total volumeof LV acquired at baseline, two weeks or four weeks after treatment with brain MRI. 25 DETAILED DESCRIPTION OF THE INVENTION The present disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting RNAs transcribed from the KCNT7 gene can effectively reduce the abundance of target KCNT7 transcripts and / or translation of the KCNT1 polypeptide from the transcripts. The ASOs of the present disclosure 30 comprise sequences that are complementary to KCNT7 transcripts and bind to defined nucleotide sequences within the transcripts. By decreasing the level of KCNT7 target transcripts in a cell, the ASO mediates a decrease in the expression of the KCNT1 protein in the cell, alleviating the severity or progression of epilepsies and neurodevelopment disorders. The 9 WO 2025 / 036916 PCT / EP2024 / 072847 ASOs of the present disclosure are expected to be particularly useful in the treatment of DEE. The ASOs of the present disclosure are highly advantageous in that they targetKCNT1 expression at the KCNT7 transcript level and thus have the ability to decrease expression of the KCNT1 protein. 5 l. The KCNT1 Gene and KCNT1 Protein The ASOs of the present disclosure bind to transcripts of the KCNT7 gene, which encodes the KCNT1 protein. The KCNT7 transcript named KCNT1-202 has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No: NM_020822.3, 10 ENST00000371757.7) and codes for the protein UNIPROT ID Q5JUK3-3 of 1235 amino acids. The transcript named KCNT1-212 (ENST00000628528.2, SEQ ID NO: 2) codes for the protein UNIPROT ID Q5JUK3-4 of 1211 amino acids. These two transcripts are mRNAs derived from the human KCNT7 gene (ENSGO0000107147, SEQ ID NO: 3). In some embodiments, an ASO described herein targets a transcript 15 ofamammalian KCNT1 gene (e.g., a rodent or human KCNT7 gene). In some embodiments, an ASO of the present disclosure binds to an KCNT1 gene sequence, or a transcript thereof. In some embodiments, an ASO of the present disclosure binds toan KCNT7 transcript that encodes a KCNT‘1 protein, e.g., as found under UniProt Accession Number Q5JUK3-3 or Q5JUK3-4. In certain 20 embodiments, an ASO of the present disclosure comprises a sequence that may be at least 60, 70, 80, 85, 90, or 95%, or 100% complementary to a same-length sequence in the target KCNT7 transcript. In some embodiments, an ASO of the present disclosure can bind to a transcript of a wildtype or mutated KCNT7 gene (e.g., a wildtype human, non-human 25 primate, or rodent gene). In some embodiments, an ASO of the present disclosure binds to a variant, such as a known variant, of the wildtype or mutated KCNT7 gene. An ASO of the present disclosure has not been designed to target selectively a KCNT1 mutated transcript. An ASO of the present disclosure complements with a perfect match to 30 wildtype KCNT7 transcripts in other nonclinical model organisms including mouse, rat, and cynomolgus monkey. The binding site of any ASOs herein was also examined for knownvariation in the human population. It contains seven polymorphisms that are not disease- associated (rs7816229371, rs1588412829, rs746160320, rs / / 0265176, 10 WO 2025 / 036916 PCT / EP2024 / 072847 rs / 80485857, rs1834215203, and rs133 / 7703203). Known disease-causing variants were not found within this region. The present ASOs can reduce or inhibit expression of wildtype or variant KNCT7 transcripts. In certain embodiments, an ASO described herein may reduce or 5 inhibit expression of an KCNT7 transcript encoding a KCNT1 protein such as KCNT1-202 or KCNT1-212. The present ASOs comprise sequences that are complementary to a same- length sequence in a target transcript encoded by the KCNT7 gene (wherein the genomic KCNT1 sequence may comprise, e.g., SEQ ID NO: 3). In certain 10 embodiments, an ASO described herein comprises a sequence that is complementary to a sequence in a hotspot region within the target KCNT7 transcript. The term “hotspot region” refers to a region of the target nucleotidesequence wherein binding of a sequence within the region by a complementary ASO tends to result in a reduction in the abundance or translational activity of the target RNA 15 transcript. A hotspot region may be entirely within an intron, entirely within an exon, or may span an intron / exon junction; or be located in whole or in part in the 5’ or 3’ untranslated region (UTR) of an RNA transcript. In certain embodiments, binding of a sequence in a hotspot region by an ASO described herein reduces KCNT1 RNA levels by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 20 100% in a cell (e.g., as determined in an in vitro assay such as the one described below in the section titled “Example of ASO Screenings in Neurons / n vitro”). In the present disclosure, an ASO compound is interchangeably referred to as KCNT1_ASO_[compound number] and as [compound number]. KCNT1_Valeriasen also is referred to as _ Valeriasen. For example, compound number 25 KCNT1_ASO_00815 and compoundnumber 00815 represent the same ASO compound. ll. Antisense Oligonucleotides The term “antisense oligonucleotide” or “ASO” refers to an oligonucleotide 30 capable of hybridizing to a sequence in a target transcript. It is understood by a person skilled in the art that the ASOs described herein do not occur in nature (i.e., they are “isolated” ASOs). The term “transcript” refers to any RNA transcribed from a gene (e.g., an KCNT71 gene). The gene may be wildtype or may be a mutated or variant (e.g., 11 WO 2025 / 036916 PCT / EP2024 / 072847 polymorphic) form. An RNA transcript may be a primary RNA transcript or precursor messenger RNA (pre-mRNA), or a messenger RNA (mRNA), and may include exons, introns, 5’ UTRs and 3’ UTRs. Unless otherwise indicated, the sequences of transcripts and ASOs provided herein denote the nucleotide sequence from 5’ end 5 (left) to 3’ end (right). The term “oligonucleotide,” as used in the present disclosure, refers to a compound comprising a strand of about 5 to100 nucleosides, e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides, e.g., 20 nucleosides, connected via internucleoside linkages. Each nucleoside and internucleoside linkage of an 10 oligonucleotide of the present disclosure may be modified or unmodified from naturally occurring nucleotides and linkages. A modified oligonucleotide may comprise one or more modified sugar (e.g., ribose or deoxyribose) moieties, one or more modified nucleobases, and / or one or more modified internucleoside linkages. An ASO described herein may comprise a sequence that is substantially or 15 fully complementary to a same-length sequence in the target transcript. Full complementarity occurs when a first strand of contiguous nucleotides (modified or unmodified) and a second strand of contiguous nucleotides (modified or unmodified) are completely complementary to each other over the entire length of the shorter strand (or both strands, if they are of the same length). The two strands are 20 consideredsubstantially complementary to each other when they base-pair with each other over 80% or more (e.g., 90% or more) over the length of the shorter strand (or both strands, if they are of the same length), with no more than 20% (e.g., no more than 10%) of mismatching base-pairs (e.g., for a duplex of 20 nucleotides, no more than 4 or no more than 2 mismatched base-pairs). In some embodiments, a 25 sequence in an ASO of the present disclosure is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target RNA transcript. In some embodiments, the present ASO comprises no more than 1, 2, 3 or 4 mismatches to its target sequence. The term “identical” or “identity” in the context of comparing two nucleotide 30 sequences refers to identical nucleobases. The term “percent identity” in this context refers to the percentage of nucleobases that are the same when the two comparing sequences are aligned (introducing gaps, if necessary) for maximum correspondence, over the length of theshorter comparing sequence (or both sequences, if the comparing sequences are of the same length). 12 WO 2025 / 036916 PCT / EP2024 / 072847 In certain embodiments, reduced, inhibited, or abrogated expression or activity of the target transcript is obServed compared to a control sample not treated with the ASO. In some embodiments, an ASO of the present disclosure reduces the abundance and / or translational activity of the target KCNT7 transcript in a treated 5 sample, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control sample not exposed to the ASO. In some cases, the ASO reduces the level of the target transcript in vivo by said percentage, and administration of the ASO optionally results in a tolerability score (Functional Observational Battery or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, e.g, 10 0. The terms “reduce” and “inhibit” do not necessarily mean a total elimination of the entire amount and / or activity of the transcript. In someembodiments, ASOs are considered to be active when they reduce the amount or activity of the target RNA by 25% or more in an in vitro assay. The present ASO may cause a detectable or measurable change in the level or activity of the KCNT1 protein encoded by the 15 target RNA. Without wishing to be bound by theory, it is believed that ASOs may inhibit expression of KCNT1 protein by recruiting an RNase H1 enzyme to the duplex formed between an ASO and the target KCNT7 transcript. Enzymes of the RNase H1 family are endonucleases that typically target RNA:DNA duplexes and catalyze 20 ‘the hydrolytic cleavage of the RNA in the duplex. In some embodiments, the ASO has minimal off-target effects, and does not hybridize to any non-KCNT7 transcript in a way that results in significant reduction in the abundance or activity of the non-KCNT77 transcript. A. Lengths of Antisense Oligonucleotides 25 In some embodiments, the present ASOs are between 8 and 30 nucleotides in length (e.g., 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length). In some embodiments, an ASO described herein can comprise a sequence, complementary to a same-length KCNT7 transcript sequence, that is any of a range of nucleotide lengths having an upper limit of 18, 30) §=619, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In certain embodiments, the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In particular embodiments, the complementary sequence in the ASO is 16, 17, 18, or 20 nucleobases in length. 13 WO 2025 / 036916 PCT / EP2024 / 072847 B. Modifications of Antisense Oligonucleotides In some embodiments, the ASOs of the present disclosure may comprise one or more modifications, e.g., to increase binding affinity to the target transcript, increase ASO stability (e.g., increase resistance to degradation, e.g., bynucleases), 5 and / or increase ease of ASO transport into the cell. Modifications may include any modification known in the art, including, for example, end modifications, nucleobase modifications, sugar modifications or replacements, and backbone modifications. End modifications may include, for example, 5’ and / or 3’ end modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and inverted linkages). Base 10 modifications may include, e.g., replacement with stabilizing bases, removal of bases, or conjugated bases. Sugar modifications or replacements may include, e.g., modifications at the 2’ and / or 4’ position of the ribose moiety, or replacement of the ribose moiety. Backbone modifications or internucleoside linkage modifications may include, for example, modification or replacement of phosphodiester linkages, e.g., 15 with one or more phosphorothioates, phosphorodithioates, phosphotriesters, methyl and other alkyl phosphonates, phosphinates, and phosphoramidates. In someembodiments, the present ASOs may have one or more modified nucleosides. The term “nucleoside” refers to a compound comprising a nucleobase and a sugar moiety. Naturally occurring nucleosides include DNA and RNA 20 ~=—nucleosides. In a non-naturally occurring nucleoside (also referred to as a “modified nucleoside” or a “nucleoside analog’), the base and / or the sugar have been modified. The modification of the nucleoside may be “silent,” in which case the modified nucleoside has the same or equivalent function in the context of the oligonucleotide compared to a naturally occurring nucleoside. In other cases, a 25 modified nucleoside may increase the efficacy of the ASO in decreasing the abundance or activity of a target transcript. The term efficacy encompasses the target engagement on KCNT7 mRNA. The term “nucleotide,” as used herein, refers to a nucleoside covalently bonded to one or more modified or unmodified internucleoside linkages. Exemplary 30 nucleotides include monophosphates,diphosphates, triphosphates, and thiophosphates. As used herein, the term “nucleotide” encompasses unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs). The term “nucleoside” encompasses unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside 14 WO 2025 / 036916 PCT / EP2024 / 072847 analogs); and the term “nucleobases” encompasses unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs). In some embodiments, a modified nucleoside comprises a modified 5 nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine (5mC) nucleobase, as shown in the structure (I) below, wherein R represents the sugar moiety. NH. CH; nom | A R (1) 10 In some embodiments, a sugar moiety can be a modified or an unmodified sugar moiety. As used herein, an unmodified sugar moiety refers to a 2’-OH(H) ribosyl moiety as found innaturally occurring RNA, also referred to as an unmodified RNA sugar moiety. In some embodiments, a modified sugar moiety may be a 2’-H(H) deoxyribose sugar moiety. This moiety is found naturally in deoxyribonucleic acids 15 and may be referred to as an unmodified DNA sugar moiety or simply a DNA sugar moiety. The structure of a 2’-deoxynucleoside sugar moiety is shown in the structure (Il) below, wherein R represents a nucleobase, and each of the 5’-hydroxyl and 3’- hydroxyl groups of the sugar is optionally involved in internucleoside linkages. HO. | a OH (Il) 20 In some embodiments, a modified sugar moiety may comprise an O- methoxyethyl (MOE) moiety. In some embodiments, the O-methoxyethyl moiety is at the 2’ position of the sugar, as shown in the structure below (III). R in the structure below represents a nucleobase. Each of the 5’-hydroxyl and 3’-hydroxyl groups of 15 WO 2025 / 036916 PCT / EP2024 / 072847 the sugar is optionally involved in internucleoside linkages. A 2’-MOE modifiedsugar or 2’-MOE modified nucleoside, or simply an MOE sugar or nucleoside, is a ribose or nucleoside in which the 2’ hydroxyl group that naturally occurs in the ribose is replaced with a 2’?O0CH2CH2O0CHs group. HO. ° ; OH OW Hs 5 (III) In some embodiments, a modified sugar moiety may comprise a bridged nucleic acid (BNA) moiety. A bridged nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4’-CH2-NH-O-2’ linkage. The nitrogen of the bridged nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with a 10 phenyl group). The structure of a BNA moiety is shown below (IV), wherein R is a nucleobase, R’ Is, for example, an H, Me, or Phenyl group, and each of the 5’- hydroxyl and 3’-hydroxyl groups of the sugar is optionally involved in internucleoside linkages. In the present ASOs, R’ is an Me group, unless otherwise specified. A BNA modified nucleoside, or simply a BNA nucleoside, is a nucleoside comprising a BNA 15 sugar moiety. HO R sae!R! In some embodiments, a modified sugar moiety may comprise a locked nucleic acid (LNA) moiety. A locked nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4’-CH2-O-2’ linkage. An LNA moiety, as described 20 ~_—si+herein, may be in the alpha-L configuration or the beta-D configuration. In particular embodiments, LNA moieties in the ASOs described herein are in the beta-D configuration. The structure of an LNA moiety is shown below (V), wherein R is a nucleobase and each of the 5’-hydroxyl and 3’-hydroxyl groups of the sugar is 16 WO 2025 / 036916 PCT / EP2024 / 072847 optionally involved in internucleoside linkages. An LNA modified nucleoside, or simply an LNA nucleoside, is a nucleoside comprising an LNA sugar moiety. HO R =, ——O HO (V) In certain embodiments, an ASO described herein may include one or more 5 modified nucleotides known in the art, including, e.g., 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, 2’-deoxy modified nucleotides,2’-O- methoxyethyl modified nucleotides, modified nucleotides allowing for alternative internucleoside linkages (e.g., nucleotides comprising thiophosphates, phosphorothioates, and phosphotriesters), modified nucleotides terminally linked to a 10 cholesterol derivative or lipophilic moiety, peptide nucleic acids, inverted deoxy or dideoxy modified nucleotides, abasic modifications of nucleotides, 2’-amino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides comprising modifications at other sites of the sugar or base of an oligonucleotide, and non- natural base-containing modified nucleotides. 15 In some embodiments, the ASO may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modified nucleosides. In certain embodiments, all of the nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% of the nucleosides in the ASO (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or10%) are modified nucleosides. 20 The ASOs of the present disclosure may comprise naturally-occurring and / or non-naturally-occurring internucleoside linkages. The term “internucleoside linkage,” as used in the present disclosure, refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In certain embodiments, an ASO described herein may include one or more modified nucleoside linkages known in the art, including, 25 @g., phosphate, phosphotriester, boranophosphate, §methylohosphonate, phosphoramidate, phosphorothioate, phosphorodithioate linkage, methylenemethylimino (-CH2-N(CH3)-O-CHz2-), thiodiester, thionocarbamate (-O- C(=O0)(NH)-S-), siloxane (-O-SiH2-O-), dialkylsiloxane, N,N'-dimethylhydrazine (-CH2- 17 WO 2025 / 036916 PCT / EP2024 / 072847 N(CHs3)-N(CHs)-), MMI (3'-CH2-N(CHs)-O-5'), amide-3 (3’-CH2-C(=O)-N(H)-5’), amide-4 (3’-CH2-N(H)-C(=O)-5'), amide-5 (3’-N(H)-C(=O)-CH2-5’)), amide-6 (3’- C(=0)-N(H)-CHz2-5’), formacetal (3’-O-CH2-O-5'), methoxypropyl,thioformacetal (3'- S-CHz2-O-5'), carboxylate ester, carboxamide, sulfide, sulfonate ester, or amide 5 linker. See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40- 65. In certain embodiments, an ASO described herein may include one or more modified nucleoside linkages known in the art, including, ¢.g., a phosphonoacetate 10 (PACE, P(CR’R”)nhCOOR) or — thiophosphonoacetate (thioPACE, (S)- P(CR’R”)nhCOOR) internucleoside linkage, wherein n is an integer from O to 6 and each of R’ and R’” is independently selected from the group consisting of H, an alkyl and substituted alkyl. Examples of these internucleoside linkages include phosphonocarboxylate, phosphonocarboxylate, thiophosphonocarboxylate, and 15. thiophosphonocarboxylate ester linkages, and in some embodiments are described in Yamada et al., J. Am. Chem. Soc. (2006) 128(15):5251-61, the contents of which are hereby incorporated byreference in its entirety. In certain embodiments, the internucleoside linkage of a nucleotide may be a phosphate group or a thiophosphate group. Methods of preparation of phosphorous- 20 ~=—containing internucleoside linkages are well known to those skilled in the art. In particular embodiments, the ASOs described herein may have phosphodiester internucleoside_ linkages, phosphorothioate internucleoside linkages, or a combination thereof. The term “phosphodiester internucleoside linkage” refers to an internucleoside linkage between two nucleosides formed by a phosphodiester group. 25 The term “phosphorothioate internucleoside linkage” refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or can be prepared as separate enantiomers. 30 Representative intemucleosidelinkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. ASOs of the present disclosure comprising internucleoside linkages having one or more chiral center(s) can be prepared as populations of ASOs comprising stereorandom internucleoside 18 WO 2025 / 036916 PCT / EP2024 / 072847 linkages, or as populations of ASOs comprising stereodefined internucleoside linkages. The term “stereodefined internucleoside linkage,” in the present disclosure, refers to an internucleoside linkage in which the stereochemical designation of the 5 phosphorus atom is controlled such that a specific amount of Rp or Sp of the internucleoside linkage is present within an ASO strand. The stereochemical designation of a chiral linkage can be defined by, for example, asymmetric synthesis. An ASO having at least one stereodefined internucleoside linkage can be referred to as a stereodefined ASO. 10 In some embodiments, the present ASOs are fully stereodefined. The term“fully stereodefined ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (Rp or Sp) in each internucleoside linkage in the ASO. The term “partially stereodefined ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (Rp or Sp) in at least one 15 internucleoside linkage, but not in all of the internucleoside linkages of the ASO. Therefore, a partially stereodefined ASO can include linkages that are achiral or non- stereodefined in addition to at least one stereodefined linkage. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate 20 __sinternucleoside linkages in a particular stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population. Suchchirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art such as, for example, the 25 methods described in Oka et al., JACS (2003) 125:8307, Wan et al., Nuc. Acid. Res. (2014) 42:13456, and PCT Patent Publication WO 2017 / 015555. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a_ particular stereochemical configuration. 30 C. Antisense Oligonucleotide Conjugates The present disclosure also provides antisense oligonucleotide conjugates (ASO conjugates) comprising one or more ASOs described herein. The term “ASO conjugate,” in the present disclosure, refers to an oligomeric compound comprising an antisense oligonucleotide that is covalently linked to one or more non-nucleotide 19 WO 2025 / 036916 PCT / EP2024 / 072847 moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacology orpharmacokinetic properties of the ASO. For example, the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cellular 5 distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and / or or stability of the ASO. In particular, the conjugate moiety may help target the ASO to a specific region in the central nervous system. In some embodiments of an ASO described herein, the conjugate moiety may be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and / or a lipid (e.g., phospholipid). 10 PCT Patent Publications WO 1993 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties for use with the ASOs of the present disclosure. Certain conjugate groups and conjugate moieties have been described previously, for example, in the following references: thioether moiety, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et al., 15 Bioorg.Med. Chem. Left. (1993) 3:2765-70), phospholipid, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium — 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett. (1995) 36:3651-4; Shea et al., Nucl. Acids Res. (1990) 18:3777-83), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides (1995) 14:969-73), or adamantane acetic acid, a 20 ~=tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids (2015) 4:e220; and Nishina et al., Molecular Therapy (2008) 16:734-40), or a GalNAc moiety (e.g., PCT Patent Publications WO 2014 / 076196, WO 2014 / 207232, and WO 2014 / 179620). In certain embodiments, conjugation of an ASO of the present disclosure to a 25 lipophilic moiety may increase the delivery of the ASO to cells of the central nervous system. The term “lipophilic moiety,” in the present disclosure, broadly refers to any compound or chemical moiety having an affinity for lipids. The lipophilic moiety may generally comprise asaturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may comprise various substituents and / or 30 one or more heteroatoms, such as an oxygen or a nitrogen atom. In certain embodiments, the lipophilic moiety is a(n) aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound. In certain embodiments, the lipophilic moiety is a steroid (e.g., sterol). Steroids include, without limitation, bile acids (e.g., cholic acid, 20 WO 2025 / 036916 PCT / EP2024 / 072847 deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone. Certain lipophilic conjugate groups and conjugate moieties have been described previously, for example, in the following references: cholesterol moiety 5 (Letsinger et al., Proc. Natl Acad. Sci. USA (1989) 86:6553-6), cholic acid moiety (Manoharan et al., Bioorg. Med. Chem. Left. (1994) 4:1053-60), thiocholesterol moiety (Oberhauser et al.,Nuci. Acids Res. (1992) 20:533-8), aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al, EMBO J. (1991) 10:1111-8; Kabanov et al., FEBS Left. (1990) 259:327-30; Svinarchuk et al., 10 Biochimie (1993) 75:49-54), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta (1995) 1264:229-37), or an octadecylamine or hexylamino-5 carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther. (1996) 277:923-37). D. Exemplary Antisense Oligonucleotide Compounds Certain abbreviations are used in the present disclosure to describe the 15 modifications of each of the nucleotides and internucleoside linkages of ASOs described herein that are modified oligonucleotides. Abbreviations are as follows: A is an adenine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; C is a cytosine nucleobase, mC is a 5-methylcytosine nucleobase; e is a 2’-MOE modified sugar (e.g., a modified deoxyribose); d is a 2’-deoxyribose sugar; 0 is a 20 phosphodiesterinternucleoside linkage; and s is a phosphorothioate internucleoside linkage. In certain embodiments, the ASOs of the present disclosure are gapmers. The term “gapmer,” as used in the present disclosure, refers to an oligonucleotide comprising or consisting of an internal region positioned between two external 25 regions, wherein the sugar moieties of the nucleosides comprising the internal region are chemically distinct from the sugar moieties of the nucleosides comprising the external region. The term “gap” refers to the internal region of the oligonucleotide, while the term “wing” refers to the external regions. A gapmer has a 5’-wing, a gap, and a 3’-wing. The three regions form a contiguous sequence. The sugar moieties of 30. ~=each of the wing nucleosides differ from at least some of the sugar moieties of the gap nucleosides. Unless otherwise noted, the nucleosides of the gap region of the ASOs of the present disclosure comprise entirely 2’-deoxyriboxyl nucleosides. In someembodiments, a gapmer may comprise one or more modified internucleoside 21 WO 2025 / 036916 PCT / EP2024 / 072847 linkages and / or modified nucleobases that do not necessarily follow the gapmer pattern of sugar modifications. In some embodiments, the oligonucleotides of the present disclosure are gapmers that comprise MOE, BNA, LNA, or DNA modifications, or any combination 5 thereof. In some embodiments, the gapmers comprise MOE, DNA moieties. In certain embodiments, the internucleoside linkages between the oligonucleosides are phosphodiester or phosphorothioate internucleoside linkages, or a combination thereof. The lengths of the three gapmer regions may be notated using the notation [# 10 of nucleosides in the 5’ wing]-number of nucleosides in the gap]—[number of nucleosides in the 3’ wing]. Thus, a 4-10-4 gapmer comprises 4 linked nucleosides in each wing and 10 linked nucleosides in the gap. In some embodiments, an ASO of the present disclosure is a 3-10-3 LNA gapmer. 3-10-3 LNA gapmersare 16 nucleobases in length, wherein the central gap 15 segment comprises ten 2’-deoxynucleosides and each of the 5 and 3 wing segments comprises three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages. 20 In some embodiments, an ASO of the present disclosure is a 3-11-3 LNA gapmer. 3-11-3 LNA gapmers are 17 nucleobases in length, wherein the central gap segment comprises 11 2’-deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methylcytosines. In some embodiments, all 25 _ internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, an ASO of the present disclosure is a 4-10-4 MOE gapmer. 4-10-4 gapmers are 18 nucleobases in length, wherein the central gap segmentcomprises ten 2’-deoxynucleosides and each of the 5’ and 3’ wing segments comprises four 2’-MOE nucleosides. In some embodiments, all cytosine 30 nucleobases throughout the 4-10-4 MOE gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, an ASO of the present disclosure is a 5-10-5 MOE gapmer. 5-10-5 gapmers are 20 nucleobases in length, wherein the central gap 22 WO 2025 / 036916 PCT / EP2024 / 072847 segment comprises ten 2’-deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate 5 _ internucleoside linkages. In some embodiments, an ASO of the present disclosure is a 5-10-5 MOE gapmer. 5-10-5 gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten2’-deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides. In some embodiments, all 10 _—_‘internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, an ASO of the present disclosure is a 5-10-5 MOE gapmer. 5-10-5 gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides. In some embodiments, all 15 cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosines. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, and 16 and 17, 1 / 7 and 18, 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. 20 In some embodiments, an ASO of the present disclosure is a 5-10-5 MOE gapmer. 5-10-5gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 25 and 5, and 16 and 17, 17 and 18, 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. In a particular embodiment, the present disclosure provides the ASOs listed in the following table and described in more detail below. 30 23 WO 2025 / 036916 PCT / EP2024 / 072847 Table 1. Representative ASOs MOE gapmer and 5- Unmodified ASO Sequence methylcytosine MOE gapmer compound number compound number ATCCCAGGTTTACCCGATTC 00849 (SEQ ID NO: 7) | 00765 (SEQ ID NO: 10) (SEQ ID NO: 4) TCCCAGGTTTACCCGATTCA 00815 (SEQ ID NO: 8) | 00764 (SEQ ID NO: 11) (SEQ ID NO: 5) TATCCCAGGTTTACCCGATT 00816(SEQ ID NO: 9) | 00769 (SEQ ID NO: 12) (SEQ ID NO: 6) E. Representative MOE Gapmer Compounds In some embodiments, an ASO of the present disclosure is a MOE gapmer 5 compound, e.g., a compound described below. Compound KCNT1_ASO_00849 is characterized as a S5MOE-10DNA-5MOE gapmer having a sequence, from 5’ to 3’, of ATCCCAGGTTTACCCGATTC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-5 and 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- 10 deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages, and each cytosine is a 5- methylcytosine. Compound KCNT1_ASO_00849 is characterized by the following chemical 15 notation: Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds Geo Aeo Teo Tes mCe (modified oligonucleotide SEQ ID NO: 7), wherein A is an adenine nucleobase, mC is a5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’- deoxyribose sugar, Oo is a phosphodiester internucleoside linkage, and s is a 20 phosphorothioate internucleoside linkage. Compound KCNT1_ASO_00849 is characterized by the following chemical structure (I): 25 24 WO 2025 / 036916 PCT / EP2024 / 072847 i iJ 2 Bis HB sn oe pt , Jk ™ vs, i oJ Bee votes ll rotec a: A. Les ime 8. \ on wondee 4 ~"" totes i ref . ane g io, on \ : fp a a JS HRs vetce 6 ie Honbxo oan 9 ij i : Saab and Rall sabeo y ne heise Sy 4 o i Compound KCNT1_ASO_00815 is characterized as a SMOE-10DNA-5MOE gapmer having a sequence, from 5’ to 3’, of TCCCAGGTTTACCCGATTCA 5 (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-5 and 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, theother internucleoside linkages are phosphodiester internucleoside linkages, and each cytosine is a 5- 10 methylcytosine. Compound KCNT1_ASO_00815 is characterized by the following chemical notation: Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (modified oligonucleotide SEQ ID NO: 8), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine 15 nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’- 25 WO 2025 / 036916 PCT / EP2024 / 072847 deoxyribose sugar, Oo is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. Compound KCNT1_ASO_00815 is characterized by the following chemical structure (Il): HS—PaU Sy wt —_ Dy 9 on . & i i Yay A, ‘ este xf 4 nocdee ix A a of ov on \ 7 J 9 a He \ i 4G & iJ neice V4 \ 89 Fo e . Ho ento Jina at > fos 4 ot, rr oe 3 . Nhs wmbee oe . fa We Ny eo ps eh © i Henbo ws_tee N i Compound KCNT1_ASO_00816 is characterized as a5MOE-10DNA-5MOE gapmer having a sequence, from 5 to 3, of TATCCCAGGTTTACCCGATT (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-5 and 10 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages, and each cytosine is a 5- methylcytosine. 15 Compound KCNT1_ASO_00816 is characterized by the following chemical notation: Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds 26 WO 2025 / 036916 PCT / EP2024 / 072847 mCds mCeo Geo Aeo Tes Te (modified oligonucleotide SEQ ID NO: 9), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’- deoxyribose sugar, Oo is a phosphodiester internucleoside linkage, and s is a 5 phosphorothioateinternucleoside linkage. Compound KCNT1_ASO_00816 is characterized by the following chemical structure (III): ani) Compound KCNT1_ASO_00765 is characterized as a 5MOE-10DNA-5MOE 10 gapmer having a sequence, from 5’ to 3’, of ATCCCAGGTTTACCCGATTC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-5 and 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside 15 linkages are phosphodiester internucleoside linkages and cytosine with a 2’-MOE modification is a 5-methylcytosine. 27 WO 2025 / 036916 PCT / EP2024 / 072847 Compound KCNT1_ASO_00765 is characterized by the following chemical notation: Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (modified oligonucleotide SEQ ID NO: 10), wherein A is an adenine nucleobase, C is a cytosine nucleobase, mC is a5-methylcytosine 5 nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 0 is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. Compound KCNT1_ASO_00765 is characterized by the following chemical structure (IV): x Q Homeao | A ——, I , C _ i e ; ‘ . / of ; aS hia weutes ‘ ie hont=e % — oe ae) \ d. ; ae \ 6 a) eh NR 1 a re wade % ik rentse _, a cine wie ir eZ neoyse a; 7 i; 10 w* ~" (IV) Compound KCNT1_ASO_00764 is characterized as a SMOE-10DNA-5MOE gapmer having a sequence, from 5’ to 3’, of TCCCAGGTTTACCCGATTCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-5 and 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- 15 deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside 28 WO 2025 / 036916 PCT / EP2024 / 072847 linkages arephosphodiester internucleoside linkages and cytosine with a 2’-MOE modification is a 5-methylcytosine. Compound KCNT1_ASO_00764 is characterized by the following chemical notation: Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds 5 Aeo Teo Teo mCes Ae (modified oligonucleotide SEQ ID NO: 11), wherein A is an adenine nucleobase, C is a cytosine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 0 is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. 10 Compound KCNT1_ASO_00764 is characterized by the following chemical structure (V): pe H8—Pas Sy & i ae ra, wo—teso ‘ ‘“ We ate ha meniee err tS ( Ss é & . “te ca ” ) b ime i)} 7 a fe} on Bi \ ‘ ; ” wots he e &. J q i —t . hoa eo ee HS —tasa ~ Ad a WS ets ‘i Sy d ok ee Sot ee i ie] Bs) hetty ‘ fd ps ey y 4 Cy Compound KCNT1_ASO_00769 is characterized as a SMOE-10DNA-5MOE15 gapmer having a sequence, from 5’ to 3, of TATCCCAGGTTTACCCGATT (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-5 and 29 WO 2025 / 036916 PCT / EP2024 / 072847 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages and cytosine with a 2’-MOE 5 modification is a 5-methylcytosine. Compound KCNT1_ASO_00769 is characterized by the following chemical notation: Tes Aeo Teo mCeo mCes Cds Ads Gds Gds Tds Tds Tds Ads Cds Cds mCeo Geo Aeo Tes Te (modified oligonucleotide SEQ ID NO: 12), wherein A is an adenine nucleobase, C is a cytosine nucleobase, mC is a 5-methylcytosine 10 nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 0 is a phosphodiester internucleoside linkage, ands is a phosphorothioate internucleoside linkage. Compound KCNT1_ASO_00769 is characterized by the following chemical structure (VI): ul Wy ky 5 | o Ney eG iZ ~ yl ns tee i Me renee _ | Pai Hee Nae, I ? N HO-FIUO f % d eal \ o Se & a J Hs vectce Hedl Hota M FI keys \ \ “ 7 Cy wn a {Tm ws i, il wie x Ky , ow) My i on e HSE So MN Rey 4 a | a a ee 8 hentao asleep 15 oo (VI) 30 WO 2025 / 036916 PCT / EP2024 / 072847 Compound KCNT1_Valeriasen is characterized as a 5MOE-10DNA-5MOE gapmer having a sequence, from 5’ to 3, of GITGCCTTTGTAGCTGAGGT (unmodified oligonucleotide SEQ ID NO: 13), wherein each of nucleosides 1-5 and 16-20 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’- 5 deoxynucleosides, the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages, and each cytosine is a 5- methylcytosine. Compound KCNT1_Valeriasen is characterized by thefollowing chemical 10 notation: Ges Teo Teo Geo mCes mCds Tds Tds Tds Gds Tds Ads Gds mCds Tds Geo Aeo Geo Ges Te (modified oligonucleotide SEQ ID NO: 14), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’- deoxyribose sugar, Oo is a phosphodiester internucleoside linkage, and s is a 15 phosphorothioate internucleoside linkage. 31 WO 2025 / 036916 PCT / EP2024 / 072847 Compound KCNT1_Valeriasen is characterized by the following chemical structure (VII): j on wn a a a —_— bo is fy - . Beg & e et ye a . Le | KEP me ‘, #o#mo ~ N Bate S wh 4 é | a i wt 7 i. et rodne 4 hn, i 4 g 1 & L \ molec Ct WS afeee RE MGC aee y oS j é | LO ex ° 2 . a0 \ ot Pv, L el os o oon : “ ou 3 LL, nfo / AE af ea ; a mS? VM) lll. Methods of Making Antisense Oligonucleotides 5 An antisense oligonucleotide of the present disclosure may be synthesized by any method known in the art. For example, an ASO maybe synthesized by in vitro transcription and purification (e.g., using commercially available in vitro RNA synthesis kits), by transcription and purification from cells (e.g., cells comprising an expression cassette / vector encoding the ASO), by use of an automated solid-phase 10 synthesizer, and the like. In solid-phase oligonucleotide synthesis, monomeric nucleoside units are added iteratively to a growing oligonucleotide chain covalently bound to a solid support. In the case of phosphodiester linkages, electrophilic 3’ phosphoramidite monomeric units may be used. However, any suitable electrophilic group can be used to covalently link two nucleosides. 15 The present ASOs may be purified following solid-phase synthesis through any method known in the art. For example, oligonucleotides may be precipitated from solution through treatment of the solution with ethanol and divalent cations. The 32 WO 2025 / 036916 PCT / EP2024 / 072847 present ASOs may also be purified using, e.g., sizingcolumns, reverse-phase chromatography, high-performance liquid chromatography, and polyacrylamide gel electrophoresis. Exemplary methods of synthesizing antisense oligonucleotides using solid- 5 phase supports and purifying said oligonucleotides are described in, for example, Ellington et al., Introduction to the synthesis and purification of oligonucleotides. Curr. Protoc. Nucleic Acid Chem. (2001) Appendix 3C. IV. Compositions of Antisense Oligonucleotides 10 In some embodiments, the present disclosure relates to compositions (e.g., pharmaceutical compositions) comprising an ASO described herein. In some embodiments, the composition is useful for treating a disease or disorder associated with expression or overexpression of KCNT1, e.g., DEE. Compositions of the present disclosure may be formulated based upon the mode of delivery. 15 A pharmaceutical composition described herein may comprise a pharmaceutically acceptable excipient. A pharmaceutically acceptable excipient can be liquidor solid and may be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent 20 may be used, including, for example, water, saline solution, buffering agents, preservatives, and the like. For example, the ASOs of the present disclosure may be administered to a patient as a formulation in phosphate buffered saline (PBS). Example of pharmaceutically acceptable excipients include water, saline, buffer solution, or artificial cerebrospinal fluid. The pharmaceutically acceptable excipient is 25 _ preferably sterile. The ASOs of the present disclosure may be administered as pharmaceutically acceptable salts. A pharmaceutically acceptable salt is a salt of the ASOs of the present disclosure that is physiologically acceptable and retains the desired biological activity of the ASO without having undesired toxicological effects. Asused 30 herein, the term ASO encompasses both the free acid form and salt forms (e.g., sodium salt form) of the oligonucleotides. The ASOs of the present disclosure may be admixed, encapsulated (e.g., ina lipid nanoparticles), conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of nucleic acids. 33 WO 2025 / 036916 PCT / EP2024 / 072847 U.S. Patent Publication Number 2020 / 0385723 provides _ suitable pharmaceutical compositions for use with the ASOs of the present disclosure. V. Methods of Using Antisense Oligonucleotides 5 The ASOs of the present disclosure typically inhibit the activity of transcripts encoded by the KCNT7 gene in a mammalian cell, such as a human cell. In some embodiments, the cell is a neuronal cell. In certain embodiments, the cell is a cell of the central nervous system (CNS), including cells of the motor cortex, frontal cortex, caudate, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus 10 collosum, dorsalcochlear nucleus (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forebrain nuclei. The present disclosure provides methods of down-regulating the abundance 15 or activity of KCNT7 gene transcripts in cells or in tissues comprising contacting the cells or tissues with an effective amount of one or more of the ASOs or compositions of the disclosure. The methods may be carried out in vitro or in vivo. In some embodiments, the ASOs of the present disclosure can be utilized for treatment or prophylaxis. The ASOs of the present disclosure can be used as 20 ~=therapeutics in animals suspected of having a disease or disorder that can be treated by modulating the expression of the KCNT7 gene transcript and / or KCNT1 protein. The animal may also be prone to having the disease or disorder associated with the expression of the KCNT7gene and is not necessarily suspected of having the disease or disorder. The animal is treated by administering a therapeutically or 25 prophylactically effective amount of one or more of the ASO compounds or pharmaceutical compositions of the present disclosure. In some embodiments, the animal is amammal. In some embodiments, the animal is a human. In some embodiments, the ASOs described herein may be used to treat KCNT1-associated diseases, in particular DEE including EIMFS and EOEE. In 30 general, a KCNT1-associated disease results in high seizure burden and experience seizures. In some embodiments, the ASOs of the present disclosure ameliorate the symptoms of a disease or disorder associated with the expression of the KCNT7 gene. Amelioration may refer to a reduction in the severity or the frequency of 34 WO 2025 / 036916 PCT / EP2024 / 072847 occurrence of a symptom, such as severity and frequency of seizures. Amelioration may also refer to a delay in the onset or progression of asymptom such as seizures. A “therapeutically effective amount’ of an ASO as disclosed herein is an amount sufficient to carry out a specifically stated purpose. Such an amount can be 5 determined empirically and in a routine manner, in relation to the stated purpose. Certain factors may influence the dosage and timing required to effectively treat a subject, including, but not limited to, severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and one or more other diseases being present. Moreover, treatment of a subject with a therapeutically 10 effective amount of a pharmaceutical composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the ASOs of the present disclosure may be made using conventional methodologies or on the basis of in vivo testing using appropriate animal models. A therapeutically effective amount may alleviate the symptoms of a disease. 15 Incertain embodiments, the ASOs or pharmaceutical compositions of the present disclosure are prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracranial, and the like). In preferred embodiments, the pharmaceutical composition is _ injected intrathecally or intracranially to the subject. 20 In some embodiments, the ASOs of the present disclosure can be used for research purposes. For example, an ASO may be used to specifically inhibit the synthesis of the KCNT1 protein in cells and experimental animals. ASO-mediated inhibition of KCNT1 synthesis can be used to perform functional analyses of KCNT‘ protein. 25 VI. Kits and Articles of Manufacture The present disclosure also provides kits and articles of manufacture comprising an ASO described herein. Kits or articles of manufacture comprising an ASO of the present disclosure can be used to perform the methods described herein. 30. =A kit or article of manufacturecomprises at least one ASO in one or more containers. In some embodiments, a kit or an article of manufacture described herein may be used for the treatment and / or prevention of a disease associated with the expression of the KCNT7 gene. The kit or article of manufacture may further comprise a container and a label or package insert on or associated with the 35 WO 2025 / 036916 PCT / EP2024 / 072847 container. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic, and may hold a composition which is by itself or combined with another composition effective for treating or preventing the disease and may have a sterile access port. 5 The kit or article of manufacture may further comprise a package insert indicating that the compositions can be used to treat a particular disease. Alternatively, or additionally, the article of manufacture or kit may further comprise a second (or third) containercomprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer’s solution and dextrose 10 — solution. It may further include other materials desirable from a commercial and / or user standpoint, including other buffers, diluents, filters, needles, and syringes. In some embodiments, the kits contain all of the components necessary and / or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of 15 results. One skilled in the art will readily recognize that the disclosed ASO can be readily incorporated into one of the established kit formats which are well known in the art. Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly 20 understood by those of ordinary skill in the art. Exemplary methods and materials are describedbelow, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of neurology, 25 medicine, medicinal and pharmaceutical chemistry, and cell biology described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall 30 ~=—sinclude the singular. Throughout this specification and embodiments, the words “have” and “comprise” or variations such as “has” “having” “comprises” or “comprising” will be understood to imply the inclusion of a stated integer or group of integers but notthe exclusion of any other integer or group of integers. As used herein, the term “approximately” or “about” as applied to one or more values of 36 WO 2025 / 036916 PCT / EP2024 / 072847 interest refers to a value that is similar to a stated reference value. In certain embodiments, the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context. 5 According to the present disclosure, back-references in the dependent claims are meant as short-hand writing for a direct and unambiguous disclosure of each and every combination of claims that is indicated by the back-reference. Further, headers herein are created for ease of organization and are not intended to limit the scope of the claimed invention in any manner. 10 All publications and other references mentioned herein are incorporated by reference in their entirety.Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents form part of the common general knowledge in the art. In order that this invention may be better understood, the following examples 15 are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the invention in any manner. EXAMPLES The materials and methods used in the experiments described in the 20 Examples below are as follows. Construction of ASOs The ASOs were designed to be complementary to the sense strand of the genomic KCNT7 sequence (chromosome: GRCh38:9: 135701585: 135796108:1, SEQ ID NO: 3) as well as the sequence of the mRNA transcribed from the KCNT7 gene 25 (ENST00000371757.7, SEQ ID NO: 2) coding for the protein KCNT1-202 of 1235 amino acids and the sequence of the mRNA transcribed from the KCNT7 gene (ENST00000628528.2, SEQ ID NO: 3) coding for the protein KCNT1-212 of 1211 amino acids.Mice C57BL / 6 Wildtype and Collection of Neurons 30 C57BL / 6 wildtype mice weighed 20-30 g at their arrival and were housed in groups of three maximum per cage at room temperature with food and water available ad / ibitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide to the Care and Use of Experimental Animals. 37 WO 2025 / 036916 PCT / EP2024 / 072847 Primary cortical neurons were collected from embryos removed from pregnant C57BL / 6 wildtype mice at embryonic day 17.5. Cortical tissue of each embryo was dissected on ice-cold Hank’s Balanced Salt Solution. Pooled tissue was minced and digested with papain at 37°C for 12 minutes. Digestion then was halted by the 5 addition of 10% FBS / DMEM. The cells were triturated and resuspended in Neurobasal™ Plus medium supplemented with GlutaMAX™, 2% penicillin / streptomycin, and B-27™ Plus supplement. Cells were seeded at a density of 15000 cells / well onto 384-wellpoly-L-lysine + boric acid coated plates in 40 uL supplemented Neurobasal™ medium. The neurons were then incubated for four 10 days at 37°C ina 5% COz atmosphere. ASO Screenings in Neurons in vitro For single dose screenings, neurons were treated with 300 nM of the test ASO. For multiple dose screenings, neurons were treated with serial dilutions of the ASO starting at 3 uM (% log dilutions, 11 concentrations total). Seven days after 15 treatment with the ASO, the culture medium was replaced with new Neurobasal™ medium. 15 days after the treatment, RNA was extracted from the cells using the TaqMan™ Fast Advanced Cells-to-CT Kit (ThermoFisher). Cells were then washed in PBS and lysed in solution for five minutes at room temperature, with simultaneous DNase treatment. Lysis was terminated by treatment of the mixture with Stop 20 ~=Solution, followed by a two-minute incubation at room temperature. Reverse transcription was conducted immediately after cell lysis using Fast Advanced RTEnzyme Mix (ThermoFisher). The cDNA samples were then used for quantitative real-time PCR measurement using TaqMan™ genotyping assays. Specific probes and primers were used for KCNT7 mRNA quantification (Mm01330661_g1 KCNT1; 25 ThermoFisher). KCNT7 mRNA levels were adjusted to the measured levels of the peptidylprolyl isomerase A housekeeping gene (PPIA) (probe / primer PPIA_Mm02342430_g1; ThermoFisher). KCNT1 RNA expression was normalized to the expression of the PPIA housekeeping gene and KCNT7 RNA expression was calculated using the ACt 30 (AACt) method. In a qPCR reaction, the quantification cycle value (Ct) is defined as the number of cycles required for the fluorescent signal to exceed the background fluorescence. The QuantStudio™ Real-Time PCR software program (Applied Biosystems, Foster City, CA) sets this threshold at ten standard deviations above the mean baseline fluorescence. The comparative Ct method normalized the Ct value of 38 WO 2025 / 036916 PCT / EP2024 / 072847 KCNT7 targetgene to PPIA housekeeping gene before comparisons are made between samples. First, the difference between Ct values (ACt) of the target gene and the housekeeping gene was calculated for each sample, and then the difference in the ACt (AACt) was calculated between two samples (e.g., control and treatment). 5 The fold-change in expression of the two samples was calculated as 2-AACt. The percentage of effect was calculated with this following formula (2’(-AACt)-1)*100 in percent (%). ASO efficacy in iPSC derived neurons WT (Cellular Dynamics; C1012; lot 105286) and P924L (Cellular Dynamics: 10 IPSC-NC; lot 01434.747.NC003) are human GABAergic neurons derived from induced pluripotent stem cells (IPSC; 01434). Immature neurons were seeded at 40000 cells / well in 100 ul of Complete Maintenance Medium composed of iCell Neural Base Medium (Cellular Dynamics; M1010; lot 105297) supplemented with iCell Neural Supplement A1 (Cellular Dynamics; M1032: lot 105480) in 96-well plates 15 coated withpoly-ornithine (Sigma; P4957; lot RNBK2252) at 0.002% and laminin (Sigma; P2020; lot 132987) at 3.3 ug / mL and incubated at 37°C, 5% CQOz. The medium was completely replaced the next day with 100 ul of Complete Maintenance Medium, and 50% of medium was replaced every 2 days for 1 week. Neurons were treated twice at DIV-8, and DIV-15 with the ASO at 0.1 and 1 uM, and 20 50% of medium is replaced 5 days after treatment (DIV-13 and 20). After 2 weeks of treatment, neurons were washed in PBS, and RNA was isolated using the TaqMan Fast Advanced Cells-to-CT Kit (A35378; lots 1115521 and 1115536; ThermoFisher) following the manufacturer protocol. RNA was reverse transcribed immediately using Fast Advanced RT Enzyme Mix (4387410BF2; lot 25 ThermoFisher, lot 1091535). KCNT7 transcripts were then measured by real time quantitative TagqMan™ PCR assays. Total KCNT7 RNA expression was measured by real time quantitative PCR using TaqMan™ PCR assays with the probes Hs01063071_m1_KCNT1 (FAM) (lotP211111-008-H08; ThermoFisher). PP / A RNA was measured using the probes 30 PPIA-Hs99999904 m1 (VIC) (lot P211204-002-H10; ThermoFisher). KCNT1 RNA expression was normalized to the expression of PPIA and KCNT1 RNA expression was calculated using the ACt (AACt) method. In a qPCR reaction, the quantification cycle value (Ct) is defined as the number of cycles 39 WO 2025 / 036916 PCT / EP2024 / 072847 required for the fluorescent signal to exceed the background fluorescence. The QuantStudio™ Real-Time PCR software program, sets this threshold at ten standard deviations above the mean baseline fluorescence. The comparative Ct method normalized the Ct value of KCN'T7 to PPIA before comparisons were made between 5 samples. First, the difference between Ct values (ACt) of the target gene and the housekeeping gene was calculated for each sample, and then the difference in the ACt (AACt) was calculated between two samples (e.g., control and treatment). The fold-change in expression of the two sampleswas calculated as 2-AACt, and expressed as a percentage compared to the vehicle (%). 10 Male Wistar Rats Male Wistar rats weighed 200-225 g at their arrival and were housed in groups of two per cage at room temperature with food and water available ad Iibitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide to the Care and Use of 15 Experimental Animals. ASO Solution Preparation Sterile saline syringes and nuclease free centrifuge tubes were used to prepare dosing solutions. The tubes containing ASO powder were briefly centrifuged before adding saline solution, then re-centrifuged for 10 min to fully dissolve the ASO 20 powder. The solution was vortexed for about 1 min and stored at 4°C until use. Intracerebroventricular (ICV) Injection C57BL / 6 mice received a single unilateral bolus injection of the ASO at a dose of 30 nmol. Mice were anesthetized with 4.5-5% isoflurane and maintained during surgerywith 1.5-2% isoflurane. For pain management, buprenorphine at a dosage of 25 0.04 mg / kg was administered subcutaneously at least 30 minutes before injection. The scalps of the mice were shaved and, following loss of the pedal reflex, mice were placed in a stereotaxic frame (David Kopf Instruments, CA). The scalp was sterilized using three alternating wipes of betadine and 70% ethanol. An incision was made in the scalp and the skull surface exposed and bregma positively identified. A 30 ~— hole was drilled in the skull at 0.5 mm AP, 1.1 mm ML, relative to bregma. The ASO was injected through a canula (31g) connected to a micro-syringe pump controller. The dorsoventral DV coordinate was measured at 1 mm below the skull surface. Once the canula was positioned, the ASO solution was administered in 5 yL of saline vehicle over 30 seconds. The canula was left in place for an additional three 40 WO 2025 / 036916 PCT / EP2024 / 072847 minutes after injection to allow diffusion of the solution in thebrain. After a slow withdrawing of the canula, the scalp was sutured and mice were subcutaneously injected with 1 mL of warm sterile saline solution to aid rehydration and placed in their warm home cage. A control group of mice was similarly dosed with saline 5 vehicle control. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerability was scored one hour following dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation. The ASOs described above were tested in C57BL / 6 mice as described above 10 to assess their tolerability profile. Valeriasen as described above was also tested as a comparator. Intrathecal Injection Male Wistar rats received a single intrathecal (IT) bolus injection of ASO at a dose of 2.5 mg. Rat were anesthetized with 4% isoflurane and maintained during 15 surgery with 2-2.5% isoflurane. For pain management,carprofen at 5 mg / kg and buprenorphine at 0.05 mg / kg were administered subcutaneously at least 20 minutes before injection. Rat were shaved and following loss of the pedal reflex, an incision was made between the 5th and the 6th lumbar vertebra. Muscle around this area was dissected allowing to access of the spinal canal to insert the catheter used for 20 ASO injection. Once the catheter was positioned, ASO solution was administered in 30ul of artificial cerebrospinal fluid (CSF) over ~30 seconds. The catheter was left in place and sealed to avoid diffusion of the CSF fluid. Muscle and skin were sutured, and the rats were subcutaneously injected with 1 mL warm sterile saline to aid rehydration and placed in their warm home cage. A control group of rats were 25 similarly dosed with artificial CSF. Rats were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerability was scored at one, three, and 24 hours post dosing. Animalsdosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation. 30 ASO Acute Tolerability Assessment At one, three, and twenty-four hours post injection, adverse effects were monitored and scored in dosed rats according to the criteria shown in FIG. 3. A normal tolerability score is O and a highly toxic score corresponds to 14. The final tolerability score was calculated based on the sum of all criteria. If for some 41 WO 2025 / 036916 PCT / EP2024 / 072847 oligonucleotides, an intolerable acute toxicity was observed without reaching the first observational time point, then the ASO was scored with an acute toxicity score of 14, and the mice were immediately euthanized. If a score of higher than 6 was measured at the one-hour time point, mice were more closely monitored over the 5 course of the experiment. ASO Long Term Tolerability Assessment Mice were weighed on the injection day and three times per week until completion of theexperiment. Any mice displaying intolerable health or behavioral observations, or weight loss of more than 20% of their initial body weight were 10 immediately euthanized. Tissue Sampling All mice were euthanized by anesthetic overdose. Animals were transcardially perfused in the left ventricle with 0.9% saline. The thoracic aorta between the lungs and the liver was clamped with hemostatic forceps to block blood flow from the heart 15 to the abdomen, but to allow blood to flow to the brain. The right ventricle was opened with scissors. A constant pressure of 100 to 120 mm Hg was maintained on the perfusion solution by connecting the solution bottle to a manometer-controlled air compressor. Perfusion was continued until the skull surface turned pale and perfusion solution exited the right ventricle. Following perfusion, brain tissues 20 = (cortex) were collected. Samples were cut into small pieces, mixed and aliquoted into three equal parts. All samples were frozen with liquid nitrogenand stored at -80°C until use for RNA, protein, and ASO measurements. For some studies, blood and CSF were also collected. mRNA Measurement by qRT-PCR 25 RNA extraction and mRNA quantification by qPCR were performed. From right cortex biopsies, RNA was extracted using RNeasy Mini Kit (Qiagen) with DNase treatment. Total RNA samples were quantified using a Nanodrop™ spectrophotometer and analyzed using TapeStation to determine the quality of the RNA (RIN). In qPCR quantification experiments, the RNA was first reverse 30 transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™). The reaction was performed in a 100 uL final reaction volume, starting from 1000 ng of total RNA (to a final RNA concentration of 10 ng / uL). Quantification of human KCNT7 mRNA and mouse PP / A mRNA were performed with 40 ng of total cDNA using QuantStudio™ 7 Flex (Applied Biosystems™), 42 WO 2025 / 036916 PCT / EP2024 / 072847 TaqMan™ Universal PCR Master Mix (Applied Biosystems™, lot4324020), and TaqMan™ Gene Expression Assays in duplex (Mm01330661_g1 in FAM fluorochrome and Mm02342430_g1 in VIC fluorochrome). qPCR analysis was performed in triplicate using the fast run mode. The Ct values of each qPCR plate 5 were analyzed using Excel software. Technical replicates (n = 3) were combined and averaged to the geometric mean. Relative expression was generated for each ASO group using the mouse control PBS condition. KCNT1 Protein Expression by Mass Spectrometry Analysis Mouse brain tissues were homogenized with Precellys® (2x20s, 5000tr) in 10 lysis buffer (ammonium bicarbonate 50mM, deoxycholate 1%, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg / mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. Brain samples were heated at 95°C for five minutes. Next, trypsin (20 yg) was added into each sample. Tryptic digestion was performed by incubation at room 15 temperature for 30 minutes followed byone minute in an ultrasonic bath (Branson 1200). The reaction was stopped by the addition of 1 uL of TCEP (0.5 M) and 1 uL of 100% formic acid followed by incubation at 95°C for five minutes. The samples were then centrifuged at 30000 g for 15 minutes. Peptide digests were analyzed by a reversed-phase liquid chromatography tandem mass spectrometry (LC-MS / MS) 20 ~=using a Shimadzu LC system (Shimadzu) coupled online to a triple quadrupole mass spectrometer (Shimadzu LCMS-8060) operated in the MRM mode. The specific peptide used to measure KCNT1 protein abundance were LFPSLSITTELTHPSNMR (SEQ ID NO: 15). The specific peptide used to measure GAPDH protein abundance was VGVNGFGR (SEQ ID NO: 16). A single 10 uL injection of each brain sample 25 digest was injected on a Waters™ XBridge Peptide BEH C18 column (300 A; 3.5 yum; 150 mm x 2.1 mm). Peptides were eluted using a linear gradient of acetonitrile (2-40%) in 0.1% formic acid over 30 min. Chromatograms were analyzed using the ShimadzuLabSolutions software. The signal intensity obtained for each peptide was normalized by GAPDH signal obtained in each sample and is expressed in arbitrary 30 ~—_ units (AU). High Performance Liquid Chromatography (HPLC) Fluorescence Samples were analyzed against a set of calibration standards prepared in water. As no matrix effect was noticed, quantification of all samples (plasma, CSF and tissues) were performed using a water set of standards. Frozen tissues were 43 WO 2025 / 036916 PCT / EP2024 / 072847 weighed and grinded into MasterPure™ / proteinase K 97 / 3 (V / V) buffer for 2x30 seconds at 6500 rpm using a Precellys device. Plasma samples (5uL) were diluted into MasterPure™ / proteinase K 97 / 3 (70 uL). Plasma and tissue homogenates were incubated during 30 minutes at 55°C under soft agitation. Then, 10 uL of 3 M KCl 5 solution was added into 50 uL of tissue homogenates or plasma dilution, rapidly vortexed and sonicated for five minutes. The tubes were centrifuged for ten minutes (20000 g) at4°C. CSF samples (10 uL) were diluted into hybridization buffer (Tris HCI 50 mM pH 8.5 / ACN 90 / 10) (45 uL) and proteinase K (1 uL) and were incubated for 15 minutes at 55°C. Prior to analysis, a hybridization step was undertaken with a 10 fluorescently labelled peptide nucleic acid oligomer complementary to the quantified oligonucleotide. For calibration standards and tissue homogenates, 40 uL hybridization buffer was mixed with 10 uL of fluorescent complementary probe and 10 uL of calibration standards, quality control sample and study sample supernatants. For plasma 15 samples, 30 wuL hybridization buffer were mixed with 10 uL of fluorescent complementary probe and 60 uL of quality control sample and study sample supernatants. For CSF analysis, 10 uL of fluorescent complementary probe was directly added into the previous dilution. The mixtures were first incubated for 15 minutes at 95°C and then for 15 minutes at 55°C. Finally, samples were centrifuged 20 ~=for 5 minutes (20000 g)at 4°C. The samples were analyzed under an RP-HPLC system with fluorescence detection. The injected volume was 50 uL except for plasma (90uL). The amount of fluorescence due to hybridized oligonucleotide to fluorescent probe was measured and compared to the calibration curve. The oligonucleotide concentration in the sample was calculated considering the different 25 dilutions used during sample preparation. Example 1: mRNA Reduction in vitro Following a Single Dose of ASO Modified oligonucleotides complementary to the human KCNT7 genomic sequence were designed and tested in vitro in primary cortical neurons for their 30 selective efficacy in reducing KCNT7 mRNA levels. Neurons were treated with 300 nM of each ASO. mRNA levels were quantified using qRT-PCR (TaqMan™) as described above. The modified oligonucleotides tested in this experiment are shown in Table A below. Each modified oligonucleotide listed in Table A is complementary to the 44 WO 2025 / 036916 PCT / EP2024 / 072847 human KCNT7genomic sequence (SEQ ID NO: 3) and is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each of the wing segments comprises five 2’-MOE nucleosides. Cytosines are not 5-methylcytosines into the gap, and the 5 internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages. Table A. 5-10-5 MOE Gapmers reo. Oligonucleotide 2 rrowraso.ooree | sooo [tarcocascrmmccccarr] 6 | S477 10 Example 2: mRNA Reduction in vitro Following Multiple Doses of MOE- modified ASOs Modified oligonucleotides complementary to the human KCNT7 genomic sequence were tested in vitro in primary cortical neurons for their selective efficacy in reducing KCNT7 mRNA levels. Neurons were treated with multiple doses (Cmax = 3 15 uM; % log dilution; 11 concentrations) of the given ASO. This assay provided the invitro cellular potency (plCs0 = -Log(ICso)) and efficacy (Delta Inhib Obs (%)) of the given ASO in neurons. In addition, the Hill coefficient, which is the slope of the line in a Hill plot, was measured in order to observe the shape of the dose response curve for each ASO. 20 Each of the ASOs in Table B is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’- deoxynucleosides and each of the flanking wing segments comprises five 2’-MOE nucleosides. Cytosines are not 5-methylcytosines into the gap, and the internucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are 25 phosphorothioate internucleoside linkages, the other internucleoside linkages are phosphodiester internucleoside linkages. FIG. 1 shows respective curves of inhibition of KCNT7 mRNA expression in function of concentrations of KCNT1_ASO_00764, KCNT1_ASO_00765, and 45 WO 2025 / 036916 PCT / EP2024 / 072847 KCNT1_ASO_00769 to measure ICs0. As multiple doses weretested, potency (plCso = -LoglCso), efficacy (Inhib Obs %) and Hill coefficient in primary neurons were calculated following Screener rules (Genedata software). Table B. mRNA Reduction following multiple doses of MOE-Modified ASOs / GompoundiD [inhib Obs (%)[ __IGaiM) | wHQ) | plCol) | 5 Example 3: mRNA Reduction in vitro in iPSCs Cultured iPSC-derived neurons (WT or P924L mutant cells) were treated in free uptake condition with 100 nM or 1000 nM concentrations of modified ASOs. Neurons were treated twice at DIV-8, and DIV-15 with ASO at 0.1 and 1 uM, and 10 50% of medium was replaced 5 days after treatment (DIV-13 and 20). Modified oligonucleotides KCNT-1_ASO_ 00849 and KCNT1_Valeriasen are a 5-10-5 MOE gapmer with all cytosines residues throughout the gapmer being 5-methylcytosines. Data in Table C are presented as the fold-change compared to the vehicle group (mean of six replicates). Statistical analyses were performed by the 15 Biostatistics Pre-Clinical Department using SAS v9.4.Significance thresholds were set to 5% for main effects. In order to evaluate treatment effect, a one-way anova with group factor was performed on the fold change (FC) of KCNT-1 expression followed by a Dunnett’s test in order to compare treated groups versus vehicle group. The analysis was performed independently for WT and P924L mutated cells 20 ~— data. The data in FIG.2 show that KCNT1_ASO_00849 has comparable potency to Valeriasen. Table C. Mean mRNA Relative Expression in WT and Mutant P924L iPSC-Derived Neurons 25 46 WO 2025 / 036916 PCT / EP2024 / 072847 Example 4: Tolerability and Efficacy of Modified Oligonucleotides Complementary to Human KCNT7 in C57BL / 6 Wildtype Mice 4.1 Tolerability 5 Three-month-old C57BL / 6 wildtype mice received a single bolus ICV injection of a modified oligonucleotide listed in Table D at a low dose of 10 nmol and a high dose of 60 nmol. Each modified oligonucleotide is complementary to the human KCNT1 genomic sequence (SEQ ID NO: 3). The positions in thetable indicate the 5’ nucleoside to which the oligonucleotide is complementary in the KCNT1-212 10 _ transcript sequence (SEQ ID NO: 2). For tolerability studies, the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour post-injection. Adverse effects were monitored and scored in dosed mice according to the criteria shown in FIG.3. Table D. Tolerability at Low and High Doses in C57BL6 / J Mice SEQ ID NO of Position FOB Treatment Unmodified Sequence Unmodified | in SEQ ID (1h) Oligo- NO: 2 nucleotide Dose tested 10 nmol PBS KCNT1_ASO_00815 | TCCCAGGTTTACCCGATTCA 3475 | 0 | KCNT1_ASO_00816| TATCCCAGGTTTACCCGATT | -6~——s|ss3477_—«|s«Oo KCNT1_ASO_00849 | ATCCCAGGTTTACCCGATTC 3476 | 0 | KCNT1_Valeriasen |GTTGCCTTTGTAGCTGAGGT| 13 | 517 | 0 | Dose tested 60 nmol po PBS KCNT1_ASO_00815 | TCCCAGGTTTACCCGATTCA 3475 KCNT1_ASO_00816| TATCCCAGGTTTACCCGATT | -6~——s|ss3477_—«|«oo | KCNT1_ASO_00849 | ATCCCAGGTTTACCCGATTC 3476 KCNT1_Valeriasen|GTTGCCTTTGTAGCTGAGGT| 13 | 517 | 6 | 15 4.2 Efficacy For efficacy studies, most treatment groups consisted of three animals. Mice were sacrificed two weeks after received a single bolus ICV injection of MOE modified oligonucleotides at a dose of 10 nmol or six weeks post-injection of a single 20 _~_—bolus ICV injection of modified oligonucleotides at a dose of 60 nmol. Brain tissue was collected and the level of KCNT7 mRNA was measured as described above. 47 WO 2025 / 036916 PCT / EP2024 / 072847 Results are presented in Table E as percent reduction of the amount of KCNT7 mRNA relative to vehicle control groups. A value of 0% reduction indicates that the compound had no effect. The data in FIG.4 show a better acute tolerability profile together with a 5 comparable efficacy of KCNT1_ASO_815, KCNT1_ASO_849 to KCNT1_Valeriasen in mice after a single ICV administration. Table E. Effects of Modified ASOs in C57BL6 / J Mice at Low and High Doses ge: . % KCNT1 mRNA PBS | KONT1_ASO_00816 | 3477 |-KCNTT_ASO_o0eas [are po PBS 10 4.3 Dose effect Three-month-old C57BL6 / J mice received a single bolus ICV injection of a modified oligonucleotide listed at doses as indicated. C57BL6 / J mice were divided into groups of five. A group of four received PBS as a negative control for each experiment. For tolerability studies, the tolerability score is represented as the FOB 15 score at one-hour post-injection. For efficacy studies, mice were sacrificed three weeks post-injection. Cortical brain tissue was collected and the level of KCNT7 mRNA was measured as described above by qRT-PCR. Results are presented in Table F as percent reduction of the amount of KCNT7 mRNA relative to vehicle (PBS) control groups 20 and normalized to mouse PPIA. A value of 0% reduction indicates that the compound had no effect. The data in FIG. 5 show a comparable dose response of KCNT1_ASO_815 and KCNT1_ASO_849 to KCNT1_Valeriasen in mice after a single ICV administration (multiple dose). 48 WO 2025 / 036916PCT / EP2024 / 072847 Table F. Dose Effect of Modified ASOs in C57BL6 / J Mouse Cortex % mRNA ee a KCNT1_ASO_00815 16 ef 5 | m5 | =< sf of 88 a KCNT1_ASO_00849 | 30 | | 422 peo [2 | rs =< ee KCNT1_Valeriasen x | eo | 4X po PBS 4.4 Dose effect of ASO Concentration in the Cortex In Table G, the amount of KCNT1_ASO_00849 and KCNT1_Valeriasen is 5 quantified per mg of cortex by HPLC fluorescence after a single ICV injection of multiple doses. The data in Table G and in FIG. 6 show that KCNT1_ASO_849 has a better dose exposure relationship in mice cortex when compared to KCNT1_Valeriasen at 5, 15 and 30 nmol doses. 10 Table G. Dose Effect of ASO Concentration in the Cortex of C57BL6 Mice Cortex Compound Name Dose (nmol) Median ASO concentration fmol / mg KCNT1_ASO_00849 ec KCNT1_Valeriasen eo |x 49 WO 2025 / 036916 PCT / EP2024 / 072847 Example 5: Duration of Action on Multiple Doses of Modified Oligonucleotides Three-month old C57BL6 / / mice were divided into groups of five to six mice. Each mousereceived a single unilateral bolus injection of the test oligonucleotide at 5 20, 60 or 80 nmol as shown in Table H below. Two ASOs were tested in this experiment: - KCNT1_ASO_00815: modified ASO sequence: TCCCAGGTTTACCCGATTCA (SEQ ID NO: 8) - KCNT1_ASO_00849: 10 modified ASO sequence: ATCCCAGGTTTACCCGATTC (SEQ ID NO: 7) The animals were sacrificed at different timepoints (2, 6, 12, and 20 weeks) and RNA was extracted from cortex tissue and analyzed by qRT-PCR. A group of four mice received PBS as a negative control for each experiment. Results are presented as percent change of RNA levels relative to the PBS control and 15 normalized to mouse peptidylprolyl isomerase A (PPIA). The data in FIG. 7 show that that both tested ASOs (KCNT1_ASO_00815 and KCNT1_ASO_00849) demonstrated dose-dependent inhibition of KCNT1 mRNA expression in mouse cortex. The data also show that the inhibition was durable, lasting for at least 20 weeks. During the 20-week observation period, the KCNT1 MRNA levelsfor both ASOs at 20 __ both tested doses decreased continuously. Table H. Inhibition of KCNT7 mRNA in Mouse Cortex 4: Cortex reduction (%) e “ KCNT1_ASO_00815 a - ee “ KCNT1_ASO_00849 sf 50 WO 2025 / 036916 PCT / EP2024 / 072847 Example 6: PK / PD in Mice Three-month-old C57BL6 / J mice received a single bolus intracerebroventricular (ICV) injection of a modified oligonucleotide listed at doses 5 described in Tables | and J. C5 / 7BL6 / J mice were divided into groups of five. A group of four mice received PBS as negative control for each experiment. For tolerability studies, the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour post-injection. For efficacy studies, mice were sacrificed three weeks post-injection. Cortical brain tissue was collected 10 and the level of KCNT7 mRNA was measured as described above by qRT-PCR. Results are presented in the tables as percent reduction of the amount of KCNT17 mRNA relative to vehicle (PBS) control groups andnormalized to PPIA. A value of 0% reduction indicates that the compound had no effect. A dose response study was performed in mice to characterize the concentration effect relationship on MRNA 15 expression level in target tissue. The data in FIG. 8 show that KCNT1_Valeriasen and KCNT1_ASO_00849 displayed similar dose-response inhibition of KCNT1 MRNA levels in the cortex. Table |. Inhibition of KCNT1 mRNA Expression by KCNT1_Valeriasen | it ean) SE [oi |i mRNA concentration reduction concentration mRNA concentration — reduction (%) (fmol / mg) (%) (fmol / mg) reduction(%) (fmol / mg) © | | e700 | 7ase | 300 | 146.94 | 79,00 | 172,01 | | | ea00 | az.23 | se.00 | 4.75 | 83.00 | to282 || e300 | 20.44 | 9500 | 82,70 | 7400 | 85.97 | | e400 | a903 | stoo0 | sate | 79.00 | ot.20 | | e700 | sza7_ | sao0 =| —s3.27_—s| 7700 |e Mean} sa.s0 | _45,62_-|__—s6,o0—'|_—sz,98_ | 78.40 | 101,92 20 Table J. Inhibition of KCNT1 mRNA Expression by KCNT1_ ASO_00849 faeeeneaeaes % (fmol / mg) % (fmol / mg) %(fmol / mg) % (fmol / mg) % (fmol / mg) ee ee © mel} 802,86 | 69,00 | 344,57 | | 59,00 | 475,51 _| | 45 | 646,00 | | 39 | 872,27 | |_| 85,00 | 85,41 | 70,00 | 164,66 | 55,00 | 551,36 | 30 | 748,88 | 32 | 862,47 | |__| 81,00 | 124,29 | 70,00 | 208,40 | 44,00 | 600,00 | 45 | 629,26 | 40 | 826.97 | 51 WO 2025 / 036916 PCT / EP2024 / 072847 |_| 75,00 | 97,27 | 75,00 | 243,28 | 66,00 | 310,10 | 37 | 807,09 | 46 | 792,57 | || s4o0| s660 | |__| 66,00 | 371,15 | 47 _| 722,83 | 42 | 28,27 | [Mean| 1,20 | 89,30 | 71,00 | 240,23 | 58,00 | 461,62 | 42,60 | 710,81 | 39,80 | 836,51 | Example 7: Tolerability of Modified Oligonucleotides Complementary to Human KCNT7 in Rats Male Wistar rats, divided into groups of four, received a single bolus IT 5 — injection of a modified oligonucleotide listed in Table K at a dose of 1 or 2.5 mg. Each modified oligonucleotide is complementary to the human KCNT7 genomic nucleic acid sequence (SEQ ID NO: 3). For tolerability studies, the tolerability score is represented as theFunctional Observational Battery (FOB) score. Tne FOB was measured at one-hour post- 10 injection, three hours post-injection, and twenty-four hours post-injection. Table K. Long-Term Tolerability in Rats | Doses | mg |g ere are |i an a [en [ma (mean) | (mean) | (mean) (mean) | (mean) | (mean) |KCNT1_Valeriasen | 1.5{| 0 4.5] Of] 1 NA |KCNT1_ASO 00849] 1.25] 1] 250.75 | [KCNT1_ASO_00815] 24] 16] O82] 86] 2| Animals treated at a dose of 2.5 mg of KCNT1_Valeriasen had to be 15 euthanized at approximatively 5 hours after dosing (premature kill) due to marked and severe clinical signs. Example 8: In vivo brain Magnetic Resonance Imaging study Twenty-four male Wistar rats weighing between 250 and 300 g, divided into 20 ~=three groups of eight animals, were anesthetized under isoflurane and placed on sterile operative field under optimal asepsis conditions to perform intrathecal (IT) injection. Animals received a single administration (80uL) of either artificial cerebrospinal fluid (aCSF),KCNT1_Valeriasen or KCNT1_ASO_ 815 by introducing a catheter at L5-L6 lumbar junction. The general study design was reviewed and 25 approved by the Institut de Recherches SERVIER ethical committee, in general accordance with the animal health and welfare guidelines and standard operating procedures. 52 WO 2025 / 036916 PCT / EP2024 / 072847 Brain MR images were performed using a 11.7-Tesla MR scanner system and 'H-quadrature transmit-receive surface coil for rat head (Bruker). HR anatomical T2- weighted images were obtained using Multi Slices Multi Echoes (MSME) sequence (TE / TR: 5 / 7000 ms; in plane resolution: 160 x 160 um?; slice thickness: 300 um; slice 5 number: n=70; total scan time: 14min). MRI acquisitions were performed for all animals prior treatment then two and four weeks after IT administration. Volumes of the lateral ventricles were assessed by manual delineation by the same experimenter on the brain anatomical images using TT-PMOD (Biomedical image quantification software) asillustrated in FIG. 9. 10 The data in FIG. 10 show that two weeks after administration, animals treated with KCNT1_Valeriasen displayed a significant 41.3% increase of total LV volume when compared to baseline. This abnormal enlargement was not observed anymore four weeks after IT injection, suggesting that the event was transient. No change in LV was observed in the animal groups treated with aCSF or KCNT1_ASO_ 815 two 15 or four weeks after treatment. SEQUENCES The table below provides a list of SEQ ID NOs disclosed herein. | SEQIDNO | CDeescription 6 | Unmodes sequence of ASO _769 and ASO_616 es fos SCS—S pe foes CS 53 WO 2025 / 036916 PCT / EP2024 / 072847 |SEQIDNO | C*iescription Unmodified sequence of ASO_Valeriasen 54 WO 2025 / 036916 PCT / EP2024 / 072847 CLAIMS 1. An antisense oligonucleotide for reducing KCNT1 expression, wherein the antisense oligonucleotide has a nucleobase sequence that comprises at least 12 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs:4-12. 2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide has a nucleobase sequence that comprises at least 15 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 4-12. 3. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 4-12. 4. The antisense oligonucleotide of claim 3, wherein the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 7, 8 and 9. 5. The antisense oligonucleotide of any one of claims 1-4, wherein the antisense oligonucleotide has 18 to 20 linked nucleosides. 6. The antisense oligonucleotide of any one of claims 1-5, wherein at least one internucleoside linkage is a modified internucleoside linkage. 7. The antisense oligonucleotide of claim 6, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage. 8. The antisense oligonucleotide of claim 7, wherein the phosphorothioateinternucleoside linkages are preferably at positions 1-2, 5-16 and 19-20. 9. The antisense oligonucleotide of any one of claims 1-8, wherein at least one nucleoside of the antisense oligonucleotide comprises a modified sugar moiety. 10. The antisense oligonucleotide of claim 9, wherein the modified sugar moiety comprises a 2’-O-methoxyethyl group. 55 WO 2025 / 036916 PCT / EP2024 / 072847 11. An oligonucleotide comprising the following formula: i) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds Geo Aeo Teo Tes mCe (SEQ ID NO: 7): iil) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 8); ili) Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds mCds mCeo Geo Aeo Tes Te (SEQ ID NO: 9); iv) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (SEQ ID NO: 10); v) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 11); vi) Tes Aeo Teo mCeo mCes CdsAds Gds Gds Tds Tds Tds Ads Cds Cds mCeo Geo Aeo Tes Te (SEQ ID NO: 12) wherein A = an adenine C =acytosine mC = a 5-methylcytosine G = a guanine T =a thymine e = a 2’-O-methoxyethylribose d = a 2’-deoxyribose s = a phosphorothioate internucleoside linkage 0 = a phosphodiester internucleoside linkage. 12. An oligonucleotide comprising the structural formula: 56 WO 2025 / 036916 PCT / EP2024 / 072847 | 4 5 Liki BB mn Bee pt _ i ™ : 3 t | & é 7 Bs | i" ns_tao pl Hemtaso if y & on BM, \ es \_. ef \ voles f- i ts - oad 6 We \ 2 i on NRe votes pl sonfec ™ hs ps muvee ot 3 AT » o \ qs ° x oo Se a f HRs vetce 6 ie vontes” pt ky \ @ {J fa) o ij ste C Saab and had negee A noise rm o ad "| o % Se GH a 13. An oligonucleotide comprising the structural formula: 57 WO 2025 / 036916 PCT / EP2024 / 072847 ad ok i re . . Py ne—oee i Sh A a a i Od Hy & & \ i i a ‘yk . Ne 8 N Dey a o I o a J Ny ne_teo E HS Pat ie an ROP mo u. * fn tee a oN 5 eat =, yee! “ \ om a 3B o o i i \ va_tee a \ ronfne “ah nsateo eer \ i? étl & ok we we yr e_hece cen aie KS—Poo9 N Ay on 6 14. An oligonucleotide comprising the structural formula: 58 WO 2025 / 036916 PCT / EP2024 / 072847 Ho ok yy, | NHe & %. Re RS—PRO te Shay ste on ii My ' an i) A ve_dee ri nome ol rr mene ct t 4 , ‘yd o img \ 2 ; —_ oa o {5 he \ a wl vooteo i AL me \ oie i OK . a oe of i a ae a NHe M5 bene ntl HOPS O ts ey o Rity i. s Ll vondeo sf | HE ont =O Hoh F ( _ oH {5 15. A conjugate comprising the antisense oligonucleotide according to any one of claims 1-14 and at least one conjugate moiety covalently attached to said oligonucleotide. 16. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-14 or the conjugate of claim 15 and a pharmaceutically acceptable excipient. 17. A method of reducing KCNT1 expression in a mammalian cell, comprising contacting the cell with the antisense oligonucleotide of any one of claims 1-14, the conjugate of claim 15, or the pharmaceutical composition of claim 16, thereby reducing KCNT1expression in the cell. 59 WO 2025 / 036916 PCT / EP2024 / 072847 18. The method of claim 17, wherein the cell is a cell in the central nervous system, optionally a cell in the human brain. 19. A method for treating developmental and epileptic encephalopathy (DEE) in a subject, optionally a human subject, in need thereof, comprising administering to the subject a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1-14, the conjugate of claim 15, or the pharmaceutical composition of claim 16. 20. The method of 19, wherein the oligonucleotide is injected intrathecally or intracranially to the subject. 21. Use of the antisense oligonucleotide of any one of claims 1-14 or the conjugate of claim 15 for the manufacture of a medicament in treating DEE in a subject in need thereof in the method of any one of claims 17-20. 22. The oligonucleotide of any one of claims 1-14, the conjugate of claim 15, or the pharmaceutical composition of claim 16 for use in treatingDEE in a subject in need thereof in the method of any one of claims 17-20. 23. The method, use, oligonucleotide for use, conjugate for use, or pharmaceutical composition for use of any one of claims 17-22, wherein the DEE is epilepsy of infancy with migrating focal seizures (EIMFS) or early onset epileptic encephalopathy (EOEE). 60 WO 2025 / 036916 PCT / EP2024 / 072847 j 20>. # . t s 0 . KCNT1_ASO_00764 a F ‘ 5 20 ye ¥ ‘ x | ‘ S 60- i * ey ~ “100 : Log Concentration [Mj] | 20 0 KCNT1_ASO_00765 ft 5 20 _— 2. “i ~ rf NP ac 60~ NS 2 Ag “BO ~N 3 OF oa . 400 eS a ak A a i i a a Log Concentration [M] FIG. 1 1 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 KCNT1_ASO_00769 _ ee = -20 ae co 2 a 2 40 ti . a. TN 5 . Rd a 1 E 80 NC se 100 Log Concentration [M] | FIG. 1 (cont’d) 2 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 WT cells 5 1.5 Oo wo 2 a. * ae » 1.04-~ sossssssessasessenesausssseeesnssnseenesnnsseseessnsaseenesuussssenessussengessnsnseseesaussesenesnasseseneganaanesenesnasee rd “Gol e a) m 0.5 . — ° I = | i =bd | ] | 0.0 ' oa “ = .S oa & Ps se & ee s RSs we yw oe 0’ ae? rs < a e & Ras P924L mutant cells s 15 v7) oO g e. . i o 1.0+-- sausasssseessssaeesssuaussssseeesssseessuaasssoseeesseneeesssnassssseeesssaseesusuaasssseeesesaneeessnaasssseeesessneeesssaassses 2 . & . Ss Z 0.5 : “ = . ha = Ss) x = 0.0 RS RS RS RS & © we © SF ‘ & s&s Rt 2 & e s s ané es & A e & Ras FIG. 2 3 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 Criteria Scare 0 Score 1 Score 2 L seceectenn . Weak postural 1 Strong postural Postu No postural abnormalities abnormalities: slightly abnormalities: osture P arched back, slightly hunched back, wobbly gait. |wobbly or tiptoe gait. A arance The mouse was bright, alert | Prostration, Low posture, Paralysis / motionless ppe and responsive straub tail ¥ Behavior: a No stereotypies and hyper- Detectable stereotypies Marked hyperactivity Stereotypies / hyperactivities activity and stereotypies - Responds normally to . - Does not respond Motor coordination (Movement stimulation Slightly reducedresponse to stimulation timulati oN t to stimulation - 4 ity t after stimulation} ormal movemen - Hypomobility ncapacity to behaviour move Strength / Motor coordination Gripping the grid Lack of grip Breathing Normal Breathing Accelerated / difficultles Labored breathing breathing tremor / convulsion continuous seizures FIG. 3 4 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 ICV Bolus FOB 10nmol (1h pi.) KCNT1 mRNA 2 weeks pi. s 15 6 om a 3 << a os Sa 1.0 433 O° a9 2 o 8 om = rn 0.0 0 & vo) ) & oO) ‘y ° Q A NV p e g s Ss Si a & & Cae RS e e y > as é a / ANZ < & & om GC e s € + ICV Bolus FOB 6Onmol = (1h pi.) KCNT1 mRNA 6 weeks pi. s 1.5 10 mn iva s EG g 28 So ee g 1.0 8 6 22 a8 ze 3 2 oa c#% Ss 4 Wo SZ 05 as 2x 608 om oO 3 ray 0.0 - 0 & & © 2 o ° a N Se ‘ g & & Ra oP’ Cae Ro a ba N7 nN? ah / a S ot & € es + FIG. 4 S / 11 WO 2025 / 036916 PCT / EP2024 / 072847 3 1s KCNT1_ASO_0815 ¢ ° EB 410 os Sea a 2 0.5 ~~ ee Sn ae i 0.0 es | | | & % Re) AS) & RY ASO dose injected (nmol) a 15 2 KCNT1_ASO_0849 a ° = 2 40 & % RK& & RS ASO dose injected (nmol) g 1 KCNT1_Valeriase E ° = B 419 Yes . there is nothing O-0 OY pcartratrareraanai a. Parasia & © x AS) ASO dose injected (nmol) FIG. 5 6 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 1000 - 800 2 a ee 600 + KCNT1_ASO_00849 eo KCNT1_Valeriasen o£ 400 fo} 2 200 160 0 FIG. 6 7 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 x 2 o. 100 oo £'O ° ee so «8 Q> =2 6 -® KCNT1_ASO_00815 20nmol £0 -& KCNT1_ASO_00815 60nmol Z 2 40 ~@- KCNT1_ASO_00849 20nSOl KCNT_801 e aa -< 20 roe x<- 600 or 0 2 4 6 8 10 12 12 14 16 18 20 Weeks FIG. 7 8 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 OO __KCNT1_Valeriasen ASO 0849. °° ©»©3”——— 100 UU 100 ¥ => ty e— he # e # a ~ a~ e , = 75 of Ae g (75 3 3g (75 e @ e J > As > . > $, 2 ' 2 ' 2 e <¢{ '\ ve f \ < O z 50 Na z 50 \ Zz 50 % EE \ E hal KCNT1_Valeriasen 6 ball ' XQ1 z 45 ® ® K “z 25 '. « 25 re) |conc. (fmol / mg) ASO cortex conc. (fmol / mg) ASO cortex conc. (fmol / mg) FIG. 8 9 / 11 WO 2025 / 036916 PCT / EP2024 / 072847 eo a co ot oo —. =. go . -< . — >. y 4 , os 2e = Be Be. ge... ye Soe HU — ai OS eel Oe: : Oe) Oe Oe Cee, — ae ererstst—C . i eo 2. ce -, 2... = ey | : ac a a. ee a. ore gee, WO 2025 / 036916 PCT / EP2024 / 072847 0.015 4 Baseline =a] +2wks post-IT _ maze +4wks post-lT ae] £ 2 © 0.010 +41.3% £ eee = 9 (p<0,0001) 7 ° . rs] * on © 0.005 aCSF KCNT1 Valeriasen KCNT1_ ASO-815 FIG. 10 11 / 11 INTERNATIONAL SEARCH REPORT ; International application No PCT / EP2024 / 072847 A. CLASSIFICATION OF SUBJECT MATTER INV. C12N15 / 113 A61K31 / 712 A61K31 / 7125 A61P25 / 08 ADD. According to International Patent Classification (IPC) or to both national classification and IPC B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) C12N A61K A61P Documentation searched other than minimum documentation to the extent that such documents are included in thefields searched Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) EPO-Internal, BIOSIS, Sequence Search, EMBASE, WPI Data C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* | Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. Xx US 2022 / 177893 Al (BUI HUYNH-HOA [US] ET 1-10, AL) 9 June 2022 (2022-06-09) 15-23 Y tables 1-4, 41 11-14 sequences 57, 135, 213, 291 paragraph

[0294] paragraph

[0237] - paragraph

[0253] paragraph

[0273] - paragraph

[0286] paragraph

[0002] paragraph

[0161] - paragraph

[0168] Y WO 2022 / 165122 Al (IONIS PHARMACEUTICALS 11-14 INC [US]) 4 August 2022 (2022-08-04) table 68 page 175, lines 1-6 [| Further documents are listed in the continuation of Box C. See patent family annex. * Special categories of cited documents : . . . .: on "T" later document published after the international filing date or priority wan a a . ate and not in conflictwith the application but cited to understand A" document defining the general state of the art which is not considered ei : : ‘ to be of particular relevance the principle or theory underlying the invention "E" earlier application or patent but published on or after the international "X" document of particular relevance:; the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive ‘ document wn may throw doubts on priority claim(s) or which is step when the document is taken alone cited to establish the publication date of another citation or other "Y" document of : . : : : : hea particular relevance;; the claimed invention cannot be special reason (as specified) considered to involve an inventive step when the document is "O" document referring to an oral disclosure, use, exhibition or other combined with one or more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior tothe international filing date but later than the priority date claimed "&" document member of the same patent family Date of the actual completion of the international search Date of mailing of the international search report 12 November 2024 22 / 11 / 2024 Name and mailing address of the ISA / Authorized officer European Patent Office, P.B. 5818 Patentlaan 2 NL - 2280 HV Rijswijk Tel. (+31-70) 340-2040, 1 Fax: (+31-70) 340-3016 Solyga-Zurek, A Form PCT / ISA / 210 (second sheet) (April 2005) International application No. INTERNATIONAL SEARCH REPORT PCT / EP2024 / 072847 Box No. | Nucleotide and / or amino acid sequence(s) (Continuation of item 1.c of the first sheet) 1. With regard to any nucleotide and / or amino acid sequence disclosed in the international application, the international search was carried out on the basis of a sequence listing: a. forming part of the international application as filed. b. [| furnished subsequent to the international filing date for the purposes of internationalsearch (Rule 13¢er1{a)). [| accompanied by a statement to the effect that the sequence listing does not go beyond the disclosure in the international application as filed. 2. [ ] With regard to any nucleotide and / or amino acid sequence disclosed in the international application, this report has been established to the extent that a meaningful search could be carried out without a WIPO Standard ST.26 compliant sequence listing. 3. Additional comments: Form PCT / ISA / 210 (continuation of first sheet (1}) (July 2022) INTERNATIONAL SEARCH REPORT ; __ International application No Information on patent family members cited in search report date member(s date US 2022177893 Al 09-06-2022 AU 2020241693 Al 02-09-2021 BR 112021015494 A2 05-10-2021 CA 3133247 Al 24-09-2020 CL 2021002398 Al 03-06-2022 CN 113661241 A 16-11-2021 CN 117106778 A 24-11-2023 co 2021013371 A2 20-10-2021 CR 20210519 A 24-11-2021 EP 3938514 Al 19-01-2022 IL 285546 A 30-09-2021 JP 7564817 B2 09-10-2024 JP 2022526267 A24-05-2022 KR 20210141983 A 23-11-2021 PE 20220168 Al 28-01-2022 SG 11202108625W A 29-09-2021 TW 202102675 A 16-01-2021 US 2022177893 Al 09-06-2022 wo 2020190740 Al 24-09-2020 WO 2022165122 Al 04-08-2022 AU 2022213384 Al 20-07-2023 CA 3210076 Al 04-08-2022 CN 116940683 A 24-10-2023 EP 4284504 Al 06-12-2023 IL 304218 A 01-09-2023 JP 2024505226 A 05-02-2024 KR 20230137958 A 05-10-2023 TW 202241462 A 01-11-2022 wo 2022165122 Al 04-08-2022 Form PCT / ISA / 210 (patent family annex) (April 2005) (19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480065822.X (22) Application Date 2024.08.14 (30) Priority data 23306381.7 2023.08.16 EP (85) PCT international application entered the national phase date 2026.04.14 (86) PCT international application application data PCT / EP2024 / 072847 2024.08.14 (87) PCT international application publication data WO2025 / 036916 EN 2025.02.20 (71) Applicant Servier Pharmaceuticals, France Address France (72) Inventors H. Tran, G. Dasdores, B. Chanrion (74) Patent Agency Beijing Zhongzi Law Firm 11247 Patent Attorneys Zhang Li, Huang Gesheng (51) Int.Cl. C12N 15 / 113 (2006.01) A61K 31 / 712 (2006.01) A61K 31 / 7125(2006.01) A61P 25 / 08(2006.01) (54) Invention Title: Oligonucleotides for Regulating KCNT1 Expression (57) Abstract: This disclosure provides an anti-KCNT1 oligonucleotide for regulating the expression of a potassium-sodium activated channel T subfamily member 1 (KCNT1) encoded by the KCNT1 gene.Antisense oligonucleotides, and their use in the treatment of developmental epileptic encephalopathy (DEE). Claims 5 pages, Description 36 pages, Sequence Listing (electronic publication), Drawings 9 pages. CN 122029279 A 2026.05.12 CN 1 22 02 92 79 A 1. An antisense oligonucleotide for reducing KCNT1 expression, wherein the antisense oligonucleotide has a nucleobase sequence comprising at least 12 consecutive nucleobases from any one of SEQ ID NOs: 4-12. 2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide has a nucleobase sequence comprising at least 15 consecutive nucleobases from any one of SEQ ID NOs: 4-12. 3. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide has a nucleobase sequence from any one of SEQ ID NOs: 4-12. 4. The antisense oligonucleotide of claim 3, wherein the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 7, 8, and 9. 5. The antisense oligonucleotide of any one of claims 1-4, wherein the antisense oligonucleotide has 18 to 20 linked nucleosides. 6. The antisense oligonucleotide of any one of claims 1-5, wherein at least one inter-nucleoside link is a modified inter-nucleoside link. 7. The antisense oligonucleotide of claim 6, wherein the modified inter-nucleoside link is a phosphate thioester inter-nucleoside link. 8. The antisense oligonucleotide of claim 7, wherein the phosphate thioester inter-nucleoside link is preferably located at positions 1-2, 5-16, and 19-20. 9. The antisense oligonucleotide of any one of claims 1-8, wherein at least one nucleoside of the antisense oligonucleotide comprises a modified sugar moiety. 10. The antisense oligonucleotide of claim 9, wherein the modified sugar moiety comprises a 2'-O-methoxyethyl group. 11. An oligonucleotide comprising the following structures: i) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds Geo Aeo Teo Tes mCe (SEQ ID NO: 7); ii) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 8); iii) Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCdsmCds mCeo Geo Aeo Tes Te (SEQ ID NO: 9); iv) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (SEQ ID NO: 10); v) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 11); vi) Tes Aeo Teo mCeo mCes Cds Ads Gds Gds Tds Tds Tds Ads Cds Cds mCeo Geo Aeo Tes Te (SEQ ID NO: 12) Where: A = adenine C = cytosine mC = 5-methylcytosine G = guanine T = 12. An oligonucleotide comprising the structural formula: . 13. An oligonucleotide comprising the structural formula: . ... 17. A method for reducing KCNT1 expression in mammalian cells, comprising contacting the cells with an antisense oligonucleotide according to any one of claims 1-14, a conjugate according to claim 15, or a pharmaceutical composition according to claim 16, thereby reducing KCNT1 expression in the cells. 18. The method of claim 17, wherein the cells are cells of the central nervous system, optionally cells of the human brain. 19. A method for treating developmental epileptic encephalopathy (DEE) in a subject of need (optionally, a human subject), the method comprising administering to the subject a therapeutically effective amount of an antisense oligonucleotide according to any one of claims 1-14.20. The method of claim 19, wherein the oligonucleotide is administered intrathecally or intracranially to the subject. 21. Use of the antisense oligonucleotide of any one of claims 1-14 or the conjugate of claim 15 for the preparation of a medicament for treating DEE in a subject requiring such treatment in the method of any one of claims 17-20. Claims 4 / 5 pages 5 CN 122029279 A 22. The oligonucleotide of any one of claims 1-14, the conjugate of claim 15, or the medicament of claim 16 for treating DEE in a subject requiring such treatment in the method of any one of claims 17-20. 23. The method, use, oligonucleotide for use, conjugate for use, or medicament for use of any one of claims 17-22, wherein the DEE is infantile epilepsy with migratory focal seizures (EIMFS) or early-onset epileptic encephalopathy (EOEE). Claims 5 / 5 Page 6 CN 122029279 A Oligonucleotides for Regulating KCNT1 Expression Background Technology

[0001] The KCNT1 gene encodes an intracellular sodium-activated potassium channel (KN-activated channel T subfamily member 1 - UNIPROT ID Q5JUK3-3) that is expressed in the central nervous system. KCNT1, also known as Slack, is a member of the Slo-type potassium channel gene family and can be co-assembled with other Slo channel subunits. These channels can mediate a sodium-sensitive potassium current that is triggered by the influx of sodium channel ions through sodium channels or neurotransmitter receptors. Delayed outward currents can be involved in regulating neuronal excitability.

[0002] Pathogenic variations in the KCNT1 gene, which encodes KN-activated channel T subfamily member 1, are associated with a range of epilepsy and neurodevelopmental disorders (Barcia et al., Neurol Genet. (2019) 5(6):e363). These cause developmental epileptic encephalopathy (DEEs), including infantile epilepsy with migratory focal seizures (EIMFS) and early-onset epileptic encephalopathy (EOEE). DEEs associated with pathogenic variants of KCNT1 are characterized by normal prenatal development and birth. EIMFS is the most common and severe DEE phenotype, usually presenting in early infancy and characterized by an extremely high seizure burden. Similar to EIMFS, patients with EOEE usually present with symptoms before one year of age and have a high seizure burden, with seizures occurring almost daily; these patients also have severe developmental delays and early death (Bonardi et al., Brain (2021) 144(12):3635-3650).A recent literature review reported 189 individuals affected by KCNT1-related DEEs (Bonardi, ibid.), but the actual number of patients may be higher, with the KCNT1 Foundation reporting 3,000 cases worldwide. This incidence rate classifies DEE as an ultra-rare disease.

[0003] Typically, the progression of DEE disease is divided into three phases: the sporadic seizure phase, the storm phase, and the chronic phase. During the storm phase, patients may experience hundreds of seizures per day, usually occurring between three and six months after birth. This phase is characterized by frequent and / or prolonged seizures or status epilepticus, leading to severe developmental delays and an increased risk of death. The chronic phase usually occurs around 1–2 years of age, with fewer seizures in patients. However, higher clinical heterogeneity has been observed, with some patients entering the storm phase without the sporadic seizure phase, and the time course of different phases can vary considerably among affected children (Kuchenbuch et al., Brain (2019) 142(10):2996–3008). Death can occur at any stage of the disease process. Death can have various causes, including heart failure and other comorbidities, but unexpected sudden epileptic death has been reported as the most prominent cause of death in EIMFS.

[0004] Seizures are primarily focal motor seizures with varying degrees of secondary generalization, including tonic, clonic, tonic-clonic, myoclonic, and epileptic spasms. In the chronic phase, seizures are primarily tonic, with manifestations of autonomic dysfunction. For example, perioral cyanosis and apnea are common. The characteristic EEG finding is focal episodic discharges that can migrate across adjacent cortical areas and can occur independently at multiple sites. Other neurological features in these patients include hypotonia, microcephaly, and severe developmental disorders. Delayed myelination, reduced hippocampal volume, and cerebellar atrophy have been observed to varying degrees on brain magnetic resonance imaging (MRI).

[0005] Various interventions have been attempted to control seizures, including benzodiazepines, vigabatrin, stiripentol, phenobarbital, topiramate, quinidine, and the ketogenic diet. However, their lack of efficacy has been widely reported (Landmark et al., Epilepsia (2021) 62(4): 857-873). Seizures can rapidly develop resistance to the drugs. Quinidine is an antiarrhythmic drug that has been explored...As an antiepileptic treatment for DEE, it has worsened the disease or even caused serious side effects in some patients (e.g., QT interval prolongation, see page 1 / 36 of the specification, CN 122029279 A, ​​Liu et al., Neurol Sci. (2023) 44(4):1201-1206). Valeriasen, an antisense oligonucleotide designed to degrade KCNT1 mRNA, has been administered to two children who are carriers of the KCNT1 mutation, resulting in a reduction in the number of seizures. However, treatment had to be suspended due to serious adverse events, including hydrocephalus.

[0006] DEE associated with pathogenic variants of KCNT1 is a devastating neurodevelopmental disorder in children with prognoses ranging from severe encephalopathy to early death. This bleak prognosis and lack of effective treatments highlight the urgent medical need for treatment of this disease.

[0007] Summary of the Invention

[0008] This disclosure provides antisense oligonucleotides (ASOs) that reduce the abundance or activity of RNA transcribed from the KCNT1 gene. By reducing the level of KCNT1 RNA, the compounds of this disclosure reduce the abundance of KCNT1 protein in cells, thereby reducing the activity of the channel and the hyperexcitability associated with the mutated channel. The compounds can alleviate symptoms and / or delay disease progression.

[0009] In some aspects, this disclosure provides an antisense oligonucleotide that reduces KCNT1 expression, wherein the antisense oligonucleotide has a nucleobase sequence comprising at least 12 consecutive nucleobases of any of the nucleobase sequences in SEQ ID NOs: 4-12.

[0010] In some specific embodiments, the antisense oligonucleotide described herein has a nucleobase sequence comprising at least 15 consecutive nucleobases of any of the nucleobase sequences in SEQ ID NOs: 4-12.

[0011] In some embodiments, the nucleobase sequence of the antisense oligonucleotide may be selected from SEQ ID NOs: 4-12. In a further embodiment, the antisense oligonucleotide has a nucleobase sequence of any of SEQ ID NOs: 7, 8, and 9.

[0012] In some embodiments, the antisense oligonucleotide described herein has 18 to 20 linked nucleosides.

[0013] In some embodiments, the oligonucleotide described herein may contain modified inter-nucleoside links, for example, phosphodiester inter-nucleoside links. In some embodiments, the oligonucleotide described herein may contain one or more phosphodiester inter-nucleoside links and / or one or more phosphate thioester inter-nucleoside links. In some embodiments, the oligonucleotide may contain at least 1, 2, 3, 4, 5, or 6 phosphodiester inter-nucleoside links. In some embodiments, the oligonucleotide contains at least1, 2, 3, 4, 5 or more or all of the nucleoside linkages are phosphate thioside linkages.

[0014] In some embodiments, the phosphate thioside linkages are located at one or more, or all of the positions 1-2 (i.e., between nucleosides 1 and 2), 5-16 (i.e., between adjacent nucleosides from nucleoside 5 to nucleoside 16; i.e., between nucleosides 5 and 6, between nucleosides 6 and 7, between nucleosides 7 and 8, between nucleosides 8 and 9, between nucleosides 9 and 10, between nucleosides 10 and 11, between nucleosides 11 and 12, between nucleosides 12 and 13, between nucleosides 13 and 14, between nucleosides 14 and 15, and between nucleosides 15 and 16) and 19-20 (i.e., between nucleosides 19 and 20).

[0015] In some embodiments, the antisense oligonucleotides described herein have at least one nucleoside comprising a modified sugar moiety (e.g., a modified ribose or a modified deoxyribose moiety). In a further embodiment, the modified sugar moiety comprises a 2'-O-methoxyethyl group (e.g., 2'-O-methoxyethyl ribose).

[0016] In some embodiments, the oligonucleotides described herein comprise the following formulas: i) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds Geo Aeo Teo Tes mCe (SEQ ID NO: 7); ii) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 8); iii) Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds mCds (SEQ ID NO: 9); iv) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (SEQ ID NO:10); v) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo Teo Teo mCes Ae (SEQ ID NO: 11); vi) Tes Aeo Teo mCeo mCes CdsAds Gds Gds Tds Tds Tds Ads Cds Cds mCeo Geo Aeo Tes Te (SEQ ID NO:12), wherein: A=adenine C=cytosine mC=5-methylcytosine G=guanine T=thymine e=2'-O-methoxyethyl ribose modified sugar d=2'-deoxyribose s=thiophosphate nucleoside link o=phosphodiester nucleoside link.

[0017] In some embodiments, this disclosure provides oligonucleotides comprising the following structural formula: Specification 3 / 36 page 9 CN 122029279 A.

[0018] In some embodiments, this disclosure provides oligonucleotides comprising the following structural formula: Specification 4 / 36 page 10 CN 122029279 A.

[0019] In some embodiments, this disclosure provides an oligonucleotide comprising the following structural formula: [Specification 5 / 36, page 11, CN 122029279 A].

[0020] This disclosure also provides an oligonucleotide conjugate comprising the antisense oligonucleotide described herein, wherein at least one conjugate portion is covalently linked to the oligonucleotide.

[0021] In some aspects, this disclosure provides a pharmaceutical composition comprising the oligonucleotide or conjugate described herein and a pharmaceutically acceptable excipient.

[0022] A method for reducing KCNT1 expression in mammalian cells is also provided, comprising contacting cells with the antisense oligonucleotide, conjugate, or pharmaceutical composition described herein to reduce KCNT1 expression in the cells. In some embodiments, the cells are central nervous system cells, such as cells in the human brain.

[0023] In some embodiments, this disclosure provides a method for treating DEE in a subject in need, comprising administering to the subject a therapeutically effective amount of the antisense oligonucleotide, conjugate, or pharmaceutical composition described herein. The oligonucleotide, conjugate, or pharmaceutical composition may be injected into the subject, for example, intrathecally or intracranially.

[0024] It should be understood that any antisense oligonucleotide, conjugate, or pharmaceutical composition described herein can be used in any of the methods described herein for the manufacture of a medicament for treating DEE in (human) subjects in need. In some embodiments, the oligonucleotide, conjugate, or pharmaceutical composition described herein can be used for the treatment of any DEE (e.g., EIMFS or EOEE) in (human) subjects in need.

[0025] Other features, objects, and advantages of the invention will become apparent in the following detailed description. However, it should be understood that while this detailed description provides embodiments and aspects of the invention, it is given by way of example only, and the specification 6 / 36 pages 12 CN 122029279 AThis is not limiting. Various variations and modifications within the scope of this invention will become apparent to those skilled in the art from the detailed description.

[0026] Brief Description of the Drawings

[0027] The graph in Figure 1 shows the dose-dependent percentage reduction in human KCNT1 RNA after treatment with the KCNT1 ASO shown.

[0028] The bar graph in Figure 2 compares the reduction in mRNA by KCNT1_ASO_00849 and KCNT1_Valeriasen in wild-type (WT) and P924L mutant induced pluripotent stem cell (iPS) derived neurons.

[0029] The table in Figure 3 shows the tolerability scoring system used in the in vivo experiments described herein for mice and rats.

[0030] The bar graph in Figure 4 shows the efficacy and tolerability of ASO tested in mice. The left Y-axis and solid bars represent the expression level of KCNT1 mRNA in mouse neurons in vivo two or six weeks after treatment with ASO, relative to PBS-treated samples. The right Y-axis and black circles represent the absolute scores of the Functional Observational Battery (FOB) observed in mice one hour after ASO treatment.

[0031] The bar chart in Figure 5 shows the efficacy of KCNT1_ASO_0815, KCNT1_ASO_0849, and KCNT1_Valeriasen at doses of 1, 5, 10, 30, and 100 nmol. The left Y-axis and solid bars represent the expression levels of KCNT1 mRNA in mouse neurons in vivo four weeks after ASO treatment, relative to PBS-treated samples.

[0032] The dot plot in Figure 6 shows the concentrations of KCNT1_ASO_00849 and KCNT1_Valeriasen quantified by HPLC fluorescence in cortical tissue homogenates four weeks after a single injection of 5, 15, 30, 60, or 100 nmol ASO.

[0033] The dot plot comparison in Figure 7 shows the inhibitory effects of KCNT1_ASO_00815 and KCNT1_ASO_00849 on KCNT1 mRNA expression in the cortex at doses of 20 or 60 nmol, quantified by qRT-PCR.

[0034] The dose-response curve in Figure 8 compares KCNT1_Valeriasen and KCNT1_ASO_00849 based on the dose-response relationship at the target tissue mRNA expression level.

[0035] Figure 9 shows a series of rat brain MRI anatomical images used to quantify the volume of the lateral ventricle (LV). The volume of the LV was assessed by manually delineating the boundaries on the MRI images. The proboscis and caudal margins of the corpus callosum were used as anatomical landmarks to define the lateral ventricle.Segmentation. Of the 70 slices covering the brain, approximately 35 to 40 slices were segmented to estimate the LV volume, the total LV volume being the sum of all these values. The upper plot corresponds to a T2-weighted brain image; the lower plot corresponds to manually delineated target regions, with LVs highlighted.

[0036] The bar chart in Figure 10 shows the total volume of the lateral ventricle (LV) after administration of aCSF, KCNT1_Valeriasen, or KCNT1_ASO_815. The left Y-axis represents the total LV volume acquired by brain MRI at baseline, two weeks, or four weeks after treatment.

[0037] Detailed Description of the Invention

[0038] This disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting the transcription of the KCNT1 gene can effectively reduce the abundance of the target KCNT1 transcript and / or reduce the translation of the KCNT1 polypeptide from the transcript. The ASOs of this disclosure contain a sequence complementary to the KCNT1 transcript, which binds to a specific nucleotide sequence within the transcript.

[0039] By reducing the level of intracellular KCNT1 target transcripts, ASO mediates the reduction of intracellular KCNT1 protein expression, thereby alleviating the severity or progression of epilepsy and neurodevelopmental disorders. The ASO of this disclosure is expected to be particularly useful in the treatment of DEE. The ASO of this disclosure has the significant advantage of targeting KCNT1 expression at the KCNT1 transcript level, and thus is able to reduce KCNT1 protein expression.

[0040] I. KCNT1 gene and KCNT1 protein

[0041] The ASO of this disclosure binds to the transcript of the KCNT1 gene, which encodes the KCNT1 protein. The KCNT1 transcript named KCNT1-202 has the sequence shown in SEQ ID NO: 1 (GENBANK accession number: NM_020822.3, specification page 7 / 36, CN 122029279 A ENST00000371757.7) and encodes a protein of 1235 amino acids, UNIPROT ID Q5JUK3-3. The transcript named KCNT1-212 (ENST00000628528.2, SEQ ID NO: 2) encodes a protein of 1211 amino acids, UNIPROT ID Q5JUK3-4. Both transcripts are mRNA derived from the human KCNT1 gene (ENSG00000107147, SEQ ID NO: 3). In some embodiments, the ASO described herein targets transcripts of the mammalian KCNT1 gene (e.g., the rodent or human KCNT1 gene).

[0042] In some embodiments, the ASO of this disclosure binds to the KCNT1 gene sequence or its transcript. In some embodimentsIn this scheme, the ASO of this disclosure binds to the KCNT1 transcript encoding the KCNT1 protein (e.g., the KCNT1 protein under UniProt accession number Q5JUK3-3 or Q5JUK3-4). In some embodiments, the ASO of this disclosure comprises a sequence that may have at least 60%, 70%, 80%, 85%, 90%, 95%, or 100% complementarity to a sequence of the same length in the target KCNT1 transcript.

[0043] In some embodiments, the ASO of this disclosure may bind to the transcript of a wild-type or mutant KCNT1 gene (e.g., a wild-type human, non-human primate, or rodent gene). In some embodiments, the ASO of this disclosure binds to a variant of the wild-type or mutant KCNT1 gene (e.g., a known variant). The ASO of this disclosure is not designed to selectively target mutant KCNT1 transcripts.

[0044] The ASO of this disclosure is perfectly complementary to wild-type KCNT1 transcripts in other non-clinical model organisms, including mice, rats, and cynomolgus monkeys.

[0045] The binding sites of any ASO disclosed herein have also been examined for known variants in human populations. It contains seven disease-independent polymorphisms (rs781622931, rs1588412829, rs746160320, rs770265176, rs780485857, rs1834215203, and rs1337703203). No known pathogenic variants were found in this region.

[0046] The ASO of the present invention can reduce or inhibit the expression of wild-type or variant KNCT1 transcripts. In some embodiments, the ASO described herein can reduce or inhibit the expression of KCNT1 transcripts encoding KCNT1 proteins (e.g., KCNT1-202 or KCNT1-212).

[0047] The ASO of the present invention comprises a sequence complementary to a sequence of the same length in the target transcript encoded by the KCNT1 gene (wherein the genomic KCNT1 sequence may include, for example, SEQ ID NO: 3). In some embodiments, the ASO described herein comprises a sequence complementary to a sequence in a hotspot region within the target KCNT1 transcript. A “hotspot region” refers to a region of the target nucleotide sequence in which binding of the complementary ASO to a sequence within the region tends to result in a reduction in the abundance or translational activity of the target RNA transcript. Hotspot regions may be entirely located within introns, entirely within exons, or may span intron / exon junctions; or may be wholly or partially located in the 5' or 3' untranslated region (UTR) of the RNA transcript. In some embodiments, binding of the ASO described herein to a sequence in a hotspot region results in a reduction of KCNT1 RNA levels in cells by at least 10%, 20%, or 25%.30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100% (e.g., as determined in an in vitro assay, such as the assay described in the “Examples of ASO Screening in In Vitro Neurons” section below).

[0048] In this disclosure, ASO compounds may be interchangeably referred to as KCNT1_ASO_[Compound Number] and [Compound Number]. KCNT1_Valeriasen is also referred to as Valeriasen. For example, compound number KCNT1_ASO_00815 and compound number 00815 represent the same ASO compound.

[0049] II. Antisense Oligonucleotides

[0050] The term “antisense oligonucleotide” or “ASO” refers to an oligonucleotide capable of hybridizing with a sequence in a target transcript. Those skilled in the art will understand that the ASOs described herein are not naturally occurring (i.e., they are “isolated” ASOs).

[0051] The term “transcript” refers to any RNA transcribed from a gene (e.g., the KCNT1 gene). The gene can be wild-type or in a mutant or variant (e.g., polymorphic) form. The RNA transcript can be a primary RNA transcript or a pre-mRNA, or a messenger RNA (mRNA), and can include exons, introns, a 5' UTR, and a 3' UTR. Unless otherwise stated in the specification 8 / 36 page 14 CN 122029279 A, ​​the sequences of transcripts and ASO provided herein represent nucleotide sequences from the 5' end (left) to the 3' end (right).

[0052] The term "oligonucleotide," as used herein, refers to a compound comprising a chain of about 5 to 100 nucleosides (e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides, e.g., 20 nucleosides), wherein the nucleosides are linked by inter-nucleoside linkages. Each nucleoside and inter-nucleoside linkage of the oligonucleotides of this disclosure can be a modified or unmodified form of naturally occurring nucleotides and linkages. Modified oligonucleotides may comprise one or more modified sugar (e.g., ribose or deoxyribose) moieties, one or more modified nucleobases, and / or one or more modified nucleoside linkages.

[0053] The ASOs described herein may comprise sequences substantially complementary or completely complementary to sequences of the same length as those in the target transcript. Complete complementarity occurs when the first consecutive nucleotide chain (modified or unmodified) and the second consecutive nucleotide chain (modified or unmodified) are completely complementary to each other over the entire length of the shorter chain (or over the entire length of both chains if they are the same length). Complete complementarity occurs when the two chains have 80% or more (e.g., 90% or more) mutual base pairing over the shorter chain (or over the length of both chains if they are the same length), and mismatched base pairs do not exceed 20% (e.g., not exceeding 20%).When the number of mismatched base pairs is less than 4 or less than 2 (e.g., for a double strand of 20 nucleotides), the two strands are considered substantially complementary to each other. In some embodiments, the sequence in the ASO of this disclosure has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the target RNA transcript. In some embodiments, the ASO of the present invention contains no more than 1, 2, 3, or 4 mismatches with its target sequence.

[0054] In the context of comparing two nucleotide sequences, the term “identical” or “identical” means identical nucleobases. In this context, “identity percentage” refers to the percentage of identical nucleobases based on the shorter of the comparison sequences (or the lengths of the two sequences if they are the same) when the two comparison sequences are aligned for maximum correspondence (introducing gaps where necessary).

[0055] In some embodiments, the expression or activity of the target transcript is observed to be reduced, inhibited, or eliminated compared to a control sample not treated with ASO. In some embodiments, the ASO of this disclosure reduces the abundance and / or translational activity of the target KCNT1 transcript in the treated sample, for example, by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control sample not exposed to the ASO. In some cases, the ASO reduces the level of the target transcript by the aforementioned percentages in vivo, and the administration of the ASO may selectively result in a tolerance score (functional observation combination test or score) less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, for example, 0. The terms “reduction” and “inhibition” do not necessarily mean the complete elimination of the entire amount and / or activity of the transcript. In some embodiments, an ASO is considered active when it reduces the amount or activity of the target RNA by 25% or more in an in vitro assay. The ASO of the present invention can cause a detectable or measurable change in the level or activity of the KCNT1 protein encoded by the target RNA.

[0056] Without being bound by theory, it is believed that ASO can inhibit the expression of KCNT1 protein by recruiting RNaseH1 enzymes to the duplex formed by ASO and target KCNT1 transcripts. RNaseH1 family enzymes are endonucleases that typically target RNA:DNA duplexes and catalyze the hydrolytic cleavage of RNA within the duplex.

[0057] In some embodiments, ASO has minimal off-target effects and does not hybridize with any non-KCNT1 transcripts in a manner that results in a significant reduction in the abundance or activity of non-KCNT1 transcripts.

[0058] A. Length of antisense oligonucleotide

[0059] In some embodiments, the length of the ASO of the present invention is between 8 and 30 nucleotides (e.g., lengths of 8, 9, ...).10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides). In some embodiments, the ASO described herein may comprise a sequence complementary to a KCNT1 transcript sequence of the same length, which may be of any nucleotide length range having an upper and lower limit as described below: the upper limit is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and the lower limit is independently selected as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0060] In some embodiments, the length of the complementary sequence in the ASO is between 16 and 20 nucleotides. In certain embodiments, the length of the complementary sequence in the ASO is 16, 17, 18, or 20 nucleotides.

[0061] B. Modification of antisense oligonucleotides

[0062] In some embodiments, the ASO of this disclosure may contain one or more modifications, for example, to increase binding affinity to target transcripts, increase the stability of the ASO (e.g., increase resistance to degradation, e.g., nuclease degradation), and / or increase the ease with which the ASO enters the cell. Modifications may include any modifications known in the art, including, for example, terminal modifications, nucleotide modifications, sugar modifications or substitutions, and backbone modifications. Terminal modifications may include, for example, 5' and / or 3' terminal modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and reverse linkage). Nucleus modifications may include, for example, substitution with a stable base, removal of a base, or conjugation of a base. Sugar modifications or substitutions may include, for example, modifications at the 2' and / or 4' positions of the ribose moiety, or substitution of the ribose moiety. Main-chain modifications or inter-nucleoside linkage modifications may include, for example, modifications or substitutions of phosphodiester bonds, such as substitution with one or more thiophosphates, dithiophosphates, triphosphates, methyl and other alkylphosphonates, phosphites, and aminophosphates.

[0063] In some embodiments, the ASO of the present invention may have one or more modified nucleosides. The term "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. Naturally occurring nucleosides include DNA and RNA nucleosides. In non-naturally occurring nucleosides (also referred to as "modified nucleosides" or "nucleoside analogs"), the bases and / or sugars have been modified. Nucleoside modification may be "silent," in which case the modified nucleoside has the same or equivalent function in the oligonucleotide compared to the naturally occurring nucleoside. In other cases, the modified nucleoside may enhance the efficacy of the ASO in reducing the abundance or activity of the target transcript. The term "efficacy" includes target binding to KCNT1 mRNA.

[0064] As used herein, the term "nucleotide" refers to a nucleoside covalently bonded to one or more modified or unmodified nucleosides. Exemplary nucleotides include monophosphates, diphosphates, triphosphates, and thiophosphates. As used herein, the term "nucleotide" includes unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs). The term "nucleoside" includes unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside analogs); and the term "nucleobase" includes unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs).

[0065] In some embodiments, the modified nucleoside comprises a modified nucleobase. In some embodiments, the modified nucleobase is a 5-methylcytosine (5mC) nucleobase, as shown in structure (I) below, where R represents the sugar moiety.

[0066] (I).

[0067] In some embodiments, the sugar moiety may be a modified sugar moiety or an unmodified sugar moiety. As used herein, the unmodified sugar moiety refers to the 2'-OH(H) ribose moiety found in naturally occurring RNA, also known as the unmodified RNA sugar moiety. In some embodiments, the modified sugar moiety may be the 2'-H(H) deoxyribose moiety. This moiety is naturally present in deoxyribonucleic acid and may be referred to as the unmodified DNA sugar moiety or simply the DNA sugar moiety. 2'-Deoxynucleoside Specification 10 / 36 pages 16 CN 122029279 A The sugar moiety is shown in the following structure (II), where R represents a nucleotide, and the 5'-hydroxyl and 3'-hydroxyl groups of the sugar may each optionally participate in the internucleotide linkage: (II).

[0068] In some embodiments, the modified sugar moiety may include an O-methoxyethyl (MOE) moiety. In some embodiments, the O-methoxyethyl moiety is located at the 2' position of the sugar, as shown in the following structure (III). In the following structure, R represents a nucleotide. The 5'-hydroxyl and 3'-hydroxyl groups of the sugar may each optionally participate in the internucleotide linkage. 2'-MOE modified sugars or 2'-MOE modified nucleosides, or simply MOE sugars or nucleosides, refer to ribose or nucleosides in which the 2' hydroxyl group naturally present in ribose is replaced by a 2'OCH2CH2OCH3 group.

[0069] (III)

[0070] In some embodiments, the modified sugar moiety may comprise a bridging nucleic acid (BNA) moiety. The bridging nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4'-CH2-NH-O-2' linker. The nitrogen of the bridging nucleic acid may optionally be substituted (e.g., methylated, alkylated, or modified with a phenyl group). The structure of the BNA moiety is shown below (IV), wherein R is a nucleobase, R' is, for example, H, Me, or a phenyl group, and the 5'-hydroxyl and 3'-hydroxyl groups of the sugar may each optionally participate in the inter-nucleoside linker. In the ASO of the present inventionUnless otherwise stated, R' is a Me group. A BNA-modified nucleoside, or simply BNA nucleoside, is a nucleoside containing a BNA sugar moiety.

[0071]

[0072] In some embodiments, the modified sugar moiety may contain a locked nucleic acid (LNA) moiety. The locked nucleic acid contains a bicyclic sugar moiety. This sugar moiety contains a 4'-CH2-O-2' linker. As described herein, the LNA moiety may be α-L or β-D configuration. In a specific embodiment, the LNA moiety in the ASO described herein is β-D configuration. The structure of the LNA moiety is shown below (V), where R is a nucleobase, and the 5'-hydroxyl and 3'-hydroxyl groups of the sugar may each optionally participate in the inter-nucleoside linker. A LNA-modified nucleoside, or simply LNA nucleoside, is a nucleoside containing an LNA sugar moiety. Specification 11 / 36 pages 17 CN 122029279 A

[0073] (V)

[0074] In some embodiments, the ASO described herein may include one or more modified nucleotides known in the art, including, for example, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, 2'-O-methoxyethyl modified nucleotides, modified nucleotides that allow for alternative nucleoside linkage (e.g., nucleotides containing thiophosphate, thiophosphate ester and phosphate triester), modified nucleotides with ends linked to cholesterol derivatives or lipophilic moieties, peptide nucleic acids, reverse deoxy or dideoxy modified nucleotides, base-free forms of nucleotides, 2'-amino modified nucleotides, aminophosphate modified nucleotides, modified nucleotides containing modifications at other sites of the sugar or base of the oligonucleotide, and modified nucleotides containing non-natural bases.

[0075] In some embodiments, the ASO may contain one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modified nucleosides. In some embodiments, all nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% of the nucleosides in the ASO (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) are modified nucleosides.

[0076] The ASO of this disclosure may contain natural and / or non-natural inter-nucleoside linkages. The term "inter-nucleoside linkage," as used herein, refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, the ASO described herein may include one or more modified nucleoside linkages known in the art, including, for example, phosphate esters, triphosphate esters, boron phosphate esters, methylphosphonates, aminophosphate esters, thiophosphate esters, dithiophosphate ester linkages, methylenemethylimino linkages.(-CH2-N(CH3)-O-CH2-), thiodiester, thiocarbamate (-O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), dialkylsiloxane, N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-), MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), amide-5 (3'-N(H)-C(=O)-CH2-5'), amide-6 (3'-C(=O)-N(H)-CH2-5'), methylal (3'-O-CH2-O-5'), methoxypropyl, thiomethylal (3'-S-CH2-O-5') '), carboxylic acid esters, carboxamides, sulfides, sulfonates, or amide linkages. See, for example: Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65.

[0077] In some embodiments, the ASO described herein may include one or more modified nucleoside linkages known in the art, such as phosphonoacetate (PACE, P(CR'R'')nCOOR) or thiophosphonoacetate (thioPACE, (S)-P(CR'R'')nCOOR) nucleoside linkages, where n is an integer from 0 to 6, and each R' and R'' is independently selected from H, alkyl, and substituted alkyl groups. Examples of these internucleotide linkages include phosphonocarboxylic acid, phosphonocarboxylic acid, thiophosphonocarboxylic acid, and thiophosphonocarboxylic acid ester linkages, and in some embodiments, described in Yamada et al., J. Am. Chem. Soc. (2006) 128(15):5251-61, the entire contents of which are incorporated herein by reference.

[0078] In some embodiments, the internucleotide linkage of the nucleotides may be a phosphate group or a thiophosphate group. Methods for preparing phosphorus-containing internucleotide linkages are well known to those skilled in the art. In certain embodiments, the ASO described herein may have a phosphate diester internucleotide linkage, a thiophosphate internucleotide linkage, or a combination thereof. “Phosphate diester internucleotide linkage” refers to an internucleotide linkage formed between two nucleosides by a phosphate diester group. “Thiophosphate internucleotide linkage” refers to a modified internucleotide linkage as described on page 12 / 36 of specification 18 CN 122029279 A, ​​wherein one of the non-bridging oxygen atoms of the phosphate diester internucleotide linkage is replaced by a sulfur atom.

[0079] In some embodiments, the inter-nucleoside linkages having chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Representative inter-nucleoside linkages having chiral centers include, but are not limited to, alkylphosphonates and thiophosphates. ASOs of this disclosure containing inter-nucleoside linkages having one or more chiral centers can be prepared as a group of ASOs containing stereodetermined inter-nucleoside linkages or as a group of ASOs containing stereodetermined inter-nucleoside linkages.

[0080] In this disclosure, the term "stereodetermined inter-nucleoside linkage" refers to an inter-nucleoside linkage in which the stereochemical designation of the phosphorus atom is controlled, such that a specific amount of Rp or Sp inter-nucleoside linkages are present in the ASO chain. The stereochemical designation of the chiral bond can be defined, for example, by asymmetric synthesis. An ASO having at least one stereodetermined inter-nucleoside linkage can be referred to as a stereodetermined ASO.

[0081] In some embodiments, the ASOs of the present invention are completely stereodetermined. As used herein, the term "fully stereodetermined ASO" refers to an ASO sequence having a defined chiral center (Rp or Sp) at each nucleotide link in the ASO. As used herein, the term "partially stereodetermined ASO" refers to an ASO sequence having a defined chiral center (Rp or Sp) at at least one nucleotide link, but not at all nucleotide links of the ASO. Therefore, in addition to at least one stereodetermined link, a partially stereodetermined ASO may include achiral or non-stereodetermined links.

[0082] In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides containing one or more specific phosphate thioester nucleotide links in a specific stereochemical configuration. In some embodiments, the specific phosphate thioester link having the specific configuration is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population. Such chiral-enriched modified oligonucleotide populations can be generated using synthetic methods known in the art, for example, those described in Oka et al., JACS (2003) 125:8307, Wan et al., Nuc. Acid. Res. (2014) 42:13456, and PCT patent publication WO 2017 / 015555.

[0083] Unless otherwise stated, the chiral nucleoside linkages of the modified oligonucleotides described herein can be stereorandom or have a specific stereochemical configuration.

[0084] C. Antisense Oligonucleotide Conjugates

[0085] This disclosure also provides antisense oligonucleotide conjugates (ASO conjugates) comprising one or more ASOs described herein. In this disclosure, the term “ASO conjugate” refers to an oligomeric compound comprising an antisense oligonucleotide covalently linked to one or more nonnucleotide moieties (conjugate moieties). Conjugating an oligonucleotide to one or more conjugate moieties can improveThe pharmacological or pharmacokinetic properties of ASO. For example, the conjugated moiety can affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cell distribution, charge, clearance, bioavailability, metabolism, excretion, permeability and / or stability of ASO. In particular, the conjugated moiety can help target ASO to specific regions of the central nervous system. In some embodiments of the ASO described herein, the conjugated moiety can be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and / or a lipid (e.g., a phospholipid).

[0086] PCT patent disclosures WO 1993 / 07883 and WO 2013 / 033230 provide conjugated moieties suitable for ASOs of this disclosure. Certain conjugated groups and conjugated moieties have been previously described, for example, in the following references: thioether moieties, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et al., Bioorg. Med. Chem. Lett. (1993) 3:2765-70); phospholipids, such as bis-hexadecyl-rac-glycerol or 1,2-bis-O-hexadecyl-rac-glycerol-3-H-phosphonate triethylammonium (Manoharan et al., Tetrahedron Lett. (1995) 36:3651-4; Shea et al., Nucl. Acids Res. (1990) 18:3777-83); polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Specification 13 / 36 pages 19 CN 122029279 A Nucleotides (1995) 14:969-73); or adamantane acetic acid, tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids (2015) 4:e220; and Nishina et al., Molecular Therapy (2008) 16:734-40); or GalNAc moiety (e.g., PCT patent disclosures WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620).

[0087] In some embodiments, conjugating the ASO of this disclosure with a lipophilic moiety can increase the delivery of ASO to central nervous system cells. The term "lipophilic moiety" in this disclosure, broadly refers to any compound having an affinity for lipids.Or a chemical moiety. The lipophilic moiety typically comprises a saturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic. This hydrocarbon chain may contain various substituents and / or one or more heteroatoms, such as oxygen or nitrogen atoms. In some embodiments, the lipophilic moiety is an aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is a steroid (e.g., a sterol). Steroids include, but are not limited to, bile acids (e.g., cholic acid, deoxycholic acid, and dehydrocholic acid), cortisone, digoxin, testosterone, cholesterol, and cationic steroids, such as cortisone.

[0088] Certain lipophilic conjugated groups and conjugated moieties have been previously described, for example, in the following literature: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA (1989) 86:6553-6); bile acid moieties (Manoharan et al., Bioorg. Med. Chem. Lett. (1994) 4:1053-60); thiocholesterol moieties (Oberhauser et al., Nucl. Acids Res. (1992) 20:533-8); aliphatic chains, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J. (1991) 10:1111-8; Kabanov et al., FEBS Lett. (1990) 259:327-30; Svinarchuk et al., Biochimie (1993) 75: 49-54); palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta (1995) 1264:229-37); or, octadecylamine or hexylamino-5-carbonyl-oxocholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther. (1996) 277:923-37).

[0089] D. Exemplary antisense oligonucleotide compounds

[0090] In this disclosure, certain abbreviations are used to describe the modifications of each nucleotide and nucleoside link in the modified oligonucleotide ASO described herein. The abbreviations are as follows: A is adenine nucleotide; G is guanine nucleotide; T is thymine nucleotide; C is cytosine nucleotide, mC is 5-methylcytosine nucleotide; e is a 2'-MOE-modified sugar (e.g., modified deoxyribose); d is 2'-deoxyribose; o is a phosphodiester nucleotide linker; s is a thiophosphate nucleotide linker.

[0091] In some embodiments, the ASO of this disclosure is a gapmer. The term "gapmer," as used in this disclosure, refers to an oligonucleotide comprising or consisting of an inner region located between two outer regions, wherein the sugar moiety of the nucleotide contained in the inner region is chemically different from the sugar moiety of the nucleotide contained in the outer region. The term "gap" refers to the inner region of the oligonucleotide, while the term "wing" refers to the outer region. A gapmer has a 5'-wing, a gap, and a 3'-wing. These three regions form a continuous sequence. The sugar moiety of each wing nucleotide is different from the sugar moiety of at least some gap nucleotides. Unless otherwise stated, the nucleotides in the gap region of the ASO of this disclosure all comprise 2'-deoxyribonucleoside. In some embodiments, the gapmer may comprise one or more modified inter-nucleotide linkages and / or modified nucleobases, which do not need to follow the sugar-modified gapmer pattern.

[0092] In some embodiments, the oligonucleotide of this disclosure is a gapmer comprising MOE, BNA, LNA, or DNA modification or any combination thereof. In some embodiments, the gapmer comprises an MOE and a DNA portion. In some embodiments, the nucleotide linking between oligonucleotides is a phosphodiester or thiophosphate nucleotide linking, or a combination thereof.

[0093] The lengths of the three gapmer regions can be represented by the notation: [number of nucleotides in the 5' wing] - [number of nucleotides in the gap] - [number of nucleotides in the 3' wing]. Thus, the 4-10-4 gapmer contains 4 linked nucleotides in each wing and 10 linked nucleotides in the gap. Specification 14 / 36 pages 20 CN 122029279 A

[0094] In some embodiments, the ASO of this disclosure is a 3-10-3 LNA gapmer. The 3-10-3 LNA gapmer is 16 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleotides, and the 5' and 3' wing fragments each contain three LNA nucleotides. In some embodiments, all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methylcytosine. In some embodiments, all nucleoside linkages are phosphate thioside linkages.

[0095] In some embodiments, the ASO of this disclosure is a 3-11-3 LNA gapmer. The 3-11-3 LNA gapmer is 17 nucleobases in length, wherein the central gap fragment contains 11 2'-deoxynucleosides, and the 5' and 3' wing fragments each contain three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methylcytosine. In some embodiments, all nucleoside linkages are phosphate thioside linkages.

[0096] In some embodiments, the ASO of this disclosure is a 4-10-4 MOE gapmer. The 4-10-4 gapmer is 18 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleosides, and the 5' and 3' wing fragments each contain four 2'-MOE nucleosides. In some embodiments, all cytosine nucleosides in the entire 4-10-4 MOE gapmer are 5-methylcytosine. In some embodiments, all inter-nucleoside linkages are phosphate thioside linkages.

[0097] In some embodiments, the ASO of this disclosure is a 5-10-5 MOE gapmer. The 5-10-5 gapmer is 20 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleosides, and the 5' and 3' ends are flanked by wing fragments each containing five 2'-MOE nucleosides. In some embodiments, all cytosine nucleobases in the entire 5-10-5 MOE gapmer are 5-methylcytosine. In some embodiments, all internucleotide links are phosphate thioside links.

[0098] In some embodiments, the ASO of this disclosure is a 5-10-5 MOE gapmer. The 5-10-5 gapmer is 20 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleosides, and wing fragments containing five 2'-MOE nucleosides are attached to the 5' and 3' ends respectively. In some embodiments, all internucleotide links are phosphate thioside links.

[0099] In some embodiments, the ASO of this disclosure is a 5-10-5 MOE gapmer. The 5-10-5 gapmer is 20 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleosides, and wing fragments containing five 2'-MOE nucleosides are attached to the 5' and 3' ends respectively. In some embodiments, all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosine. In some embodiments, the internucleotide links between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, and positions 16 and 17, 17 and 18, and 18 and 19 are phosphodiester internucleotide links. In some embodiments, the remaining internucleotide links are thiophosphate internucleotide links.

[0100] In some embodiments, the ASO of this disclosure is a 5-10-5 MOE gapmer. The 5-10-5 gapmer is 20 nucleotides long, wherein the central gap fragment contains ten 2'-deoxynucleosides, and flanking fragments each containing five 2'-MOE nucleosides are attached to the 5' and 3' ends. In some embodiments, positions 2 and 3, 3 and 4, 4 and 5, and positions 16 and 19 are phosphodiester internucleotide links.17. The inter-nucleoside linkages between the nucleosides at positions 17 and 18, and positions 18 and 19, are phosphodiester inter-nucleoside linkages. In some embodiments, the remaining inter-nucleoside linkages are thiophosphate inter-nucleoside linkages.

[0101] In one specific embodiment, this disclosure provides ASOs listed in the following table and described in more detail below.

[0102] Table 1. Representative ASOs Specification 15 / 36 pages 21 CN 122029279 A

[0103]

[0104] E. Representative MOE Gapmer Compounds

[0105] In some embodiments, the ASOs of this disclosure are MOE gapmer compounds, such as those described below.

[0106] The compound KCNT1_ASO_00849 is characterized in that it is a 5MOE-10DNA-5MOE gapmer with a sequence from 5' to 3': ATCCCAGGTTTACCCGATTC (unmodified oligonucleotide SEQ ID NO: 4), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are each 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are thiophosphate inter-nucleoside linkages, the other inter-nucleoside linkages are phosphodiester inter-nucleoside linkages, and each cytosine is 5-methylcytosine.

[0107] Compound KCNT1_ASO_00849 can be characterized by the following chemical representation: Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds Geo Aeo Teo Tes mCe (modified oligonucleotide SEQ ID NO: 7), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphodiester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0108] Compound KCNT1_ASO_00849 can be characterized by the following chemical structure (I): (I).

[0109] The compound KCNT1_ASO_00815 is characterized in that it is a 5MOE-10DNA-5MOE gapmer, having the sequence from the 5' end to the 3' end of CN 122029279 A on pages 16 / 36 of the specification: TCCCAGGTTTACCCGATTCA (unmodified oligonucleotide SEQ ID NO: 5), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are each 2'-deoxynucleosides, and nucleosides 1-2, 5-16 and 19-The inter-nucleoside linkages between 20 and 3 are thiophosphate inter-nucleoside linkages, and the other inter-nucleoside linkages are phosphodiester inter-nucleoside linkages, and each cytosine is 5-methylcytosine.

[0110] The compound KCNT1_ASO_00815 can be characterized by the following chemical representation: Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds Aeo Teo Teo mCes Ae (modified oligonucleotide SEQ ID NO: 8), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphodiester inter-nucleoside linkage, and s is a thiophosphate inter-nucleoside linkage.

[0111] Compound KCNT1_ASO_00815 can be characterized by the following chemical structure (II): (II).

[0112] Compound KCNT1_ASO_00816 is characterized in that it is a 5MOE-10DNA-5MOE gapmer with a sequence from the 5' end to the 3' end: TATCCCAGGTTTACCCGATT (unmodified oligonucleotide SEQ ID NO: 6), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are all 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are thiophosphate nucleoside linkages, the other inter-nucleoside linkages are phosphodiester nucleoside linkages, and each cytosine is 5-methylcytosine. Specification 17 / 36 pages 23 CN 122029279 A

[0113] The compound KCNT1_ASO_00816 can be characterized by the following chemical representation: Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds mCds mCeo Geo Aeo Tes Te (modified oligonucleotide SEQ ID NO: 9), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphodiester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0114] The compound KCNT1_ASO_00816 can be characterized by the following chemical structure (III): (III).

[0115] The compound KCNT1_ASO_00765 is characterized in that it is a 5MOE-10DNA-5MOE gapmer with a sequence from the 5' end to the 3' end.End: ATCCCAGGTTTACCCGATTC (unmodified oligonucleotide SEQ ID NO: 4), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are all 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are thiophosphate inter-nucleoside linkages, the other inter-nucleoside linkages are phosphodiester inter-nucleoside linkages, and the cytosine with 2'-MOE modification is 5-methylcytosine.

[0116] Compound KCNT1_ASO_00765 can be characterized by the following chemical representation: Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds Geo Aeo Teo Tes mCe (modified oligonucleotide SEQ ID NO: 10), where A is an adenine nucleobase, C is a cytosine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphate ester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0117] Compound KCNT1_ASO_00765 can be characterized by the following chemical structure (IV): (IV).

[0118] The compound KCNT1_ASO_00764 is characterized in that it is a 5MOE-10DNA-5MOE gapmer with the sequence from the 5' end to the 3' end: TCCCAGGTTTACCCGATTCA (unmodified oligonucleotide SEQ ID NO: 5), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are all 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are thiophosphate nucleoside linkages, the other inter-nucleoside linkages are phosphodiester nucleoside linkages, and the cytosine with 2'-MOE modification is 5-methylcytosine.

[0119] The compound KCNT1_ASO_00764 can be characterized by the following chemical representation: Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo Teo Teo mCes Ae (modified oligonucleotide SEQ ID NO: 11), where A is an adenine nucleobase, C is a cytosine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphodiester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0120] The compound KCNT1_ASO_00764 is characterized by the following chemical structure (V): Specification 19 / 36 page 25 CN 122029279 A (V).

[0121] The compound KCNT1_ASO_00769 is characterized by 5MOE-10DNA-5MOE gapmer, whose sequence from 5' to 3' is TATCCCAGGTTTACCCGATT (unmodified oligonucleotide SEQ ID NO: 6), wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are all 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are thiophosphate nucleoside linkages, the other inter-nucleoside linkages are phosphodiester nucleoside linkages, and the cytosine with 2'-MOE modification is 5-methylcytosine.

[0122] The compound KCNT1_ASO_00769 can be characterized by the following chemical representation: Tes Aeo Teo mCeo mCes Cds Ads Gds Gds Tds Tds Tds Ads Cds Cds mCeo Geo Aeo Tes Te (modified oligonucleotide SEQ ID NO: 12), where A is an adenine nucleobase, C is a cytosine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose, o is a phosphodiester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0123] The compound KCNT1_ASO_00769 is characterized by the following chemical structure (VI): Specification 20 / 36 pages 26 CN 122029279 A (VI).

[0124] The compound KCNT1_Valeriasen is characterized as a 5MOE-10DNA-5MOE gapmer with the sequence GTTGCCTTTGTAGCTGAGGT (unmodified oligonucleotide SEQ ID NO: 13) from 5' to 3', wherein nucleosides 1-5 and 16-20 each contain 2'-MOE modification, nucleosides 6-15 are all 2'-deoxynucleosides, the inter-nucleoside linkages between nucleosides 1-2, 5-16 and 19-20 are phosphate thioester nucleoside linkages, the remaining inter-nucleoside linkages are phosphodiester nucleoside linkages, and each cytosine is 5-methylcytosine.

[0125] The compound KCNT1_Valeriasen can be characterized by the following chemical representation: Ges Teo Teo Geo mCes mCds Tds Tds Tds Gds Tds Ads Gds mCds Tds Geo Aeo Geo Ges Te (modified oligonucleotide SEQ ID NO: 13)ID NO: 14), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE-modified sugar, d is a 2'-deoxyribose, o is a phosphodiester nucleoside linker, and s is a thiophosphate nucleoside linker.

[0126] The compound KCNT1_Valeriasen is characterized by the following chemical structure (VII): Specification 21 / 36 pages 27 CN 122029279 A (VII).

[0127] III. Method for preparing antisense oligonucleotides

[0128] The antisense oligonucleotides of this disclosure can be synthesized by any method known in the art. For example, ASO can be synthesized by in vitro transcription and purification (e.g., using a commercially available in vitro RNA synthesis kit), by transcription and purification from cells (e.g., cells containing an expression cassette / vector encoding ASO), by using an automated solid-phase synthesizer, etc. In solid-phase oligonucleotide synthesis, monomeric nucleoside units are repeatedly added to the growing oligonucleotide chain covalently bound to a solid support. In the case of phosphodiester linkage, an electrophilic 3'-phosphamide monomeric unit can be used. However, any suitable electrophilic group can be used to covalently link the two nucleosides.

[0129] The ASO of the present invention can be purified after solid-phase synthesis by any method known in the art. For example, the oligonucleotide can be precipitated from the solution by treating the solution with ethanol and divalent cations. The ASO of the present invention can also be purified using methods such as size exclusion columns, reversed-phase chromatography, high-performance liquid chromatography, and polyacrylamide gel electrophoresis.

[0130] Exemplary methods for synthesizing antisense oligonucleotides using a solid support and purifying said oligonucleotides are described, for example, in Ellington et al., Introduction to the synthesis and purification of oligonucleotides. Curr. Protoc. Nucleic Acid Chem. (2001) Appendix 3C.

[0131] IV. Compositions of Antisense Oligonucleotides

[0132] In some embodiments, this disclosure relates to compositions comprising the ASOs described herein (e.g., Pharmaceutical Composition Specification, pages 22 / 36, CN 122029279 A). In some embodiments, the composition may be used to treat diseases or conditions associated with the expression or overexpression of KCNT1, such as DEE. The compositions of this disclosure may be formulated according to the method of delivery.

[0133] The pharmaceutical compositions described herein may comprise pharmaceutically acceptable excipients. Pharmaceutically acceptable excipientsIt can be a liquid or a solid and can be selected according to the planned route of administration to provide the required volume, consistency, and other relevant transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent can be used, including, for example, water, saline solutions, buffers, preservatives, etc. For example, the ASO of this disclosure can be administered to a patient in the form of a formulation in phosphate-buffered saline (PBS). Examples of pharmaceutically acceptable excipients include water, saline, buffer solutions, or artificial cerebrospinal fluid. Pharmaceutically acceptable excipients are preferably sterile.

[0134] The ASO of this disclosure can be administered in the form of a pharmaceutically acceptable salt. A pharmaceutically acceptable salt is a salt of the ASO of this disclosure that is physiologically acceptable and retains the desired biological activity of the ASO without adverse toxicological effects. As used herein, the term ASO covers both the free acid form and the salt form (e.g., sodium salt form) of the oligonucleotide.

[0135] The ASO of this disclosure can be mixed, encapsulated (e.g., in lipid nanoparticles), conjugated, or otherwise combined with other molecules, molecular structures, or nucleic acid mixtures.

[0136] U.S. Patent Publication No. 2020 / 0385723 provides suitable pharmaceutical compositions applicable to the ASO of this disclosure.

[0137] V. Method of Use of Antisense Oligonucleotides

[0138] The ASO of this disclosure typically inhibits the activity of transcripts encoded by the KCNT1 gene in mammalian cells (e.g., human cells). In some embodiments, the cells are neuronal cells. In some embodiments, the cells are cells of the central nervous system (CNS), including the motor cortex, frontal cortex, caudate nucleus, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, dorsal cochlear nucleus (DCN), entorhinal cortex, hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, and superior colliculus.Cells of the colliculi and basal forebrain nuclei.

[0139] This disclosure provides a method for downregulating the abundance or activity of KCNT1 gene transcripts in cells or tissues, comprising contacting the cells or tissues with an effective amount of one or more of the ASOs or compositions of this disclosure. The method may be performed in vitro or in vivo.

[0140] In some embodiments, the ASOs of this disclosure may be used for treatment or prevention. The ASOs of this disclosure may be used as therapeutic agents for animals suspected of having a disease or condition that can be treated by regulating the expression of KCNT1 gene transcripts and / or KCNT1 protein. The animal may also be susceptible to a disease or condition associated with KCNT1 gene expression without being suspected of having the disease or condition. The animal is treated by administering a therapeutically effective amount or a preventively effective amount of one or more of the ASO compounds or pharmaceutical compositions of this disclosure. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human.

[0141] In some embodiments, the ASOs described herein may be used to treat diseases associated with KCNT1, particularly DEE, including EIMFS and EOEE. Typically, diseases associated with KCNT1 lead to a high seizure burden and experience of seizures.

[0142] In some embodiments, the ASO of this disclosure improves symptoms of diseases or conditions associated with KCNT1 gene expression. Improvement may refer to a reduction in the severity or frequency of symptoms, such as the severity and frequency of seizures. Improvement may also refer to a delay in the onset or progression of symptoms, such as seizures.

[0143] The “therapeutic effective amount” of the ASO disclosed herein is an amount sufficient to achieve the specific stated purpose. This amount may be determined empirically and conventionally according to the stated purpose as described on pages 23 / 36 of CN 122029279 A. Certain factors may affect the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or condition, prior treatment, the subject’s overall health and / or age, and one or more other pre-existing diseases. Furthermore, treatment of a subject with a therapeutically effective amount of the pharmaceutical composition may include a single treatment or a series of treatments. The effective dose and in vivo half-life of the ASO of this disclosure may be estimated using conventional methods or based on in vivo testing using appropriate animal models. A therapeutically effective dose can alleviate the symptoms of the disease.

[0144] In some embodiments, the ASO or pharmaceutical composition of this disclosure is prepared for injection (e.g., intravenous injection, subcutaneous injection, intramuscular injection, intrathecal (IT) injection, intraventricular (ICV) injection, intracranial injection, etc.). In a preferred embodiment, the pharmaceutical composition is injected intrathecally or intracranially into the subject.

[0145] In some embodiments, the ASO of this disclosure can be used for research purposes. For example, the ASO can be used to specifically inhibit cells.Synthesis of KCNT1 protein in cells and experimental animals. ASO-mediated inhibition of KCNT1 synthesis can be used for functional analysis of the KCNT1 protein.

[0146] VI. Kits and Articles

[0147] This disclosure also provides kits and articles comprising the ASOs described herein. Kits or articles comprising the ASOs of this disclosure can be used to perform the methods described herein. Kits or articles may contain at least one ASO in one or more containers.

[0148] In some embodiments, the kits or articles described herein may be used to treat and / or prevent diseases associated with KCNT1 gene expression. The kit or article may further comprise a container and a label or instruction manual on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The container may be made of various materials (such as glass or plastic) and may contain a composition and may have a sterile inlet, wherein the composition alone or in combination with another composition is effective in treating or preventing the disease. The kit or article may further comprise an instruction manual indicating that the composition may be used to treat a specific disease. Alternatively, or additionally, the article or kit may further comprise a second (or third) container containing a pharmaceutically acceptable buffer solution, such as antibacterial water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and glucose solution. It may also include other materials desired from a commercial and / or user perspective, including additional buffer solutions, diluents, filters, needles, and syringes.

[0149] In some embodiments, the kit contains all components necessary and / or sufficient for performing the test, including all controls, instructions for performing the test, and any software required for analyzing and presenting the results. Those skilled in the art will readily recognize that the disclosed ASO can be readily incorporated into one of the kit forms well known in the art.

[0150] Unless otherwise defined herein, scientific and technical terms relating to this disclosure should have the meanings commonly understood by one of ordinary skill in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials may also be used in the practice or testing of this disclosure. In case of conflict, this specification (including definitions) shall prevail. Generally, the terms and techniques described herein related to neurology, medicine, pharmaceuticals and medicinal chemistry, and cell biology are well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions, as commonly practiced in the art or as described herein. Furthermore, unless the context requires otherwise, singular terms shall include plurals, and plural terms shall include singulars. In this specification and embodiments, the words “having” and “comprising” or variations such as “having,” “owning,” “including,” or “containing” are to be understood as implying inclusion of the integers or groups of integers stated, but do not exclude any other integers.Numbers or groups of integers. As used herein, the term “about” when applied to one or more intended values ​​refers to a value similar to the stated reference value. In some embodiments, unless otherwise stated or clearly understood from the context, the term refers to a value falling within a range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction of the stated reference value.

[0151] According to this disclosure, references to dependent claims are intended as a convenient writing style to directly and unambiguously disclose each and all combinations of the referenced claims. Furthermore, the headings in this document are created for ease of organization and are not intended to limit the scope of the claimed invention in any way.

[0152] All publications and other references mentioned herein are incorporated herein in their entirety. Although numerous references are cited herein, such citations do not constitute an admission that any of these references are part of common general knowledge in the art.

[0153] The following embodiments are provided to better understand the invention. These examples are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way.

[0154] Examples

[0155] The materials and methods used in the following examples are as follows.

[0156] Construction of ASO

[0157] ASO was designed to be complementary to the positive strand of the genomic KCNT1 sequence (chromosome: GRCh38:9:135701585:135796108:1, SEQ ID NO: 3), and to the mRNA sequence of the KCNT1-202 protein encoded by the KCNT1 gene (ENST00000371757.7, SEQ ID NO: 2), and also to the mRNA sequence of the KCNT1-212 protein encoded by the KCNT1 gene (ENST00000628528.2, SEQ ID NO: 3), encoded by the KCNT1 gene.

[0158] Collection of C57BL / 6 wild-type mice and neurons

[0159] C57BL / 6 wild-type mice arrived weighing 20-30 grams and were housed in cages of up to three at room temperature with free access to food and water. All procedures were approved by the SERVIER Institute Ethics Committee and in accordance with the principles of the Guidelines for the Care and Use of Laboratory Animals.

[0160] Embryos were removed from C57BL / 6 wild-type pregnant mice on day 17.5, and primary cortical neurons were collected from the embryos. The cortical tissue of each embryo was dissected in ice-cold Hank's balanced salt solution. The collected tissues were...The cells were chopped and digested with papain at 37°C for 12 minutes. Digestion was then terminated by adding 10% FBS / DMEM. The cells were ground and resuspended in Neurobasal™ Plus medium supplemented with GlutaMAX™, 2% penicillin / streptomycin and B-27™ Plus supplement. Cells were seeded at a density of 15,000 cells / well in 40 µL of supplemented Neurobasal™ medium on 384-well poly-L-lysine + borate coated plates. The neurons were then incubated at 37°C in a 5% CO2 atmosphere for four days.

[0161] ASO Screening in Neurons in Vitro

[0162] For single-dose screening, neurons were treated with 300 nM of test ASO. For multi-dose screening, neurons were treated with serial dilutions of ASO, starting at a concentration of 3 µM (½ log dilution, 11 concentrations in total). Seven days after ASO treatment, the medium was replaced with fresh Neurobasal™ medium. Fifteen days post-treatment, RNA was extracted from cells using the TaqMan™ Fast Advanced Cells-to-CT kit (ThermoFisher). Cells were washed with PBS and lysed in solution at room temperature for five minutes while undergoing DNase treatment. Lysis was terminated by treating the mixture with stop solution, followed by incubation at room temperature for two minutes. Immediately after cell lysis, reverse transcription was performed using the Fast Advanced RT-PCR mixture (ThermoFisher). cDNA samples were then used for quantitative real-time PCR measurements using the TaqMan™ genotyping method. KCNT1 mRNA was quantified using a specific probe and primer (Mm01330661_g1 KCNT1; ThermoFisher). KCNT1 mRNA levels were adjusted based on the measured levels of the housekeeping gene peptidyl prolyl isomerase A (PPIA) (probe / primer PPIA_Mm02342430_g1; ThermoFisher).

[0163] KCNT1 RNA expression was normalized relative to PPIA housekeeping gene expression, and KCNT1 RNA expression was calculated using the ΔCt (ΔΔCt) method. In qPCR reactions, the quantitative cycle value (Ct) is defined as the number of cycles required for the fluorescence signal to exceed the background fluorescence. The QuantStudio™ real-time PCR software program (Applied Biosystems, Foster City, CA) set this threshold to be ten standard deviations above the mean baseline fluorescence. This comparative Ct method normalized the Ct values ​​of the KCNT1 target genes relative to the PPIA housekeeping genes before sample comparison. First, the target gene and housekeeping gene expression in each sample were calculated. (Instructions for use, page 25 / 36, 31)The difference (ΔCt) between Ct values ​​of CN 122029279 A was calculated, and then the difference (ΔΔCt) between the two samples (e.g., control and treatment) was calculated. The fold change in expression in the two samples was calculated as 2 - ΔΔCt. The percentage of effect (%) was calculated using the following formula (2^(-ΔΔCt)-1) × 100.

[0164] Efficacy of ASO in iPSC-derived neurons

[0165] Wild-type (WT) (Cellular Dynamics; C1012; Lot No. 105286) and P924L (Cellular Dynamics; IPSC-NC; Lot No. 01434.747.NC003) were both human GABAergic neurons derived from induced pluripotent stem cells (iPSC; 01434). In 96-well plates coated with 0.002% polyornithine (Sigma; P4957; batch number RNBK2252) and 3.3 μg / ml laminin (Sigma; P2020; batch number 132987), immature neurons were seeded at a density of 40,000 cells / well in 100 μl of complete maintenance medium, which consisted of iCell neural basal medium (Cellular Dynamics; M1010; batch number 105297) supplemented with iCell Neural Supplement A1 (Cellular Dynamics; M1032; batch number 105480), and incubated at 37°C and 5% CO2.

[0166] On the second day, the medium was completely replaced with 100 μl of complete maintenance medium, and thereafter 50% of the medium was replaced every 2 days for 1 week. At DIV-8 and DIV-15, neurons were treated twice with ASO at concentrations of 0.1 and 1 μM, and the culture medium was replaced with 50% of the medium 5 days after treatment (DIV-13 and 20).

[0167] Two weeks after treatment, neurons were washed with PBS and RNA was isolated using the TaqMan Fast Advanced Cells-to-CT kit (A35378; lot numbers 1115521 and 1115536; ThermoFisher) according to the manufacturer's protocol. RNA was immediately reverse transcribed using Fast Advanced RT Enzyme Mix (4387410BF2; lot number ThermoFisher, lot number 1091535). KCNT1 transcripts were then measured by real-time quantitative TaqMan™ PCR assay.

[0168] The probe Hs01063071_m1_KCNT1 (FAM) (lot number P211111-008-H08) was used.The total expression level of KCNT1 RNA was measured by real-time quantitative PCR using the TaqMan™ PCR assay (ThermoFisher). PPIA RNA was measured using the probe PPIA-Hs99999904_m1 (VIC) (batch number P211204-002-H10; ThermoFisher).

[0169] KCNT1 RNA expression level was normalized to the expression level of PPIA, and the KCNT1 RNA expression level was calculated using the ΔCt (ΔΔCt) method. In the qPCR reaction, the quantitative cycle value (Ct) is defined as the number of cycles required for the fluorescence signal to exceed the background fluorescence. The QuantStudio™ real-time PCR software program set this threshold to be ten standard deviations above the mean baseline fluorescence. This comparative Ct method normalized the Ct value of KCNT1 relative to PPIA before sample comparison. First, the difference (ΔCt) between the Ct values ​​of the target gene and the housekeeping gene in each sample was calculated, and then the difference (ΔΔCt) between two samples (e.g., control and treatment) was calculated. The fold change in expression in the two samples was calculated as 2 - ΔΔCt and expressed as a percentage (%) relative to the solvent.

[0170] Male Wistar Rats

[0171] Male Wistar rats arrived weighing 200-225 g and were housed at a density of two per cage at room temperature with free access to food and water. All procedures were approved by the SERVIER Institute Ethics Committee and in accordance with the principles of the Guidelines for the Care and Use of Laboratory Animals.

[0172] ASO Solution Preparation

[0173] The administration solution was prepared using a sterile saline syringe and nuclease-free centrifuge tubes. The centrifuge tube containing ASO powder was briefly centrifuged, then the saline solution was added, and the tube was centrifuged again for 10 minutes to fully dissolve the ASO powder. The solution was vortexed for about 1 minute and stored at 4°C until use.

[0174] Intraventricular (ICV) Injection

[0175] C57BL / 6 mice were given a single unilateral bolus injection of 30 nmol of ASO. Mice were anesthetized with 4.5-5% isoflurane and maintained at 1.5-2% isoflurane anesthesia during the procedure, as per instructions on pages 26 / 36, 32 CN 122029279 A. For pain management, 0.04 mg / kg of buprenorphine was administered subcutaneously at least 30 minutes prior to the injection. The mice were shaved and placed in a stereotaxic apparatus (David Kopf Instruments, CA) after the loss of foot reflexes. The scalp was disinfected alternately with three wet wipes containing iodine and 70% ethanol. An incision was made in the scalp to expose the skull surface and clearly identify the anterior fontanelle. The anterior fontanelle was located at 0.5 mm AP and 1.1 mm AP.At the ML site, a hole was drilled in the skull. ASO was injected through a cannula (31g) connected to a microinjection pump controller.

[0176] Dorsoventral (DV) coordinates were measured 1 mm below the surface of the skull. Once the cannula was in place, the ASO solution was administered in 5 µL of saline solution over 30 seconds. After injection, the cannula was left in place for three minutes to allow the solution to diffuse in the brain. After the cannula was slowly removed, the scalp was sutured, and 1 mL of warm, sterile saline solution was injected subcutaneously into the mouse to help it rehydrate, and then it was placed in a warm home cage. Mice in the saline solution control group were administered in a similar manner. The mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerance was scored one hour after administration. Animals that received administration of the non-tolerant compound (tolerance score >8) were euthanized immediately after assessment one hour later.

[0177] The ASO described above was tested in C57BL / 6 mice as described above to assess their tolerance characteristics. Valeriasen, as described above, was also tested as a control.

[0178] Intrathecal Injection

[0179] Male Wistar rats received a single intrathecal (IT) bolus injection of 2.5 mg of ASO. The rats were anesthetized with 4% isoflurane and maintained at 2–2.5% isoflurane throughout the procedure. For pain management, 5 mg / kg carbofenone and 0.05 mg / kg buprenorphine were administered subcutaneously at least 20 minutes prior to the injection. The rats were shaved, and an incision was made between the 5th and 6th lumbar vertebrae after the foot reflexes disappeared. The muscles surrounding the area were dissected to allow access to the spinal canal, and a catheter for ASO injection was inserted. Once the catheter was in place, the ASO solution was administered in 30 µl of artificial cerebrospinal fluid (CSF) over approximately 30 seconds. The catheter was left in place and sealed to prevent CSF diffusion. The muscles and skin were sutured, and the rats were subcutaneously injected with 1 mL of warm sterile saline to aid in rehydration before being returned to a warm home cage. Control rats were injected with artificial CSF in a similar manner. Rats were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerance was assessed at 1 hour, 3 hours, and 24 hours after administration. Animals receiving non-tolerable compounds (tolerance score > 8) were euthanized immediately after the 1-hour assessment.

[0180] Acute Tolerance Assessment of ASO

[0181] Adverse reactions in administered rats were monitored and scored according to the criteria shown in Figure 3 at 1 hour, 3 hours, and 24 hours after injection. A normal tolerance score was 0, and a high toxicity score corresponded to 14. The final tolerance score was calculated based on the sum of all criteria. If, for some oligonucleotides, intolerable acute toxicity was observed without reaching the first observation time point, the ASO was rated as an acute toxicity score of 14, and the mice were euthanized immediately. If the score measured at the 1-hour time point was higher than 6, the mice were monitored more closely during the experiment.

[0182] Long-term tolerance assessment of ASO

[0183] Mice were weighed on the day of injection and then three times a week until the end of the experiment. Any mouse exhibiting intolerable health or behavioral findings, or losing more than 20% of its initial weight, was immediately euthanized.

[0184] Tissue sampling

[0185] All mice were euthanized by an overdose of anesthetic. Animals were perfused through the left ventricle with 0.9% saline. The thoracic aorta located between the lungs and liver was clamped with hemostatic forceps to prevent blood from flowing from the heart to the abdomen, but blood was allowed to flow to the brain. The right ventricle was opened with scissors. The pressure of the perfusion fluid was maintained at a constant pressure of 100 to 120 mm Hg by connecting the solution bottle to a pressure gauge-controlled air compressor. Perfusion continued until the skull surface turned white and the perfusion fluid flowed out of the right ventricle. After perfusion, brain tissue (cortex) was collected. The sample was cut into small pieces, mixed, and divided into three equal parts. All samples were frozen in liquid nitrogen and stored at -80°C until used for RNA, protein, and ASO measurements. Blood and CSF were also collected in some studies, as per the instructions on pages 27 / 36 of CN 122029279 A.

[0186] mRNA Measurement by qRT-PCR

[0187] RNA extraction and mRNA quantification by qPCR were performed. RNA was extracted from the right cortical biopsy sample using the RNeasy Mini Kit (Qiagen) and treated with DNase. Total RNA samples were quantified using a Nanodrop™ spectrophotometer, and TapeStation analysis was used to determine RNA quality (RIN). In the qPCR quantification experiment, RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™). The reaction was performed in a final reaction volume of 100 µL, starting with 1000 ng of total RNA (until a final RNA concentration of 10 ng / µL). Using a QuantStudio™ 7 Flex (Applied Biosystems™), TaqMan™ Universal PCR Master Mix (Applied Biosystems™, batch number 4324020), and dual TaqMan™ Gene Expression Assays (Mm01330661_g1, FAM fluorescent dye labeled; Mm02342430_g1, VIC fluorescent dye labeled), 40 ng of total cDNA was used to quantify human KCNT1 mRNA and mouse PPIA mRNA. The rapid run mode was used with three replicates.qPCR analysis was performed. The Ct values ​​of each qPCR plate were analyzed using Excel software. The technical replicates (n = 3) were combined and the geometric mean was calculated. The relative expression levels for each ASO group were generated using mouse control PBS conditions.

[0188] Mass spectrometry analysis of KCNT1 protein expression

[0189] Mouse brain tissue was homogenized at 150 mg / mL in lysis buffer (50 mM ammonium bicarbonate, 1% deoxycholate, Sigma protease and phosphatase inhibitor mixture, 1% deoxycholate) using Precellys® (2x20s, 5000tr). The brain homogenate was then centrifuged (27000g, 4°C, 20 min) and the supernatant was collected. The brain samples were heated at 95°C for 5 min. Next, trypsin (20 µg) was added to each sample. The samples were incubated at room temperature for 30 min and then treated in an ultrasonic bath (Branson 1200) for 1 min for trypsin digestion. The reaction was stopped by adding 1 µL of TCEP (0.5 M) and 1 µL of 100% formic acid, followed by incubation at 95°C for 5 minutes. The samples were then centrifuged at 30,000 g for 15 minutes. Peptide digests were analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (LC-MS / MS) using a Shimadzu LC system connected to a triple quadrupole mass spectrometer (Shimadzu LCMS-8060), with the spectrometer running in MRM mode. The specific peptide used to measure KCNT1 protein abundance was LFPSLSITTELTHPSNMR (SEQ ID NO: 15). The specific peptide used to measure GAPDH protein abundance was VGVNGFGR (SEQ ID NO: 16). 10 μL of each brain sample digest was injected as a single injection onto a Waters™ XBridge Peptide BEH C18 column (300 Å; 3.5 µm; 150 mm x 2.1 mm). Elution was performed for 30 minutes using a linear gradient (2-40%) of acetonitrile in 0.1% formic acid. Chromatograms were analyzed using Shimadzu LabSolutions software. The signal intensity obtained for each peptide was normalized by the GAPDH signal obtained for each sample and expressed in arbitrary units (AU).

[0190] High Performance Liquid Chromatography (HPLC) Fluorescence

[0191] Samples were analyzed relative to a set of calibration standards prepared in water. Since no matrix effect was observed, all samples (plasma, CSF, and tissue) were quantified using a set of water standards. Frozen tissues were weighed and ground for 2 x 30 seconds at 6500 rpm in MasterPure™ / proteinase K 97 / 3 (V / V) buffer using a Precellys device. Plasma samples (5 µL) were diluted toIn MasterPure™ / Protein K 97 / 3 (70 µL), incubate plasma and tissue homogenates with gentle agitation at 55°C for 30 min. Then, add 10 µL of 3 M KCl solution to 50 µL of tissue homogenate or plasma diluent, vortex rapidly, and sonicate for 5 min. Centrifuge the tubes at 20000 g for 10 min (4°C). Dilute the CSF sample (10 µL) to hybridization buffer (Tris HCl 50 mM pH 8.5 / ACN 90 / 10) (45 µL) and proteinase K (1 µL), and incubate at 55°C for 15 min. Before analysis, perform a hybridization step using fluorescently labeled peptide-nucleic acid oligomers (complementary to quantitative oligonucleotides).

[0192] For calibration standards and tissue homogenates, 40 µL of hybridization buffer was mixed with 10 µL of fluorescent complementary probe and 10 µL of calibration standard, quality control sample, and study sample supernatant. For plasma samples, 30 µL of hybridization buffer was mixed with 10 µL of fluorescent complementary probe and 60 µL of quality control sample and study sample supernatant. For CSF analysis, 10 µL of fluorescent complementary probe was added directly to the previously diluted solution. The mixture was incubated first at 95°C for 15 min, then at 55°C for 15 min. Finally, the sample was centrifuged at 20000 g for 5 min at 4°C. The sample was analyzed by fluorescence detection using an RP-HPLC system. Except for plasma (90 µL), the injection volume was 50 µL. The fluorescence intensity generated by the oligonucleotide hybridization fluorescent probe was measured and compared with the calibration curve. Considering the different dilutions used in sample preparation, the oligonucleotide concentrations in the samples were calculated.

[0193] Example 1: In vitro mRNA reduction after a single dose of ASO

[0194] Modified oligonucleotides complementary to the human KCNT1 genome sequence were designed and their selective efficacy in reducing KCNT1 mRNA levels was tested in primary cortical neurons in vitro. Each ASO was used to treat neurons at 300 nM. mRNA levels were quantified using qRT-PCR (TaqMan™) as described above.

[0195] Table A below shows the modified oligonucleotides tested in this experiment. Each modified oligonucleotide listed in Table A is complementary to the human KCNT1 genome sequence (SEQ ID NO: 3) and is a 5-10-5 MOE gapmer. These gapmers are 20 nucleotides in length, wherein the central gap fragment contains ten 2'-deoxynucleotides and each wing fragment contains five 2'-MOE nucleotides. Cytosine is not present in the gap.5-Methylcytosine, and the inter-nucleoside linkages between nucleosides 1-2, 5-16, and 19-20 are phosphate thioester nucleoside linkages, and the other nucleoside linkages are phosphodiester nucleoside linkages.

[0196] Table A. 5-10-5 MOE gapmer

[0197] Example 2: In vitro reduction of mRNA after multiple administrations of MOE-modified ASO

[0198] In primary cortical neurons, modified oligonucleotides complementary to the human KCNT1 genomic sequence were tested in vitro to evaluate their efficacy in selectively reducing KCNT1 mRNA levels. Neurons were treated with multiple doses of a given ASO (Cmax = 3 µM; 1 / 2 log dilution; 11 concentrations). This assay provides the in vitro cellular potency (pIC50 = -Log(IC50)) and efficacy (Delta Inhib Obs (%)) of a given ASO in neurons. In addition, the Hill coefficient (i.e., the slope of the straight line in the Hill plot) was measured to observe the shape of the dose-response curve for each ASO.

[0199] Each ASO in Table B is a 5-10-5 MOE gapmer. These gapmers are 20 nucleotides long, with the central gap fragment containing ten 2'-deoxynucleosides and each wing fragment containing five 2'-MOE nucleosides. Cytosine in the gap is not 5-methylcytosine, and the inter-nucleoside linkages between nucleosides 1-2, 5-16, and 19-20 are phosphate thioester nucleoside linkages, while the other inter-nucleoside linkages are phosphodiester nucleoside linkages.

[0200] Figure 1 shows the corresponding curves of KCNT1_ASO_00764, KCNT1_ASO_00765, and KCNT1_ASO_00769 inhibiting KCNT1 mRNA expression at different concentrations to measure IC50. Since multiple doses were tested, the potency (pIC50 = -LogIC50), efficacy (Inhib Obs %), and Hill coefficient in primary neurons were calculated according to Screener rules (Genedata software).

[0201] Table B. Reduction of mRNA after multiple administrations of MOE-modified ASO. Instructions for use, pages 29 / 36, 35 CN 122029279 A

[0202] Example 3: In vitro reduction of iPSC mRNA

[0203] Cultured iPSC-derived neurons (WT or P924L mutant cells) were treated with modified ASO at concentrations of 100 nM or 1000 nM under free uptake conditions. At DIV-8 and DIV-15, neurons were treated twice with 0.1 µM and 1 µM ASO, respectively.The culture medium was replaced with 50% of the medium 5 days after treatment (DIV-13 and 20). The modified oligonucleotides KCNT-1_ASO_00849 and KCNT1_Valeriasen are 5-10-5 MOE gapmers, in which all cytosine residues throughout the gapmer are 5-methylcytosine.

[0204] The data in Table C are presented as fold change (mean of six replicates) compared to the vehicle group. Statistical analysis was performed by the preclinical biostatistics department using SAS v9.4. The significance threshold for the major effect was set at 5%. To assess the treatment effect, a one-way ANOVA was performed on the fold change (FC) of KCNT-1 expression with group as a factor, followed by Dunnett's test to compare the treatment group with the vehicle group. Data for WT and P924L mutant cells were analyzed independently.

[0205] The data in Figure 2 show that KCNT1_ASO_00849 has comparable potency to Valeriasen.

[0206] Table C. Mean relative mRNA expression levels in neurons derived from WT and mutant P924L iPSCs

[0207] Example 4: Tolerance and efficacy of modified oligonucleotides complementary to human KCNT1 in C57BL / 6 wild-type mice

[0208] 4.1 Tolerance

[0209] Three-month-old C57BL / 6 wild-type mice received a single ICV bolus injection of the modified oligonucleotides listed in Table D, at a low dose of 10 nmol and a high dose of 60 nmol. Each modified oligonucleotide was complementary to the human KCNT1 genomic sequence (SEQ ID NO: 3). The position in the table indicates the 5' nucleoside complementary to the oligonucleotide in the KCNT1-212 transcript sequence (SEQ ID NO: 2).

[0210] In the tolerability study, the tolerability score was expressed as the Functional Observation Combination Test (FOB) score one hour after injection. Adverse reactions in administered mice were monitored and scored according to the criteria shown in Figure 3.

[0211] Table D. Tolerance of low and high doses in C57BL6 / J mice, 30 / 36 pages, CN 122029279 A

[0212] 4.2 Efficacy

[0213] For efficacy studies, most treatment groups consisted of three animals. Mice were sacrificed two weeks after receiving a single bolus injection of 10 nmol of MOE-modified oligonucleotides via ICV, or six weeks after receiving a single bolus injection of 60 nmol of MOE-modified oligonucleotides via ICV. Brain tissue was collected, and KCNT1 mRNA levels were measured as described above. The results are presented in Table E as a percentage reduction in KCNT1 mRNA levels relative to the mediator control group. A 0% reduction indicates that the compound...The drug had no effect.

[0214] The data in Figure 4 show that, in mice, KCNT1_ASO_815 and KCNT1_ASO_849 had better acute tolerability after a single ICV administration and were comparable in efficacy to KCNT1_Valeriasen.

[0215] Table E. Effects of modified ASO in C57BL6 / J mice at low and high doses

[0216] 4.3 Dose-effect

[0217] Three-month-old C57BL6 / J mice received a single ICV bolus injection of the specified dose of the modified oligonucleotide listed. C57BL6 / J mice were divided into groups of five. For each experiment, four mice were given a group receiving PBS as a negative control. For tolerance studies, the tolerance score was expressed as the Functional Observation Combination Test (FOB) score one hour after injection.

[0218] For efficacy studies, mice were sacrificed three weeks after injection. Cortical brain tissue was collected, and KCNT1 mRNA levels were measured by qRT-PCR as described above. The results are presented in Table F, expressed as a percentage reduction in KCNT1 mRNA levels relative to the solvent (PBS) control group, and normalized to mouse PPIA. A 0% reduction indicates that the compound had no effect.

[0219] The data in Figure 5 show that, after a single ICV administration (multiple doses), KCNT1_ASO_815 and KCNT1_ASO_849 were dose-responsive to KCNT1_Valeriasen in mice.

[0220] Table F. Dose-effect of modified ASO in the cortex of C57BL6 / J mice

[0221] 4.4 Dose-effect of ASO concentration in the cortex

[0222] In Table G, the amounts of KCNT1_ASO_00849 and KCNT1_Valeriasen per milligram of cortex were quantified by HPLC fluorescence after single ICV injections at multiple doses. The data in Table G and Figure 6 indicate that KCNT1_ASO_849 had a better dose-exposure relationship in the mouse cortex compared to 5, 15, and 30 nmol doses of KCNT1_Valeriasen.

[0223] Table G. Dose-effect relationship of ASO concentration on the cortex of C57BL6 mice. Instructions for use, pages 32 / 36, 38 CN 122029279 A

[0224] Example 5: Duration of action of multiple doses of modified oligonucleotides

[0225] Three-month-old C57BL6 / J mice were divided into groups of five to six. Each mouse received a single unilateral injection of the test oligonucleotide at doses of 20, 60, or 80 nmol, as shown in Table H below. Two ASOs were tested in this experiment: - KCNT1_ASO_00815: Modified ASO sequence:TCCCAGGTTTACCCGATTCA (SEQ ID NO: 8) - KCNT1_ASO_00849: Modified ASO sequence: ATCCCAGGTTTACCCGATTC (SEQ ID NO: 7) Animals were sacrificed at different time points (2, 6, 12, and 20 weeks), and RNA was extracted from cortical tissue and analyzed by qRT-PCR. For each experiment, a group of four mice received PBS as a negative control. Results are expressed as percentage changes in RNA levels relative to the PBS control and normalized to mouse peptidyl prolyl isomerase A (PPIA).

[0226] The data in Figure 7 show that both tested ASOs (KCNT1_ASO_00815 and KCNT1_ASO_00849) exhibited dose-dependent inhibition of KCNT1 mRNA expression in mouse cortex. The data also showed that this inhibition was durable, lasting at least 20 weeks. During the 20-week observation period, the KCNT1 mRNA levels of both ASOs at both test doses continued to decrease.

[0227] Table H. Inhibitory effect of KCNT1 mRNA in mouse cortex, manual, 33 / 36 pages, 39 CN 122029279 A

[0228] Example 6: Mouse PK / PD study

[0229] Three-month-old C57BL6 / J mice were given a single intraventricular (ICV) bolus injection of the modified oligonucleotides and their doses as shown in Tables I and J. C57BL6 / J mice were divided into groups of five. In each experiment, a group of four mice received PBS as a negative control.

[0230] For tolerability studies, the tolerability score was expressed as the Functional Observation Combination Test (FOB) score one hour after injection. For efficacy studies, mice were sacrificed three weeks after injection. Cortical brain tissue was collected and the KCNT1 mRNA level was measured by qRT-PCR as described above. The results are presented in tables as a percentage decrease in KCNT1 mRNA levels relative to the solvent (PBS) control group, normalized to PPIA. A 0% decrease indicates that the compound had no effect. Dose-response studies were conducted in mice to characterize the concentration-effect relationship of mRNA expression levels in target tissues.

[0231] The data in Figure 8 show that KCNT1_Valeriasen and KCNT1_ASO_00849 exhibited similar dose-response inhibitory effects on KCNT1 mRNA levels in the cortex.

[0232] Table I. Inhibitory effect of KCNT1_Valeriasen on KCNT1 mRNA expression 34 / 36 pages 40 CN 122029279 A

[0233] Table J. Inhibition of KCNT1 mRNA expression by KCNT1_ASO_00849

[0234] Example 7: Tolerance of modified oligonucleotides complementary to human KCNT1 in rats

[0235] Male Wistar rats were divided into groups of four and received a single bolus injection of the modified oligonucleotides listed in Table K at a dose of 1 or 2.5 mg. Each modified oligonucleotide was complementary to the human KCNT1 genomic nucleic acid sequence (SEQ ID NO: 3).

[0236] For tolerability studies, tolerability scores were expressed as Functional Observation Combination Test (FOB) scores. FOB was measured at one hour, three hours and twenty-four hours after injection.

[0237] Table K. Long-term tolerability in rats

[0238] Animals treated with 2.5 mg KCNT1_Valeriasen were euthanized (prematurely sacrificed) approximately 5 hours after administration due to significant severe clinical symptoms.

[0239] Example 8: In vivo brain magnetic resonance imaging study

[0240] Twenty-four male Wistar rats, weighing between 250 g and 300 g, were divided into three groups of eight animals each. These animals were anesthetized with isoflurane, placed in a sterile surgical area, and under optimal aseptic conditions underwent intrathecal (IT) injection. Animals received a single administration (80 µL) of artificial cerebrospinal fluid (aCSF), KCNT1_Valeriasen, or KCNT1_ASO_815 via catheter insertion at the L5-L6 lumbar junction. The overall design of this study was reviewed and approved by the SERVIER Institute Ethics Committee and generally complied with animal health and welfare guidelines and standard operating procedures.

[0241] Brain MR images were acquired using an 11.7-Tesla MR scanner system and a 1H-orthogonal emitter-receiver surface coil (Bruker) for the rat head. HR anatomical T2-weighted images were obtained using a multi-slice multi-echo (MSME) sequence (TE / TR: 5 / 7000 ms; in-plane resolution: 160 x 160 µm²; slice thickness: 300 µm; number of slices: n=70; total scan time: 14 minutes). All animals underwent MRI acquisition before treatment, and two and four weeks after IT administration. Lateral ventricle volume was manually assessed by the same researcher using π-PMOD (biomedical image quantification software) on anatomical brain images, as shown in Figure 9.

[0242] The data in Figure 10 show that two weeks after administration, animals treated with KCNT1_Valeriasen showed a significant increase in total LV volume of 41.3% compared to baseline. This abnormal increase was no longer observed four weeks after IT injection, indicating that the event was transient. In the animal groups treated with aCSF or KCNT1_ASO_815, no change in LV was observed two or four weeks after treatment. (Instructions for Use, pages 35 / 36, 41 CN 122029279 A)

[0243] Sequence

[0244] The following table provides a list of SEQ ID NOs disclosed herein.

[0245] Specification page 36 / 36, page 42, CN 122029279 A, ​​Figure 1; Specification drawing 1 / 9, page 43, CN 122029279 A, ​​Figure 1 (continued); Specification drawing 2 / 9, page 44, CN 122029279 A, ​​Figure 2; Specification drawing 3 / 9, page 45, CN 122029279 A, ​​Figure 3; Specification drawing 4 / 9, page 46, CN 122029279 A, ​​Figure 4; Specification drawing 5 / 9, page 47, CN 122029279 A, ​​Figure 5; Specification drawing 6 / 9, page 48, CN 122029279 A, ​​Figure 6; Specification drawing 7 / 9, page 49, CN 122029279 A, ​​Figure 8; Specification drawing 8 / 9, page 50, CN 122029279 A, ​​Figure 10; Specification drawing 9 / 9, page 51, CN 122029279 A

Claims

1. An antisense oligonucleotide for reducing KCNT1 expression, wherein the antisense oligonucleotide has a nucleobase sequence comprising at least 12 consecutive nucleobases from any one of SEQ ID NOs: 4-12.

2. The antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide has a nucleobase sequence comprising at least 15 consecutive nucleobases from any of the nucleobase sequences of SEQ ID NOs: 4-12.

3. The antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 4-12.

4. The antisense oligonucleotide according to claim 3, wherein the antisense oligonucleotide has a nucleobase sequence of any one of SEQ ID NOs: 7, 8 and 9.

5. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide has 18 to 20 linked nucleosides.

6. The antisense oligonucleotide according to any one of claims 1-5, wherein at least one nucleoside link is a modified nucleoside link.

7. The antisense oligonucleotide according to claim 6, wherein the modified nucleoside link is a phosphate thioside link.

8. The antisense oligonucleotide according to claim 7, wherein the thiophosphate nucleoside linker is preferably located at positions 1-2, 5-16, and 19-20.

9. The antisense oligonucleotide according to any one of claims 1-8, wherein at least one nucleoside of the antisense oligonucleotide comprises a modified sugar moiety.

10. The antisense oligonucleotide of claim 9, wherein the modified sugar moiety comprises a 2'-O-methoxyethyl group.

11. An oligonucleotide comprising the following structure: i) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads mCds mCds mCds GeoAeo Teo Tes mCe (SEQ ID NO: 7); ii) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads mCds mCds mCds Gds AeoTeo Teo mCes Ae (SEQ ID NO: 8); iii) Tes Aeo Teo mCeo mCes mCds Ads Gds Gds Tds Tds Tds Ads mCds mCdsmCeo Geo Aeo Tes Te (SEQ ID NO: 9); iv) Aes Teo mCeo mCeo mCes Ads Gds Gds Tds Tds Tds Ads Cds Cds Cds GeoAeo Teo Tes mCe (SEQ ID NO: 10); v) Tes mCeo mCeo mCeo Aes Gds Gds Tds Tds Tds Ads Cds Cds Cds Gds Aeo TeoTeo mCes Ae (SEQ ID NO: 11); vi) Tes Aeo Teo mCeo mCes Cds Ads Gds Gds Tds Tds Tds Ads Cds Cds mCeoGeo Aeo Tes Te (SEQ ID NO: 12) in: A = Adenine C = cytosine mC = 5-methylcytosine G = Guanine T = thymine e = 2'-O-methoxyethyl ribose d = 2'-deoxyribose s = phosphate thioester nucleoside linkage o = Phosphodiester nucleoside linkage.

12. An oligonucleotide comprising the following structural formula: 。 13. An oligonucleotide comprising the following structural formula: 。 14. An oligonucleotide comprising the following structural formula: 。 15. A conjugate comprising an antisense oligonucleotide according to any one of claims 1-14 and at least one conjugate moiety covalently linked to said oligonucleotide.

16. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1-14 or a conjugate according to claim 15, and a pharmaceutically acceptable excipient.

17. A method for reducing KCNT1 expression in mammalian cells, comprising contacting the cells with an antisense oligonucleotide according to any one of claims 1-14, a conjugate according to claim 15, or a pharmaceutical composition according to claim 16, thereby reducing KCNT1 expression in the cells.

18. The method of claim 17, wherein the cell is a cell in the central nervous system, optionally a cell in the human brain.

19. A method of treating developmental epileptic encephalopathy (DEE) in a subject in need (optionally, a human subject), the method comprising administering to the subject a therapeutically effective amount of an antisense oligonucleotide according to any one of claims 1-14, a conjugate according to claim 15, or a pharmaceutical composition according to claim 16.

20. The method of claim 19, wherein the oligonucleotide is injected intrathecally or intracranially into the subject.

21. Use of the antisense oligonucleotide of any one of claims 1-14 or the conjugate of claim 15 for the preparation of a medicament for treating a subject with DEE in the manner of any one of claims 17-20.

22. The oligonucleotide of any one of claims 1-14, the conjugate of claim 15, or the pharmaceutical composition of claim 16, for treating a subject with DEE requiring such treatment in the method of any one of claims 17-20.

23. The method, use, oligonucleotide for use, conjugate for use, or pharmaceutical composition for use according to any one of claims 17-22, wherein the DEE is infantile epilepsy with migratory focal seizures (EIMFS) or early-onset epileptic encephalopathy (EOEE).

Images