Transaminase mutant and use thereof in preparation of sitagliptin intermediate

Abstract

Provided are a transaminase mutant and the use thereof in the preparation of a sitagliptin intermediate. The mutant is obtained by means of substituting tyrosine at position 74 with proline, glutamic acid at position 228 with aspartic acid, leucine at position 254 with alanine and methionine at position 290 with threonine in an amino acid sequence shown in SEQ ID NO: 2. The sitagliptin intermediate or sitagliptin ester intermediate is prepared by means of using wet thallus or a pure enzyme obtained by fermenting and culturing engineering bacteria containing a gene encoding the transaminase mutant as a biocatalyst and of using a sitagliptin intermediate precursor ketone or a prochiral carbonyl compound as a substrate. The total yield is about 82% and the e.e. value of the product can be up to 99%.

Description

Transaminase mutants and their use in preparing sitagliptin intermediates (1) Technical field

[0001] The present invention relates to the field of biochemical engineering technology, specifically to a method for using transaminase and its mutant enzymes in preparing optically pure sitagliptin intermediates, comprising a transaminase, a mutant, an encoding gene, a recombinant vector containing the gene, a recombinant genetically engineered bacterium transformed with the recombinant vector, and a recombinant enzyme, as well as applications. (2) Background technology

[0002] Sitagliptin, developed by Merck and Codexis in the United States, is the first dipeptidyl peptidase-IV (DPP-IV) inhibitor approved by the FDA for the treatment of type 2 diabetes. Sitagliptin increases insulin secretion in a blood sugar-dependent manner, has a moderate glucose-lowering effect, does not cause hypoglycemia, and has no side effects such as weight gain, nausea, or vomiting. Sitagliptin, marketed as Januvia, is currently approved for use in over 70 countries worldwide and is a top-20 drug in international sales.

[0003] Sitagliptin and its intermediates can be prepared by a combined chemoenzymatic method, which is becoming the preferred method for synthesizing chiral pharmaceutical chemicals and their intermediates. The key to this chemoenzymatic method is obtaining a transaminase capable of catalyzing asymmetric transamination reactions to produce optically pure sitagliptin intermediates. U.S. Patent No. 8,293,507 discloses a biocatalyst developed by Codexis using a transaminase (ATA117) derived from Arthrobacter sp., achieving an ee value of 99% for the transamination product.

[0004] However, there are currently few reports of natural transaminases with R-selective transamination. Furthermore, these transaminases have a narrow substrate spectrum and are often the optimal biocatalysts screened for specific reactions. This greatly limits their scope of application, resulting in very few enzymes that can be used to synthesize sitagliptin intermediates. With the development of directed evolution technology, protein engineering is increasingly being used to modify enzyme substrate specificity, screen for novel transaminases with broad substrate spectra, and study their ability to efficiently and selectively catalyze chiral drugs and their intermediates. This not only broadens their application scope and enhances their potential, but also lays the foundation for industrial production.

[0005] (3) Summary of the invention

[0006] The present invention addresses the defects in existing processes for producing sitagliptin intermediates (poor stereoselectivity, expensive catalysts, difficulty in solvent recovery, and other issues) and provides a transaminase mutant, an encoding gene, a recombinant vector, a recombinant genetically engineered bacterium, and applications in asymmetric transamination to obtain sitagliptin or sitagliptin ester intermediates. The method has high raw material conversion rate, low production cost, and high yield.

[0007] The technical solution adopted in the present invention is:

[0008] The present invention provides a transaminase mutant, wherein the mutant is obtained by replacing tyrosine at position 74 with proline, glutamic acid at position 228 with aspartic acid, leucine at position 254 with alanine, and methionine at position 290 with threonine in the amino acid sequence shown in SEQ ID NO: 2. The amino acid sequence of the transaminase mutant is shown in SEQ ID NO: 4, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 3.

[0009] The transaminase mutant of the present invention is obtained by mutating a transaminase derived from Mycobacterium. The amino acid sequence of the transaminase is shown in SEQ ID NO. 2, and the nucleotide sequence is shown in SEQ ID NO: 1. The amino acid sequence identity of the transaminase of the present invention shown in SEQ ID NO: 2 and the transaminase ATA117-Rd11 derived from Arthrobacter (U.S. Patent No. 8,293,507) is only 42%, indicating significant differences.

[0010] The present invention also relates to a recombinant vector constructed with the gene encoding the transaminase mutant and a recombinant genetically engineered bacterium prepared by transforming the recombinant vector. The recombinant genetically engineered bacterium is preferably prepared according to the following method: the transaminase gene (or mutant gene) is connected to the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b-MbTA (or pET28b-MbTAmut1) containing the transaminase gene; the expression recombinant plasmid pET28b-MbTA (or pET28b-MbTAmut1) is transformed into Escherichia coli BL21 (DE3) to obtain recombinant Escherichia coli / pET28b-MbTA (or pET28b-MbTAmut1) containing the recombinant plasmid pET28b-MbTA.

[0011] The present invention also provides an application of the transaminase mutant in biocatalysis of the synthesis of a sitagliptin intermediate from a precursor ketone of a sitagliptin intermediate. The application comprises the following steps: using a wet cell obtained by fermentation and culture of a recombinant genetically engineered bacterium (preferably a recombinant Escherichia coli) containing a gene encoding the transaminase mutant or a pure enzyme extracted from the wet cell after ultrasonic crushing as a biocatalyst, using the precursor ketone of the sitagliptin intermediate ([1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone]) as a substrate, using dimethyl sulfoxide (DMSO) as a cosolvent, using pyridoxal phosphate as a coenzyme, using isopropylamine as a cosubstrate, and using pH 7. 8-9 triethanolamine buffer is used as a reaction medium to form a reaction system, and a biocatalytic reaction is carried out at a temperature of 30-45° C. (preferably 35° C.) and a stirring speed of 100-250 r / min (preferably 150 r / min). After the reaction, the reaction liquid is separated and purified to obtain a sitagliptin intermediate ((R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone); in the reaction system, the amount of wet bacteria is 10-50 g / L (preferably 50 g / L), the amount of pure enzyme is 0.01-1.0 g / L (preferably 0.07 g / L), the final concentration of the substrate added is 2-50 g / L (preferably 20 g / L), the volume of dimethyl sulfoxide added is 10-40% (v / v) (preferably 20%), pyridoxal phosphate is added to a final concentration of 0.5 g / L, and isopropylamine is added to a final concentration of 10 g / L.

[0012] The present invention also provides an application of the transaminase mutant in the biocatalytic synthesis of sitagliptin ester intermediates from a prochiral carbonyl compound, wherein the application comprises the following steps: using a wet cell obtained by fermentation of a recombinant genetically engineered bacterium (preferably a recombinant Escherichia coli) containing a gene encoding the transaminase mutant as a biocatalyst, using a prochiral carbonyl compound as a substrate, using dimethyl sulfoxide as a cosolvent, using pyridoxal phosphate as a coenzyme, using isopropylamine as a cosubstrate, and using a pH of 4. 8-9 triethanolamine buffer is used as a reaction medium to form a reaction system, and a biocatalytic reaction is carried out at a temperature of 25-35° C. (preferably 35° C.) and a stirring speed of 100-250 r / min (preferably 150 r / min). After the reaction is completed, the reaction liquid is separated and purified to obtain a sitagliptin ester intermediate; in the reaction system, the amount of wet bacteria is 10-100 g / L (preferably 50 g / L), the final concentration of the substrate added is 2-60 g / L (preferably 20 g / L), and the final concentration of dimethyl sulfoxide added is 10-40% (preferably 20%) by volume. Pyridoxal phosphate is added to a final concentration of 0.5 g / L, and isopropylamine is added to a final concentration of 10 g / L; the substrate is one of the following: 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester.

[0013] The method for separating and purifying (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone from a reaction liquid of the present invention comprises the following steps: after the reaction is completed, adjusting the pH of the reaction liquid to 1.0-2.0 with concentrated hydrochloric acid (mass fraction of 36%-38%), adding diatomaceous earth adsorption cells, stirring for 10-30 minutes, filtering to obtain filtrate a and filter residue a, adding 1M hydrochloric acid to the filter residue a (the amount used is sufficient to immerse the filter residue a, preferably at a volume ratio of 1.5:1 to the reaction liquid), stirring for 10-30 minutes, and filtering to obtain filtrate b and filter residue b; and combining the filtrate a and the filtrate b. , extracted once with dichloromethane to obtain an organic phase a and an aqueous phase a, the organic phase a was extracted with 1M hydrochloric acid to obtain an organic phase b and an aqueous phase b, the aqueous phase a and the aqueous phase b were combined and the pH was adjusted to 12 with sodium hydroxide, and then extracted with dichloromethane to obtain an organic phase c and an aqueous phase c, dichloromethane was added to the aqueous phase c to extract to obtain an organic phase d and an aqueous phase d, the organic phase c and the organic phase d were combined and washed twice with saturated sodium chloride water, anhydrous sodium sulfate was added to dry, sodium sulfate was removed by suction filtration, and rotary evaporated at 45°C to obtain a sitagliptin intermediate; the amount of diatomaceous earth used was 0.18 g / mL based on the volume of the reaction solution. Taking 400 mL of reaction solution as an example: I. Adjust the pH of the reaction solution to 1.5 with concentrated hydrochloric acid (mass fraction of 36%-38%), add 72 g of diatomaceous earth to absorb cells, stir for 20 minutes, filter, and obtain filtrate a and residue a. Add 600 ml of 1 M hydrochloric acid to the residue a, stir for 20 minutes, filter, and obtain filtrate b and residue b; II. Combine the filtrate a and filtrate b totaling about 1.0 L, extract once with 500 mL of dichloromethane to obtain aqueous phase a and organic phase a, extract the organic phase a with 100 ml of 1 M hydrochloric acid to obtain aqueous phase b and organic phase b, and combine the aqueous phase a and aqueous phase b were adjusted to pH 12 with sodium hydroxide and then extracted with 1.2L of dichloromethane to obtain an organic phase c and an aqueous phase c. 800mL of dichloromethane was then added to the aqueous phase c for extraction to obtain an organic phase d and an aqueous phase d. The organic phases c and d were combined; III. The organic phases c and d were washed twice with saturated sodium chloride (36g / L) water, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and rotary evaporated at 45°C to obtain 23.1g of a high-purity white powder of sitagliptin intermediate (white powder). The purification yield was 95%, and the purity of the sitagliptin intermediate was greater than 99%. The letters in the filtrate a-filtrate c, filter residue a-filter residue c, organic phase a-organic phase d, and aqueous phase a-aqueous phase d of the present invention are meaningless and are named for convenience of description.

[0014] The wet bacterial cells of the present invention are prepared as follows: recombinant Escherichia coli containing a transaminase encoding gene or a transaminase mutant encoding gene is inoculated into an LB liquid culture medium containing 50 μg / ml kanamycin, cultured at 37°C and 200 rpm for 12 hours, then inoculated into a fresh LB liquid culture medium containing 50 μg / ml kanamycin resistance at a volume concentration of 1%, cultured at 37°C and 150 rpm until the bacterial OD600 reaches 0.6-0.8, IPTG is added at a final concentration of 0.1 mM, and after induction culture at 28°C for 12 hours, the culture is centrifuged at 4°C and 5000 rpm for 20 minutes, the supernatant is discarded, and the precipitate is collected to obtain the wet bacterial cells.

[0015] The method for extracting pure enzyme after ultrasonic disruption of wet bacteria is as follows: the wet bacteria are resuspended in a binding buffer (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 10mM imidazole), ultrasonically disrupted (under ice bath conditions, 240W disruption for 10min, working for 2s and pausing for 2s), centrifuged at 12000rpm for 40min, incubated with a Ni affinity chromatography resin equilibrated with the binding buffer, and then rinsed with a washing buffer (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 20mM imidazole) until substantially free of foreign proteins, and then eluted with an elution buffer (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 250mM imidazole) and the eluate is collected to obtain the target protein. After the purity is identified by electrophoresis, the target proteins are combined and dialyzed with a dialysis buffer (50mM, pH 8.0). 8.0 sodium phosphate buffer) for 48 h (dialysis bag molecular cutoff 14 kD), and the retentate is the pure transaminase enzyme.

[0016] The amino acid sequence of the present invention is substituted, deleted or added with one or more amino acid residues and the derived amino acid sequence having transaminase activity has at least 95% identity, which belongs to the protection scope of the present invention. The protein composed of the amino acid sequence shown in SEQ ID No: 2 can be isolated from Mycobacterium, or can be isolated from an expression transformant that recombinantly expresses the protein, or can be obtained by artificial synthesis. The identity between two amino acid sequences or two nucleotide sequences can be obtained by algorithms commonly used in the art, preferably calculated using NCBI Blastp and Blastn software according to default parameters.

[0017] As known to those skilled in the art, due to the degeneracy of codons, the nucleic acid sequences encoding the amino acid sequences of SEQ ID No: 2 and SEQ ID No: 4 are not limited to SEQ ID No: 1 and SEQ ID No: 3. The transaminase gene of the present invention can also be a polynucleotide homolog provided by appropriately introducing substitutions, deletions, or insertions into SEQ ID No: 1 and SEQ ID No: 3.

[0018] The present invention also relates to the use of a transaminase gene in the preparation of a recombinant transaminase, specifically comprising: constructing a recombinant vector containing the transaminase gene (or a transaminase mutant gene), transforming the recombinant vector into Escherichia coli, inducing and culturing the obtained recombinant genetically engineered bacteria, separating the culture fluid to obtain bacterial cells containing the recombinant transaminase, crushing the crude transaminase enzyme solution, and purifying the pure transaminase enzyme (or transaminase mutant).

[0019] The catalyst of the present invention includes other forms such as transaminase and its mutant pure enzymes, corresponding recombinant genetically engineered bacteria wet cells, crude enzyme liquid, crude enzyme powder, pure enzyme liquid, pure enzyme powder, etc.

[0020] The invention discloses an application of a transaminase in the biocatalytic synthesis of a sitagliptin intermediate. The application uses wet cells obtained by fermentation of recombinant Escherichia coli containing a transaminase encoding gene as a biocatalyst, a precursor ketone of the sitagliptin intermediate ([1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone]) as a substrate, dimethyl sulfoxide (DMSO) as a cosolvent, pyridoxal phosphate as a coenzyme, isopropylamine as a cosubstrate, and a pH of 4. 8-9 triethanolamine buffer is used as a reaction medium to form a reaction system, and a biocatalytic reaction is carried out at a temperature of 30-45° C. and a stirring speed of 100-250 r / min. After the reaction is completed, the reaction liquid is separated and purified to obtain a sitagliptin intermediate (obtaining (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone); in the reaction system, the amount of wet bacteria is 10-50 g / L (preferably 50 g / L), the final concentration of the substrate is 2-50 g / L, the final volume concentration of dimethyl sulfoxide is 10-20% (v / v), pyridoxal phosphate is 0.5 g / L, and isopropylamine is 10 g / L.

[0021] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: addressing the problems of low total yield (generally less than 50%), low stereoselectivity (product ee value is generally less than 90%), expensive metal catalysts, and the inability of biocatalysts to directly use sitagliptin precursor ketone as a substrate in the reported asymmetric synthesis of sitagliptin and its intermediates, the present invention provides a transaminase mutant (biocatalyst) derived from a mycobacterium, a sitagliptin intermediate precursor ketone (such as: 1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone) or a sitagliptin ester intermediate carbonyl substrate (3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid) The invention relates to a method for preparing a sitagliptin intermediate or a sitagliptin ester intermediate with high optical purity by using methyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester) as substrates, isopropylamine as an amino donor, and pyridoxal phosphate as a coenzyme to carry out a biocatalytic reaction, separation and purification, and prepare a sitagliptin intermediate or a sitagliptin ester intermediate with high optical purity. The total yield of the method reaches 82% (including the conversion yield and the separation and purification yield), and the ee value of the product reaches 99% (high stereoselectivity). (IV) Description of the accompanying drawings

[0022] FIG1 is a schematic diagram of the reaction formula for the biocatalytic synthesis of sitagliptin intermediates by transaminase mutants. (V) Specific implementation methods

[0023] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0024] Example 1: Amplification of the transaminase gene MbTA

[0025] Based on the sequencing data of transaminase genes from Mycolicibacterium included in GenBank, total genomic DNA of the transaminase gene of Mycolicibacterium was extracted using a rapid nucleic acid extraction instrument. PCR amplification was performed using this genomic DNA with Primer 1 (ATGGGCATCGATACC) and Primer 2 (GTAGCAGATATCTTCGA). The PCR reaction system (total volume 50 μL) consisted of 5 μL of 10× Pfu DNA Polymerase Buffer, 1 μL of a 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL each of cloning primers 1 and 2 at 50 μM concentrations, 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase, and 40 μL of nuclease-free water.

[0026] A BioRad PCR instrument was used, and the PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 45 s, extension at 72°C for 1 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0027] The PCR reaction solution was electrophoresed on a 0.9% agarose gel, and the fragment was purified by gel excision. Taq DNA polymerase was used to introduce a base A at the 5' end of the fragment. The fragment was ligated with the pMD18-T vector using T4 DNA ligase to generate the cloned recombinant plasmid pMD18-T-MbTA. This recombinant plasmid was transformed into Escherichia coli JM109 and screened using a blue-white spot screening system. Randomly selected white colonies were sequenced, and the sequencing results were analyzed using software. The results showed that the nucleotide sequence amplified by primers 1 and 2 was 1011 bp in length (MbTA gene, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2), encoding a complete open reading frame.

[0028] Example 2: Construction of recombinant Escherichia coli BL21 / pET28b-MbTA

[0029] Primer 3 (CCGGAATTC GGTATCGACACCGGTACCTC) and primer 4 (TTGGGATCC GTACTGGATAGCTTCGATCAGC) were designed based on the MbTA gene sequence in Example 1, and EcoR I and BamH I restriction enzyme sites (underlined) were introduced into primers 3 and 4, respectively. Under priming by primers 3 and 4, amplification was performed using high-fidelity Pfu DNA polymerase, and the recombinant plasmid pMD18-T-MbTA was used as a template (obtained in Example 1) to obtain the MbTA gene sequence. After sequencing, the amplified fragment was treated with EcoR I and BamH I restriction endonucleases (TaKaRa), and the fragment was ligated with the commercial vector pET28b (Invitrogen) treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pET28b-MbTA. The constructed expression vector pET28b-MbTA was transformed into Escherichia coli BL21 (DE3) (Invitrogen) (42°C, 90s), spread on LB plates containing 50 μg / ml kanamycin resistance, and cultured at 37°C for 8-12h. Clones were randomly picked and plasmids were extracted for sequencing and identification. Recombinant Escherichia coli BL21 (DE3) / pET28b-MbTA containing the recombinant plasmid pET28b-MbTA was screened and obtained.

[0030] Example 3: Inducible expression of transaminase (MbTA)

[0031] The recombinant E. coli BL21(DE3) / pET28b-MbTA obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance and cultured at 37°C, 200 rpm for 12 hours. A 1% (v / v) inoculum was then inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance and cultured at 37°C, 150 rpm until the cell OD600 reached 0.6-0.8. IPTG was added to a final concentration of 0.1 mM and induced at 28°C for 12 hours. The culture was then centrifuged at 4°C, 5000 rpm for 25 minutes, the supernatant discarded, and the precipitate collected to obtain wet cells of recombinant E. coli BL21 / pET28b-MbTA containing the recombinant plasmid. The cells can be used directly as a biocatalyst or for protein purification.

[0032] Example 4: Isolation and purification of transaminase (MbTA)

[0033] The wet cells obtained in Example 3 were resuspended in binding buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 10 mM imidazole), and then ultrasonically disrupted (under ice bath conditions, 240 W for 10 min, working for 2 s and pausing for 2 s), and centrifuged at 12000 rpm for 40 min. The supernatant was incubated with Ni affinity chromatography resin equilibrated with the above binding buffer, and then rinsed with washing buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 20 mM imidazole) until there was substantially no impurity protein. Subsequently, the cells were eluted with elution buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 250 mM imidazole) and the eluate was collected to obtain the target protein. After electrophoresis to identify the purity, the target proteins were combined and dialyzed with dialysis buffer (50 mM, pH 8.0). The transaminase solution was dialyzed against 50 mM sodium phosphate buffer (pH 8.0) for 48 h (dialysis bag molecular cutoff: 14 kD). The retentate was obtained as the transaminase solution. The protein content was determined by Coomassie Brilliant Blue assay and was 1.8 mg / mL. The enzyme solution (enzyme activity approximately 150 U / mg) was diluted with 50 mM sodium phosphate buffer (pH 8.0) to a final concentration of 0.5 mg / mL. Aliquots were then stored frozen at -80°C.

[0034] The amount of transaminase MbTA required to catalyze the conversion of substrate 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone to produce 1 μmol of product per hour is 1 enzyme activity unit, expressed as U.

[0035] Example 5: Establishment of MbTA gene mutation library

[0036] Error-prone PCR was performed using the plasmid pET28b-MbTA constructed in Example 2 as a template. Error-prone PCR was performed with Primer 1 (ATGGGCATCGATACC) and Primer 2 (GTAGCAGATATCTTCGA). The PCR reaction system (total volume 50 μL) included 5 μL of 10× Pfu DNA Polymerase Buffer, 1 μL of a 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 0.5 μM each of cloning Primer 1 and Primer 2 at 50 μM concentrations, 0.8 ng / μL of plasmid template, 2.5 U of Taq DNA Polymerase, 0.2 mM MnCl2, and deionized water to a volume of 50 μL. A BioRad PCR instrument was used, and the PCR reaction conditions were: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 65°C for 45 seconds, extension at 72°C for 1 minute, for a total of 30 cycles, and a final extension at 72°C for 10 minutes. After purification of the error-prone PCR product, megaprimer PCR was performed using this product as a primer and the plasmid pET28b-MbTA constructed in Example 2 as a template to obtain the megaprimer PCR product (i.e., mutant library 1). PCR system: megaprimer 10 ng / μL, plasmid template 1 ng / μL, Pfu DNA Polymerase 2.5 U. PCR reaction conditions: A-tail removal at 72°C for 5 minutes, pre-denaturation at 96°C for 2 minutes, denaturation at 96°C for 30 seconds, annealing at 60°C for 45 seconds, extension at 72°C for 4 minutes, for a total of 25 cycles, and a final extension at 72°C for 10 minutes.

[0037] Example 6: Screening of MbTA gene mutation library 1 to obtain mutant 1

[0038] The gene library 1 of Example 5 was transformed into competent Escherichia coli BL21 (DE3) cells under the transformation conditions of 42°C and heat shock for 90 seconds. 9501 single clones were picked from LB resistance plates containing 50 μg / ml kanamycin and inoculated into LB medium containing 50 μg / ml kanamycin for induced expression. The induction conditions were the same as those of Example 3, and 9501 recombinant E. coli wet cells containing the mutant gene were obtained, namely, wet cells of Mutant 1.

[0039] After obtaining E. coli containing the mutant protein, biotransformation screening was performed on a low concentration of 20 g / L of the sitagliptin intermediate precursor ketone. The final composition and catalytic conditions of the catalytic system (15 ml) were as follows: 0.75 g of wet cells of Mutant 1, triethanolamine buffer (pH 8-8.5), 20 g / L of the substrate (1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone), 10% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 35°C, stirring speed 150 rpm, and reaction time 36 hours. Under the same conditions, a blank control was used with the reaction solution containing no bacteria, and a negative control was used with wet cells of E. coli BL21 / pET28b containing an empty vector, replacing the wet cells of Mutant 1. After the reaction, samples were collected for HPLC analysis (same conditions as in Example 15) (50:50 acetonitrile:water, 10 mM ammonium acetate, 0.8 ml / min flow rate, 205 nm detection wavelength). From the 6503 proteins, a mutant with the highest substrate conversion rate, pET28b-MbTAmut1, was selected, with a conversion rate of 96% and an ee value of 99%. The nucleotide sequence and amino acid sequence of the mutant pET28b-MbTAmut1 are shown in SEQ ID No: 3 and SEQ ID No: 4 in the sequence listing. Mutant 1 is a mutant in which the tyrosine at position 74 shown in SEQ ID NO: 2 is substituted with proline, the glutamic acid at position 228 is substituted with aspartic acid, the leucine at position 254 is substituted with alanine, and the methionine at position 290 is substituted with threonine.

[0040] The wet cells of mutant 1 were obtained by the method of Example 3, and the pure enzyme of mutant 1 (enzyme activity of about 150 U / mg) was obtained by the method of Example 4.

[0041] Example 7: Application of recombinant transaminase MbTA in the preparation of sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone

[0042] The recombinant Escherichia coli BL21 / pET28b-MbTA wet cells containing the recombinant expression plasmid obtained by the method of Example 3 or the pure MbTA enzyme obtained by the method of Example 4 were used as biocatalysts, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.

[0043] The final concentration and catalytic conditions of the low-substrate concentration catalytic system (15 ml) were as follows: 0.75 g wet cells or 1 mg pure MbTA enzyme, triethanolamine buffer (pH 8-8.5), 2 g / L sitagliptin precursor ketone substrate, 10% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 rpm, reaction time 36 h. Under the same conditions, the reaction solution containing no cells was used as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MbTA as a negative control. After the reaction, samples were collected and analyzed by HPLC (same conditions as in Example 15), revealing a substrate conversion of 2.3% and an ee of 99%. Using E. coli cells without the transaminase MbTA as catalyst, the reaction was carried out under the same conditions, resulting in a substrate conversion of less than 0.01%.

[0044] The high substrate concentration catalytic system (15 ml) had the following final concentration composition and catalytic conditions: 0.75 g wet cells or 1 mg pure MbTA enzyme, triethanolamine buffer (pH 8-8.5), 50 g / L sitagliptin precursor ketone substrate, 40% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 rpm, reaction time 36 h. Under the same conditions, a reaction solution containing no cells was added as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MbTA as a negative control. After the reaction, samples were collected for HPLC analysis (same conditions as in Example 15), and the substrate conversion rate was less than 1%. Using E. coli cells without the transaminase MbTA as the catalyst, the catalytic reaction was carried out under the same conditions, and the substrate conversion rate was less than 0.01%.

[0045] Example 8: Application of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone as a sitagliptin intermediate

[0046] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet bacteria containing the recombinant expression plasmid obtained by the method of Example 3 in Example 6 or the pure enzyme of MbTA mutant 1 obtained by the method of Example 4 were used as biocatalysts, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.

[0047] The final concentration composition and catalytic conditions of the low substrate concentration catalytic system (15 ml) are as follows: 0.75 g wet bacteria or 1 mg pure enzyme of MbTA mutant 1, pH 8-8.5 triethanolamine buffer, 2 g / L substrate sitagliptin precursor ketone, 10% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 r / min, reaction time 36 h. Under the same conditions, the reaction solution with no bacteria added served as a blank control, and wet E. coli BL21 / pET28b bacteria were used instead of the above-mentioned recombinant E. coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction was completed, samples were taken for HPLC analysis (conditions were the same as in Example 15). When the substrate concentration of the reaction system was 2 g / L, the substrate conversion rate was 95.5% and the ee value was 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0048] The final concentration composition and catalytic conditions of the high substrate concentration catalytic system (15 ml) are as follows: 0.75 g wet bacteria or 1 mg pure enzyme of MbTA mutant 1, pH 8-8.5 triethanolamine buffer, 50 g / L substrate sitagliptin intermediate precursor ketone, DMSO final concentration of 40% (v / v), 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 r / min, reaction time 36 h. Under the same conditions, the reaction solution with sterile bacteria was used as a blank control, and wet Escherichia coli BL21 / pET28b bacteria were used instead of the above-mentioned recombinant Escherichia coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction was completed, samples were taken for HPLC detection (conditions were the same as in Example 15). The conversion rate of the substrate was 58% and the ee value was 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0049] Further, Examples 9-14 introduce the use of recombinant transaminase MbTA mutant 1 in the preparation of sitagliptin ester intermediates

[0050] Example 9: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester

[0051] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester.

[0052] The final concentration and conditions of the catalytic system (15 ml) were as follows: 0.75 g of wet cells, triethanolamine buffer (pH 8-8.5), 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, 20% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: 35°C, 150 rpm, and 36 h. Under the same conditions, a blank control was used with the reaction solution containing no cells, and a negative control was performed with wet cells of E. coli BL21 / pET28b, replacing the recombinant E. coli BL21 / pET28b-MbTAmut1. After the reaction, a sample was taken for HPLC analysis (under the same conditions as in Example 15). 0.12 mol of substrate (3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester) yielded approximately 0.12 mol of product (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester (28.3 g), with a substrate conversion of 90% and an ee value of 99%. Using Escherichia coli cells lacking the transaminase MbTA mut1 as catalyst, the reaction was carried out under the same conditions, resulting in a substrate conversion of less than 0.01%.

[0053] Example 10: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester

[0054] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester.

[0055] The final concentration composition and catalytic conditions of the catalytic system (15 ml) are as follows: 0.75 g wet cells, pH 8-8.5 triethanolamine buffer, 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, DMSO final concentration of 20% (v / v), 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 r / min, reaction time 36 h. Under the same conditions, the reaction solution with no cells added served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction, samples were taken for HPLC analysis (conditions same as in Example 15). The substrate conversion rate was 90% and the ee value was 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0056] Example 11: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester

[0057] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester.

[0058] The final concentration and catalytic conditions of the catalytic system (15 ml) were as follows: 0.75 g wet cells, triethanolamine buffer (pH 8-8.5), 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester, DMSO final concentration of 20% (v / v), 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 r / min, reaction time 36 h. Under the same conditions, the reaction solution with no cells added served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction, samples were taken for HPLC analysis (conditions the same as in Example 15). The substrate conversion rate was 88% and the ee value was 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0059] Example 12: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester

[0060] The recombinant Escherichia coli BL21 / pET28b-MbAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester.

[0061] The final concentration and catalytic conditions of the catalytic system (15 ml) were as follows: 0.75 g wet cells, triethanolamine buffer (pH 8-8.5), 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, 20% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 rpm, reaction time 36 h. Under the same conditions, the reaction solution containing no cells was used as a blank control, and wet cells of E. coli BL21 / pET28b were used instead of the recombinant E. coli BL21 / pET28b-MbTA mut1 as a negative control. After the reaction, samples were collected for HPLC analysis (same conditions as in Example 15), revealing a substrate conversion rate of 84% and an ee value of 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0062] Example 13: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester

[0063] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester.

[0064] The final concentration and catalytic conditions of the catalytic system (15 ml) are as follows: 0.75 g of wet cells, triethanolamine buffer (pH 8-8.5), 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester, 20% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 rpm, reaction time 36 h. The enzyme has been demonstrated to transaminize (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester with high selectivity (EE value; 99%). Under the same conditions, the reaction solution containing no cells was added as a blank control, and wet cells of E. coli BL21 / pET28b were used instead of the recombinant E. coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction, samples were taken for HPLC analysis (same conditions as in Example 15), and the substrate conversion rate was 86% and the ee was 99%. Using E. coli cells without transaminase MbTA mut1 as catalyst, the reaction was carried out under the same conditions, and the substrate conversion rate was less than 0.01%.

[0065] Example 14: Use of recombinant transaminase MbTA mutant 1 in the preparation of (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester

[0066] The recombinant Escherichia coli BL21 / pET28b-MbTAmut1 wet cells containing the recombinant expression plasmid obtained in Example 6 by the method of Example 3 were used as a biocatalyst, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester was used as a substrate to carry out a biocatalytic reaction to prepare (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester.

[0067] The final concentration and catalytic conditions of the catalytic system (15 ml) were as follows: 0.75 g wet cells, triethanolamine buffer (pH 8-8.5), 20 g / L substrate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester, DMSO final concentration of 20% (v / v), 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions: temperature 35°C, stirring speed 150 rpm, reaction time 36 h. Under the same conditions, the reaction solution containing no cells was used as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MbTAmut1 as a negative control. After the reaction, samples were taken for HPLC analysis (conditions the same as in Example 15). The substrate conversion rate was 84% ​​and the ee value was 99%. When Escherichia coli cells without the transaminase MbTA mut1 were used as catalysts and the catalytic reaction was carried out under the same conditions, the substrate conversion rate was less than 0.01%.

[0068] Example 15: Liquid phase detection method for sitagliptin intermediate precursor ketone, sitagliptin (R) intermediate and sitagliptin (S) enantiomer.

[0069] High-performance liquid chromatography instruments: Shimadzu LC-16 system-SPD-16 UV detector and Hitachi 8DD-0801 system-1410 UV detector.

[0070] Conversion was determined using a ZORBAX Eclipse XDB-C18 column (4.6 mm × 250 mm, 5 μm) with a mobile phase of 50:50 (v / v) water:acetonitrile, 10 mM ammonium acetate in the aqueous phase, a flow rate of 0.8 mL / min, a column temperature of 40°C, and a detection wavelength of 205 nm. The retention time of the sitagliptin intermediate precursor ketone was 4.0 min. The retention time of the sitagliptin intermediates was 2.8 min, respectively.

[0071] The EE was detected using a Chiralpak AD-H column (150×4.6mm, 5μm), with a mobile phase of ethanol / n-heptane / diethylamine (60:40:0.1 v / v / v), a flow rate of 0.8 mL / min, a column temperature of 35°C, and a detection wavelength of 205 nm. The retention times of the sitagliptin intermediate precursor ketone and the (R) enantiomer of the sitagliptin intermediate were approximately 10 and 5 minutes, respectively. The retention time of the (S) enantiomer of the sitagliptin intermediate was 9.5 minutes. (The liquid chromatography was performed using a Shimadzu LC-20AD system with an SPD20A detector.)

[0072] Product ee p Calculation formula:

[0073] ee p =(C R -C S ) / (C R +C S )×100%

[0074] C R is the peak area of ​​sitagliptin, and Cs is the peak area of ​​the S-enantiomer.

[0075] Example 16: Separation and purification of high-purity sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone from the reaction system

[0076] Take 400 mL of the reaction solution of the low substrate concentration catalytic system in Example 8, adjust the pH to 1.5 with concentrated hydrochloric acid (mass fraction of 36%-38%), add 72 g of diatomaceous earth (median particle size 19.6 μm) to adsorb the cells, and stir for 20 minutes. Filter with suction to obtain filtrate a and filter residue a. Add 600 ml of 1 M hydrochloric acid to the filter residue a, stir for 20 minutes, and filter with suction to obtain filtrate b and filter residue b. Combine filtrate a and filtrate b, totaling about 1.0 L, and extract once with 500 mL of dichloromethane (purity 99.5%) to obtain aqueous phase a and organic phase a. Extract organic phase a with 100 ml of 1 M hydrochloric acid to obtain aqueous phase b and organic phase b. Combine aqueous phase a and aqueous phase b and adjust the pH to 12 with sodium hydroxide and add 1.2 L of dichloromethane was added for extraction to obtain an organic phase c and an aqueous phase c. 800 mL of dichloromethane was then added to extract the aqueous phase c to obtain an aqueous phase d and an organic phase d. The organic phases c and d were combined and washed twice with saturated sodium chloride (36 g / L) water, then dried over anhydrous sodium sulfate. The sodium sulfate was removed by filtration and rotary evaporated at 45° C. to obtain 20.5 g of a white powder. Liquid chromatography analysis in Example 15 indicated a yield of 93% and a purity of 99.5% for the sitagliptin intermediate. The total yield of the sitagliptin intermediate was 82%.

[0077] It should be understood that after reading the above content of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A transaminase mutant, characterized in that The mutant is obtained by substituting tyrosine at position 74 into proline, glutamic acid at position 228 into aspartic acid, leucine at position 254 into alanine, and methionine at position 290 into threonine in the amino acid sequence shown in SEQ ID NO:

2.

2. A gene encoding the transaminase mutant according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO:

3.

3. A recombinant genetically engineered bacterium prepared by transforming the gene encoding the transaminase mutant according to claim 2.

4. Use of the transaminase mutant according to claim 1 in biocatalytic synthesis of a sitagliptin intermediate from a sitagliptin intermediate precursor ketone.

5. The use according to claim 4, characterized in that The application comprises the following steps: using wet cells obtained by fermentation culture of recombinant genetically engineered bacteria containing a transaminase mutant encoding gene or pure enzyme extracted from the wet cells after ultrasonic disruption as a biocatalyst, using 1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone as a substrate, using dimethyl sulfoxide as a cosolvent, using pyridoxal phosphate as a coenzyme, using isopropylamine as a cosubstrate, and using a pH 8-9 triethanolamine buffer as a reaction medium to form a reaction system, carrying out a biocatalytic reaction at a temperature of 30-45° C. and a stirring speed of 100-250 r / min, and separating and purifying the reaction solution after the reaction to obtain (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone.

6. The use according to claim 5, characterized in that In the reaction system, the amount of wet bacteria is 10-100 g / L, the amount of pure enzyme is 0.01-1.0 g / L, the final concentration of substrate added is 2-50 g / L, the final concentration of dimethyl sulfoxide added is 10-40% by volume, the final concentration of pyridoxal phosphate added is 0.5 g / L, and the final concentration of isopropylamine added is 10 g / L.

7. Use of the transaminase mutant according to claim 1 in the biocatalytic synthesis of sitagliptin ester intermediates from potentially chiral carbonyl compounds, characterized in that The prochiral carbonyl compound is one of the following: 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isobutyl ester, and 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester.

8. The use according to claim 7, characterized in that The application is as follows: wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing a transaminase mutant encoding gene are used as a biocatalyst, a potential chiral carbonyl compound is used as a substrate, dimethyl sulfoxide is used as a cosolvent, pyridoxal phosphate is used as a coenzyme, isopropylamine is used as a cosubstrate, and a pH 8-9 triethanolamine buffer is used as a reaction medium to form a reaction system; a biocatalytic reaction is carried out at a temperature of 25-35°C and a stirring speed of 100-250 r / min; after the reaction is completed, the reaction liquid is separated and purified to obtain a sitagliptin ester intermediate.

9. The use according to claim 8, characterized in that In the reaction system, the wet cell dosage is 10-100 g / L, the final concentration of the substrate is 2-60 g / L, the volume of dimethyl sulfoxide is added to a final concentration of 10-40%, the final concentration of pyridoxal phosphate is added to 0.5 g / L, and the final concentration of isopropylamine is added to 10 g / L.

10. The use according to claim 5 or 8, characterized in that The wet cells were prepared as follows: recombinant Escherichia coli containing a transaminase mutant encoding gene was inoculated into LB liquid culture medium containing 50 μg / ml kanamycin, cultured at 37°C and 200 rpm for 12 hours, then inoculated into fresh LB liquid culture medium containing 50 μg / ml kanamycin resistance at a volume concentration of 1%, cultured at 37°C and 150 rpm until the cell OD600 reached 0.6-0.8, IPTG was added at a final concentration of 0.1 mM, and after induction culture at 28°C for 12 hours, the culture was centrifuged at 4°C and 5000 rpm for 20 minutes, the supernatant was discarded, and the precipitate was collected to obtain the wet cells.